Volume 17 Number 13 1989 Nucleic Acids Research Two purified factors bind to the same sequence in the enhancer of mouse MHC class I genes: one of them is a positive regulator induced upon differentiation of teratocarcinoma cells Alain Israel, Osamu Yano*, Fr6dIrique Logeat, Mark Kieran and Philippe Kourilsky Unite de Biologie Moleculaire du Gene, U.277 INSERM, UAC 115 CNRS, Institut Pasteur, 25 rue du Dr Roux, 75724 Paris CUdex 15, France Received April 4, 1989; Revised and Accepted May 24, 1989 ABSTRACT The MHC class I murine and beta-2-microglobulin genes are silent in embryonal carcinoma (EC) cells but are induced upon differentiation of these cells. We have previously shown that enhancer-like sequences located in the promoter of the H-2Kb gene are non-functional in F9 and PCC3 cells. We have previously purified a 48 kd protein (KBFI) from a mouse T cell line which binds to a palindromic sequence located in this enhancer and to a similar sequence in the promoter of the beta-2-microglobulin gene. We des- cribe here the purification of a second protein (KBF2, 58 kd) which also binds to this sequence. While both activities are present in differentiated cells, KBF1 binding activity is absent in undifferentiated EC cells, where the palindromic sequence shows no enhancer activity. Upon differentiation, KBF1 binding activity is induced and the palindromic sequence becomes active as an enhancer. Thus, the absence of KBF1 activity in undifferentiated EC cells is at least in part responsible for the lack of expression of H-2 class I and beta-2-microglobulin genes in these cells and suggests that KBF1 activity is regulated during differentiation. INTRODUCTION The major class I transplantation antigens specified by class I genes of the major histocompatibility complex (MRC) play a key role in a number of immunological processes, particularly in the recognition of foreign antigens by cytotoxic T cells of the host (1). Their expression is developmentally regulated : class I mRNA and proteins are not expressed until midsomite sta- ge of mouse embryogenesis (2). Then, they are expressed on most somatic cells of the adult organism. Undifferentiated F9 cells exhibit a variety of molecular and cellular properties characteristic of early embryos (3) ; in particular, they do not express class I antigens (4, 5, 6). These cells can be induced to differentiate after treatment with retinoic acid and dibutyryl cyclic AMP (7). This differentiation is accompanied by expression of class I antigens (8) at the cell surface. This regulation involves activation of both beta-2-microglobulin and H-2 genes, and is likely to operate at the transcriptional level (5, 9). It has been reproduced after transfection of © I RL Press 5245 Nucleic Acids Research EC cells by a cloned H-2 gene (10). Fusion experiments between undifferen- tiated EC and differentiated cells have given conflicting results as to whe- ther positive or negative regulation is involved (11, 12). Differential DNA methylation between undifferentiated and differentiated cells has also been invoked (13). We (14, 15) and others (16, 17) have shown that a major element of the mouse MHC H-2Kb gene promoter is a palindromic sequence located approxima- tely 160-180 bp upstream from the cap site. This sequence, TGGGGATTCCCCA is part of a larger sequence exhibiting enhancer activity in differentiated but not in undifferentiated embryonal carcinoma (EC) cells (14). A protein, called KBF1, which recognizes this palindrome, and a similar sequence loca- ted in the beta-2-microglobulin promoter, has been characterized (15, 17) and purified from a mouse T cell line (18). A similar activity, called H2TFI, has been characterized in human HeLa cells (17, 19). Mutations which abolish enhancer activity in the Kb promoter also prevent binding of KBF1 (15). In vivo competition experiments have suggested that KBF1 is a positive trans-acting factor regulating the expression of mouse MHC class I genes (15, 17). We wanted to know whether the lack of expression of class I and beta-2-microglobulin genes in undifferentiated EC cells correlates with the absence of KBFI activity. This question turned out to be more difficult to answer than we anticipated. We found that a second protein, named KBF2, binds to the same sequence as KBFI, and is present in undifferentiated EC cells. We report here the characterization and purification of KBF2. This knowledge has allowed us to unambiguously show that KBF1 binding activity is absent in undifferentiated EC cells while KBF2 activity is present. There- fore, KBF1 activity appears to be regulated during the differentiation of these cells and may in part be involved in the activation of class I gene expression observed in differentiated EC cells. MATERIALS AND METHODS Cell lines F9 cells were obtained from Dr. K. Ozato and were grown in DMEM supple- mented with 10 % fetal calf serum. They were subcultured every 2 days. The undifferentiated state was regularly checked by immunofluorescence for the presence of the SSEAI antigen. Differentiation was induced by treatment with 3x10-7 M retinoic acid and 10-3 M dibutyryl cyclic AMP. PCC3, PCC4 and 3A1D3 were obtained from Dr. J.F. Nicolas and were subcultured every 2 5246 Nucleic Acids Research days. 3T6 cells were grown in the same medium, while BW5147 cells were grown in RPMI supplemented with 10 % fetal calf serum. Transfection and CAT assays Transfection by the calcium phosphate coprecipitation technique and CAT assays were carried out as described in Kimura et al., (14) with some modi- fications : undifferentiated cells were broken by treatment with 0.05 x Tri- ton X-100 and no freeze-thawing ; cytoplasmic extracts were heated for 10 minutes at 65°C before the CAT assays. Preparation of nuclear extracts Nuclear extracts were prepared as described in IsraEl et al. (15) ex- cept that for undifferentiated cells, 0.05 % Triton X-100 was used and no mechanical disruption was required. Retardation experiments For each binding assay, 0.25 ng of 5'-end labelled oligonucleotide was incubated in a volume of 10 jil with 200 ng of poly(dI-dC) and 3-6 Ujg of nuclear extract in the buffer described in Yano et al. (18). When purified protein was used, the binding reaction contained no poly(dI-dC) but 100 pg/ml of bovine serum albumin. The reaction was incubated for 15 min. at room temperature and then loaded onto a 5 % polyacrylamide gel in 0.5 X Tris-Borate EDTA buffer, which was run for 2 hours at 12 V/cm. The gel was then fixed, dried and exposed for 2-5 hours with Kodak X-AR film. Purification of KBF2 from nuclear extracts of BW5147 cells The fractions giving rise to bands 1 and 3 eluted from the KBF1 affini- ty column (see Yano et al., (18) for details) at 0.2 M and KBF2 was further purified by repeated passages through an affinity column made with concate- nated beta-2-microglobulin oligonucleotide which has the following sequen- ce GATCAAGGGACTTTCCCAT TTCCCTGAAAGGGTACTAG (see Table 1 for details). UV cross-linking experiments Cross-linking was carried out as described in Cereghini et al. (30). The probe was prepared by annealing the two oligonucleotides GATGGGGATTCCCCATCTCCACAGTTTCACTTCTGCA GAGGTGTCAAAGTGAAGACGTCT followed by elongation using the Klenow enzyme with 0.1 mM BudR, dATP, dGTP and 5 iM alpha-32P-dCTP. The sequence in common between the two oligonucleo- 5247 Nucleic Acids Research tides represents the interferon response sequence of the H-2Kb gene and does not bind KBF1 or KBF2. The probe was incubated with purified KBFI, KBF2 or BW5147 crude nuclear extract and a retardation gel was run as described above. The gel was irradiated with a 312 nm UV light lamp for 30 min. at 4°C and autoradiographed. The retarded bands were excised, incubated for 10 min. at 650C in SDS-beta-mercaptoethanol protein sample buffer, and loaded directly in the slots of a 10 % SDS-polyacrylamide gel, which was then fixed, dried and autoradiographed. Methylation protection experiments For DMS protection experiments, a double-stranded oligonucleotide in- cluding the binding site for KBF1 and KBF2 (see legend to figure 3) was labelled at the 5' end of one strand and incubated with purified KBF1 or KBF2 in a 5 times scaled up binding reaction. After 20 min. at room tempera- ture, 1 ll of DMS was added for 5 min. After phenol extraction and ethanol precipitation, the samples were analysed on a 20 % polyacrylamide 8 M urea gel. RESULTS 1.- Detection and purification of a new factor, KBF2, that binds to the enhancer of the Kb gene In the course of KBFI purification we performed bandshift assays using as a probe, a short 18 bp palindromic sequence derived from the H-2Kb enhancer called KBF (cf. legend to Figure 1). By using crude nuclear extracts derived from various differentiated murine cells, we could detect three specific retarded bands (bands 1, 2 and 3 in Figure IA) which were all competed by an excess of cold homologous oligonucleotide (not shown). Star- ting from a crude nuclear extract derived from the BW5147 T cell line (18), the protein(s) responsible for these three bands copurified through the first conventional columns used in the purification of KBFl (18 : hydroxya- patite, heparine agarose, gel filtration). However, bands I and 3 were ob- tained with the 0.2 M NaCl eluate from the DNA affinity column used as a last purification step (this column is made of concatenated KBF oligonucleo- tide bound to Affigel 15). In contrast, the activity responsible for band 2 was eluted between 0.6 M and 1 M NaCl and constituted the 48 kd KBFl protein (18). We decided to purify further the activity corresponding to bands 1 and 3 (Table 1).