CCDC109B (MCUB) (NM 017918) Human Untagged Clone Product Data

CCDC109B (MCUB) (NM 017918) Human Untagged Clone Product Data

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC327798 CCDC109B (MCUB) (NM_017918) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: CCDC109B (MCUB) (NM_017918) Human Untagged Clone Tag: Tag Free Symbol: MCUB Synonyms: CCDC109B Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >OriGene SC327798 ORF sequence for NM_017918, the custom clone sequence may differ by one or more nucleotides ATGTTGTCAACAGTTGGTTCATTCCTTCAGGACCTACAAAATGAAGATAAGGGTATCAAAACTGCAGCCA TCTTCACAGCAGATGGCAACATGATTTCAGCTTCTACCTTGATGGATATTTTGCTAATGAATGATTTTAA ACTTGTCATTAATAAAATAGCATATGATGTGCAGTGTCCAAAGAGAGAAAAACCAAGTAATGAGCACACT GCTGAGATGGAACACATGAAATCCTTGGTTCACAGACTATTTACAATCTTGCATTTAGAAGAGTCTCAGA AAAAGAGAGAGCACCATTTACTGGAGAAAATTGACCACCTGAAGGAACAGCTGCAGCCCCTTGAACAGGT GAAAGCTGGAATAGAAGCTCATTCGGAAGCCAAAACCAGTGGACTCCTGTGGGCTGGATTGGCACTGCTG TCCATTCAGGGTGGGGCACTGGCCTGGCTCACGTGGTGGGTGTACTCCTGGGATATCATGGAGCCAGTTA CATACTTCATCACATTTGCAAATTCTATGGTCTTTTTTGCATACTTTATAGTCACTCGACAGGATTATAC TTACTCAGCTGTTAAGAGTAGGCAATTTCTTCAGTTCTTCCACAAGAAATCAAAGCAACAGCACTTTGAT GTGCAGCAATACAACAAGTTAAAAGAAGACCTTGCTAAGGCTAAAGAATCCCTGAAACAGGCGCGTCATT CTCTCTGTTTGCAAATGCAAGTAGAAGAACTCAATGAAAAGAATTAA Restriction Sites: SgfI-MluI ACCN: NM_017918 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 CCDC109B (MCUB) (NM_017918) Human Untagged Clone – SC327798 OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA RefSeq: NM_017918.4, NP_060388.2 RefSeq Size: 1298 bp RefSeq ORF: 747 bp Locus ID: 55013 UniProt ID: Q9NWR8 Domains: DUF607 Protein Families: Transmembrane Gene Summary: Negatively regulates the activity of MCU, the mitochondrial inner membrane calcium uniporter, and thereby modulates calcium uptake into the mitochondrion. Does not form functional calcium channels by itself. Mitochondrial calcium homeostasis plays key roles in cellular physiology and regulates cell bioenergetics, cytoplasmic calcium signals and activation of cell death pathways.[UniProtKB/Swiss-Prot Function] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    2 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us