ISSN 1226-9999 (print) ISSN 2287-7851 (online) Korean J. Environ. Biol. 35(3) : 329~334 (2017) https://doi.org/10.11626/KJEB.2017.35.3.329 <Original article> First Record of Ulva torta (Ulvales, Chlorophyta) in Korea Jae Woo An and Ki Wan Nam* Department of Marine Biology, Pukyong National University, Busan 48513, Republic of Korea Abstract - A marine ulvalean species (Chlorophyta) was collected from Imgok, which is located on the eastern coast of Korea. This species is morphologically characterized by distromatic, filiform to strap compressed or tubular thallus. Many branches were found near the base, but lacked proliferations. Cells were longitudinally aligned in the younger part of the branch and were disordered in the older part of the branch. A cap-like parietal chloroplast with one or two pyrenoids was contained in each cell. In a phylogenetic tree based on ITS and rbcL sequences, this species was nested in the same clade as Ulva torta and U. clathratioides from Australia, but formed a sister clade to U. torta from Japan. However, the genetic divergence between them was included in an intraspecific variation range within Ulva. This finding suggests that U. clathratioides should be reduced to a synonym of U. torta. Accordingly, the Korean alga was identified as U. torta based on the morphological and molecular data. This investigation is the first record of U. torta in the Korean marine algal flora. Key words : ‌ulvalean species, molecular data, morphology, marine algal flora, new record INTRODUCTION For these, the molecular data, such as the nuclear internal transcribed spacer (ITS) and plastid ribulose-1, 5-bisphos- Green marine algal genus Ulva Linnaeus (Ulvales) is a phate carboxylase/oxygenase (rbcL), have been used to commonly abundant inhabitant of marine, estuarine and delineate the species within the genus and phylogenetic freshwater habitats worldwide and often causes harmful analyses (Blomster et al. 1998, 1999; Shimada et al. 2008; blooms in eutrophic estuaries and bays (Fletcher 1996). Hofmann et al. 2010; Mares et al. 2011; Ogawa et al. About 120 species are currently accepted in this genus (Gui- 2013). ry and Guiry 2017). Those species exhibit a simple thallus Seventeen species in Ulva are currently recorded in the structure along with a lack of differentiated reproductive or- marine algal flora of Korea (Lee and Kang 1986, 2002; Lee gans (Bliding 1963, 1968; Womersley 1984; Phillips 1988; 2008; Bae 2010; Kim et al. 2013; Lee et al. 2014). During a Blomster et al. 1998, 1999; Hayden and Waaland 2004), survey of marine algal flora, a species of Ulva was collected which makes it difficult to identify the species. Moreover, from Imgok, which is located on the eastern coast of Korea. the taxonomy of the genus is further complicated by the Based on morphological and molecular analyses conducted significant intraspecific variation and interspecific overlap in the current study, it was identified as U. torta which is a in the relatively few morphological and anatomical charac- newly recorded in marine algal flora of Korea. ters that occurred in response to the varying conditions of the habitat environments (Tanner 1979, 1986; Phillips 1988; Malta et al. 1999). MATERIALS AND METHODS For the current study, samples were collected from * ‌Corresponding author: Ki Wan Nam, Tel. 051-629-5922, Fax. 051-629-5922, E-mail. [email protected] Imgok, which is on the eastern coast of Korea. A part of the ⓒ2017. Korean Society of Environmental Biology. 330 Jae Woo An and Ki Wan Nam samples was preserved in 5% formalin seawater, and the Korean name: Sil-gal-pa-rae nom. nov. (신칭: 실갈파래) others were made as herbarium specimens. A portion of the Specimens examined: MGARB012127, MGARB012128, material was dried, and preserved in silica gel for DNA ex- MGARB012129, MGARB012130 (Imgok, 7 April 2017) traction. Sections of the thallus were mounted in 30% corn Habitat: Epilithic near the intertidal zone syrup for permanent preparation. The extraction of total ge- Morphology: Thalli 5-10 cm high, 1-8 mm wide (Fig. 1A, nomic DNA was made by using the DNeasy Plant Mini Kit B), distromatic, filiform to strap compressed or tubular (Fig. (Qiagen, Hilden, Germany) according to the usual protocol. 1A-C), branched near the base (Fig. 1A, B) but without The extracted DNA was assessed by using a gel electropho- proliferations, light green to green in color; branches slight- resis on a 1% agarose gel and used for amplification of the ly tapered, with a uniseriate apex in the juvenile stage (Fig. internal transcribed spacer (ITS) and Ribulose-1, 5-bisphos- 1D); vegetative cells rectangular to slightly round shape in phate carboxylase/oxygenase (rbcL) regions by means of the surface view (Fig. 1E), 10-40 μm×10-20 μm, longi- published primers (Ogawa et al. 2013). The primer sequenc- tudinally aligned in the younger part of the blade (Fig. 1F), es were as follows: ITS primer (F: 5′ TCTTTGAAACCG disordered in the older part (Fig. 1G); each cell with a one TATCGTGA 3′ R: 5′ GGTGAACCTGCGGAGGGAT 3′) cap-like parietal chloroplast bearing one or two pyrenoids and rbcL primer (F: 5′ TGTTTACGAGGTGGTCTTGA 3′, (Fig. 1H, I). R: 5′ TCAAGACCACCTCGTAAACA 3′) (Hayakawa et Ulva torta was originally described from Norderney, East al. 2012). PCR amplifications were performed in a TaKaRa Frisian Islands, Germany (Silva et al. 1996). This species is PCR Thermal Cycler Dice (TaKaRa Bio Inc., Otsu, Japan) widely distributed throughout the temperate regions of both with an initial denaturation step at 94°C for 1 minute, 35 hemispheres (Guiry and Guiry 2017), and its morphological cycles at 94°C for 30 seconds, 55°C for 1 minute, 68°C variation is common, particularly under certain conditions, for 2 minutes and a final extension at 72°C for 5 minutes. such as in brackish water and on mud flats in estuaries (Pol- The reaction volume was 30 μL and consisted of 20 ng of derman 1975; Burrows 1991). According to some authors genomic DNA, 2 μL of 10× PCR buffer, 2 μL of 200 μM (Bliding 1963; Koeman and van den Hoek 1984; Brodie dNTP, 2 μL each of forward and reverse primer, and 0.5 et al. 2007), it is characterized by very narrow unbranched units of Taq polymerase (TaKaRa Bio Inc.). Amplifications filaments of similar diameter (mostly 25-50 μm) and longi- were examined using a gel electrophoresis in a 1% agarose tudinal alignment of cells throughout the thallus. However, gel and the amplified ITS region products were purified Ogawa et al. (2013) reported highly branched thalli and dis- using a QIAquick Gel Extraction Kit (Qiagen). The PCR ordered cells in older plants of the species from Japan. Ulva products were moved to the Macrogen Sequencing Service clathratioides L.G. Kraft, Kraft et R.F. Waller, which was for sequencing (Macrogen, Seoul, Korea). The PCR primers recently described from Australia (Kraft et al. 2010) but is were also used for sequencing. In the sequences for the ITS, genetically assignable to U. torta (Kirkendale et al. 2013; the rbcL region were aligned using BioEdit (Hall 1999). the present study), also shows a densely branched main axis Phylogenetic analyses were performed using the maxi- (Kraft et al. 2010). In our specimens, many branches are mum-likelihood (ML) method. The bootstrap values were found near the base of the thallus, but they lack prolifera- calculated with 1,000 replications. ITS sequences of other tions (Fig. 1A, B). It appears that the features are variable species were obtained from GenBank. Umbraulva japonica based on those observations. The resulting morphological was used as an outgroup. delimitation for U. torta seems to be more or less unclear, as commented by Phillips et al. (2016, see p. 62). Consid- ering these aspects, our specimens, which share many fea- RESULTS AND DISCUSSION tures in the gross morphology with some exceptions (Ogawa et al. 2013; Phillips et al. 2016; the present study), can be Ulva torta (Mertens) Trevisan 1841: 480 also referred to as U. torta. According to Ogawa et al. (2013), U. torta is very similar Type locality: Norderney, East Frisian Islands, Germany to U. clathrata (Roth) C. Agardh from Fehmarn, SW Baltic New Record of Ulva torta in Korea 331 A B C 1 cm 1 cm 80 μm D E F 80 μm 20 μm 20 μm G H I 10 μm 10 μm 10 μm Fig. 1. Ulva torta (Mertens) Trevisan. (A) Herbarium specimen (MGARB012127); (B) Habit of the vegetative plant in a liquid-preserved specimen; (C) Cross-section of the blade with a tubular form; (D) A juvenile branch with a uniseriate apex (arrow); (E) Surface view of the vegetative cells with rectangular to slightly round shape (arrows); (F) Surface view of the vegetative cells with longitudinal align- ment in the younger part of the blade; (G) Surface view of the vegetative cells with a disordered alignment in the older part; (H) Surface view of a cap-like parietal chloroplast (arrow); (I) Surface view of the vegetative cells with one or two pyrenoid (arrows) per chloroplast. in morphology. However, it has been known by the molec- distance, respectively (Ogawa et al. 2013; Kirkendale et al. ular analysis based on ITS and rbcL sequences that both 2013; the present study). It is also similar to U. clathratioi- species nest in different clades with interspecific genetic des from Australia (Ogawa et al. 2013). 332 Jae Woo An and Ki Wan Nam Fig. 2. ‌Phylogenetic tree of the selected taxa obtained from a max- Fig. 3. ‌Phylogenetic tree of the selected taxa obtained from a max- imum-likelihood analysis based on ITS sequences. The boot- imum-likelihood analysis based on rbcL sequences. The strap percentages (1000 replicates samples) are displayed bootstrap percentages (1000 replicates samples) are dis- above the branches.