Virus Research 102 (2004) 207–213 New Calicivirus isolated from walrus Lilia Ganova-Raeva a,∗, Alvin W. Smith b, Howard Fields a, Yury Khudyakov a a Division of Viral Hepatitis, Centers for Disease Control and Prevention, National Center for Infectious Diseases, 1600 Clifton Road NE, MS A-33 Atlanta, GA 30333, USA b Laboratory of Caliciviral Studies, College of Veterinary Medicine, Oregon State University, Corvallis, OR USA Received 3 October 2003; received in revised form 30 January 2004; accepted 30 January 2004 Abstract The nucleotide sequence and genome organization of a new member of Caliciviridae was determined. Cell culture inoculated with fecal matter from walrus was used to recover fragments of a new virus by Suppression Subtractive Hybridization (SSH). The isolate was identified as a member of the Vesivirus genus of Caliciviridae and designated the name Walrus Calicivirus (WCV). Sets of PCR primers spanning the entire putative genome were designed using known sequences of other vesiviruses. The assembled genome was 8289 nucleotides (nt) long and shared no more than 87% identity with sequences of the other members of the genus Vesivirus. The largest open reading frame (ORF1) between positions 4-5646 encoded a polyprotein. ORF2, found at position 5652–7778, encoded a putative capsid protein. ORF3 overlapped ORF2 and encoded a small basic protein. Comparative analysis of multiple caliciviral capsid proteins was performed to propose a uniform capsid structural organization for this viral family. © 2004 Elsevier B.V. All rights reserved. Keywords: Vesivirus; Capsid; Walrus; SSH 1. Introduction (Smith et al., 1998), respiratory disorders, conjunctivitis, pneumonia, vesiculation and diarrhea in felines (Geissler Caliciviridae, former members of Picornaviridae (Berke et al., 1997), hemorrhagic disease in rabbits and hares ac- et al., 1997; Berke and Matson, 2000), are now a separate companied by massive liver necrosis (Lamarque et al., 1997; family of viruses with linear, single stranded positive RNA Meyers et al., 1991), gastroenteritis and pediatric acute gas- genome containing a poly(A)-tail at the 3-end. They are troenteritis in humans (Fankhauser et al., 1998; Green et al., divided into four genera: Vesivirus, Lagovirus, Norovirus 1995). An interesting case was described in a laboratory and Sapovirus (Berke and Matson, 2000; Buchen-Osmond, worker who developed vesiculation and fever after infection 2003; Green et al., 2000). Caliciviruses have broad host with SMSV (Smith et al., 1998) that causes a disease with range. First observed in swine and domestic cats, they were similar symptoms in marine mammals. found in reptiles, rodents, felines, canines, birds, marine All four genera have very similar genomic organization. mammals (Smith et al., 1998), chimpanzees and humans In Vesivirus and Norovirus open reading frame (ORF1) en- (Berke et al., 1997; Fankhauser et al., 1998; Green et al., codes a nonstructural polyprotein composed of helicase, pro- 1995; Lamarque et al., 1997; Liu et al., 1999; Seal and Neill, tease and polymerase, ORF2 encodes the capsid protein and 1995). They have been shown to cross species (Lamarque ORF3 encodes a protein with putative nucleic acid bind- et al., 1997; Smith et al., 1998) and are known to cause var- ing function. The nonstructural polyprotein and the capsid ious diseases: vesicular exanthema, encephalitis, myocardi- protein are encoded by one large ORF in Lagovirus and tis, fever, diarrhea and abortion in pigs (Guo et al., 1999; Sapovirus. The size of a caliciviral genome varies from about Neill et al., 1998), flipper vesiculation in marine mammals 7400–8300 nucleotides (nt). In this study, we report the cloning and sequencing of the genome of a new calicivirus isolated from frozen walrus fe- ∗ Corresponding author. Tel.: +1-404-639-1158; fax: +1-404-639-1563. ces gathered from the ice shelf of the Chukchi Sea in 1977 E-mail address: [email protected] (L. Ganova-Raeva). (Smith et al., 1983). In this work we used isolate 7420, that 0168-1702/$ – see front matter © 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2004.01.033 208 L. Ganova-Raeva et al. / Virus Research 102 (2004) 207–213 was successfully grown in cell culture, which is unique fea- reverse transcription-polymerase chain reaction (RT-PCR) ture for caliciviruses, even though only at titer of about 102. on marine caliciviruses (Reid et al., 1999) did not am- The isolate was found to infect swine casing liver pathol- plify specific product using cDNA generated from isolate ogy, but lost infectivity after passaging (A. Smith, personal 7420. To recover and clone the viral genetic material we communication). used Suppression Subtractive Hybridization (SSH). Total RNA was extracted by TRIZOL reagent (Roche, Alameda, CA). One hundred microliters VMK cells inoculated with 2. Materials and methods isolate 7420 were used to create tester and 100 ␮l VMK cells, to create a driver. The RNA was reverse transcribed The virus was isolated and three-times plaque purified in and amplified by the SMART PCR cDNA synthesis kit Vero monkey kidney (VMK) cells after primary inoculation (Clontech Laboratories, Inc., Palo Alto, CA). The SMART with walrus fecal material (Smith et al., 1983). Primers II primer was used as described in the kit but instead of Hel1/Hel2 and 1F/1R considered suitable for diagnostic the oligo-dT, a new primer was designed. It contained a Table 1 Genome amplification primers designed for this study Name Product size (bp) Sequence First-generation A17F 685 GCTATGGCTCAAACGCTCTCAAAA A702R GAGTAGTCAACATTAGCCGGGTGT F2249F 330 GTATTCTAAGGAGTACGTATTGGAT F2970R ATGACTCGAGGATGATGGTTC H3474F 643 TTGGCCGTGGTGGCGTGAA H4117R GAGCCCTTTGTAGGATATTGTTGG I3930F 752 GCGACTGCGGTCTCCCATA I4682R TGAAGGCAGCGGCACAACT K4976F 689 GGTGGGTTGCCTTCGGGTAT K5665R TGGCTAATTCTCAAACACCT L5339F 732 ATAATTCGGCAATTCTACTACATCAA L6071R GGATCCCAAGTAGAGCCAAGTT Second-generation 2120FE 738 GAAACACCAGTCAAACCAAC C165RE AGGTCTTATCGTAAACGGTGTGAA C744FE 700 GTGCGCTACGGAATTGGATGGAT DE412RE GACGATGGCGTTTTTGTGGGTGAC DE1049FE 520 GCTCGGGCTTGCACTTCCACAC FG1274RE TCCTCGAGAGCCTTGACCACAG Third-generation AB533F 1607 ACGACCCCGGCTTTTCTGTTTTT AB598F 1542 CAACCTGGCGGCTCACT CCFE86 765 GGATGAATTAGATGATGATTGG CCFI111 740 GATGATCCTTTTAATTGTTGCTTTGCT 2120RI 1607/1542 GTTGGTTTGACTGGTGTTTC 6068FE 571 CCACCACTACTACGCCAC 6071FI 516 ACTCGGATCTACTTGGGATCC 6380GAPF 653/1277 TACTCAACRTGGTCTGGCGG 6566GAPR 571/516/765/740 GGRATKGTGAAGATCACAGGTTC 7085RI 653 CCATCCATCTGGTAGCCCAGG 7087FI 434/506/730 GGGCTACCAGATGGATGGCC 7512RI 434 CCTTGTGTAAAGGCTTCTGGG 7572RE 506/1277 GATGCTTTGTCAAAGTCCCAA 7818R 730 GCTAGCTGCACTCCCTAGAAGG 7490FE 434 AAGTTGTGAGGATTGCAAC 8351RI 861 TAATTCTACAGTCTACTA 8374RE 884 CCTAATGCAACCTACCAATT GenBank nucleotide sequences used for primer design: AF091736, SMU15301, SMU15302, VEU76874, SMU52089, M87481, M87482, U76874, U76887, U76885, U76883, U76881, U76879, U76888, Z24757, AF231353, Y15427, Y15441, Y15442, AJ006019, AF109468, AF109467, AB032758, AB022679, P36285, U52005, P36284, X99445, AF283778, L40021, X86667, AF182760, M86379, AF109465, AF258618, Z49271, U54983, Z29514, X87608, M67473, AJ011099, AF145896, X86557, AF182760, AF093797, M87661. F: forward primer, R: reverse primer. The primer designation corresponds to the approximate location of annealing in the genome. Different primer generations were designed after successful rounds of amplification and sequencing. Different product sizes listed reflect use of different forward/reverse primers. L. Ganova-Raeva et al. / Virus Research 102 (2004) 207–213 209 stretch of seven 5-nitro-indol (Loakes and Brown, 1994) ilarity to SMSV was less than 83% at the 5-end of the residues at the 3-end (7N primer). This primer was intro- genome and a fragment of about 800nt close to the 3-end duced to utilize total RNA. The cDNA PCR product was (position 6900–7700nt) had only 60% homology to other used without further modifications in the PCR select cDNA Vesivirus sequences. An open reading frame search revealed subtraction protocol (SSH) as described (CLONTECH Lab- three major ORFs. ORF1 at position 4–5646 nt, ORF2 at oratories, Inc., Palo Alto, CA) (Diatchenko et al., 1996). position 5652–7778 nt and ORF3 at position 7775–8107 nt. The subtracted products from the tester and driver were Multiple ATG codons were found in different phases within cloned with pTAdvantage vector in Escherichia coli Top the 5-end region of OFR1 and ORF2, a feature typical for 10F electro-competent cells from Clontech (Clontech Lab- Vesivirus. oratories, Inc., Palo Alto, CA). Randomly selected clones ORF1 of WCV was 86% identical to ORF1 of SMSV-4. from the tester and the driver were isolated and probed ORF1 translated into protein with an estimated molecu- by hybridization with biotinilated driver cDNA at 65 ◦C lar weight of 209 kD that corresponded to the polyprotein overnight. All non-hybridizing clones were sequenced by found in the related calicivirus species. It was comprised the dye-termination method on ABI PRIZMTM 377 DNA of a helicase, as identified by similarity to the Pfam00910 Sequencer (Applied Biosystems, Foster City, CA). The helicase motif; a thiol-protease, as identified by similarity obtained sequences were submitted for BLAST search to the corresponding proteins in other caliciviruses; and an (NCBI, http://www.ncbi.nlm.nih.gov/blast/Blast.cgi) and RNA-dependant RNA-polymerase, as identified by simi- were found to have 83–87% homology to vesiviral se- larity to the Pfam 00680 RNA dep RNA-pol motif. The quences in GenBank encoding the capsid, the