Repository of the Max Delbrück Center for Molecular Medicine (MDC) in the Helmholtz Association http://edoc.mdc-berlin.de/14376 The E3-ubiquitin ligase MID1 catalyzes ubiquitination and cleavage of Fu Schweiger, S. and Dorn, S. and Fuchs, M. and Koehler, A. and Matthes, F. and Mueller, E.C. and Wanker, E. and Schneider, R. and Krauss, S. This is a copy of the original article. This research was originally published in Journal of Biological Chemistry. Schweiger, S. and Dorn, S. and Fuchs, M. and Koehler, A. and Matthes, F. and Mueller, E.C. and Wanker, E. and Schneider, R. and Krauss, S. The E3-ubiquitin ligase MID1 catalyzes ubiquitination and cleavage of Fu. J Biol Chem. 2014; 289: 31805-31817. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc. Journal of Biological Chemistry 2014 NOV 14 ; 289(46): 31805-31817 Doi: 10.1074/jbc.M113.541219 American Society for Biochemistry and Molecular Biology Cell Biology: The E3 Ubiquitin Ligase MID1 Catalyzes Ubiquitination and Cleavage of Fu Susann Schweiger, Stephanie Dorn, Melanie Fuchs, Andrea Köhler, Frank Matthes, Eva-Christina Müller, Erich Wanker, Rainer Downloaded from Schneider and Sybille Krauß J. Biol. Chem. 2014, 289:31805-31817. doi: 10.1074/jbc.M113.541219 originally published online October 2, 2014 http://www.jbc.org/ Access the most updated version of this article at doi: 10.1074/jbc.M113.541219 Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites. at MAX DELBRUECK CENTRUM FUE on November 17, 2014 Alerts: • When this article is cited • When a correction for this article is posted Click here to choose from all of JBC's e-mail alerts This article cites 40 references, 10 of which can be accessed free at http://www.jbc.org/content/289/46/31805.full.html#ref-list-1 THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 289, NO. 46, pp. 31805–31817, November 14, 2014 © 2014 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A. The E3 Ubiquitin Ligase MID1 Catalyzes Ubiquitination and Cleavage of Fu Received for publication, December 6, 2013, and in revised form, October 1, 2014 Published, JBC Papers in Press, October 2, 2014, DOI 10.1074/jbc.M113.541219 Susann Schweiger‡, Stephanie Dorn§, Melanie Fuchs¶, Andrea Köhlerʈ, Frank Matthes§, Eva-Christina Müller**, Erich Wanker**, Rainer Schneiderʈ, and Sybille Krauߧ1 From the ‡Institute for Human Genetics, Medical School, University of Mainz, 55122 Mainz, Germany, the §German Center for Neurodegenerative Diseases, 53127 Bonn, Germany, the ¶Department of Dermatology, Charité University Hospital, 10117 Berlin, Germany, the ʈInstitute of Biochemistry and Center for Molecular Biosciences Innsbruck, 6020 Innsbruck, Austria, and **Max Delbrück Center for Molecular Medicine, 13125 Berlin-Buch, Germany Background: SHH signaling is an important growth-stimulating factor in diverse cancers. Results: MID1 catalyzes ubiquitination and proteasomal cleavage of Fu. Downloaded from Conclusion: The MID1-PP2A complex regulates the activity of the SHH effector GLI3 in cancer cell lines by regulating proteasomal cleavage of Fu. Significance: Understanding the molecular mechanisms underlying tumorigenesis is crucial for developing therapeutic approaches to treat cancers. http://www.jbc.org/ SHH (Sonic Hedgehog)-GLI signaling plays an important role from the microtubules. Ci maturates into a transcriptional acti- during embryogenesis and in tumorigenesis. The survival and vator and translocates into the nucleus, where it stimulates growth of several types of cancer depend on autonomously acti- transcription of Hh target genes. vated SHH-GLI signaling. A protein complex containing the Although Hh signaling seems more complex in mammals, ubiquitin ligase MID1 and protein phosphatase 2A regulates the several elements of the Hh pathway are highly conserved at MAX DELBRUECK CENTRUM FUE on November 17, 2014 nuclear localization and transcriptional activity of GLI3, a tran- throughout species. Three homologues of Hh (SHH (Sonic scriptional effector molecule of SHH, in cancer cell lines with Hedgehog), DHH (Desert Hedgehog), and IHH (Indian Hedge- autonomously activated SHH signaling. However, the exact hog) (7)), two Ptch homologues (PTCH1 (Patched 1) and molecular mechanisms that mediate the interaction between PTCH2 (Patched 2) (8)), and three Ci homologues (GLI1, GLI2, MID1 and GLI3 remained unknown. Here, we show that MID1 and GLI3) (9, 10) have been identified in mammalian cells (3, 4). catalyzes the ubiquitination and proteasomal cleavage of the Also, a human orthologue of the Fu kinase (11) has been dis- GLI3 regulator Fu. Our data suggest that Fu ubiquitination and covered. However, transduction of Hh signals and in particular cleavage is one of the key elements connecting the MID1-PP2A the function of the mammalian Fu kinase seem to differ sub- protein complex with GLI3 activity control. stantially from Drosophila and are discussed controversially in the literature. Some studies have suggested that human Fu enhances the activator function of GLI proteins similar to its Members of the Hh (Hedgehog) protein family are key medi- role in Drosophila (11–13). Fu knock-out mice, however, do ators of several fundamental processes during embryonic not display typical SHH deficiency phenotypes. Instead, they development including growth, body patterning, and tissue develop normally until birth, but fail to thrive within the first morphogenesis (reviewed in Refs. 1 and 2). In response to extra- week, and develop severe growth retardation and hydrocepha- cellular stimulation, Hh proteins bind to their receptor Patched lus. They die within the first 3 weeks after birth (14, 15). (Ptch), a 12-span transmembrane protein. In the absence of Hh These data show that although Fu is dispensable for Hh sig- ligands, Ptch inhibits Smoothened (Smo), a second transmem- naling during embryogenesis, its fundamental function evolves brane protein. Hh binding leads to the relief of Smo and the after birth, suggesting two different mechanisms of Hh signal activation of a downstream signaling cascade (3). In Drosophila, transduction in mammals: one is Fu-dependent and important the cytosolic transduction of the Hh signal involves a microtu- for the regulation of growth and brain formation after birth, and bule-associated protein complex containing Fu (Fused), the a second one is Fu-independent and either solely responsible GLI family transcription factor Ci (Cubitus Interruptus), the for embryonic Hh signaling or at least able to back up for the kinesin-like protein Cos2 (Costal2), and SuFu (Suppressor of Fu-dependent pathway in embryonic tissues. Fused) (reviewed in Ref. 4). Upon Hh stimulation, the Fu kinase Likewise, mechanisms leading to the activation of mamma- gets phosphorylated and thereby activated, enabling it to phos- lian GLI proteins are much less well understood than in Dro- phorylate Cos2 at two different positions (5, 6). Phosphoryla- sophila. As we have shown previously, a protein complex con- tion of Cos2 leads to the release of the entire protein complex sisting of the microtubule-associated ubiquitin ligase MID1, the ␣4 protein, and protein phosphatase 2A (PP2A)2 regulates 1 To whom correspondence should be addressed: German Center for Neuro- the nuclear localization and transcriptional activity of one of degenerative Diseases, University of Bonn/BMZ1, Sigmund-Freud-Str. 25, 53127 Bonn, Germany. Tel.: 49-228-28751113; E-mail: sybille.krauss@ dzne.de. 2 The abbreviation used is: PP2A, protein phosphatase 2A. NOVEMBER 14, 2014•VOLUME 289•NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 31805 MID1 Catalyzes Ubiquitination and Cleavage of Fu the three transcriptional effector molecules of mammalian TABLE 1 SHH signaling, GLI3, in cancer cell lines with autonomously siRNA sequences (activated SHH signaling (16, 17). Via its ubiquitin ligase activity, siRNA Gene targeted Target sequence (5؅-3؅ the RING finger protein MID1 targets PP2A toward ubiquitin- Fu si2 Fu AAGGCACACCACTCTATATGTCT Fu si3 Fu AAGGTAAAAGTAGTAGATTGGGA dependent degradation by the proteasome and thereby Fu si1 Fu AAGAGTCTACTGAAGTGACACT decreases PP2A activity at the microtubules (18). Furthermore, MID1si-2 MID1 TGCCATTGGTCTTGCTTACAA we found that MID1 activity is fundamental for the maturation MID1si-4 MID1 GGATTACAACTTTTAGGAATT of GLI3 into a transcriptional activator. However, the exact TABLE 2 molecular mechanisms that mediate the interaction between Primer sequences MID1 and GLI3 remain unknown. Primer name Target (Here we show that in mammalian cells, the kinase domain of (real time PCR) gene Sequence (5؅-3؅ Fu is cleaved off upon ubiquitination of Fu leading to the GAPDH-f1 GAPDH CCACCCATGGCAAATTCC expression of a 90-kDa fragment. We further show that this GAPDH-r1 GAPDH TGGGATTTCCATTGATGACAAG GAPDH-f2 GAPDH CCACATCGCTCAGACACCAT ubiquitination is mediated through interaction of Fu with the GAPDH-r2 GAPDH AAATCCGTTGACTCCGACCTT Downloaded from MID1 ubiquitin ligase, which targets Fu toward Lys6, Lys48, and CCND1-f1 CCND1 TGGGTCTGTGCATTTCTGGTT 63 CCND1-r1 CCND1 GCTGGAAACATGCCGGTTAC Lys ubiquitination. Blockage of the proteasome leads to a sig- CCND1-f2 CCND1 TGCGCTGCTACCGTTGACT nificant increase in abundance of full-length Fu compared with CCND1-r2 CCND1 AGCGATTGTAATATTTCCAAACC Fu-f1 Fu TGTACAAGGGTCGAAGAAAATACAGT the 90-kDa fragment. Likewise, knockdown of MID1 leads to a Fu-r1 Fu GAGCGCCCCAATTTTGG remarkable reduction of the 90-kDa fragment. Together with Fu-f2 Fu CGCATCCTACACCGAGATATGA the observation