
10.1071/ZO13080_AC CSIRO 2013 Australian Journal of Zoology 2013, 61(6), 462-468 SUPPLEMENTARY MATERIAL Long-term persistence and vicariance within the Australian Monsoonal Tropics: the case of the Giant Cave and Tree Geckos (Pseudothecadactylus) Paul M. OliverA,B,, Rebecca J. LaverA,B, Katie L. SmithB and Aaron M. BauerC A Department of Zoology, University of Melbourne, Parkville, Vic. 3052, Australia. B Museum Victoria, GPO Box 666, Melbourne, Vic. 3001, Australia. C Department of Biology, Villanova University, 800 Lancaster Ave, Villanova, PA, 19085, USA Correspondence to: Paul Oliver. Email: [email protected] Table S1. Locality, specimen and collection details of Pseudothecadactylus specimens included in genetic analyses. ID number is to allow identification of specimens on Figures 1 and 2. Taxon Specimen ID Locality State Latitude Longitude ND2 RAG1 Pseudothecadactylus australis QMJ57120 na Heathlands Ranger Station QLD -11.75 142.58 GU459946 FJ855449/JX0245 Pse udothecadactylus cavaticus WAMR171550 1 Prince Regent Nature Reserve WA -15.7605 125.2564 KJ685523 KJ685534 Pseudothecadactylus cavaticus WAMR171551 2 Prince Regent Nature Reserve WA -15.7619 125.2578 KJ685524 KJ685535 Pseudothecadactylus cavaticus WAMR171453 3 Prince Regent Nature Reserve WA -15.5519 125.4792 KJ685522 KJ685533 Pseudothecadactylus cavaticus WAMR171594 4 Prince Regent Nature Reserve WA -15.9788 125.3675 KJ685526 KJ685537 Pseudothecadactylus cavaticus WAMR38873 5 Donkin's Hill, Mitchell Plateau WA -14.9875 125.5069 KJ685527 _ Pseudothecadactylus cavaticus WAMR171590 6 Mitchell Plateau WA -14.8222 125.7106 KJ685525 KJ685536 Pseudothecadactylus lindneri NTMR27595 1 West Arnhemland, near Kikiyown NT -12.19 133.81 KJ685529 _ Pseudothecadactylus lindneri NMVD72623 2 West Arnhemland, near Kikiyown NT -12.19 133.81 KJ685530 _ Pseudothecadactylus lindneri NTMR35722 3 Oenpelli NT -12.32 133.05 KJ685531 KJ685538 Pseudothecadactylus lindneri NTMR23151 4 Oenpelli NT -12.39 133.08 KJ685528 _ Pseudothecadactylus lindneri AMSR90195 5 Liverpool R (mid reaches) NT -12.55 133.88 AY369024 _ Pseudothecadactylus lindneri MVZ99544 6 Near East Alligator Ranger Station NT -12.42 132.96 JX024510 AY662626 Table S2. Summary details of additional gekkotans included in phylogenetic analyses. Species Specimen Locality ND2 RAG-1 Carphodactylidae Carphodactylus laevis AMS R143258 AUS, Queensland, Lamb Range GU459943 GU459542 Nephrurus levis AMS R140561 AUS, WA, Denham GU459945 GU459544 Nephrurus stellatus SAMA R36563 AUS, SA, 19.3 km NE Courtabie JF807337 FJ855446 Orraya occultus QMA002513 AUS, Qld, Mcllwraith Ranges JX041389 JQ945320 Phyllurus platurus AMB42 AUS, NSW, Sydney JX024357 HQ426314 Saltuarius swaini AMS R143262 AUS, Queensland, Lamb Range JX024356 JQ945338 Underwoodisaurus milii SAMA R38006 AUS, SA, 17 km SE Burra, South Australia HQ288423 FJ571622 Uvidicolus sphyrurus AMS152381 AUS, NSW, Kaputar National Park GU459944 GU459543 Diplodactylidae Bavayia cyclura CAS 157697 NC, Plage de Poé JX024367 JX024467 Bavayia montana AMS R144235 NC, Mt. Panié JX024370 JX024471 Bavayia ornata AMS R149306 NC, Mt. Panié DQ533737 JX024472 Bavayia sauvagii AMS R144318 NC, Mt. Koghis JX024373 JX024475 Bavayia septuiclavis CAS 205439 NC, Rivière Bleue, vic. Pont Germain JX024374 JX024476 Correlophus ciliatus 3 AMS R146594 NC, Rivière Bleue, vic. Pont Germain JX024439 EF534778 Crenadactylus Cape Range WAM R132481 AUS, WA, Shothole Canyon, Cape Range National Park HQ288435 HQ288476 Crenadactylus Carnarvon WAM R135495 AUS, WA, False Entrance Well HQ288446 FJ855457 Crenadactylus Central Ranges SAMA R22245 AUS, Northern Territory, 10 km S Barrow Creek JX024364 JX024489 Crenadactylus Kimberley A SAMA R53980 AUS, WA, 24 km N Tunnel Creek HQ288467 HQ288479 Crenadactylus Kimberley E WAMR171693 AUS, WA, Long Is JQ820277 Q820289 Crenadactylus Kimberley F WAMR168725 AUS, WA, Katers Is JQ820273 JQ820286 Crenadactylus Kimberley G WAMR171007 AUS, WA, Adolphus Is JQ820269 JQ820282 Crenadactylus ocellatus WAM R129700 AUS, WA, Ravensthorpe HQ288434 HQ288477 Crenadactylus Pilbara WAM R132627 AUS, WA, Burrup Peninsula HQ288450 HQ132627 Dierogekko koniambo AMS R161129 NC, Headwaters of Rivière Pandanus, Massif de Koniambo JF972451 JX024493 Dierogekko poumensis AMS R161205 NC, Sommet Poum, 3 km S Poum JX024375 JX024495 Dierogekko validiclavis AMS R144230 NC, Mt. Panié JF972461 JX024497 Diplodactylus conspicillatus AMS R158426 AUS, NSW, Sturt National Park JX024358 JQ173721 Diplodactylus granariensis AMS R150637 AUS, WA, Dedari JX024359 JX024498 Eurydactylodes occidentalis AMS R166218 NC, Marais Fournier, Mouéara, Gouaro-Déva DQ533776 JX024500 Eurydactylodes vieillardi AMS R149485 NC, Fôret Plate DQ533773 JX024502 Hesperoedura reticulata SAMA R23035 AUS, WA, 73 km E. Norseman EF681803 FJ855450 Hoplodactylus duvaucelli FT174 NZ, Mercury Island GU459843 GU459440 Lucasium byrnei SAMA R52296 AUS, SA, Camel Yard Spring EF681801 FJ855453 Lucasium maini AMS R150647 AUS, WA, Dedari JX024362 JX024503 Mniarogekko chahoua AMS R144171 NC, Sarraméa JX024432 JX024505 Mokopirirakau cryptozoicus RAH 489 NZ, Takitimu Mtns. GU459808 GU459405 Mokopirirakau granulatus RAH 66 NZ, Northcross GU459817 GU459414 Naultinus grayi RAH 253 NZ, Kaimaumau Swamp GU459766 GU459363 Oedodera marmorata AMS R161254 Creek à Paul, Sommet Noir, Paagoumène, 11 km, NW Koumac AY858957 JQ173726 Oedura marmorata AMS R143861 AUS, Qld, Stonehenge area GU459951 GU459550 Amalosia rhombifer A SAMAR34513 QLD: Townsville JQ173660 FJ855472 Amalosia rhombifer B AMS R136216 AUS, NT, 3.5 km upstream from Bells Gorge JX024363 JX024509 Paniegekko madjo AMS R149329 NC, Mt. Panié GU459950 GU459549 Rhacodactylus auriculatus AMS R152650 NC, Plaine des Lacs, Kwa Néie JX024378 JX024516 Rhacodactylus leachianus AMS R152651 NC, Plaine des Lacs, Kwa Néie JX024444 JX024554 Rhacodactylus trachycephalus CAS 214440 NC, Îlot Môrô JX024465 JX024559 Rhynchoedura ornata AMS R155371 AUS, NSW, Sturt National Park GU459954 JX024563 Strophurus intermedius AMS R158434 AUS, NSW, 35 km from Mt. Hope on Euabalong Road GU459952 GU459551 Strophurus jeanae SAMA R53984 AUS, QLD, 11 km S of Wycliffe Well KJ685532 FJ855477 Toropuku stephensi RAH 137 NZ, Stephens Is. GU459782 GU459379 Tukutuku rakuriae RAH 238 NZ, Stewart Is. GU459785 GU459382 Woodworthia chrysosireticus RAH 476 NZ, Mana Is. GU459841 GU459438 Woodworthia maculata RAH 292 NZ, Titahi Bay GU459852 GU459449 Pygopodidae Aprasia inaurita SAMA R40729 AUS, SA, 2 km E Burra AY134574 FJ571632 Delma australis SAMA R22784 AUS, SA, Mt Remarkable NP, SA AY134582 FJ571633 Delma molleri SAMA R23137 AUS, SA, Mt Remarkable NP, SA AY134593 FJ571635 Lialis burtonis JFBM8 captive (no data) JX024354 GU459540 Pygopus lepidopodus WBJ1206 AUS, WA, Lesueur National Park AY134603 HQ426319 Pygopus nigriceps MVZ 197233 AUS, NT, 81 km S Alice springs JX024355 EF534783 Ophidiocephalus taeniatus SAMA R44653 AUS, SA, Todmorden Stn AY134601 FJ571645 Paradelma orientalis QMJ56089 AUS, 20 km N Capella, QLD, Australia JX041398 HQ426304 Pletholax gracilis WAM R104374 AUS, WA, Victoria Park AY134602 FJ571631 Gekkonids Gehyra variegata AY369026 FJ855439 Gekko gekko AF114249 AY662625 Sphaerodactylus shrevei AY662547 AY662623 Teratoscincus przewalskii U71326 AY662624 Table S3. Primer combinations and reaction conditions. Fragment Locus Primers Sequence size PCR mix Thermocycler conditions GoTaq 5 min @ 95C, 40 x (30s @ 95C, 30 sec @ ND2 ND2.F GCCCATACCCCGAAAATSTTG ~900 bp HotStart MM 55C, 1 min @ 72C), 5 min @ 72C, hold at 15C ND2.R TTAGGGTRGTTATTTGHGAYATKC GoTaq 5 min @ 95C, 40 x (30s @ 95C, 30 sec @ ND2b.f GCCCATACCCCAAAAATGTYG ~900 bp HotStart MM 50C, 1 min @ 72C), 5 min @ 72C, hold at 15C ND2f.r TGTRGTTATRTGDGATATYCG GoTaq 5 min @ 95C, 40 x (30s @ 95C, 30 sec @ ND2b.f GCCCATACCCCAAAAATGTYG ~900 bp HotStart MM 50C, 1 min @ 72C), 5 min @ 72C, hold at 15C ND2e.r GCGCGCTGGTTTGGGTDWTTAGYTGTTAA GoTaq 5 min @ 95C, 40 x (30s @ 95C, 30 sec @ RAG1 RAG1R13.F TCTGAATGGAAATTCAAGCTGTT ~800 bp HotStart MM 55C, 1 min @ 72C), 5 min @ 72C, hold at 15C RAG1r.Stroph840 AAGTGCTTGCATGTTGTTTC GoTaq 5 min @ 95C, 40 x (30s @ 95C, 30 sec @ RAG1f.Stroph379 GTGAGAGGAGACATTGAYACA ~800 bp HotStart MM 55C, 1 min @ 72C), 5 min @ 72C, hold at 15C RAG1R18.R GATGCTGCCTCGGTCGGCCACCTTT References: ND2. F, ND2. R – Oliver, P.M., Hugall, A.H., Adams, M.A., Cooper S.J.B. and Hutchinson, M.N. (2007) Genetic elucidation of cryptic and ancient diversity in a group of Australian diplodactyline geckos; the Diplodactylus vittatus complex. Molecular Phylogenetics and Evolution. 44, 77-88. ND2b.f, ND2f.r ND2e.r - Jennings B., Pianka, E.R., Donnellan, S.C. (2003). Systematics of the lizard family Pygopodidae with implications for the diversification of Australian temperate biotas. Systematic Biology, 52: 757–780. RAG1r.Stroph840, RAG1f.Stroph379 – Courtesy of Stuart Nielson, unpublished RAG1R13.F, RAG1R18.R - Groth, J.G., Barrowclough, G.F., 1999. Basal divergences in birds and the phylogenetic utility of the nuclear RAG-1 gene. Mol. Phylogenet. Evol. 12, 115–123. .
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages6 Page
-
File Size-