![Human Population Genomics Heritability & Environment](https://data.docslib.org/img/3a60ab92a6e30910dab9bd827208bcff-1.webp)
ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG 010101100010010100001010101010011011100110001100101000100101 Human Population Genomics Heritability & Environment Bienvenu OJ, Davydow DS, & Kendler KS (2011). Psychological medicine, 41 (1), 33-40 PMID: Heritability & Environment Heritability & Environment Heritability & Environment Feasibility of identifying genetic variants by risk allele frequency and strength of genetic effect (odds ratio). TA Manolio et al. Nature 461, 747-753 (2009) doi:10.1038/nature08494 Where is the missing heritability? Some plausible explanations • Rare variants not captured in genotyping microarrays • Many variants of small effect • Structural variants not captured in short read sequencing • Epistatic effects: non-linear gene-gene interactions • ??? TA Manolio et al. Nature 461, 747-753 (2009) doi: 10.1038/nature08494 Global Ancestry Inference Nature. 2008 November 6; 456(7218): 98–101. Modeling population haplotypes – VLMC G , …, G ; G = g … g ; g {0, 1, 2} 0000 1 N i i1 in ij ∈ 0001 Gi = Hi1 + Hi2, where, 0011 0110 Hi = hij1 … hijn ; hijk ∈ {0, 1} 1000 1001 1011 Browning, 2006 Phasing Browning & Browning, 2007 Identity By Descent . { { IBD detection IBD = F IBD = T FastIBD: sample haplotypes for Parente each individual, check for IBD Rodriguez et al. 2013 Browning & Browining 2011 Mexican Ancestry The genetics of Mexico recapitulates Native American substructure and affects biomedical traits, Moreno-Estrada et al. Science, 2014. Fixation, Positive & Negative Selection How can we How can we detect negative detect positive selection? selection? Negative Selection Neutral Drift Positive Selection How can we detect positive selection? Ka/Ks ratio: Ratio of nonsynonymous to synonymous substitutions Very old, persistent, strong positive selection for a protein that keeps adapting Examples: immune response, spermatogenesis How can we detect positive selection? Positive Selection in Human Lineage Positive Selection in Human Lineage Mutations and LD X X X Slide Credits: Marc Schaub Long Haplotypes –EHS, iHS tests Less time: • Fewer mutations • Fewer recombinations Application: Malaria • Study of genes known to be implicated in the resistance to malaria. • Infectious disease caused by protozoan parasites of the genus Plasmodium • Frequent in tropical and subtropical regions • Transmitted by the Anopheles mosquito Slide Credits: Image source: wikipedia.orgMarc Schaub Application: Malaria Image source: Slide Credits: NIH - http://history.nih.gov/exhibits/bowman/images/malariacycleBig.jpg Marc Schaub Application: Malaria Image source: CDC - http://www.dpd.cdc.gov/dpdx/images/ParasiteImages/M-R/Malaria/ malaria_risk_2003.gif Slide Credits: Marc Schaub Results: G6PD, TNFSF5 Slide Credits: Source: Sabeti et al. Nature 2002. Marc Schaub Malaria and Sickle-cell Anemia • Allison (1954): Sickle-cell anemia is limited to the region in Africa in which malaria is endemic. Distribution of malaria Distribution of sickle-cell anemia Slide Credits: Image source: wikipedia.org Marc Schaub Lactose Intolerance Source: Ingram and Swallow. Population Genetics of Encyclopedia of LifeSlide Credits: Sciences. 2007. Marc Schaub Lactose Intolerance LCT, 5’ LCT, 3’ Slide Credits: Source: Bersaglieri et al. Am. J. Hum. Genet. 2004. Marc Schaub Positive Selection in Human Lineage .
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages27 Page
-
File Size-