THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 45, Issue of November 7, pp. 44331–44337, 2003 © 2003 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. ATPase and DNA Helicase Activities of the Saccharomyces cerevisiae Anti-recombinase Srs2* Received for publication, July 7, 2003, and in revised form, September 2, 2003 Published, JBC Papers in Press, September 8, 2003, DOI 10.1074/jbc.M307256200 Stephen Van Komen‡§¶, Mothe Sreedhar Reddy‡§ʈ, Lumir Krejci‡¶, Hannah Klein**, and Patrick Sung ¶‡‡ From the ‡Institute of Biotechnology and Department of Molecular Medicine, University of Texas Health Science Center, San Antonio, Texas 78245 and **Department of Biochemistry and Kaplan Comprehensive Cancer Center, New York University School of Medicine, New York, New York 10016 Saccharomyces cerevisiae SRS2 encodes an ATP-de- that influence recombination events. One such helicase is en- pendent DNA helicase that is needed for DNA damage coded by the Saccharomyces cerevisiae SRS21 (Suppressor of checkpoint responses and that modulates the efficiency RAD Six-screen mutant 2) gene. Srs2 protein belongs to the Downloaded from of homologous recombination. Interestingly, strains si- SF1 helicase family and contains regions of similarity to the multaneously mutated for SRS2 and a variety of DNA bacterial UvrD, Rep, and PcrA helicases (4). A mutant form of repair genes show low viability that can be overcome by SRS2 was initially identified as a suppressor of the radiation- inactivating homologous recombination, thus implicat- sensitivity of rad6 and rad18 mutants that are defective in ing inappropriate recombination as the cause of growth post-replicative DNA repair (4, 5). Subsequent studies revealed impairment in these mutants. Here, we report on our that suppression of rad6 and rad18 mutations by the srs2 biochemical characterization of the ATPase and DNA mutation is due to heightened recombination mediated by the www.jbc.org helicase activities of Srs2. ATP hydrolysis by Srs2 occurs RAD52 epistasis group of genes (6). Consistent with this obser- efficiently only in the presence of DNA, with ssDNA vation, srs2 mutants show a hyper-recombination phenotype being considerably more effective than dsDNA in this (7, 8). Together, these genetic observations indicate that SRS2 regard. Using homopolymeric substrates, the minimal at NYU School of Medicine Library on July 26, 2007 DNA length for activating ATP hydrolysis is found to be negatively regulates RAD52-mediated homologous recombina- 5 nucleotides, but a length of 10 nucleotides is needed tion. It has been suggested that by antagonizing the recombi- for maximal activation. In its helicase action, Srs2 pre- nation machinery, Srs2 ensures the channelling of DNA lesions -fers substrates with a 3؅ ss overhang, and ϳ10 bases of 3؅ that arise during DNA replication into the Rad6/Rad18-medi overhanging DNA is needed for efficient targeting of ated repair reactions (4). Hence, in rad6 and rad18 mutants, -Srs2 to the substrate. Even though a 3؅ overhang serves repair of the replication-associated DNA lesions by recombina to target Srs2, under optimized conditions blunt-end tion is inefficient unless SRS2 is inactivated (4). DNA substrates are also dissociated by this protein. The Multiple studies have shown that inactivating SRS2 in cells ability of Srs2 to unwind helicase substrates with a long already mutated for one of a number of genes needed for DNA duplex region is enhanced by the inclusion of the single- metabolism results in poor growth and sometimes inviability strand DNA-binding factor replication protein A. (6, 9–11). Interestingly, simultaneous ablation of homologous recombination (i.e. by deleting RAD51, RAD52, RAD55, and RAD57, members of the RAD52 epistasis group) restores via- DNA helicases are ubiquitous among prokaryotes and eu- bility to the double mutants, implicating inappropriate recom- karyotes. These enzymes utilize the free energy derived from bination as the underlying cause of growth impediment in the hydrolysis of a nucleoside triphosphate to disrupt the hy- these mutants (11–13). In some instances (i.e. srs2⌬ rad54⌬ drogen bonds that bind the complementary strands of duplex and srs2⌬ rdh54⌬), cell inviability can also be overcome by DNA. DNA helicases play an essential role in virtually every deleting genes that function in DNA damage checkpoints, aspect of nucleic acid metabolism, including transcription, rep- which suggests that growth impairment is caused by the for- lication, recombination, and repair (reviewed in 1–3). mation of a recombination intermediate that is sensed by DNA We focus on the mechanism of homologous recombination in damage checkpoints to result in prolonged cell cycle arrest and eukaryotes and are interested in the biology of DNA helicases eventual cell death (13). Srs2 protein has also been implicated in signaling events in the intra-S checkpoint in cells treated with a DNA damaging agent (13, 14). More recently, a role for * This work was supported by United States Public Health Service Srs2 in mediating adaptation and recovery from DNA damage Research Grants ES07061, CA96593, GM53738, and GM57814. The checkpoint-imposed G2/M arrest has been reported (15). Dele- costs of publication of this article were defrayed in part by the payment tion of RAD51 enables srs2-null cells to recover from DNA of page charges. This article must therefore be hereby marked “adver- tisement” in accordance with 18 U.S.C. Section 1734 solely to indicate damage checkpoint-mediated cell cycle arrest (15), implicating this fact. Rad51 in the prevention of recovery in the srs2 mutant. § These authors contributed equally to this work. The involvement of the SRS2 gene in the modulation of ¶ Present address: Dept. of Molecular Biophysics and Biochemistry, recombination and DNA damage checkpoint responses, which Yale University School of Medicine, 333 Cedar St., C130 Sterling Hall of Medicine, New Haven, CT 06520-8024. have a direct bearing on the maintenance of genome integrity, ʈ Present address: Dept. of Pathology, Brigham and Women’s Hospi- tal and Harvard Medical School, 75 Francis St., Boston, MA 02115. ‡‡ To whom correspondence should be addressed: Dept. of Molecular 1 The abbreviations used are: SRS2, suppressor of RAD six-screen Biophysics and Biochemistry, Yale University School of Medicine, 333 mutant 2 gene; RPA, replication protein A; ss, single strand; AMP-PNP, Cedar St., C130 Sterling Hall of Medicine, New Haven, CT 06520-8024. adenosine 5Ј-(␤,␥-imino)triphosphate; AMP-PCP, adenosine 5Ј-(␤,␥- Tel.: 203-785-4553; Fax: 203-785-6404; E-mail: [email protected]. methylene)triphosphate; ATP␥S, adenosine 5Ј-3-O-(thio)triphosphate. This paper is available on line at http://www.jbc.org 44331 44332 Saccharomyces cerevisiae Anti-recombinase Srs2 Activities TABLE I Oligonucleotides used Name of the Ј Ј oligonucleotide DNA sequence (5 to 3 ) H1 ATTAAGCTCTAAGCCATGAA TTCAAATGAC CTCTTATCAA H2 TTGATAAGAG GTCATTTGAA TTCATGGCTT AGAGCTTAAT H3 TTGATAAGAG GTCATTTGAA TTCATGGCTT AGAGCTTAAT TGCTGAATCT GGTGCTGGGA TCCAACATGT TTTAAATATG H4 ATGTCACTAT TGAAGCGCTG ATCACTGTCT CCATCGAACG TTGATAAGAG GTCATTTGAA TTCATGGCTT AGAGCTTAAT H5 ATTAAGCTCTAAGCCATGAA TTCAAATGAC CTCTTATCAA ATCTGATGCT ATAGGCTAGC H6 TTGATAAGAG GTCATTTGAA TTCATGGCTT AGAGCTTAAT AGTCGTATTA ATGCTATGAT H7 GCTTAGTCAT GTCAGTATAT ATTAAGCTCTAAGCCATGAA TTCAAATGAC CTCTTATCAA H8 ATGTCACTGT CGCTATGTAT TTGATAAGAG GTCATTTGAA TTCATGGCTT AGAGCTTAAT H9 TTGATAAGAG GTCATTTGAA TTCATGGCTT AGAGCTTAA TT H10 TTGATAAGAG GTCATTTGAA TTCATGGCTT AGAGCTTAA TTTTTT H11 TTGATAAGAG GTCATTTGAA TTCATGGCTT AGAGCTTAA TTTTTTTTT H12 TTGATAAGAG GTCATTTGAA TTCATGGCTT AGAGCTTAA TTTTTTTTTTT H13 TTGATAAGAG GTCATTTGAA TTCATGGCTT AGAGCTTAA TTTTTTTTTTTTT H14 TTGATAAGAG GTCATTTGAA TTCATGGCTT AGAGCTTAA TTTTTTTTTTT TTTTTT P1 GAGTTTTATCGCTTCCATGACGCAGAAG P2 TTTCTCATTTTCCGCCAGCAGTCCACTTCG P3 CAGAAAATCGAAATCATCTTCGGTTAAATC Downloaded from underscores the importance for biochemical characterization of its encoded product. Previously, a recombinant form of Srs2 tagged with a C-terminal six-histidine sequence was expressed in Escherichia coli but was found to be insoluble. Nonetheless, the histidine-tagged Srs2 protein could be extracted from the www.jbc.org inclusion bodies with 6 M guanidine and enriched by passing the solubilized fraction over a nickel-NTA column and eluting the bound proteins under denaturing conditions. Following gel filtration, a renaturation protocol was used to obtain a small amount of soluble Srs2 protein. The renatured Srs2 protein at NYU School of Medicine Library on July 26, 2007 was shown to possess a modest ssDNA-dependent ATPase ac- tivity and also a DNA helicase activity that has a 3Ј to 5Ј FIG.1.DNA-dependent ATPase activity of Srs2. Reactions con- taining 35 nM Srs2, 1.5 mM [␥-32P]ATP, and one of a number of DNA polarity with respect to the ssDNA on which the protein trans- cofactors (25 ␮M nucleotides each) were incubated at 30 °C and pH 7.6 locates (16). To define the biochemical properties of Srs2, we in the presence of 15 mM KCl. The level of ATP hydrolysis was meas- have achieved expression of soluble Srs2 in E. coli and have ured by thin layer chromatography and phosphorimaging analysis. The devised a procedure that entails conventional chromatographic DNA co-factors were ␾X viral (ϩ) strand, ␾X linear duplex DNA desig- ␾ ␾ ϳ fraction steps for its purification. Here we show that the non- nated as X LDS, X replicative form I DNA ( 90% supercoiled) designated as ␾X RF, poly(dA), and poly(dT). The