J Mol Evol (2005) 60:434–446 DOI: 10.1007/s00239-004-0152-2 Divergent Histories of rDNA Group I Introns in the Lichen Family Physciaceae Dawn Simon,1 Jessica Moline,1 Gert Helms,2 Thomas Friedl,2 Debashish Bhattacharya1 1 Department of Biological Sciences and the Roy J. Carver Center for Comparative Genomics, University of Iowa, 312 Biology Building, Iowa City, IA 52242-1324, USA 2 Albrecht-von-Haller-Institut fu¨ r Pflanzenwissenschaften, Abteilung Experimentelle Phykologie und Sammlung von Algenkulturen, Universita¨ tGo¨ ttingen, 37073 Go¨ ttingen, Germany Received: 14 May 2004 / Accepted: 7 November 2004 [Reviewing Editor: Dr. W. Ford Doolittle] Abstract. The wide but sporadic distribution of group Introduction I introns in protists, plants, and fungi, as well as in eubacteria, likely resulted from extensive lateral Group I introns are autocatalytic RNAs that encode transfer followed by differential loss. The extent of conserved primary and secondary structures essential horizontal transfer of group I introns can potentially for self-splicing (Kruger et al. 1982; Cech 1985). The be determined by examining closely related species or conserved RNA elements are readily aligned and can genera. We used a phylogenetic approach with a large be used for phylogenetic reconstruction to uncover data set (including 62 novel large subunit [LSU] the evolutionary history of these sequences (e.g., rRNA group I introns) to study intron movement Bhattacharya et al. 1994; Hibbett et al. 1996; Haugen within the monophyletic lichen family Physciaceae. and Bhattacharya 2004; Haugen et al. 2004a, b, Our results show five cases of horizontal transfer into 2005). Group I introns are distributed in organellar homologous sites between species but do not support and ribosomal (r)DNA in protists, plants, and fungi, transposition into ectopic sites. This is in contrast to as well as in eubacteria (Turmel et al. 1993; Bhat- previous work with Physciaceae small subunit (SSU) tacharya et al. 1994; Gargas et al. 1995; Bhattacharya rDNA group I introns where strong support was 1998; Nishida et al. 1998; Schroeder-Diedrich et al. found for multiple ectopic transpositions. This dif- 1998; Perotto et al. 2000). Their scattered distribution ference in the apparent number of ectopic intron in some lineages has been interpreted as evidence for movements between SSU and LSU rDNA genes may rampant lateral transfer of group I introns (DePriest in part be explained by a larger number of positions and Been 1992; Hibbett 1996; Cho and Palmer 1999). in the SSU rRNA, which can support the insertion Remarkable examples of horizontal movement be- and/or retention of group I introns. In contrast, we tween distantly related taxa (e.g., fungi to plants, suggest that the LSU rRNA may have fewer accept- [Vaughn et al. 1995], red algae to brown algae able positions and therefore intron spread is limited [Bhattacharya et al. 2001], algae to amoebae [Tunnel in this gene. et al. 1995]) have been described, but the scarcity of these events suggests that they may be relatively Key words: rRNA group I introns — Lichens — infrequent or poorly sampled until now (for excep- Physciaceae — Large subunit rRNA — Small subunit tion, see Cho et al. 1998). In other cases, detailed rRNA phylogenetic analyses have provided strong evidence for intron vertical inheritance over millions of years with few losses (e.g., Bhattacharya et al. 1994; Be- sendahl et al. 2000; Simon et al. 2003; Haugen et al. Correspondence to: Debashish Bhattacharya; email: dbhattac@ 2004a). It therefore seems clear that group I introns blue.weeg.uiowa.edu experience a variety of evolutionary fates, which are 435 likely dependent upon a number of factors (e.g., et al. 2003). This suggests that the distribution in the autocatalytic ability [see Haugen et al. 2004a], selec- rRNAs of the highly structured and relatively large tive pressure [see Goddard and Burt 1999], ecological (e.g., 180- to 400-nt) group I introns may reflect factors [see Friedl et al. 2000; Haugen et al. 2005]). divergent probabilities of insertion, efficient splicing, The relative roles of vertical and horizontal trans- and loss. Here we use phylogenetic methods and a mission in the evolution of group I introns remain an large data set containing 62 novel LSU rDNA group important but poorly understood aspect of the biol- I introns from 23species to study their horizontal ogy of mobile elements. transfer within the monophyletic Physciaceae with The rapidly accumulating data suggest that in or- the goal of contrasting these data for SSU and LSU der to gain a more realistic picture of the significance rDNA introns. of horizontal transfer in group I intron evolution, it is important to focus on lower taxonomic levels, such as species and/or genera, and ultimately within and be- Materials and Methods tween populations. By narrowing the taxonomic scope, we can focus on a small window of evolu- DNA Extraction, PCR, and Sequencing tionary time and sample densely within the target Total genomic DNA was extracted from lichen in the ascomycete group. There have, however, been relatively few family Physciaceae as described previously (Helms et al. 2001). The examples in which group I intron horizontal transfer PCR conditions were as follows: 95°C for 4 min, followed by 35 has been studied in detail among closely related spe- cycles of 95°C for 30 s, 50°C for 30 s, and 72°C for 2 min. cies (exceptions include Holst-Jensen et al. 1999; Amplification concluded with a 10-min extension period at 72°C. Friedl et al. 2000; Nikoh and Fukatsu 2001). Several sets of primers were used to screen the LSU rDNA for group I introns. The primer sequences are as follows (the numbers Lichens are a symbiosis of photosynthetic cells refer to the corresponding position in the E. coli LSU rRNA); 5¢-40 (photobiont) and fungi (mycobiont). Whereas both (5¢CTCGCATCGATGAAGAACGCA3¢), 3¢-148 (5¢AATGACR lichen bionts often have rDNA group I introns, there CTCAAACAGGCATG3¢), 5¢-148 (5¢CATGCCTGTTTGAGYG is no evidence until now to suggest a close evolu- TCATT3¢), 3¢-562 (5¢TTGGTCCGTGTTTCAAGAC3¢), 5¢-562 tionary relationship between these sequences. This (5¢GTCTTGAAACACGGACCAA3¢), 3¢-1245 (5¢ACCACCAAG ATCTGCACTAGAG3¢), 5¢-1252 (5¢GATCTTGGTGGWAGT suggests that horizontal transfer may not occur be- AGC3¢), 3¢-1825 (5¢GAGCACTGGGCAGAAATCAC3¢), 5¢-1825 tween the mycobiont and the photobiont (Friedl et al. (5¢GTGATTTCTGCCCAGTGCTC3¢), 3¢-2252 (5¢TTTAACAGA 2000; Bhattacharya et al. 2002). The fungal compo- TGTGCCGCC3¢), 5¢-2252(5¢GGCGGCACATCTGTTAAA3¢), nent of the Physiaceae family of lichens comprises 3¢-2746 (5¢GATTCTGRCTTAGAGGCGTTC3¢), and 3¢-2904 one of the most group I intron-rich lineages known (5¢ACAAAGGCTTAATCTCAG3¢). The primers were designed to ensure coverage of the entire LSU rDNA. The following primer (Bhattacharya et al. 2000, 2002), making them a good pairs were used: 5¢-40/3¢-148, 5¢-148/3¢-562, 5¢-562/3¢-1245, 5¢-1252/ model to address many questions regarding group I 3¢-1825, 5¢-1825/3¢-2252, and 5¢-2252/3¢-2746 (or 3¢-2904). If the intron evolution. Previous work in our lab has fo- PCR products were larger than the expected size (based on the cused on the small subunit (SSU) rDNA gene in the corresponding Saccharomyces cerevisiae coding region), they were Physciaceae mycobiont and has identified multiple purified and directly sequenced. Alternatively, the PCR products were cloned into the pGEM-T vector (Promega) prior to cases of intron lateral transfer between neighboring sequencing. Both strands were sequenced using an ABI 3100 and distant ectopic rDNA sites (Bhattacharya et al. automated sequencer (Applied Biosystems) at the Center for 2002). In this paper, we expand our analyses to the Comparative Genomics at the University of Iowa. large subunit (LSU) rDNA in this taxonomic group to address one critical question: Are there significant differences in the phylogeny of group I introns in the Reconstruction of Group I Intron Trees SSU versus the LSU rDNA gene? Specifically, we are interested in understanding whether the observed A total of 82 group I intron sequences were included in the phy- logenetic analyses. These sequences were both novel (62) and ex- differences in the folding property and structure of tracted from GenBank (20). Intron secondary structures were the rRNAs correlate with different intron evolution- constructed manually using previously published foldings as a ary histories. It is now well known that the SSU guide (Michel and Westhof 1990; Bhattacharya et al. 1994). The ribosome is composed of discrete structural domains less well-conserved peripheral regions of the structure were esti- (Ramakrishnan and Moore 2001). In contrast, the mated using m-fold V3.1 (Zuker 2003). The secondary structure shown in Fig. 1A illustrates the results of this process. Juxtaposi- LSU ribosome is more monolithic with a significant tion of conserved secondary structure elements offers the only fraction of buried RNA (Ban et al. 2000). Perhaps viable approach to aligning highly divergent group I intron se- reflecting this difference, the distributions of group I quences (Haugen et al. 2005). Whereas many introns at the same introns in the primary, secondary, and tertiary site can be machine-aligned, this process is generally not useful structure of the SSU and LSU rRNAs differ, with the when introns from multiple different insertions sites are compared (Haugen et al. 2004b). In our alignment, BioEdit v5.0.9 (Hall 1999) introns in the SSU rRNA having a more uniform was used to manually align and delimit conserved secondary distribution and those in the LSU rRNA being more structure elements (e.g., P3, P7; see Fig. 1). The final data set highly clustered (Jackson et al. 2002; Bhattacharya contained 122 aligned characters; 118 of these sites were parsimony 436 Fig. 1. Intron secondary structure models. A Secondary structure each of the genic positions analyzed in this study.