Pak. J. Bot., 52(5): 1849-1855, 2020. DOI: http://dx.doi.org/10.30848/PJB2020-5(17) DEVELOPMENT OF A dCAPS MARKER BASED ON A MINOR RESISTANCE GENE RELATED TO HEAD SMUT IN BIN8.03 IN MAIZE LIN ZHANG1#, XUAN ZHOU2#, XIAOHUI SUN1, YU ZHOU1, XING ZENG1, ZHOUFEI WANG3, ZHENHUA WANG1 AND HONG DI1* 1Northeast Agricultural University, Harbin 150030, Heilongjiang Province, China 2Promotion Station of Machinery Technology for Agricultural and Animal Husbandry, Huhhot 010000, Inner Mongolia Autonomous Region, China 3The Laboratory of Seed Science and Technology, Guangdong Key Laboratory of Plant Molecular Breeding, State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, South China Agricultural University, Guangzhou, China #Lin Zhang and Xuan Zhou contributed equally to this research. *Corresponding author’s email: [email protected] Abstract Head smut can cause maize yield losses of up to 80% in the maize-growing region of Northern China. Molecular markers based on candidate resistance genes have proved to be useful for highly sensitive selection of resistance in maize breeding programs. In the present study, a SNP (single-nucleotide polymorphism) in resistant and susceptible maize lines was identified within the nucleotide-binding site (NBS)-leucine-rich repeat (LRR) gene GRMZM2G047152 in bin 8.03. Using this SNP, we developed the derived cleaved amplified polymorphic sequence marker DNdCAPS8.03-1. The molecular coincidence rate of the combination of markers DNdCAPS8.03-1 and LSdCAP2 (related to the QTL qHS2.09) was higher than that of a single marker in a set of 56 inbred maize lines belonging to five heterotic groups. These results provide information and tools that will prove to be useful in marker-assisted selection (MAS) in breeding maize for head smut resistance. Key words: Maize; Head smut resistance; NBS gene family; Marker-assisted selection. Introduction candidate gene GRMZM2G047152, and (ii) to assess the efficacy of new markers in maize inbred lines and a Head smut is a destructive disease in both commercial recombinant inbred line (RIL) population derived from maize (Zea mays) production and seed production in the Mo17 × Huangzaosi. The findings from this study will maize-growing regions in Northern China (Wang et al., improve the efficiency of MAS for head smut resistance 2012). The causal agent is the fungus Sporisorium reilianum breeding in maize. (Kühn) Clint and the disease leads to significant yield losses (Bernardo et al., 1992; Lu et al., 1999; Yu et al., 2014). Materials and Methods Breeding for resistance to head smut is now seen as the most resource-efficient and ecologically sustainable way to Plant materials: Huangzao4 is an elite line of Chinese manage this disease. inbred maize but extremely susceptible to head smut; Resistance to head smut is quantitatively inherited and is approximately 75% of field-grown plants are susceptible controlled by several genes (Bernardo et al., 1992). to this disease (Chen et al., 2008). The resistant lines Quantitative Trait Loci (QTL) have been identified on Mo17 and Qi319 have almost complete resistance to the chromosomes 1, 2, 3, 5, 6, 8, 9, and 10 (Lu et al., 1999; fungus. The genome of inbred maize line B73 has been Lübberstedt et al., 1999; Chen et al., 2008; Li et al., 2015). sequenced and serves as the reference genome for maize Our previous study found five QTL on chromosomes 1, 2, 3, (https://www.maizegdb.org/). The B73 reference genome and 8 using an F2:3 population developed from a susceptible and the sequenced genomes of Mo17 and Qi319 were inbred line (Huangzao4) and a resistant inbred line (Mo17). used to develop SNP markers for head smut resistance. To 43.7% of the phenotypic variance in this population was assess the efficacy of dCAPS markers for selection of explained by the key QTL identified in bin 2.09, qHS2.09 (Li head smut resistance, we analyzed 56 lines of inbred et al., 2008). Six dCAPS markers linked closely to qHS2.09 maize from five subgroups: LAN (Lancaster), SPT were reported and the efficiency of them had been evaluated (derived from Si-ping-tou, a Chinese landrace), PA in maize inbred lines (Di et al., 2015). We propose that (derived from modern US hybrids), PB (derived from US minor QTL should also be considered useful for highly hybrid 78599), and BSSS (derived from the Iowa Stiff sensitive selection in maize breeding programs. Stalk Synthetic population) (Supplementary Table 1) (Di Wang et al., (2012) revealed 18 candidate genes et al., 2015; Yong et al., 2017). associated with resistance to maize head smut in a genome- The inbred lines Mo17 and Huangzaosi were crossed wide association study (GWAS) based on 45,868 SNPs in a to generate the F1 hybrid and a random set of 191 F2 set of 144 inbred lines. This set of candidate genes included individuals (Li et al., 2008). F2 individuals were selfed genes related to disease resistance, disease response, and and lines developed by single-seed descent were used to other plant disease-related processes. The candidate gene generate an F9 RIL population consisting of 151 families. GRMZM2G047152 in bin 8.03 was identified as the subject In 2011 and 2012, the 56 inbred maize lines and the Mo17 of this study by synthesizing results from QTL gene × Huangzaosi RIL population were grown outdoors at the functional analyses. experimental farm of the Northeast Agricultural Our objectives of the current study include the following: University to investigate their resistance to head smut (i) to establish dCAPS markers based on SNPs in the (Supplementary Table 2). 1850 LIN ZHANG ET AL., Table 1. Primers and enzymes used for dCAPS marker development. Forward primer Reverse primer Recognition Expected SNPsd Markers Typesb Enzyme (5’to 3’)a (5’to 3’)a site product sizec Location SNP AGCTCAACGCAATT CGCTCACTGCCAAG DNdCAPS8.03-1 S BsiHKAI GWGCWC 137/23,114 23 C/T CATTgTGC TTGTGC TACATTGATATTTG CAAATCAACGAGTG LSdSCAP2 S PstI CTGCAG 93/7320 69 T/C CCACACGAAT ATTTACtGCA a. Italicized lower case letters indicate mismatched base b. S denotes that the PCR product from susceptible maize plants could be digested c. Expected size of PCR product and size after digestion d. Number corresponds to position of SNP site relative to the 5’ end of the PCR product Table 2 Analysis of consistency between molecular detection and field phenotypic identification. Resistance Field phenotypic LSdCAP2 LSdCAP2+DNdCAPS8.03-1 Groups levela identification Marker detectionb Consistency Marker detectionb Consistency R 13 13 100.0 13 100.0 LAN S 2 0 0.0 2 100.0 Total 15 13 86.7 15 100.0 R 9 9 100.0 9 100.0 PB S 3 2 66.7 2 66.7 Total 12 11 91.7 11 91.7 R 0 0 100.0 0 100.0 SPT S 11 10 90.9 11 100.0 Total 11 10 90.9 11 100.0 R 4 4 100.0 4 100.0 PA S 8 3 37.5 4 50.0 Total 12 7 58.3 8 66.7 R 4 3 75.0 4 100.0 BSSS S 2 1 50.0 2 100.0 Total 6 4 66.7 6 100.0 R 30 29 96.7 30 100.0 All inbred lines S 26 16 61.5 21 80.8 Total 56 45 80.4 51 91.1 R 5 4 80.0 5 100.0 Mo17 × S 146 128 87.7 136 93.2 Huangzaosi RIL Total 151 132 87.4 141 93.4 a. R, disease incidence of inbred lines ranging from 0 to 10%; S, disease incidence of inbred lines ranging from 10.1 to 100% b. Numbers of inbred lines whose dCAPS assay results agreed with field phenotypic identification of disease incidence Table 3. Information for PCR amplification of the two overlapping fragments of the GRMZM2G047152 gene. PCR product Annealing Fragments Primer name Primer sequences sizes temperature 8.03-1-F: 5' TCGGTCCTCACTGTCCTGTA 3' 1 1625 bp 62℃ 8.03-1-R: 5' CACAATCAAACCGAGAAACCT 3' 8.03-2-F: 5' GCGTCGGAGTTACTATTACA 3' 2 1902 bp 62℃ 8.03-2-R: 5' AGTACACCACGCACCTTT 3' Sequence analysis of candidate gene GRMZM2G047152: Amplification of GRMZM2G047152: The uppermost two Sequence analysis was conducted in 2014. The candidate leaves were harvested from three-leaf stage maize seedlings gene sequence GRMZM2G047152 was obtained from the and genomic DNA was extracted following the CTAB maize reference genome B73 RefGen_v2 at MaizeGDB (cetyl trimethylammonium bromide) procedure (Murray et (https://www.maizegdb.org/). Fgenesh software al., 1980). Primer sequences to amplify the two (www.softberry.com/berry.phtml) was used for sequence overlapping fragments of gene GRMZM2G047152 were analysis, and ORF Finder (http://www. ncbi.nlm.nih.gov/ designed using Primer 5.0 software (http://simgene. projects/gorf/) and Conserved Domain Search Service com/Primer5). Primer sequences, approximate PCR (http://www.ncbi.nlm.nih.gov/Structure/ cdd/wrpsb.cgi/) was product sizes, and annealing temperatures used for used for prediction of conserved protein motifs. BLAST amplification of gene sequences appear in Table 3. PCR searches were run using the National Center for was conducted in 20-L reactions comprised of 1 U Taq Biotechnology Information (NCBI) (http://www.ncbi. polymerase with 1 PCR buffer with 1.5 mM MgCl2, 0.5 nlm.nih.gov/) and MaizeGDB (http:// www.maizegdb.org/) mM of each dNTP, 2.5 M of each primer, and 50 ng of databases. Predicted protein sequences were aligned and a template DNA. PCR conditions consisted of initial phylogenetic tree was built with the neighbor-joining (NJ) denaturation for 5 min at 94°C, then 35 cycles of 45 s at method and a bootstrap value of 1000 in MEGA 6.0 94°C, 45 s at 62°C, and 1.5 min at 72°C, and final (http://www.megasoftware.