J Mol Evol 12003) 56:38±45 DOI: 10.1007/s00239-002-2378-1 Structure and Evolution of the Mitochondrial Control Region of Leaf Beetles Coleoptera: Chrysomelidae): A Hierarchical Analysis of Nucleotide Sequence Variation Patrick Mardulyn,1,2 Arnaud Termonia,1,2 Michel C. Milinkovitch1 1 Unit of Evolutionary Genetics, Free University of Brussels, Rue Jeener et Brachet 12, 6041 Gosselies, Belgium 2 Laboratoire de Biologie Animale et Cellulaire, CP 160/12, Free University of Brussels, av. F.D. Roosevelt 50, 1050 Brussels, Belgium Received: 31 October 2001 / Accepted: 19 July 2002 Abstract. To assess the levels of variation at dier- [T1T)A1A)] repeats, all found in the control region of ent evolutionary scales in the mitochondrial 1mt) other insect orders. Our analyses allowed us to control region of leaf beetles, we sequenced and identify portions of the control region with enough compared the full mt control region in two genera variation for population genetic or phylogeographic 1Chrysomela and Gonioctena), in two species within a studies. genus 1Gonioctena olivacea and G. pallida), in indi- viduals from distant populations of these species in Key words: Mitochondrial DNA Ð Control re- Europe, and in individuals from populations sepa- gion Ð Repeated elements Ð Chrysomelidae Ð rated by moderate 110- to 100-km) to short 1<5-km) Sequence variation Ð Concerted evolution distances. In all individuals, a highly repetitive section consisting of the tandem repetition of 12 to 17 im- perfect copies of a 107- to 159-bp-long core sequence was observed. This repetitive fragment accounts for Introduction roughly 50% of the full control-region length. The sequence variability among repeated elements within The noncoding portion of the mitochondrial 1mt) the control region of a given individual depends on genome in animals is called the control region be- the species considered: the variability within any cause it is believed to control the transcription and G. olivacea individual is much higher than that within replication of the mtDNA molecule. In vertebrates, G. pallida individuals. Comparisons of the repeated the control region has been shown to contain the elements, in a phylogenetic framework, within and promoters for transcription initiation and the origin among individuals of G. olivacea and G. pallida sug- of heavy-strand DNA replication 1e.g., Shadel and gests that the repetitive section of the control region Clayton 1997). In insects, this region is usually called experienced recurrent duplications/deletions, leading the ``A + T-rich region'' following Fauron and to some degree of concerted evolution. Comparisons Wolstenholme 11976), because it exhibits a frequency between Chrysomela and Gonioctena control regions of deoxyadenylate and deoxythymidylate residues revealed virtually no signi®cant sequence similarity, higher than in the rest of the mt molecule. It was except for two long stretches of A's and several found that the origin of replication lies within the control region in Drosophila 1Goddard and Wol- stenholme 1978), and promoters for transcription Correspondence to: Patrick Mardulyn; email: pmarduly@ulb. have possibly been identi®ed in this segment as well ac.be 1Lewis et al. 1994). 39 The control region varies greatly in size among DNA was extracted from ethanol-preserved insects. Whole speci- insects: from 350 bp in Lepidoptera 1Taylor et al. mens were individually ground in an SDS homogenization buer 1993) to 13 kbin barkweevils 1Coleoptera) 1Boyce and incubated overnight with proteinase K 12 mg/ml) at 40°C, followed by three phenol/chloroform extractions, ethanol precipi- et al. 1989). Large dierences in size can also be tation, and resuspension in TE buer 110 mM Tris, 1 mM EDTA). found among closely related taxa, as sizes from 1 to 5 Because no sequences of the control region and of the adjacent kbwere reported among Drosophila species 1Lewis et NADH dehydrogenase subunit 2 1ND2) were available in Gen- al. 1994), as well as within species. This length poly- Bank for Coleoptera, a large fragment of 6±8 kb, including the morphism in the control region often results from the control region, the ND2 gene, and portions of the cytochrome oxidase I 1COI) and of the small-subunit rRNA 112S) genes, was presence of a variable number of tandemly repeated PCR-ampli®ed from two individuals per species. This ampli®cation elements 1Rand 1993; Zhang and Hewitt 1997; Lunt was performed with the Expand Long Template PCR System kit et al. 1998). 1Roche), following the manufacturer's protocol, with an annealing Because the control region is known generally to temperature of 55°C and an extension step of 12 min at 68°C. experience high rates of evolution in both nucleotide The primers used are modi®ed versions of universal primers described by Simon et al. 11994) and are located in the COI and 12s substitution and insertion/deletion events 1e.g., Mo- genes: C1-N-2414 15¢GTGCTAATCATCTAAAAATTTTAATT ritz et al. 1987), although this is not always true for CCTG3¢) 1modi®ed reverse complement of Cl-J-2441) and modi®ed insects 1Zhang and Hewitt 1997), it is increasingly 1longer version) SR-J-14233 15¢CCAGTAAGAGYGACGGGC used as a polymorphic marker for population genetic GATGTGT3¢). These primers were chosen because they were studies or for phylogenetic analyses involving closely previously used successfully for the ampli®cation of shorter frag- ments in Gonioctena leaf beetles 1unpublished data). Shorter ver- related taxa 1e.g., McMillan and Palumbi 1997; RuÈ ber sions of these primers were used to sequence the ¯anking regions et al. 2001). However, to our knowledge, this marker 1+/)700 nucleotides) of the long PCR products 1ABI Prism BigDye has never been used for coleopterans, an insect order Terminator Cycle Sequencing Ready Reaction Kit FS; Applied for which no sequence of the control region is avail- Biosystems). Sequencing products were separated by electropho- able in international sequence databases. We present resis on an ABI 377 automated DNA sequencer. New primers were designed on the sequenced ¯anking regions and used to sequence here a hierarchical study of sequence variation in leaf the long PCR fragment further. This primer-walking strategy was beetles: we sequenced and compared the full mt con- continued until reaching the 3¢ and 5¢ boundaries of the control trol region in two genera, in two species within a ge- region. We thereafter designed new primers [and named them nus, in individuals from distant populations of these according to Simon and co-workers' 11994) nomenclature] for the species in Europe, and in individuals from popula- ampli®cation of the complete mt control region 13.3±5.5 kb): SR-J- 14766 15¢CATTATTTGTATAACCGCAACTGCTGGCAC3¢)in tions separated by moderate 110- to 100-km) to short 12S and TM-N-204 15¢TAACCTTYATAAATGGGGTATG3¢)in 1<5-km) distances. The aim of this exploratory work the methionine transfer RNA 1tRNA). This was done using the is to assess the levels of variation at dierent evolu- Expand Long Template PCR System kit 1Roche), following the tionary scales in the mt control region of leaf beetles manufacturer's protocol, with an annealing temperature of 55°C and infer its mode and tempo of evolution. We also and an extension step of 6 min at 66°C. The ampli®ed products were puri®ed and ligated into a pBluescript II SK1+) vector compare the leaf beetle control-region organization to 1Stratagene) and transferred to E. coli DH5a competent cells. those observed in other orders of insects. Plasmids from positive clones were isolated and subjected to in vitro transposition reactions 1TGS; Finnzymes) that randomly Materials and Methods insert one 1and only one) transposon per plasmid. The transposon contains priming sites and a gene conferring antibiotic resistance. The resulting products were again transferred to E. coli DH5a Insect Collection competent cells. Clones containing a randomly inserted transposon were selected through antibiotic resistance and sequenced using two Sequencing of the mt control region from 24 individuals 1see primers annealing to the transposon. Each clone sequenced with Table 1 for collection sites) allowed the comparison of these both primers 1sequencing in opposite directions) yielded approxi- sequences between two leaf beetle genera 1Gonioctena and mately 1400 bp of sequence. Contigs were assembled manually. Chrysomela, both belonging to the tribe Chrysomelini, subfamily Control-region sequences were obtained with this transposon Chrysomelinae), between two species within the genus Gonioctena insertion strategy for three individuals per species. On the basis of 1G. pallida and G. olivacea), among geographically distant popu- the alignments among these three sequences we designed, for each lations of these three species in Europe, among ®ve populations of species, a set of 8±12 primers allowing the sequencing 1on both G. pallida across the Vosges mountains and the Black Forest, and strands) of the entire 1or nearly so, see below) control region ini- among ®ve populations of G. olivacea inside a 5 ´ 2-km area in the tially PCR-ampli®ed with SR-J-14766 and TM-N-204. In some Belgian Ardennes. A population is de®ned here as a group of instances, the within-species variability of control region sequences beetles associated with a geographically well-delimited patch of forced us to design population-speci®c primers. The control region host plants 1Salix caprea and/or Salix aurita, and/or Corylus of all studied species includes an area of about 1500±2500 bp 1i.e., avellana for G. pallida, Sarothamnus scoparius for G. olivacea, and roughly 50% of the full control region) consisting of >10 imperfect, Salix spp.orBetula spp. for Chrysomela lapponica). tandemly arranged, copies of a >100-bp motif 1see Results). For two species, G. pallida and C. lapponica, the repeated elements were too similar in sequence for the design of speci®c sequencing DNA Sequencing primers.