Serrano et al. BMC Microbiology 2011, 11:82 http://www.biomedcentral.com/1471-2180/11/82 METHODOLOGYARTICLE Open Access Rapid identification of Aspergillus fumigatus within the section Fumigati Rita Serrano1,2, Leonor Gusmão1, António Amorim1,2 and Ricardo Araujo1* Abstract Background: New fungal species that are morphologically similar to Aspergillus fumigatus were recently described and included in section Fumigati. Misidentification of such fungal species, particularly of the human pathogens, Aspergillus lentulus, Neosartorya fischeri, Neosartorya hiratsukae, Neosartorya pseudofischeri and Neosartorya udagawae, has been increasingly reported by numerous clinical labs. Nevertheless, A. fumigatus still accounts for more than 90% of all invasive aspergillosis cases. The purpose of the present study was to develop a rapid method for the molecular identification of A. fumigatus to distinguish it from other species within the section Fumigati. Results: A multiplex PCR was developed using prior information based on b-tubulin (btub) and rodlet A (rodA) partial gene sequences. PCR amplification of btub and rodA fragments resulted in a distinctive electrophoretic pattern in A. fumigatus and N. udagawae. The polymorphisms found in the smallest amplified sequence of btub (153 bp) and rodA (103 bp) genes were then compared among and within species of this taxonomic section. btub was able to differentiate among 13 individual species and two groups of species that included the pathogenic fungus A. lentulus. A more limited number of sequences were available for rodA; nevertheless, we were able to distinguish Aspergillus viridinutans, N. hiratsukae and N. udagawae. Conclusions: The assay described in the present study proved to be specific and highly reproducible, representing a fast and economic way of targeting molecular identification of the relevant mould, A. fumigatus, in clinical laboratories. Keywords: Aspergillus azole resistance, electrophoretic profile, invasive aspergillosis, molecular identification, mould, multiplex PCR, rodlet A, β-tubulin Background Misidentification of fungal species within the section Aspergillosis is the most common invasive mould dis- Fumigati has been increasingly reported by clinical ease worldwide. Recently, molecular techniques have laboratories. Species, such as Aspergillus lentulus, Asper- been applied to fungal diagnosis and to the identifica- gillus viridinutans, Aspergillus fumigatiaffinis, Aspergillus tion of species, and new fungal species that are morpho- fumisynnematus, Neosartorya pseudofischeri, Neosartorya logically similar to A. fumigatus have been described, hiratsukae and Neosartorya udagawae,arefrequently authenticated and included in section Fumigati [1-3]. reported as A. fumigatus [1,2,5,6]. Some of these species Therefore, this section now includes a few anamorphous have been described as human pathogens, particularly A. Aspergillus species and teleomorphic species that are lentulus, A. viridinutans, N. pseudofischeri and N. udaga- found in the genus Neosartorya [4]. The characteristics wae, and some species have been reported to be resistant of the colonies on standard culture media are often in vitro to the azole antifungals itraconazole, miconazole, similar to A. fumigatus, but conidia may be rather dis- posaconazole, ravuconazole and/or voriconazole [7,8]. tinct. Neosartorya species produce heat-resistant ascos- Therefore, molecular identification is currently recom- pores [4]. mended for the correct identification of species within the “A. fumigatus complex” group. Sequencing of genes, * Correspondence: [email protected] such as actin, calmodulin, ITS, rodlet A (rodA) and/or b- 1 IPATIMUP, Institute of Molecular Pathology and Immunology of the tubulin (btub), has been used to distinguish A. fumigatus University of Porto, Rua Dr. Roberto Frias s/n, 4200-465 Porto, Portugal Full list of author information is available at the end of the article from related species [4,9]. Multilocus sequence typing © 2011 Serrano et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Serrano et al. BMC Microbiology 2011, 11:82 Page 2 of 7 http://www.biomedcentral.com/1471-2180/11/82 can alternatively be used for the identification of those work at high temperatures (Figure 1), whereas the related species, which is a strategy that also involves amplification of some regions (e.g., the rodA region of sequencing of several gene fragments [5]. A few other 313 bp) could only be observed in non-fumigatus spe- techniques, such as random amplified polymorphic DNA cies at 60°C. A region of the btub gene of 198 bp was [10,11], restriction fragment length polymorphisms [12] observed only in A. fumigatus even when low amplifica- and a new proposed microsphere-based Luminex assay tion temperatures were tested. The electrophoretic pro- [13], may enable molecular identification of A. fumigatus file obtained for each fungal species was very clear, without sequencing. However, these methodologies are revealing few secondary and/or minor bands as a conse- quite time consuming and labour demanding and are quence of primer combinations in the multiplex PCR thus impractical in most clinical labs. In addition, they (four nonspecific bands in the case of A. fumigatus and can be very expensive when employed to study collec- occasionally two bands in the case of non-fumigatus tions of large numbers of isolates. species). Those secondary bands did not reduce the per- Thus, a rapid, practical and cheap alternative method formance of the multiplex PCR, as shown in Figure 1. for the molecular identification of A. fumigatus and the distinction of the species within the section Fumigati is Rapid identification of Aspergillus fumigatus required. In this study, a multiplex PCR was developed Multiplex PCR was successfully conducted in all fungal using prior information based on btub and rodA partial strains included in the study. The specificity of the pri- gene sequences. We propose a single PCR to target the mers at 69°C was confirmed by the results obtained with molecular recognition of the A. fumigatus fungus, avoid- singleplex PCR and amplification of each gene fragment ing the use of restriction enzymes. Additional sequen- in A. fumigatus: partial sequences of 153 and 198 bp for cing of fragments of btub and rodA allowed the btub, and 105 and 313 bp for rodA. The electrophoretic identification of several A. fumigatus related species. profile with four bands (105, 153, 198 and 313 bp) was similar in all 35 tested strains of A. fumigatus.Non-fumi- Results gatus isolates of section Fumigati,specificallyA. fumiga- Multiplex optimization tiaffinis, A. lentulus, A. novofumigatus, A. unilateralis, N. The present strategy was proposed to simultaneously hiratsukae, and N. pseudofischeri, produced two discrete target btub and rodA gene fragments that are specific to bands (105 and 153 bp) corresponding to the conserved a single species (A. fumigatus) and other gene fragments region of the section Fumigati for which the primers that are common to a group of species (all species of were designed (as showed in Figure 1). Neosartorya uda- section Fumigati). A similar strategy was attempted with gawae wasanexceptionandformedathirdband(with calmodulin sequences from species within the section 313 bp) in a location that was similar to the amplification Fumigati, but we could not obtain primers that were of A. fumigatus. Amplicon sizes were confirmed using specific for A. fumigatus (data not shown). Thus, pairs automated electrophoresis with the primers stained with of primers were selected based on the information on 6-FAM. Therefore, the present multiplex PCR targeting polymorphic and conserved regions of btub and rodA btub and rodA gene fragments resulted in a distinct band genes among fungal species, as shown in Table 1 (for pattern in A. fumigatus compared to the band pattern primer design criteria see the Methods section). As pri- obtained for the other species of section Fumigati.In mer specificity could be improved by increasing the addition, a clear differentiation of N. udagawae was also amplification temperature, a range from 60°C to 72°C observed. The electrophoretic profile of the Aspergillus was tested with our multiplex; highly specific primers species of other taxonomic sections was distinct from the Table 1 Forward (F) and reverse (R) PCR primers employed for molecular identification of all Aspergillus species of section Fumigati and for Aspergillus fumigatus Primers (5’-3’) Fragment length Aspergillus section Fumigati b-tubulin F AGGCAGACCATCTCTGGTGAG 153 bp R TCGGAGGAGCCATTGTAGC Rodlet A F CCAGGCTCAGCTCTCTTGCT 105 bp R CCACCACCGATGAGGTTCTT A. fumigatus b-tubulin F TGACGGGTGATTGGGATCTC 198 bp R CGTCCGCTTCTTCCTTGTTT Rodlet A F ACATTGACGAGGGCATCCTT 313 bp R ATGAGGGAACCGCTCTGATG Serrano et al. BMC Microbiology 2011, 11:82 Page 3 of 7 http://www.biomedcentral.com/1471-2180/11/82 Ladder F1 F2 F3 F4 F5 F6 F7 AF1 AF2 AF3 100 bp 105 bp 153 bp 200 bp 198 bp 300 bp 313 bp 400 bp 600 bp Figure 1 Electrophoretic profile of several species of section Fumigati.F1-Aspergillus fumigatiaffinis,F2-Aspergillus lentulus,F3-Aspergillus novofumigatus,F4-Aspergillus unilateralis,F5-Neosartorya hiratsukae,F6-Neosartorya pseudofischeri,F7-Neosartorya udagawae; AF1, AF2 and AF3 - Aspergillus