SUPPLEMENTAL MATERIAL FOR: Pax5 loss imposes a reversible differentiation block in B-progenitor acute lymphoblastic leukemia Grace J. Liu, Luisa Cimmino, Julian G. Jude, Yifang Hu, Matthew T. Witkowski, Mark D. McKenzie, Mutlu Kartal-Kaess, Sarah A. Best, Laura Tuohey, Yang Liao, Wei Shi, Charles G. Mullighan, Michael A. Farrar, Stephen L. Nutt, Gordon K. Smyth, Johannes Zuber, and Ross A. Dickins SUPPLEMENTAL FIGURE LEGENDS Figure S1. Restricted expression of Igh variable segments in STAT5-CA;Vav-tTA;TRE- GFP-shPax5 B-ALL. Expression (RNA-seq RPKM) of immunoglobulin heavy chain variable (Ighv) gene segments in leukemic cells sorted from untreated Rag1-/- mice (black) compared with normal pre-B cells (grey), showing dominant expression of Ighv2-5 in leukemia. Segments are arranged from 5’ to 3’. Mean ± SEM, n=3 mice for each group. Figure S2. Characterisation of the Pax5 restoration response of independent Stat5-CA; Vav-tTA; TRE-GFP-shPax5 leukemia A008. (A) Peripheral white blood cell (WBC) counts in Rag1–/– mice transplanted with leukemia cells from STAT5-CA;Vav-tTA;TRE-GFP-shPax5 mouse A008. Mean ± SEM, n=4 for each group prior to Dox treatment and following 14 days of Dox treatment as indicated. P < 0.0005, Student’s t test. (B) Flow cytometry of CD19 and IgM expression on mononuclear cells from the peripheral blood of a representative Rag1–/– mouse that was transplanted with leukemia A008 and subsequently Dox treated as indicated. (C) Flow cytometry of CD19 and IgD expression as shown in (B). (D) Leukemia burden (proportion of CD19+ cells in the blood) upon Dox treatment (mean ± SEM, n=4 mice). (E) Proportion of CD19+ cells co-expressing IgM upon Dox treatment (mean ± SEM, n=4 mice). (F) Proportion of IgM+ cells co-expressing IgD upon Dox treatment (mean ± SEM, n=4 mice). (G) Kaplan-Meier survival curve for Rag1–/– mice transplanted with the leukemia A008. Dox treatment of leukemic mice was initiated at day zero. n=3 untreated mice and 5 Dox treated mice, logrank test P < 0.005. (H) Immunophenotype of bone marrow (upper panels), lymph nodes (middle panels) and peripheral blood (lower panels) of representative Rag1–/– recipient mice when moribund following prolonged Dox treatment. Flow cytometry of CD45.1 and CD19 expression is shown on left, and IgM and IgD expression on CD45.1–CD19+ cells is shown on right. (I) Cell cycle 1 profiles of CD45.1–CD19+ leukemia cells freshly isolated from representative untreated and Dox-treated leukemic mice. Percentage of cells in G0/G1 and S/G2/M phases are indicated. (J) Proportion of CD45.1–CD19+ cells in S/G2/M phases in untreated and Dox-treated leukemic mice (mean ± SEM, n=3 mice). Bone marrow P = NS, Blood P < 0.05, Spleen P < 0.005, Lymph node P < 0.05. (K) Quantitative RT-PCR analysis of changes in Pax5, Myc and Rag1 expression in A008 leukemia cells harvested from a Dox-treated leukemic mouse. Results were normalized to housekeeping gene Gapdh and shown relative to levels in leukemia cells from an untreated mouse (mean ± SEM from 3 technical replicates). Figure S3. Moribund phenotype following long-term Dox treatment of mice transplanted with Stat5-CA; Vav-tTA; TRE-GFP-shPax5 leukemia A024. Immunophenotype of bone marrow (upper panels), blood (middle panels) and spleen (lower panels) of representative Rag1– /– mice bearing triple transgenic leukemia A024, which then became moribund following prolonged Dox treatment. Flow cytometry of CD45.1 (host cell marker) and CD19 expression is shown on left, and CD45.1 and Mac1 is shown on right. Figure S4. Gene expression changes upon Pax5 restoration specifically correlate with the large cycling to small resting pre-B transition. Gene set analysis barcode plots (left panels) comparing differential gene expression upon Pax5 restoration in STAT5-CA;Vav-tTA;TRE-GFP- shPax5 leukemia cells in vivo with sets of previously described genes that are induced (red bars) or repressed (blue bars) upon the transition from: (A) pre-BI to large pre-BII (pro-B to large cycling pre-B); (B) large pre-BII to small pre-BII (large cycling pre-B to small resting pre-B); (C) small resting pre-B to immature B; (D) immature to mature B (Hoffmann et al. 2002). Red/blue traces above/below the bars represent relative enrichment. Scatter plots (right panels) comparing the log2 fold changes upon Pax5 restoration with the log2 fold changes during consecutive stages of normal B lymphocyte development from (Hoffmann et al. 2002). Regression lines are shown in red. Figure S5. Coordinate upregulation of pre-BCR complex and signaling components following Pax5 restoration. (A) Schematic of the pre-BCR complex and associated signaling molecules. (B-D) Expression (RNA-seq RPKM) of Pax5 (B), selected pre-BCR complex components (C), and critical downstream pre-BCR signaling components (D) in B-ALL cells from untreated and Dox treated mice, compared with normal pre-B cells (mean ± SEM, n=3 mice for each group). (E) Expression (RNA-seq RPKM) of Stat5a and Stat5b as described above. 2 Figure S6. Pax5 restoration induces transcriptional changes associated with loss of Myc activity. Gene set analysis barcode plots comparing differential gene expression upon Pax5 restoration in STAT5-CA;Vav-tTA;TRE-GFP-shPax5 leukemia cells in vivo with sets of previously described genes that are induced (red bars) or repressed (blue bars) upon (A) activation of Myc (Zeller et al., 2003) or (B) or inactivation of Myc (Shachaf et al., 2004). Red/blue traces above/below the bar represent relative enrichment. Figure S7. Cell cycle analysis and additional control data for human B-ALL cell lines. (A) Representative cell cycle flow cytometry profiles of 697 cells, with BrdU and DAPI staining indicating the proportion of cells in S phase 3 days after PAX5-IRES-GFP induction relative to matched IRES-GFP control cells. Cells with less than 2N DNA content were excluded from analysis. (B) Quantitation of S phase cells (%) based on analysis shown in (A). For each cell line, the proportion GFP– (left) and GFP+ (right) cells (gated from within the same population) in S phase following Dox-mediated induction of PAX5-IRES-GFP (red) or control IRES-GFP (blue) is indicated. (C, D) Flow cytometric analysis of cell size/FSC (C) and cell surface markers (D) in GFP– (red line) and GFP+ (green line) cells in B-ALL cell lines showing no changes 3 days after Dox-dependent induction of the control IRES-GFP cassette. (E) Scatter plot of gene expression fold changes upon inducible PAX5 expression in the human B-ALL cell line REH versus Pax5 restoration in STAT5-CA;Vav-tTA;TRE-GFP-shPax5 leukemia A024. Dotted lines indicate 2- fold differential expression, and genes with > 2-fold upregulation in both experiments are shown in red. (F) Gene set analysis barcode plot. The RNA-seq differential gene expression dataset upon Pax5 restoration in STAT5-CA;Vav-tTA;TRE-GFP-shPax5 leukemia cells in vivo is shown as a horizontal bar as described in Figure 5F. Vertical lines indicate the expressed mouse homologs (106 genes) of genes upregulated > 2-fold upon inducible PAX5 expression in REH cells (203 genes). The curved line indicates relative enrichment. A significant positive correlation is observed with genes upregulated upon Pax5 restoration in mouse B-ALL (P < 0.0005, roast test). 3 SUPPLEMENTAL MATERIALS AND METHODS Transgenic mice TRE-GFP-shRNA transgenes were detected by PCR using forward primers specific for each shRNA (Pax5.437: TGTATTTGTCCGAATGATCCTGTTG; Ren.713: GTATAGATAAGCATTATAATTCC) and a common reverse primer (GAAAGAACAATCAAGGGTCC) yielding a 210 bp product. The Stat5b-CA transgene was detected using Stat5b-CA specific forward (TAGGAAGAAGCCTATATCCCAAAGG) and reverse (ACAGTCTCTCAAAGTCAGTGGGG) primers, yielding a 275 bp product. The CAGS-rtTA3 transgene was detected by CAGS specific forward (CTGCTGTCCATTCCTTATTC) and reverse (CGAAACTCTGGTTGACATG) primers, yielding a 200 bp product. The Vav-tTA transgene (Kim et al. 2007) was detected tTA specific forward (CCATACTCACTTTTGCCCTTTAG) and reverse (CAGCGCTGAGTGCATATAATGCA) primers, yielding a 221 bp product. All mice were on an inbred C57BL6/J background except for Vav-tTA mice, which were on an FVB/N background. Blood and flow cytometry analysis Antibodies recognising mouse CD19 (eBio1D3), IgM (II/41), IgD (11-26c) and CD93 (AA4.1) were from Affymetrix eBioscience (San Diego, CA). Anti-mouse CD25 (PC61), TCRβ (H57- 597) and Mac1 (M1/70) was from BD Pharmingen (San Jose, CA), while anti-cKit (2B8) was from BioLegend (San Diego, CA). Antibodies against mouse B220 (RA36B2), CD45.1 (A20.1), CD45.2 (S450) and cKit (ACK-4) were generated in-house. Cell preparations were co-stained with Fluoro-Gold to exclude dead cells (Sigma-Aldrich, St Louis, MO). qPCR Total RNA was extracted using RNAeasy Plus Mini Kit (QIAGEN, Valencia, CA) and cDNA was prepared using SuperScript III First-Strand Synthesis System (Life Technologies). qPCR was performed using SYBR Green-based detection in a LightCycler 480 (Roche) using the following primers: Pax5-F, 5'-CCACAGTCCTACCCTATTGTCA-3'; Pax5-R, 5'- GTAATAGTATGGGGAGCCAAGC-3'; Myc-F, 5'-AGAGCTCCTCGAGCTGTTTG -3'; Myc- R, 5'-AGGGCTGTACGGAGTCGTAG-3'; Rag1-F, 5'- CTGGGTTTACCATGAACTCAAA-3'; Rag1-R, 5'-GGTGCTAGGAGAAGACCTCACT-3'; Gapdh-F, 5'- ACCCAGAAGACTGTGGATGG-3'; Gapdh-R, 5'-CCCTGTTGCTGTAGCCGTAT-3'. 4 Human leukemia cell lines The human B-ALL cell lines BV173 (Pegoraro et al. 1983), NALM-6 (Hurwitz et al. 1979), REH (Rosenfeld et al. 1977), and 697 (Findley et al. 1982) were obtained from the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) and cultured as previously described (Drexler 2010). PAX5 copy number data for these cell lines was derived from our previous Affymetrix Mapping 250k SNP array data available in the NCBI Gene Expression Omnibus under GEO series accession number GSE9112 (Mullighan et al. 2008). The NALM-6 cell PAX5 promoter deletion coordinates are 37.025-37.067 Mb (build hg17).