Journal of Systematics and Evolution 48 (3): 183–194 (2010) doi: 10.1111/j.1759-6831.2010.00076.x Molecular studies resolve Nyholmiella (Orthotrichaceae) as a separate genus ∗ 1Jakub SAWICKI 2V´ıtezslavˇ PLA´ SEKˇ 1Monika SZCZECINSKA´ 1(Department of Botany and Nature Protection, University of Warmia and Mazury in Olsztyn, Plac Łodzki´ 1, 10-727 Olsztyn, Poland) 2(Department of Biology & Ecology, University of Ostrava, Chittussiho 10, CZ-710 00, Czech Republic) Abstract Two Orthotrichum species of the subgenus Orthophyllum were compared with other representatives of this genus using internally transcribed spacer regions 1 and 2, the chloroplast trnH–psbA region, and inter-simple sequence repeat (ISSR) and intron–exon splice conjunction (ISJ) markers. The ISSR and ISJ markers used revealed many bands and mutations specific only to O. gymnostomum and O. obtusifolium. Phylogenetic analysis clearly supported previous concepts postulating that species of the subgenus Orthophyllum should be recognized as the separate genus Nyholmiella. Key words molecular taxonomy, Nyholmiella, Orthotrichum, phylogeny. The genus Orthotrichum Hedw. is a widespread namely O. gymnostomum and O. obtusifolium, into the moss group that includes approximately 155 species subgenus Orthophyllum. Hagen (1908) went one step (Goffinet et al., 2007). Taxa belonging to this genus further, forming a separate genus for O. gymnostomum are found throughout the world, from the Arctic to the and O. obtusifolium, namely Stroemia Hag. These plants Antarctic, except in deserts and wet tropical forests. were distinguished by obtuse leaves with incurved or Species of the genus Orthotrichum grow on trees and plane leaf margins and incrassate leaf cells with a stout rocks to a height of approximately 5000 m above sea central papilla on each side. Because Stroemia was an level (Lewinsky, 1993). In the most recent revision, Or- illegitimate name, it was later replaced by Nyholmiella thotrichaceae was divided into Macromitrioideae, Zy- Holmen & Warncke (Damsholt et al., 1969). A later godontoideae, and Orthotrichoidae, and Orthotrichum revision of the genus Orthotrichum resulted in the in- was placed in the last group (Goffinet et al., 1998, 2004). clusion of O. gymnostomum and O. obtusifolium into The subdivision within this genus has been a matter of a Orthotrichum (Vitt, 1973), because the features noted continuing debate since the end of the 19th century. Cer- above were also observed in other representatives of this tain taxa have been alternately included in and excluded genus. The affiliation of these species with the genus from the genus Orthotrichum in an attempt to divide it Orthotrichum was tested by Lewinsky-Haapasaari and into lower taxonomic units, subgenera and sections. The Hedenas¨ (1998) using cladistic methods. However, anal- basis for the classification of the genus Orthotrichum ysis of selected morphological characters of the above from a historical perspective has been described in de- taxa in subgenus Orthophyllum did not confirm their tail elsewhere (Lewinsky, 1993; Lewinsky-Haapasaari distinctness sufficiently to place them into a separate & Hedenas,¨ 1998). genus. According to the latest revision, the genus Or- Molecular studies have shed new light on the as- thotrichum is divided into seven subgenera (Lewin- signment of species in the subgenus Orthophyllum to sky, 1993): Callistoma, Exiguifolium, Gymnoporus, Or- the genus Orthotrichum. Goffinet et al. (2004) ex- thotrichum, Phaneroporum, Pulchella, and Orthophyl- amined phylogenetic relationships within the family lum. The inclusion of Orthophyllum into the genus Or- Orthotrichaceae and noted that dissimilarity of O. ob- thotrichum is a matter of contention. The distinctness of tusifolium from other members of this genus, thus sug- species belonging to the subgenus Orthophyllum from gesting the need to exclude the subgenus Orthophyllum other taxa in the genus Orthotrichum was noted by De- from the genus Orthotrichum. Sawicki et al. (2009a) logne (1885), who was the first to place two species, arrived at a similar conclusion while analyzing inter- nal transcribed spacer (ITS) sequences in the genus Orthotrichum. Analysis of ITS sequences has revealed a closer re- Received: 9 November 2009 Accepted: 1 March 2010 ∗ lationship between Ulota crispa and other Orthotrichum Author for correspondence. E-mail: [email protected]; Tel.: 48-89-524-5190; Fax: 48-89-523-3546. species than between these species of the genera Ulota C 2010 Institute of Botany, Chinese Academy of Sciences 184 Journal of Systematics and Evolution Vol. 48 No. 3 2010 and Orthotrichum and O. gymnostomum and O. obtusi- 1 Material and Methods folium, which strongly supports the separation of taxa of the subgenus Orthophyllum from those of the genus 1.1 Material Orthotrichum. However, in both cases the analysis was Our analyses included 32 species representing three limited to single specimens of one (Goffinet et al., 2004) genera of the family Orthotrichaceae. The genus Or- or two (Sawicki et al., 2009a) representatives of the sub- thotrichum was represented by 28 species belonging to genus Orthophyllum. five subgenera. Two Zygodon species were used as out- Current morphological revisions of various moss group, based on previous analyses (Goffinet et al., 1998, taxa are often supported by molecular data (Virtanen, 2004; Sawicki et al., 2009a). 2003; Hyvonen¨ et al., 2004; Cano et al., 2005; Peder- The list of species used in the molecular analysis, sen & Hedenas,¨ 2005). Compared with morphological details regarding voucher data and GenBank accession data, DNA sequences are not affected by changes in numbers are given in Appendix 1. the environmental conditions under which the plants are grown. Hence, molecular data can be used as a 1.2 DNA extraction powerful tool to resolve taxonomic and systematic Total genomic DNA was extracted from herbarium problems. The aim of the present study was to de- material. A single stem was ground with silica beads termine, using molecular analysis with DNA mark- in a FastPrep tissue disruptor (MP Biomedicals, Solon, ers, whether representatives of the subgenus Orthophyl- OH, USA) for 20 s and subsequently treated using the lum should be excluded from the genus Orthotrichum DNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA) and whether the genus status of Nyholmiella should be according to the manufacturer’s instructions. Extracted resurrected. DNA samples were stored at −20◦C. The ITS region is commonly used in phylogenetic and population genetics studies on bryophytes (Shaw, 1.3 Amplification and sequencing of the ITS 2000; Vanderpoorten et al., 2003; Hedenas,¨ 2008; Hein- For amplification and sequencing of the ITS, we richs et al., 2009). In plants, the ITS region is grouped used the primers described by Fiedorow et al. (1998); into arrays consisting of hundreds to thousands of tan- Table 1). The ITS regions were amplified in a volume of dem repeats. This region includes two spacers, ITS1 and 25 μL containing 20 mmol/L (NH4)2SO4, 50 mmol/L ◦ ITS2, that separate the 18S, 5.8S and 26S genes of nu- Tris-HCl (pH 9.0 at 25 C), 1.5 mmol/L MgCl2,1μL clear ribosomes (Baldwin et al., 1995). The sequences bovine serum albumin (BSA), 200 μmol/L dNTPs of nuclear ribosomal DNA have been used successfully (dATP, dGTP, dCTP, and dTTP), 1.0 μmol/L of each in previous studies of Orthotrichum (Pla´sekˇ et al., 2009; primer, 1 unit Taq polymerase (Qiagen), and 1 mL DNA Sawicki et al., 2009a,b). solution. The reaction was processed at 94◦C for 1 min, The chloroplast trnH–psbA sequence, which is a candidate region for plant bar coding but is character- ized by relatively high variability (Erickson et al., 2008; Table 1 Sequences of internal transcribed spacer, trnH–psbA, intron– exon splice conjunction, and inter-simple sequence repeat primers used Newmaster et al., 2008), was also used in the present in the present study study. Primer Sequence (5–3) In addition, genome-scanning intron–exon splice ITS1-F CAAGGTTTCCGTAGGTGAAC junction (ISJ) and inter-simple sequence repeat (ISSR) ITS1-R CAAGAGCCAAGATATCCG markers were used. The ISSR markers have been widely ITS2-F CGGATATCTTGGCTCTTG ITS2-R CCGCTTAGTGATATGCTTA used in both taxonomic and population genetics studies psbA-F GTTATGCATGAACGTAATGCTC on bryophytes (Vanderpoorten et al., 2003; Gunnars- trnH-R CGCGCATGGTGGATTCACAAATC son et al., 2005). In contrast, the ISJ markers, which IS810 (GA)8T have been proven effective in studies of both bryophytes IS813 (CT)8T IS822 (TC)8A (Sawicki & Szczecinska,´ 2007; Baczkiewicz et al., IS825 (AT)8G 2008; Sawicki et al., 2008; Pla´sekˇ & Sawicki, 2010) and IS828 (TG)8A IS831 (ACC)6 higher plants (Szczecinska´ et al., 2006, 2009), have been IS843 CATGGTGTTGGTCATTGTTCCA used less frequently. The ISJ primers are partly comple- IS846 GGGT(GGGGT)2G mentary to the sequences on the exon-intron boundary ISJ 2 ACTTACCTGAGGCGCCAC ISJ 4 GTCGGCGGACAGGTAAGT and can therefore can the genome fragments containing ISJ 5 CAGGGTCCCACCTGCA functional genes, including those responsible for the ISJ 6 ACTTACCTGAGCCAGCGA phenotype. ITS, internal transcribed spacer; ISJ, intron–exon splice conjunction. C 2010 Institute of Botany, Chinese Academy of Sciences SAWICKI et al.: Molecular data support genus Nyholmiella 185 followed by 30 cycles at 94◦C for 1 min, 59◦C for 1 min, Table 2 Numbers of specific substitution, indels, and bands for each and 72◦C for 1.5 min, with a final extension at 72◦C group analyzed + for 5 min. Finally, 5 μL of the amplification products Taxa ITS1 ITS2 trnH–psbA ISSR ISJ was visualized on a 1.5% agarose gel with ethidium Zygodon 11s, 23i 22s, 33i 3s, 2i 21 Ulota 3i 1i – – bromide staining. Purified polymerase chain reaction Orthophyllum 13s, 24i 5s, 7i 1s 18 (PCR) products were sequenced in both directions us- Gymnoporus –– – – ing the ABI BigDye 3.1 Terminator Cycle Kit (Applied Phaneroporum –– – – Orthotrichum –1s– – Biosystems, Foster City, CA, USA) and then visualized Pulchella –– – – using an ABI Prism 3130 Automated DNA Sequencer s, substitutions; i, indels; –, no specific mutations or bands; ITS, inter- (Applied Biosystems).