Supplementary Table S1 Genes differently expressed between LNM35 and N15 UniGene ID Gene symbol Description Ratio Genes up-regulated in LNM35 Hs.535012 LOC441052 6.14 Hs.182885 SLC35B2 Solute carrier family 35, member B2 5.34 Hs.7100 T70922 3.69 Genes down-regulated in LNM35 Hs.530009 AGR2 Anteriogradient 2 homolog 0.16 Hs.213264 YARS Tyrosyl-tRNA synthetase 0.24 Hs.594137 EIF2S2 Eukaryotic translation initiation factor 2, subunit 2 beta 0.29 Supplementary Table S2 Proteins differently expressed in shCIM- vs. VC LNM35 No. Gene ID Gene symbol Description Ratio Genes up-regulated in shCIM-LNM35 1 gi|21361331 CPS1 carbamoyl-phosphate synthetase 1, mitochondrial 4.9 2 gi|54859722 NUP160 nucleoporin 160kDa 4.1 3 gi|21361657 PDIA3 protein disulfide isomerase family A 4.1 4 gi|47419916 WARS tryptophanyl-tRNA synthetase 3.9 5 gi|4506669 RPLP1 ribosomal protein P1 3.4 6 gi|115430223 LGALS3 galectin 3 3.4 7 gi|24234688 GRP75 heat shock 70kDa protein 9B precursor 3.2 8 gi|5453740 MRLC3 myosin regulatory light chain 3.1 9 gi|24307907 SERPINE2 plasminogen activator inhibitor type 1 3.1 10 gi|16579885 RPL4 ribosomal protein L4 3.0 11 gi|4506671 RPLP2 ribosomal protein P2 3.0 12 gi|67189747 RPL6 ribosomal protein L6 2.9 13 gi|13904870 RPS5 ribosomal protein S5 2.8 14 gi|77539758 HIST2H4B histone cluster 2, H4b 2.6 15 gi|4504517 HSPB1 heat shock 27kDa protein 1 2.6 16 gi|4809279 ANXA7 annexin VII 2.6 17 gi|4506633 RPL31 ribosomal protein L31 2.5 18 gi|5031973 PD1A6 protein disulfide isomerase-associated 6 2.5 19 gi|20127454 ATIC 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase 2.4 20 gi|109637763 CAST calpastatin 2.3 21 gi|55666442 DPP7 dipeptidyl-peptidase 7 2.3 22 gi|16117796 RPL36 ribosomal protein L36 2.3 23 gi|4506723 RPS3A ribosomal protein S3a 2.3 24 gi|112382250 SPTBN1 spectrin, beta, non-erythrocytic 1 isoform 1 2.2 25 gi|33946327 NUP214 nucleoporin 214kDa 2.2 26 gi|24497609 NUP62 nucleoporin 62kDa 2.1 27 gi|25777600 PSMD1 proteasome 26S non-ATPase subunit 1 2.1 Genes down-regulated in shCIM-LNM35 1 gi|4505789 SERPINB5 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5 0.5 2 gi|20127592 AKR1B10 aldo-keto reductase family 1, member B10 0.5 3 gi|4503529 EIF4A1 eukaryotic translation initiation factor 4A isoform 1 0.5 4 gi|5453543 AKR1C1 aldo-keto reductase family 1, member C1 0.4 5 gi|4506685 RPS13 ribosomal protein S13 0.4 6 gi|9845502 RPSA ribosomal protein SA 0.4 7 gi|14591909 RPL5 ribosomal protein L5 0.4 8 gi|74136883 HNRNPU heterogeneous nuclear ribonucleoprotein U isoform a 0.4 9 gi|116063573 FLNA filamin A 0.4 10 gi|32454741 SERPINH1 serine (or cysteine) proteinase inhibitor, clade H, member 1 precursor 0.4 11 gi|5803181 STIP1 stress-induced-phosphoprotein 1 (Hsp70/Hsp90-organizing protein) 0.4 12 gi|88900491 GANAB alpha glucosidase II alpha subunit isoform 3 0.4 13 gi|4885379 HISTH1 histone cluster 1, H1e 0.4 14 gi|12667788 MYH9 myosin, heavy polypeptide 9, non-muscle 0.4 15 gi|4506179 PSMA1 proteasome alpha 1 subunit isoform 2 0.4 16 gi|52632383 HNRNPL heterogeneous nuclear ribonucleoprotein L isoform a 0.4 17 gi|68160922 RPS14 ribosomal protein S14 0.4 18 gi|23110942 PSMA5 proteasome alpha 5 subunit 0.4 19 gi|4501885 ACTB beta actin 0.4 20 gi|4506649 RPL3 ribosomal protein L3 isoform a 0.4 21 gi|4557032 LDHB lactate dehydrogenase B 0.4 22 gi|22538465 PSMB3 proteasome beta 3 subunit 0.4 23 gi|5453842 PA2GA proliferation-associated 2G4 0.4 24 gi|4502101 ANXA1 annexin A1 0.4 25 gi|4503471 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 0.4 26 gi|194097371 BiP Immunoglobulin heavy chain-binding protein 0.4 27 gi|24234684 HSPA8 heat shock 70kDa protein 8 isoform 1 0.4 28 gi|117190254 HNRNPC heterogeneous nuclear ribonucleoprotein C isoform b 0.4 29 gi|5901912 CALM1 calmodulin 1 0.4 30 gi|5453541 AGR2 anterior gradient 2 homolog 0.4 31 gi|4506725 RPS4X ribosomal protein S4, X-linked X isoform 0.3 32 gi|4506691 RPS16 ribosomal protein S16 0.3 33 gi|105990514 FLNB filamin B 0.3 34 gi|4505595 SERPINB2 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2 0.3 35 gi|4503483 EEF2 eukaryotic translation elongation factor 2 0.3 36 gi|21361176 ALDH1A1 aldehyde dehydrogenase 1A1 0.3 37 gi|4507645 TPI1 triosephosphate isomerase 1 0.3 38 gi|20149594 HSP90AB1 heat shock 90kDa protein 1, beta 0.3 39 gi|4885375 HISTH1 histone cluster 1, H1c 0.3 40 Hs.531081 ALDOA Aldolase A 0.2 41 Hs.433732 ENO1 enolase 1 0.2 42 Hs.28491 LDHA lactate dehydrogenase A 0.2 43 Hs.531176 HNRPA1 heterogeneous nuclear ribonucleoprotein A1 isoform a 0.2 44 Hs.404321 ANXA3 annexin A3 0.2 45 Hs.497599 RPL13A ribosomal protein L13a 0.2 46 Hs.524430 ANXA2 annexin A2 isoform 1 0.2 47 Hs.172648 VIM vimentin 0.1 Supplementary Table S3 Gene Ontology (GO) terms significantly related to the acquisition of metastatic phenotype GO aspect GO term GO accession P Biological processes translation GO:0006412 <0.0001 cellular macromolecule metabolic process GO:0044260 0.0002 cellular macromolecule biosynthetic process GO:0034645 0.0002 cellular biosynthetic process GO:0044249 0.0074 unfolded protein response GO:0006986 0.0122 protein stimulus response GO:0051789 0.0122 glycolysis GO:0006096 0.0129 cellular protein metabolic process GO:0019538 0.0192 protein metabolic process GO:0006411 0.0228 glucose catabolic process GO:0006007 0.0297 primary metabolic process GO:0044238 0.0455 Molecular functions structural constituent of ribosome GO:0003735 0.0002 structural molecule activity GO:0005198 0.0002 Ca-dependent phospholipid binding GO:0005544 0.0140 phospholipase inhibitor activity GO:0004859 0.0324 lipase inhibitor activity GO:0055102 0.0324 enzyme inhibitor activity GO:0004857 0.0429 Cellular component cytoplasm GO:0005737 <0.0001 ribonucleoprotein complex GO:0030529 <0.0001 macromolecular complex GO:0032991 <0.0001 cytoplasmic part GO:0044444 0.0002 ribosome GO:0005840 0.0004 cytosol GO:0005829 0.0004 non-membrane-bounded organelle GO:0043228 0.0038 intracellular non-membrane-bounded organelle GO:0043232 0.0038 intracellular part GO:0044424 0.0074 organellar ribosome GO:0000313 0.0172 mitochondrial ribosome GO:0005761 0.0172 Supplementary Information Primer sequence for generation of a CIM cDNA probe by polymerase chain reaction a sense primer, 5'-TCTGCCCACAACTGGAGTTT an antisense primer, 5'-GGCCAACATATTCCCAAGGT Oligonucleotides sequence for generation of a CIM-specific shRNA expression vector si#5; sense 5'-GATCCCC(GTGCAAAGAATCAGATTCA)ttcaagaga(TGAATCTGATTCTTTGCAC)TTTTTG GAAA-3', anti-sense 3'-GGG(CACGTTTCTTAGTCTAAGT)aagttctct(ACTTAGACTAAGAAACGTG)AAAAACCTTT TCGA-5' si#6; sense 5'-GATCCCC(GGACAACCCACATATCCAA)ttcaagaga(TTGGATATGTGGGTTGTCC)TTTTTG GAAA-3' anti-sense 3'-GGG(CCTGTTGGGTGTATATGGTT)aagttctct(AACCTATACACCCAACAGG)AAAAACCTT TTCGA-5') Control; sense, 5’-GATCCCCTTTTTTTTGGAAA antisense, 5’-AGCTTTTCCAAAAAAAAGGG Oligonucleotides sequence for generation of a CIM expression vector CIMS; Sense 5'- AAACTGCAGGATGGAGGAAGGAGGCG CIMAS; anti-sense 5'- CGGGATCCGAGACACAGTGGGACAGAAA Two dimensional HPLC Instrument; DiNa Nano-flow LC system (KYA Technologies, Tokyo, Japan) Column; HiQ Sil SCX, 0.5 mm inside diameter (i.d.) x 35 mm (KYA Technologies) HiQ Sil C18-3 reverse-phase (RP) trap, 0.8 mm i.d. x 3 mm (KYA Technologies) HiQ Sil C18-3 Gradient RP analytical column, 0.15 mm i.d. x 50 mm (KYA Technologies) Elution buffer for a SCX column; 10, 30, 50, 80, 100, 150, 200, 300, and 500 mM of ammonium-formate in pH 3.0, containing 2 % acetonitrile) Condition for RP column; 0 to 50% solvent B in solvent A over 125 minutes (solvent A: 0.1 % formic acid (FA), 2% acetonitrile; solvent D: 0.1% FA, 70% acetonitrile) and 50-100% solvent B for 10 minutes at a flow rate 200 nl/minute Mass spectrometry analysis Instrument; Q-STAR XL mass spectrometer (Applied Biosystems Inc.) Analytical mode; Information-Dependent Acquisition (IDA) mode with the scan cycles set to perform a 1-second MS Scan followed by 3 MS/MS scans for 2 seconds each. The acquisition method; 1 repetition at any m/z followed by a dynamic exclusion for a period of 60 seconds Data acquisition and analysis software; Analyst 1.1, ProQUANT 1.1 and ProGroup (Applied Biosystems Inc.) Search parameters; tolerance 0.3 Da for the MS and 0.15 Da for the MS/MS Supplementary Figure legends Supplementary Fig. S1. Detection of CIM transcripts by Northern blot analysis in NCI-H460-LNM35 and -N15 clones knocked down for CIM. Supplementary Fig. S2. Detection of CIM transcripts by Northern blot analysis in various adult tissues. MTNTM blots containing 2 µg each of poly(A)+ RNA (Clontech) were used for the analysis of CIM expression. Significant abundant expressions of CIM transcripts 2.5 kb in size were present in testis, skeletal muscle, pancreas, and prostate tissues. CIM splice variant transcripts 2.0 kb in size are also abundantly observed in pancreas and testis. Supplementary Fig. S3. Significant up-regulation of CIM in the highly metastatic LNM35 subline as well as primary lung cancers. (A) Significantly more abundant CIM expression was found in highly metastatic LNM35 in comparison with that in its representative parental clone, N15. (B) Increased expression of CIM analyzed by northern blot in primary lung cancers in vivo. NL, normal lung; SCLC, small cell lung cancer; AD, adenocarcinomas; SQ, squamous cell carcinoma; LA, large cell carcinoma. (C) Increased expression of CIM analyzed by microarray in primary lung cancers in vivo.