Structure Article RecA-Binding pilE G4 Sequence Essential for Pilin Antigenic Variation Forms Monomeric and 50 End-Stacked Dimeric Parallel G-Quadruplexes Vitaly Kuryavyi,1,* Laty A. Cahoon,2 H. Steven Seifert,2 and Dinshaw J. Patel1,* 1Structural Biology Program, Memorial Sloan-Kettering Cancer Center, New York, NY, 10065, USA 2Department of Microbiology-Immunology, Northwestern University Feinberg School of Medicine, Chicago, IL 60611, USA *Correspondence: [email protected] (V.K.), [email protected] (D.J.P.) http://dx.doi.org/10.1016/j.str.2012.09.013 SUMMARY varies at a high frequency by a gene conversion process (Criss et al., 2005). Pilin antigenic variation results from nonreciprocal Neisseria gonorrhoeae is an obligate human DNA recombination between one of many silent pilin loci termed pathogen that can escape immune surveillance pilS and the pilin expression locus, pilE (Hagblom et al., 1985). through antigenic variation of surface structures Genetic, pharmacological, and biophysical experiments show that pilin antigenic variation requires a cis-acting DNA element such as pili. A G-quadruplex-forming (G4) se- 0 0 situated upstream of pilE with the sequence 5 -G3TG3TTG3TG3 quence (5 -G3TG3TTG3TG3) located upstream of the N. gonorrhoeae pilin expression locus (pilE)is that forms a G-quadruplex structure in the bacterial cell and in- vitro (Cahoon and Seifert, 2009). necessary for initiation of pilin antigenic variation, G-quadruplexes are four-stranded structures formed by a recombination-based, high-frequency, diversity- G-rich sequences through formation of stacked G,G,G,G generation system. We have determined NMR-based tetrads (G-tetrads) in monovalent cation-containing solutions structures of the all parallel-stranded monomeric (Burge et al., 2006; Neidle, 2009; Patel et al., 2007). The length 0 and 5 end-stacked dimeric pilE G-quadruplexes in and number of individual G-tracts and the length and sequence monovalent cation-containing solutions. We demon- context of linker residues define the diverse topologies adopted strate that the three-layered all parallel-stranded by G-quadruplexes. Bearing homology rather than complemen- monomeric pilE G-quadruplex containing single- tarity of four interacting bases, and thus devoid of coding func- residue double-chain reversal loops, which can be tions, G-quadruplexes have long been considered as genomic modeled without steric clashes into the 3 nt DNA- outliers (Davis, 2004). However, recently, G-quadruplexes have binding site of RecA, binds and promotes E. coli drawn significant interest because of an ever-expanding reper- toire of experiments indicative of their potential biological RecA-mediated strand exchange in vitro. We discuss roles impacting oncogenic promoter regions (Balasubramanian how interactions between RecA and monomeric pilE et al., 2011; Qin and Hurley, 2008), telomeric DNA (Paeschke G-quadruplex could facilitate the specialized recom- et al., 2005; Smith et al., 2011), regions of genomic instability bination reactions leading to pilin diversification. (Ribeyre et al., 2009), and the discovery of enzymes acting on G-quadruplex topology (Huber et al., 2002; Wu et al., 2008; reviewed in Lipps and Rhodes, 2009; Maizels, 2006; Sissi INTRODUCTION et al., 2011). It was also earlier hypothesized that intermolecular parallel-stranded G-quadruplexes may be involved in the align- DNA recombination is common to all organisms and is utilized to ment and recombination of sister chromatids during meiosis repair DNA and generate genetic diversity. In normal cells, most (Liu and Gilbert, 1994; Sen and Gilbert, 1988). DNA recombination reactions occur at low frequency, but in We have recently initiated a systematic analysis of possible many genetic diversity-generating systems, such as immunoglo- molecular mechanisms of normal and pathogenic genome rear- bin class switching, yeast mating-type switching, or pathogen- rangements based on various G-quadruplexes as alternative esis-associated antigenic variation, programmed recombination precursor structures for recombination or gene conversion. reactions occur at a relatively high frequency (Criss et al., 2005; Thus, we have identified a structural motif that exhibits similarity Haber, 1998; Maizels, 2006). DNA recombination is generally between the human intronic G-quadruplex and the active site of beneficial to the organism but can also be detrimental; such is group I intron (Kuryavyi and Patel, 2010), as well as invoked the case for chromosomal translocations, which are the molec- parallel-stranded crossing-over mediated by a novel dimeric ular signature for many types of cancer (Zhang et al., 2010). G-quadruplex formed by the c-kit2 intergenic region (Kuryavyi The obligate human pathogen Neisseria gonorrhoeae is et al., 2010). a Gram-negative bacterium, which relies on type IV pili for twitch- Here, we present solution structures of monomeric and 50 end- ing motility, adherence to host cells, and natural DNA transfor- stacked dimeric G-quadruplexes formed by the N. gonorrhoeae 0 mation (Rudel et al., 1992; Sparling, 1966; Wolfgang et al., pilE G4 sequence (5 -G3TG3TTG3TG3) in monovalent cation 1998). Pili are mainly composed of pilin, which antigenically solution. We show that the pilE G-quadruplex binds to 2090 Structure 20, 2090–2102, December 5, 2012 ª2012 Elsevier Ltd All rights reserved Structure Structures of pilE Parallel G-Quadruplexes A Figure 1. pilE G4 DNA Oligomer Sequences Used in the Current Study, Their Imino GGGTGGGTTGGGTGGG NG16 NG19 TAGGGTGGGTTGGGTGGGG Proton NMR Spectra, and Their Mobilities GGGTGGGTTGGGTGGGG NG17 GGGTGGGTTGGGTGGG NG22 TA GAAT in Native PAGE GGGTGGGTTGGGTGGGGAAT NG20 AGAATAGGGTGGGTTGGGTGGGGAATTTT NG29 (A) pilE G4 DNA oligomers starting with 50G (NG16, NG17, and NG20) (left) and those containing a 50-prefix (NG19, NG22, NG29) (right). The core B NG16 NG19 C segment is highlighted in bold lettering. (B) Imino proton NMR spectra of aforementioned- 93del h-telo NG16 NG17 NG20 NG19 NG22 NG29 listed DNA oligomers in 100 mM KCl, 5 mM K-phosphate buffer (pH 6.8) at 25C. (C) Electrophoretic mobilities of dimeric NG16, NG17 NG22 NG17, and NG20 and monomeric NG19, NG22, and NG29 pilE G4 sequences are compared with } dimeric 93 del (93del) (Phan et al., 2005b) and Dimers monomeric human telomere (h-telo) (Phan et al., 2007b) G-quadruplex markers in 25% acrylamide } gel with 25 mM KCl at 4C. NG20 NG29 Monomers 0 11.5 11 10.5 1 12 11.5 11 10.5 NG20 all begin with the 5 -G residue of H ppm 0 5 -G3TG3TTG3TG3), whereas the remain- ing sequences tested have extra bases Escherichia coli RecA. RecA binds to the pilE G4 with affinity at their 50 end (50-TA in NG19 and NG22, and 50-AGAATA in similar to single-stranded DNA (ssDNA) but does not bind other NG29) (Figure 1A). Contrary to the profound impact of residues G-quadruplex structures. We also show that the pilE G-quadru- at the 50 end, addition of residues at the 30 end has no impact plex can promote E. coli RecA-mediated strand exchange. In on either of the two distinct guanine imino proton spectral addition, we hypothesize how interactions between RecA and patterns (Figure 1B). monomeric pilE G-quadruplex could facilitate the specialized We have monitored the native gel electrophoresis migration recombination reactions leading to pilin diversification. patterns of various pilE G4-containing DNA oligomers (NG16– NG29) so as to elucidate the oligomeric state of these sequences RESULTS that exhibit the two distinct guanine imino proton spectral patterns (Figure 1B). The DNA oligomers that begin with a 50-G Impact of the 50-Prefix Sequence on G-Quadruplex residue (NG16, NG17, and NG20) and exhibited a narrower imino Formation proton spectral pattern (Figure 1B, left panel) migrated as dimers The N. gonorrhoeae pilE G4 sequence is essential for pilin anti- in both K+ (Figure 1C) and Na+ (data not shown) cation-contain- genic variation and is located upstream of pilE in the gonococcal ing solution, whereas those that had extra bases at the 50 end genome (Cahoon and Seifert, 2009). The pilE G4 16-mer (NG19, NG22, and NG29) exhibited a more dispersed imino 0 sequence (5 -G3TG3TTG3TG3) exhibits perfect mirror symmetry proton spectral pattern (Figure 1B, right panel) and migrated centered between two central T residues (NG16, Figure 1A). predominantly as monomers (Figure 1C). Molecularity based One extra G nucleotide at the 30 end (NG17), as well as AT- on gel migration has its limitations because molecular shape, containing segments at one or both ends (NG19, NG20, NG22, net charge, and dangling ends can impact on mobility of and NG29), breaks this symmetry (Figure 1A). We have system- G-quadruplexes. The gel migration of dimeric NG29 G-quadru- atically recorded NMR spectra of sequences NG16–NG29 (Fig- plex is at the border of monomeric and dimeric G-quadruplexes, ure 1A) in monovalent cation solution so as to investigate the and this could reflect the contributions of 6 nt dangling 50 and 30 effect of flanking sequences on G-quadruplex formation by the ends on either side of the G-quadruplex fold for this sequence. 0 5 -G3TG3TTG3TG3 pilE G4 sequence. We observed two distinct imino proton spectral patterns as a function of flanking sequence Proton NMR Assignments of NG19 and NG22 pilE G4 between 10.5 and 12.0 ppm (Figure 1B), a region characteristic Sequences of guanine imino protons involved in G-tetrad formation. The numbering systems for the NG19 and NG22 sequences are 0 0 0 One spectral pattern, adopted by NG19, NG22, and NG29 as follows: 5 -T1AGGG5TGGGT10TGGGT15GGGG-3