PSG4 (NM 002780) Human 3' UTR Clone – SC209027 | Origene

PSG4 (NM 002780) Human 3' UTR Clone – SC209027 | Origene

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC209027 PSG4 (NM_002780) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: PSG4 (NM_002780) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: PSG4 Synonyms: PSBG-4; PSBG-9; PSG9 ACCN: NM_002780 Insert Size: 700 bp Insert Sequence: >SC209027 3’UTR clone of NM_002780 The sequence shown below is from the reference sequence of NM_002780. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC GTCAAAGTCTCTGACTGGATATTACCCTGAATTCTACTAGTTCCTCCAATTCCATTTTCTCCCATGGAA TCACGAAGAGCAAGACCCACTCTGTTCCAGAAGCCCTATAAGCTGGAGGTGGACAACTCGATGTAAATT TCATGGGAAAACCCTTGTACCTGACATGTGAGCCACTCAGAACTCACCAAAATGTTCGACACCATAACA ACAGCTACTCAAACTGTAAACCAGGATAACAAGTTGATGACTTCACACTGTGGACAGTTTTTCCAAAGA TGTCAGAACAAGACTCCCCATCATGATAAGGCTCCCACCCCTCTTAACCGTCCTTGCTCATGCCTGCCT CTTTCACTTGGCAGGATAATGCAGTCATTAGAATTTCACATGTAGTAGCTTCTGAGGGTAACAACAGAG TGTCAGATATGTCATCTCAACCTCAAACTTTTACGTAACATCTCAGGGGAAATGTGGCTCTCTCCATCT TGCATACAGGGCTCCCAATAGAAATGAACACAGAGATATTGCCTGTGTGTTTGCAGAGAAGATGGTTTC TATAAAGAGTAGGAAAGCTGAAATTATAGTAGAGTCTCCTTTAAATGCACATTGTGTGGATGGCTCTCA CCATTTCCTAAGAGATACAGTGTAAAACGTGACAGTAATACTGATTCTAGCAGAATAAAACATGTACCA CATTTGCTAA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG Restriction Sites: SgfI-MluI OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). RefSeq: NM_002780.5 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 PSG4 (NM_002780) Human 3' UTR Clone – SC209027 Summary: The protein encoded by this gene is a pregnancy-specific glycoprotein (PSG), one of several encoded by a cluster of similar genes on chromosome 19. This gene is a member of the carcinoembryonic antigen (CEA) gene family and may play a role in regulation of the innate immune system. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015] Locus ID: 5672 MW: 27 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    2 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us