Hepatocyte Small Heterodimer Partner Mediates Sex-Specific

H OH metabolites OH

Article Hepatocyte Small Heterodimer Partner Mediates Sex-Speciﬁc Effects on Triglyceride Metabolism via Androgen Receptor in Male Mice

Brian T. Palmisano 1,2,3,4,† , Lin Zhu 1,4,†, Bridget Litts 4, Andreanna Burman 2, Sophia Yu 1,4, Joshua C. Neuman 1,4, Uche Anozie 1,4, Thao N. Luu 4, Emery M. Edington 4 and John M. Stafford 1,2,4,*

1 Tennessee Valley Health System, Veterans Affairs, Nashville, TN 37212, USA; [email protected] (B.T.P.); [email protected] (L.Z.); [email protected] (S.Y.); [email protected] (J.C.N.); [email protected] (U.A.) 2 Department of Molecular Physiology & Biophysics, Vanderbilt University, 2201 W End Ave, Nashville, TN 37235, USA; [email protected] 3 Department of Internal Medicine, Stanford Healthcare, Stanford, CA 94304, USA 4 Department of Medicine, Division of Diabetes, Endocrinology and Metabolism, Vanderbilt University Medical Center, Nashville, TN 37232, USA; [email protected] (B.L.); [email protected] (T.N.L.); [email protected] (E.M.E.) * Correspondence: [email protected]; Tel.: +1-615-936-6113 † These authors contributed equally to this work.

Abstract: Mechanisms of sex differences in hypertriglyceridemia remain poorly understood. Small heterodimer partner (SHP) is a nuclear receptor that regulates bile acid, glucose, and lipid metabolism. Citation: Palmisano, B.T.; Zhu, L.; SHP also regulates transcriptional activity of sex hormone receptors and may mediate sex differences Litts, B.; Burman, A.; Yu, S.; Neuman, in triglyceride (TG) metabolism. Here, we test the hypothesis that hepatic SHP mediates sex differ- J.C.; Anozie, U.; Luu, T.N.; Edington, ences in TG metabolism using hepatocyte-specific SHP knockout mice. Plasma TGs in wild-type E.M.; Stafford, J.M. Hepatocyte Small males were higher than in wild-type females and hepatic deletion of SHP lowered plasma TGs in Heterodimer Partner Mediates males but not in females, suggesting hepatic SHP mediates plasma TG metabolism in a sex-specific Sex-Specific Effects on Triglyceride manner. Additionally, hepatic deletion of SHP failed to lower plasma TGs in gonadectomized male Metabolism via Androgen Receptor mice or in males with knockdown of the liver androgen receptor, suggesting hepatic SHP modifies in Male Mice. Metabolites 2021, 11, 330. plasma TG via an androgen receptor pathway. Furthermore, the TG lowering effect of hepatic dele- https://doi.org/10.3390/ metabo11050330 tion of SHP was caused by increased clearance of postprandial TG and accompanied with decreased plasma levels of ApoC1, an inhibitor of lipoprotein lipase activity. These data support a role for

Academic Editor: Wilfried Le Goff hepatic SHP in mediating sex-specific effects on plasma TG metabolism through androgen receptor signaling. Understanding how hepatic SHP regulates TG clearance may lead to novel approaches to Received: 28 April 2021 lower plasma TGs and mitigate cardiovascular disease risk. Accepted: 19 May 2021 Published: 20 May 2021 Keywords: sex differences; hypertriglyceridemia; small heterodimer partner; postprandial TG clearance; cardiovascular disease risk Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affil- iations. 1. Introduction Hypertriglyceridemia is associated with adverse cardiovascular outcomes in both men and women. Current therapies aimed at lowering triglycerides (TGs) have proved insufficient in improving cardiovascular disease outcomes [1–4]. Yet, from human genetic Copyright: © 2021 by the authors. studies, lifelong reductions in plasma TG levels protect against cardiovascular disease [5–8]. Licensee MDPI, Basel, Switzerland. Therefore, understanding pathways regulating plasma TG levels may yield novel targets This article is an open access article that protect against cardiovascular disease. distributed under the terms and Hypertriglyceridemia can arise from the overproduction of TGs in very-low den- conditions of the Creative Commons sity lipoprotein (VLDL) particles by the liver or from decreased clearance of circulating Attribution (CC BY) license (https:// TGs. Overproduction of TGs is a hallmark of insulin resistance, which independently creativecommons.org/licenses/by/ increases the risk of cardiovascular disease [9,10]. Some therapies aimed at reducing liver 4.0/).

Metabolites 2021, 11, 330. https://doi.org/10.3390/metabo11050330 https://www.mdpi.com/journal/metabolites Metabolites 2021, 11, 330 2 of 17

VLDL-TG production have been hampered by the development of fatty liver [11,12]. Im- paired TG clearance is associated with cardiovascular disease [13]. Non-fasting plasma TG levels have a stronger association with cardiovascular disease than fasting plasma TG levels, highlighting the importance of postprandial TG clearance in cardiovascular disease risk [14–18]. Therapeutic strategies promoting TG clearance may therefore prevent major adverse cardiovascular events. Several therapies targeting TG clearance are currently in clinical trials [19–21]. Understanding differences in lipid metabolism between males and females may reveal mechanisms by which women are protected from cardiovascular disease compared to men. It is well known that premenopausal women are protected from cardiovascular disease compared to age-matched men. Women have more favorable blood lipid profiles including lower triglycerides than men [22,23]. Women have both greater VLDL-TG production and plasma TG clearance than men [23–26], indicating that enhanced plasma TG clearance likely explains lower TG levels in women compared to men. Mechanisms mediating this sex difference in TG clearance remain incompletely understood. The nuclear receptor small heterodimer partner (SHP) may mediate sex differences in TG metabolism. SHP represses gene transcription by negative regulation of other nuclear receptors without direct binding to DNA [27,28]. SHP regulates target genes governing bile acid metabolism in the liver [29], as well as genes involved in glucose and lipid metabolism [30–33]. SHP negatively regulates both Androgen Receptor (AR) and Estrogen Receptor (ER) signaling [34,35], and thus, may mediate sex differences in TG metabolism. In addition to function in the liver, SHP has been shown to function in adipose, testes, and ovaries [32,36,37]. Global knockout models support a role for SHP in glucose and TG metabolism [30,31,36]. However, global SHP knockout alters body weight, adiposity, glucose tolerance, and hepatic steatosis, all of which confound triglyceride metabolism. Furthermore, Hepatic SHP knockout studies have focused predominantly on liver fibrosis [37,38], leaving the role of SHP in plasma TG metabolism unstudied. Since the liver is a major regulator of plasma TG metabolism both directly through TG production and indirectly via the production of secreted proteins that regulate peripheral TG clearance, we investigated the impact of hepatic deletion of SHP on plasma TG metabolism. In this study, we examined plasma TG metabolism in male and female mice with hepatic deletion of SHP (SHP∆hep) in comparison to their wild-type littermates. Here, we demonstrate that hepatic knockout of SHP enhances postprandial TG clearance through a pathway specific to males. Our data suggest that hepatic expression of SHP may mediate sex differences in TG metabolism.

2. Results 2.1. Effect of Hepatic SHP Deletion on Plasma Lipids To determine whether hepatic SHP impacts sex-specific regulation of TG metabolism, we measured TGs in male and female mice with and without hepatocyte-specific deletion of SHP. There was no difference in body weight between hepatic-SHP knockout mice (SHP∆hep) and their wild-type littermates (SHPfl/fl) (Figure1A). Body weight, plasma cholesterol, TGs, and insulin levels were lower in females than in males (Figure1A–D). Plasma cholesterol was not significantly reduced by hepatic SHP deletion in either sex (Figure1B,E,F). However, plasma TGs were 30% lower in male SHP ∆hep than in male SHPfl/fl mice (78 vs. 109 mg/dL, p < 0.01, Figure1C). The TG reduction by hepatic deletion of SHP in males was primarily within VLDL lipoproteins while the TG content of lipoproteins was similar between SHP∆hep and WT littermates in females (Figure1G,H). Hepatic deletion of SHP did not alter plasma insulin levels or lipoprotein cholesterols in either sex (Figure1D–F). These results demonstrate that hepatic deletion of SHP lowered TGs in males to a level similar in females, indicating that hepatic SHP may mediate sex differences in plasma TG metabolism. Metabolites 2021, 11, x FOR PEER REVIEW 3 of 16 Metabolites 2021, 11, 330 3 of 17

$$$ $$$ 40 $$$ D

A $$$ B150 C 250 1.5 ) l 200

30 d

)

l g

g **

)

l (

100 m 1.0

(

150 g

20 (

(

n d

l o

s 100

l s

50 T 0.5

o n

10 I h

C 50

0 0 0 0.0 fl/fl Δhep fl/fl Δhep fl/fl Δhep fl/fl Δhep fl/fl Δhep fl/fl Δhep fl/fl Δhep fl/fl Δhep Male Female Male Female Male Female Male Female E F G H 8 8 8

8 )

)

d l / VLDL fl/fl

d 7 7

g / fl/fl fl/fl ) HDL l

g fl/fl

)

m d

l Δhep (

Δhep 6 / 6

6 6 Δhep d

g /

( Δhep

r m

o HDL

5 5 (

r m

VLDL

(

G e

s 4 4 G

4 4 T

h o 3 e

3 a

C a LDL

LDL m

C LDL

l e

2 2 M 2 2 LDL

e a l VLDL

VLDL HDL F HDL a

1 m 1

e M 0 F 0 0 0 0 10 20 30 40 50 0 10 20 30 40 50 0 10 20 30 40 50 0 10 20 30 40 50 Fraction Fraction Fraction Fraction

Figure 1. Effect of hepatic deletion of SHP on plasma lipids. (A) Body weight of male and female SHPfl/fl and SHP∆hep Figure 1. Effect of hepatic deletion of SHP on plasma lipids. (A) Body weight of male and female SHPfl/fl and SHPΔhep littermates. (B–D) Plasma cholesterol (B), TG (C), and insulin (D) of ad lib fed SHPfl/fl and SHP∆hep males and females. fl/fl Δhep littermates.(E–H ()B FPLC–D) separationPlasma cholesterol of pooled plasma (B), lipoproteins.TG (C), and Cholesterol insulin ( contentD) of ad of lipoproteinslib fed SHP in male and (E )SHP and female males (F) SHP andfl/fl females. (E– fl/fl H) FPLCand separation SHP∆hep littermates. of pooled TG plasma content lipoproteins. of lipoproteins Cholesterol in male (G) and content female of (H lipoproteins) SHPfl/fl and SHPin male∆hep littermates. (E) and female Data (F) SHP Δhep fl/fl Δhep and SHPshown littermates. are mean ± TGSD, ncontent= 7–9/group, of lipoproteins ** p < 0.01 for in genotype male (G difference,) and female$$$ p (

) $ fl/fl fl/fl l ***

/ 2.5 l

s Δhep

s l uptakeo and genes possibly inﬂuencing TG clearance. Hepatic deletion of SHP increased Δhep l 3.0

250 e

v v

m ***

mRNA levels of liver lipid uptakee 2.0 receptors Vldlr, Scarb1, and Sdc1 similarly in both males

( l

l 2.5

* *

s 200 A * A andd females (Figure3C,D). The similar elevation of these genes in both males and females

i ** N N 2.0

c 1.5 *

R R

A ***

suggests 150 that these genes may not mediate the hypotriglyceridemic effect of hepatic SHP

l 1.5

i e

1.0 e

B v

deletion in males. Hepatic deletion of SHP did not signiﬁcantly changev liver mRNA levels

100 i

t t

a 1.0

e e

l l

ofm other lipid uptake receptors Ldlr, Lrp1, Lipc, Cd36, or Gpihbp1 in males (Figure3C). Hep-

e e

s 50 0.5

R R

a 0.5

aticl deletion of SHP had only modest effects on the expression of genes involved in VLDL P assembly0 in both males and females0.0 (Figure3E,F). Thus, hepatic deletion0.0 of SHP altered fl/fl Δhep fl/fl Δhep 1 1 1 5 8 1 1 1 5 8 a b b g g a b b g g 7 8 7 c c 7 8 7 c c liver mRNA levels of several genes involvedp p in TGp metabolismb b in males, butp thesep changesp b b Male Female y y y A A y y y A A were unlikely to explain the sex differencesC C in TGC levels. Therefore, liverC expressionC C of TG clearance receptors may not explain how hepatic deletion of SHP enhances TG clearance D 2.0 E in males. fl/fl 2.0 fl/fl

Δhep Δhep

e v

1.5 *** * v 1.5 *

l l

***

*** *** A

* A

N R

1.0 R 1.0

e l

l 0.5 0.5

R R

0.0 0.0 r r p r 1 γ α r p r1 rγ rα x h A r r r x h A s a a F s a a F S E p p S E p p P P P P

Metabolites 2021, 11, x FOR PEER REVIEW 3 of 16

$$$ $$$ 40 $$$ D

A $$$ B150 C 250 1.5 ) l 200

30 d

)

l g

g **

)

l (

100 m 1.0

(

150 g

20 (

(

n d

l o

s 100

l s

50 T 0.5

o n

10 I h

C 50

0 0 0 0.0 fl/fl Δhep fl/fl Δhep fl/fl Δhep fl/fl Δhep fl/fl Δhep fl/fl Δhep fl/fl Δhep fl/fl Δhep Male Female Male Female Male Female Male Female E F G H 8 8 8

8 )

)

d l / VLDL fl/fl

d 7 7

g / fl/fl fl/fl ) HDL l

g fl/fl

)

m d

l Δhep (

Δhep 6 / 6

6 6 Δhep d

g /

( Δhep

r m

o HDL

5 5 (

r m

VLDL

(

G e

s 4 4 G

4 4 T

h o 3 e

3 a

C a LDL

LDL m

C LDL

l e

2 2 M 2 2 LDL

e a l VLDL

VLDL HDL F HDL a

1 m 1

e M 0 F 0 0 0 0 10 20 30 40 50 0 10 20 30 40 50 0 10 20 30 40 50 0 10 20 30 40 50 Fraction Fraction Fraction Fraction

Figure 1. Effect of hepatic deletion of SHP on plasma lipids. (A) Body weight of male and female SHPfl/fl and SHPΔhep littermates. (B–D) Plasma cholesterol (B), TG (C), and insulin (D) of ad lib fed SHPfl/fl and SHPΔhep males and females. (E– H) FPLC separation of pooled plasma lipoproteins. Cholesterol content of lipoproteins in male (E) and female (F) SHPfl/fl and SHPΔhep littermates. TG content of lipoproteins in male (G) and female (H) SHPfl/fl and SHPΔhep littermates. Data shown are mean ± SD, n = 7–9/group, ** p < 0.01 for genotype difference, $$$ p < 0.001 for sex effect (2-way ANOVA with post-hoc comparisons).

2.2. Metabolic Changes after Hepatic Deletion of SHP Plasma bile acid levels were higher in females and were similar between SHPΔhep and WT controls in both sexes (Figure 2A). mRNA level of Shp was reduced more than 1000- fold in SHPΔhep mice in comparison to their WT littermates in both sexes along with the modification of mRNA levels of SHP target genes (Figure 2D,E). As expected from global

MetabolitesSHP knockout2021, 11, 330 models [39–42], hepatic deletion of SHP increased the expression of bile4 of 17 acid metabolic target genes, which was similar in both males and females (Figure 2B,C).

A 300 B * C 3.5

) $ fl/fl fl/fl l ***

/ 2.5 l

s Δhep

s l

o Δhep l 3.0

250 e

v v

m ***

e 2.0

( l

l 2.5

* *

s 200 A

* A d

i ** N N 2.0

c 1.5 *

R R

A ***

150

l 1.5

i e

1.0 e

100 i

t t

a 1.0

e e

s 50 0.5

R R

a 0.5

l P 0 0.0 0.0 fl/fl Δhep fl/fl Δhep 1 1 1 5 8 1 1 1 5 8 a b b g g a b b g g 7 8 7 c c 7 8 7 c c p p p b b p p p b b Male Female y y y A A y y y A A C C C C C C D E 2.0 fl/fl 2.0 fl/fl

Δhep Δhep

e v

1.5 *** * v 1.5 *

l l

***

*** *** A

* A

N R

1.0 R 1.0

e l

l 0.5 0.5

R R

0.0 0.0 r r p r 1 γ α r p r1 rγ rα x h A r r r x h A s a a F s a a F S E p p S E p p P P P P

Figure 2. Effect of hepatic deletion of SHP on bile acids. Ad lib chow fed male and female SHPﬂ/ﬂ and SHP∆hep littermates were used for the study. (A) Plasma bile acids. $ p < 0.05 for sex effect (2-way ANOVA). (B,C) Hepatic deletion of SHP increased liver expression bile acid metabolism genes similarly in males (B) and females (C). (D,E) Hepatic deletion of SHP reduced expression of Androgen receptor (Ar) and Pparγ in males (D), but not females (E). * p < 0.05, ** p < 0.01, *** p < 0.001 (t-test).

2.3. Effect of Gonadectomy on Hepatic SHP Regulation of Plasma TGs in Males and Females We next hypothesized that male gonadal hormones are involved in hepatic SHP mediated lowering of plasma TGs. To test whether gonadal hormones are required for sex differences in plasma TG metabolism regulated by hepatic SHP, plasma lipids and liver gene expression were measured in surgically gonadectomized males and ovariectomized females with and without hepatic deletion of SHP. Surgical gonadectomy increased the body weight more in female mice than in male mice and minimized the sex differences in body weight and plasma lipids (Figure4A–D). With surgical gonadectomy, hepatic deletion of SHP lowered plasma cholesterol similarly in both sexes (Figure4C). In contrast to males with intact gonads, hepatic deletion of SHP failed to lower plasma TGs in males lacking gonadal hormones (Figure4D vs. Figure1C). In females lacking gonadal hormones, deletion of hepatic SHP did not alter plasma TGs, which was similar to intact females (Figure4D vs. Figure1C). The plasma cholesterol-lowering effect of hepatic SHP deletion in mice lacking gonadal hormones was in HDL fractions in both sexes (Figure4E,F). In the absence of male sex hormones, hepatic deletion of SHP failed to lower VLDL-TG content as seen in intact males (Figure4G vs. Figure1G). In ovariectomized females, hepatic deletion of SHP did not signiﬁcantly decrease LDL-TG content (Figure4H). These data suggest that gonadal hormones are required for hepatic deletion of SHP to decrease plasma TGs and VLDL-TG content in males. Metabolites 2021, 11, x FOR PEER REVIEW 4 of 16

Figure 2. Effect of hepatic deletion of SHP on bile acids. Ad lib chow fed male and female SHPfl/fl and SHPΔhep littermates were used for the study. (A) Plasma bile acids. $ p < 0.05 for sex effect (2-way ANOVA). (B,C) Hepatic deletion of SHP increased liver expression bile acid metabolism genes similarly in males (B) and females (C). (D,E) Hepatic deletion of SHP reduced expression of Androgen receptor (Ar) and Pparγ in males (D), but not females (E). * p < 0.05, ** p < 0.01, *** p < 0.001 (t-test).

The liver TG content was higher in females than males and was lower in SHPΔhep than WT controls in both sexes (Figure 3A), which is in agreement with previous reports [31,36,40]. Liver cholesterol content was higher in females than males and was not different between SHPΔhep and SHPfl/fl mice in either sex (Figure 3B). We next investigated the effects of hepatic deletion of SHP on the expression of genes governing liver lipid uptake and genes possibly influencing TG clearance. Hepatic deletion of SHP increased mRNA levels of liver lipid uptake receptors Vldlr, Scarb1, and Sdc1 similarly in both males and females (Figure 3C,D). The similar elevation of these genes in both males and females suggests that these genes may not mediate the hypotriglyceridemic effect of hepatic SHP deletion in males. Hepatic deletion of SHP did not significantly change liver mRNA levels of other lipid uptake receptors Ldlr, Lrp1, Lipc, Cd36, or Gpihbp1 in males (Figure 3C). He- patic deletion of SHP had only modest effects on the expression of genes involved in VLDL assembly in both males and females (Figure 3E,F). Thus, hepatic deletion of SHP altered liver mRNA levels of several genes involved in TG metabolism in males, but these changes were unlikely to explain the sex differences in TG levels. Therefore, liver expres- Metabolites 2021, 11, 330 sion of TG clearance receptors may not explain how hepatic deletion of SHP enhances5 of 17 TG clearance in males.

$$$ Lipid Uptake Receptors A B $ C

8 1.5 2.5

) g

s * fl/fl Δhep

) e

# / 2.0

v g

6 g ***

(

l 1.0 A

g *

o r

m 1.5

(

4 R s

G #

o 1.0

v h

e 0.5

2 e

L e

e 0.5

R L 0 0.0 0.0 fl/fl Δhep fl/fl Δhep fl/fl Δhep fl/fl Δhep lr 1 lr 1 c 6 1 1 d rp ld rb ip 3 p c Male Female L L V a L d b d Male Female c C ih S S p G D E F

2.5 Lipid Uptake Receptors 2.0 VLDL Assembly 2.0 VLDL Assembly

s l

fl/fl Δhep l

l *** fl/fl Δhep fl/fl Δhep

e e

2.0 *** v v

v 1.5 1.5

e l

***

A N 1.5 N * *

N *

R R

R * * ** 1.0 1.0

1.0 e

e e

l 0.5 e

l 0.5

e e

e 0.5

R R 0.0 0.0 0.0 b p b 3 4 r r b p b 3 4 o tt h a a l 1 l 1 c 6 1 1 o tt h a a p 4 i i d rp ld rb ip 3 p c p 4 i i A M P d d L L V a L d b d M d d P P c C ih S A P P P S p G

Figure 3. Effect of hepatic deletion of SHP on liver lipid content and metabolism. Ad lib chow fed male and female SHPfl/fl Figure 3. Effect of hepatic deletion of SHP on liver lipid content and metabolism. Ad lib chow fed male and female SHPfl/fl and SHP∆hep littermates were used for the study (n = 7–9/group). (A,B) Liver TG (A) and cholesterol (B) contents. # p < 0.05 and SHPΔhep littermates were used for the study (n = 7–9/group). (A,B) Liver TG (A) and cholesterol (B) contents. # p < 0.05 for genotype effect. $ p < 0.05, $$$ p < 0.001 for sex effect (2-way ANOVA). (C,D) mRNA levels of liver lipid uptake receptors for genotype effect. $ p < 0.05, $$$ p < 0.001 for sex effect (2-way ANOVA). (C,D) mRNA levels of liver lipid uptake receptors in SHPfl/fl and SHP∆hep males (C) and females (D). (E,F) mRNA expression of VLDL production and assembly genes in in SHPfl/fl and SHPΔhep males (C) and females (D). (E,F) mRNA expression of VLDL production and assembly genes in males (E) and females (F). * p < 0.05, ** p < 0.01, *** p < 0.001, (t-test). males (E) and females (F). * p < 0.05, ** p < 0.01, *** p < 0.001, (t-test). 2.4. Hepatic Deletion of SHP Promotes TG Clearance in Hypertriglyceridemic Mice 2.3. EffectSince of Gonadectomy hepatic deletion on Hepatic of SHP SHP lowered Regulation plasma of TGs Plasma in males, TGs in but Males not females, and Females we measuredWe next both hypothesized TG production that and male clearance gonadal in hormones males to further are involved investigate in hepatic how hepatic SHP me- diatedSHP lowering regulates of plasma plasma TGs. TGs. TG To production test whether was measuredgonadal hormones in fasted mice are treatedrequired with for sex differencesa lipolytic in inhibitor, plasma TyloxapolTG metabolism (500 mg/kg), regulated and plasmaby hepatic TGs SHP, were measuredplasma lipids over time.and liver Plasma TG levels over time and TG production rate were similar in SHP∆hep relative to WT littermate controls (Figure5A). To examine plasma TG clearance, we monitored postprandial TG excursion after an oral fat administration to overnight fasting mice in a fat tolerance assay. We did not see significant increases in plasma TG clearance in SHP∆hep mice compared to SHPfl/fl littermates on chow diet (data not shown), which was likely due to the fast TG clearance rate in mice. We then used mouse models of hypertriglyceridemia to increase the power to detect a difference in TG clearance. First, mice were fed a high fructose diet by supplementing drinking water with 20% fructose for 10 weeks [43]. With fructose supplementation, both SHP∆hep and littermate control mice gained a similar amount of body weight (5.86 ± 3.85 vs. 6.43 ± 2.64 g, p = 0.75). Mice with hepatic SHP deletion had lower plasma TG excursion compared to WT littermate controls in the oral fat tolerance test (Figure5B). Plasma clearance of postprandial TG was increased in SHP∆hep males, as determined by a 24% decrease in area under the curve (p < 0.05, Figure5B). Second, SHP ∆hep mice were crossed with mice expressing the Cholesteryl Ester Transfer Protein (CETP) transgene, a genetic model of hypertriglyceridemia [44]. Similar to results in Figure4B, CETP +/SHP∆hep mice had lower postprandial TG excursion relative to CETP+/SHPfl/fl controls (Figure5C). This was consistent with increased plasma TG clearance, as shown by a nearly 30% decrease in area under the curve (p < 0.05, Figure5C). Thus, hepatic deletion of SHP lowers plasma TGs by enhancing plasma TG clearance in males via a male-specific pathway. Metabolites 2021, 11, x FOR PEER REVIEW 5 of 16

gene expression were measured in surgically gonadectomized males and ovariectomized females with and without hepatic deletion of SHP. Surgical gonadectomy increased the body weight more in female mice than in male mice and minimized the sex differences in body weight and plasma lipids (Figure 4A–D). With surgical gonadectomy, hepatic deletion of SHP lowered plasma cholesterol similarly in both sexes (Figure 4C). In contrast to males with intact gonads, hepatic deletion of SHP failed to lower plasma TGs in males lacking gonadal hormones (Figure 4D vs. Figure 1C). In females lacking gonadal hormones, deletion of hepatic SHP did not alter plasma TGs, which was similar to intact females (Figure 4D vs. Figure 1C). The plasma cholesterol-lowering effect of hepatic SHP deletion in mice lacking gonadal hormones was in HDL fractions in both sexes (Figure 4E–F). In the absence of male sex hormones, hepatic deletion of SHP failed to lower VLDL- TG content as seen in intact males (Figure 4G vs. Figure 1G). In ovariectomized females, hepatic deletion of SHP did not significantly decrease LDL-TG content (Figure 4H). These Metabolites 2021, 11, 330 data suggest that gonadal hormones are required for hepatic deletion of SHP6 to of 17decrease plasma TGs and VLDL-TG content in males.

$$$ $$$ A 40 $ B 6 C150 D 125 $$

## ) l 125 100

4 d /

30 )

g g )

# )

(

g 100

(

l g

W 2

20 y 75

(

d o

s 50

T l 0

B 50

o D

10 h 25 C 25 -2 0 0 0 fl/fl Δhep fl/fl Δhep fl/fl Δhep fl/fl Δhep fl/fl Δhep fl/fl Δhep fl/fl Δhep fl/fl Δhep GDX OVX GDX OVX GDX OVX GDX OVX Male Female Male Female Male Female Male Female MetabolitesE 2021, 11, x FOR PEER REVIEWF G H 3.0 6 of 16

5 ) 5 3.0

l HDL

)

d g

l OVX fl/fl

/ 2.5 OVX fl/fl 2.5 GDX fl/fl d

g VLDL

m /

4 4 ) l

( GDX fl/fl OVX Δhep

m d GDX Δhep l OVX Δhep

( HDL /

2.0

m l

g GDX Δhep r

2.0 (

o e

r to increase the power to detect a difference in TG clearance. First, mice were fed a high m

3 t 3 G

( VLDL

t 1.5

s -

l 1.5

fructose diet by supplementingG drinking water with 20% fructose for 10 weeks [43]. With e

LDL e

- h

o 2 2 LDL Δhep a LDL

e 1.0

h LDL l

fructoseC supplementation, both1.0 SHP and littermate control mice gained a similar m

- HDL

C e

e VLDL -

l HDL

F e

amounta of body weight (5.86 ± 3.85 vs. 6.43 ± 2.64 g, p = 0.75). Mice with hepatic SHP l 1 VLDL 1 0.5

a 0.5

m e M deletion had lower plasma TG excursion compared to WT littermate controls in the oral

F 0.0 0 fat tolerance0 test (Figure 5B). 0.0 Plasma clearance of postprandial TG was increased in 0 10 20 30 40 50 0 10 20 30 40 50 0 10 20 30 40 50 0 10 20 30 40 50 Δhep Fraction SHP males,Fraction as determined by a 24% decreaseFraction in area under the curveFraction (p < 0.05, Figure 5B). Second, SHPΔhep mice were crossed with mice expressing the Cholesteryl Ester Trans- Figure 4. Effect of gonadectomyfer Protein on hepatic (CETP) SHP transgene, regulation a of genetic plasma model lipids. of Two hypertriglyceridemia weeks prior to the study, [44]. male Similar and to re- Figure 4. Effectﬂ/ﬂ of gonadectomy∆hep on hepatic SHP regulation of plasma lipids. Two weeks prior to the study, male and female SHP and SHP littermates underwent surgical+ gonadectomyΔhep (GDX) or ovariectomy (OVX). (A,B) Body weight female SHPfl/fl and SHPΔhep littermatessults in underwentFigure 4B, CETP surgical/SHP gonadectomy mice had (GDX) lower or postprandial ovariectomy TG (OVX). excursion (A,B) relativeBody weight to (A) and body weight change (B) after+ surgery.fl/fl (C,D) Plasma cholesterol (C) and TG (D). (E,F) Pooled plasma was separated (A) and body weight change (BCETP) after/SHP surgery. controls (C,D) Pla (Figuresma cholesterol 5C). This was(C) and consistent TG (D). with (E,F )incre Pooledased plasma plasma was TG separated clear- into lipoproteins by FPLC. Cholesterolance, as shown content ofby lipoproteins a nearly 30% in GDX decrease male ( Ein) and area OVX under female the (F curve) mice. ( (pG ,

1500 A B C 2000 Cetp+ 2500 350 + * 2000 2.4. Hepatic Deletion500 of SHP Promotes TG* Clearance inCetp Hypertriglyceridemic Mice 1500 2000

1000

) 300

)

C Since hepatic deletion of SHP lowered plasma TGs in males, but not females, we

1500 U 1000

/ d

400 U

A / 1500 1000 g 250 g 500 500

measured bothg TG production and clearance in males to further investigate how hepatic

( m

m 500

( ( 0 200 300 fl/fl Δhep

SHP regulates plasma TGs. TG production wasG measured in fasted mice treated with a

0 G 0 G fl/fl Δhep fl/fl Δhep T

1000

150

lipolytic inhibitor, Tyloxapol (500 mg/kg), anda plasma TGs were measured over time. a

a 200 #

m m

s 100 Δhep

s a

s Plasma TG levels over time and TG production## rate were similar in SHP relative to WT

a a

500 l l 100 P

P 50 P littermatefl/fl controls (Figure 5A). To examine plasma TG clearance, we monitored postpran- Δhep fl/fl Δhep fl/fl Δhep dial TG excursion0 after an oral fat administration0 to overnight fasting mice in a fat toler- 0 0 2 4 6 8 0.0 0.5 1.0 1.5 2.0 0 2 4 6 8 Δhep ance assay. We did not see significant increases in plasmaTim TGe (h r)clearance in SHP mice Time (hrcompared) to SHPfl/fl littermatesTime (hr) on chow diet (data not shown), which was likely due to

Figure 5. Effect of hepaticthe deletion fast ofTG SHP clear on TGance kinetics. rate (inA) mice. Plasma We TG overthen time/TG used mouse production models rate (inset of panel)hypertriglyceridemia were Figure 5. Effect of hepatic deletion of SHP on TG kinetics. (A) Plasma TG over time/TG production rate (inset panel) were measured following i.v. injection of Tyloxapol (500 mg/kg) in 3 h fasted male SHPfl/fl and SHP∆hep littermates (2-way measured following i.v. injection of Tyloxapol (500 mg/kg) in 3 h fasted male SHPfl/fl and SHPΔhep littermates (2-way Re- Repeatedpeated Measures Measures ANOVA, ANOVA, nn == 7 7–10/group).–10/group). (B (B) )Mice Mice were were fed fed 20% 20% fructose fructose for for 10 weeks. Overnight fasted micemice ofof malemale fl/fl ∆hep SHPSHPfl/fl andand SHP Δhep littermateslittermates were were orally orally gavaged gavaged with with olive oil (200(200 µμL/mouse),L/mouse), po postprandialstprandial TG excursionexcursion overover 88 hh andand AUCAUC were were measured. measured. ( C(C)) SHP SHP∆Δhephep mice were crossed with mice expressing the transgene of Cholesteryl EsterEster TransferTransfer ProteinProtein (CETP)(CETP) toto generategenerate CETPCETP++/SHPfl/flfl/fl andand CETP CETP+/SHP+/SHPΔhep∆. hepOvernight. Overnight fasted fasted male male mice mice were were orally orally gavaged gavaged with witholive oliveoil (200 oil μ (200L/mouse)µL/mouse) and postprandial and postprandial TG excursion TG excursion were measured. were measured. Data shown Data shownare mean are ± mean SD (n± = SD6~8/group), (n = 6~8/group), # p < 0.05 #andp < ## 0.05 p < and 0.01 ## forp

2.5. Hepatic SHP Regulates Plasma TGs through Androgen Receptor To further elucidate the molecular mechanism for the male-specific pathway regulating the sex differences in plasma TG metabolism, we next examined whether liver Andro- gen Receptor (AR) signaling was required for hepatic SHP to alter plasma TGs in male mice. We hypothesized that hepatic SHP may regulate plasma TGs through liver AR signaling because the TG lowering effect of SHPΔhep was lost in gonadectomized male mice (Figure 4D vs. Figure 2E). To test this hypothesis, we knocked down AR using short hairpin RNA (shAR) delivered via liver trophic adeno-associated viral vector serotype 8 (AAV8, [45]). Two weeks after viral treatment, liver Ar mRNA was knocked down >80% (Figure 6A). Body weight and body weight change two weeks after viral injection were similar in SHPfl/fl/shAR and SHPΔhep/shAR mice (Figure 6B). With Ar knockdown, plasma cholesterol was modestly increased in SHPΔhep/shAR mice relative to SHPfl/fl/shAR mice (Figure 6C). Additionally, with Ar knockdown, hepatic deletion of SHP failed to decrease plasma TGs relative to controls; and in fact, plasma TGs were increased with Ar knockdown in SHPΔhep mice relative to controls (172 vs. 117 mg/dL, p < 0.01, Figure 6C). The changes in cholesterol and TGs were predominantly within VLDL fractions as measured by FPLC separation of lipoproteins (Figure 6D). Thus, liver AR signaling is required for hepatic deletion of SHP to lower plasma TGs and decrease VLDL-TG content in males.

Metabolites 2021, 11, 330 7 of 17

2.5. Hepatic SHP Regulates Plasma TGs through Androgen Receptor Metabolites 2021, 11, x FOR PEER REVIEW 7 of 16 To further elucidate the molecular mechanism for the male-specific pathway regulating the sex differences in plasma TG metabolism, we next examined whether liver Androgen Receptor (AR) signaling was required for hepatic SHP to alter plasma TGs in male mice. We hypothesized that hepatic SHP may regulate plasma TGs through liver ARNext, signaling we sought because to the determine TG lowering whether effect of SHPAR ∆washep was required lost in gonadectomizedfor the TG lowering male effect of hepaticmice (Figure deletion4D vs. of Figure SHP.2E). Ar To knockdown test this hypothesis, did not we impact knocked body down weight AR using (Figure short 6A,B); plasmahairpin TG RNA and (shAR)cholesterol delivered levels via liverwere trophic higher adeno-associated in SHPΔhep/shAR viral mice vector than serotype SHP 8fl/fl/shAR mice(AAV8, (Figure [45 ]).6C). Two Despite weeks afterAr knockdown, viral treatment, bile liver acidAr mRNA metabolic was knocked genes weredown >80%increased in SHP(FigureΔhep/shAR6A). Bodymice weight relative and to body SHP weightfl/fl/shAR change mice, two weekswhich after was viral similar injection to gonadally were sim- intact fl/fl ∆hep miceilar (Figure in SHP 6E /shARvs. Figure and SHP2B). Additionally,/shAR mice (Figureliver mRNA6B). With levelsAr knockdown, of TG uptake plasma receptors cholesterol was modestly increased in SHP∆hep/shAR mice relative to SHPfl/fl/shAR mice Δhep fl/fl were(Figure increased6C). Additionally, in SHP with/shARAr knockdown, mice relative hepatic to SHP deletion/shAR of SHP mice failed despite to decrease Ar knockdown,plasma whic TGsh was relative similar to controls; to changes and in fact,seen plasma in intact TGs males were increased (Figure with 6E Arvs.knockdown Figure 3C). Since thesein SHPmRNA∆hep mice expression relative to changes controls with (172 vs. hepatic 117 mg/dL, SHPp deletion< 0.01, Figure persist6C). The despite changes Ar knockdown,in cholesterol these target and genes TGs were are unlikely predominantly to mediate within the VLDL TG fractions lowering as measuredeffect of hepatic by FPLC deletion of SHseparationP in males. of lipoproteins (Figure6D). Thus, liver AR signaling is required for hepatic deletion of SHP to lower plasma TGs and decrease VLDL-TG content in males.

Figure 6. Effect of liver androgen receptor knockdown on hepatic SHP regulation of plasma lipids. Two weeks prior to the Figure 6.study, Effect SHP offl/fl liverand androgen SHP∆hep littermate receptor male knockdown mice were treatedon hepatic with 1.8E12GC SHP regulation of adeno-associated of plasma virus lipids. serotype Two 8 weeks (AAV8) prior to the study,containing SHPfl/fl aand short-hairpin SHPΔhep RNAlittermate to knockdown male mice hepatocyte were treated Androgen with Receptor 1.8E12GC (shAR). of ( Aadeno) Liver-associated mRNA levels virus of Ar serotypein 8 (AAV8)SHP containingfl/fl/shAR a andshort SHP-hairpin∆hep/shAR RNA males. to knockdown Male C57Bl/6 hepatocyte mice treated Androgen with AAV8 Receptor containing (shAR). GFP were (A) usedLiver as mRNA controls. levels of Ar in SHP(B)fl/fl Endpoint/shAR and body SHP weightΔhep and/shAR body males. weight Male change C57Bl/6 two weeks mice after treated viral with treatment AAV8 in SHPcontainingfl/fl/shAR GFP and were SHP∆ hepused/shAR as controls. (B) Endpointmales. body (C) Plasma weight cholesterol and body and weight TG levels. change (D) Cholesterol two weeks and after TG content viral treatment of FPLC separated in SHP lipoproteinsfl/fl/shAR and of pooledSHPΔhep/shAR males. (plasma.C) Plasma (E) Liver cholesterol mRNA levels. and TG Data levels. shown ( areD) mean Cholesterol± SD (n =and 7~9/group), TG content * p < 0.05,of FPLC ** p < separated 0.01, and *** lipoproteinsp < 0.001 (t-test). of pooled plasma. (E) Liver mRNA levels. Data shown are mean ± SD (n = 7~9/group), * p < 0.05, ** p < 0.01, and *** p < 0.001 (t-test).

Metabolites 2021, 11, 330 8 of 17

Next, we sought to determine whether AR was required for the TG lowering effect of hepatic deletion of SHP. Ar knockdown did not impact body weight (Figure6A,B); plasma TG and cholesterol levels were higher in SHP∆hep/shAR mice than SHPfl/fl/shAR mice (Figure6C). Despite Ar knockdown, bile acid metabolic genes were increased in SHP∆hep/shAR mice relative to SHPfl/fl/shAR mice, which was similar to gonadally intact mice (Figure6E vs. Figure2B). Additionally, liver mRNA levels of TG uptake receptors were increased in SHP∆hep/shAR mice relative to SHPfl/fl/shAR mice despite Ar knockdown, which was similar to changes seen in intact males (Figure6E vs. Figure3C). Since these mRNA expression changes with hepatic SHP deletion persist despite Ar knockdown, these target genes are unlikely to mediate the TG lowering effect of hepatic deletion of SHP in males.

2.6. Hepatic SHP Regulates TG Clearance via ApoC1 and Involves Regulation by Liver AR We hypothesized that the hepatic deletion of SHP may enhance TG clearance through the regulation of genes involved in TG clearance. To further test this hypothesis, we measured plasma levels of apolipoproteins ApoC1, ApoC2, and ApoC3, which regulate peripheral lipase activity. Hepatic deletion of SHP decreased plasma ApoC1, but this effect was lost with gonadectomy (Figure7A,B). Additionally, in the presence of gonadal hormones while liver Ar was knocked down, hepatic SHP deletion failed to lower plasma ApoC1 (Figure7A,B). Hepatic deletion of SHP did not affect plasma levels of ApoC2 or ApoC3, other regulators for lipase activity (Figure7A–D). Plasma ApoE was only decreased by hepatic deletion of SHP in the absence of gonadal hormones, while plasma ApoA1 was not altered between experimental groups. To further understand why plasma ApoC1 was increased in gonadectomized mice and decreased in shAR mice, we measured mRNA levels of liver Ar. Liver Ar mRNA was decreased by hepatic deletion of SHP and increased by the removal of gonadal hormone in male mice, falling in the same pattern of changes for plasma ApoC1 (Figure7A,B,G). We next examined lipase activities and if they were impacted by the ApoC1 changes induced by hepatic SHP deletion. Plasma ApoC1 inhibits lipase activity and TG clearance [46,47]. The plasma from SHP∆hep mice did not significantly increase lipase activity relative to the plasma from SHPfl/fl littermate controls (Figure7H), which is in line with our observation that TG clearance was not different in mice fed a chow diet (data now shown). When hypertriglyceridemia was induced by a fructose administration, the decrease in plasma ApoC1 caused by hepatic deletion of SHP was associated with increased lipase activity and faster TG clearance in SHP∆hep mice than in SHPfl/fl mice (Figures5B and7I ). Gonadectomy was associated with a four-to-six-fold increase in plasma ApoC1 levels, which was associated with lower plasma lipase activity relative to intact mice (Figure7H) . After gonadectomy, hepatic deletion of SHP did not lower ApoC1 or impact lipase activity (Figure7A,B,H). Our results together indicate that hepatic deletion of SHP may enhance plasma TG clearance in males by suppressing ApoC1 and subsequently enhancing lipase activity. Metabolites 2021, 11, x FOR PEER REVIEW 8 of 16

ApoC1 was increased in gonadectomized mice and decreased in shAR mice, we measured mRNA levels of liver Ar. Liver Ar mRNA was decreased by hepatic deletion of SHP and Metabolites 2021, 11, 330 increased by the removal of gonadal hormone in male mice, falling in the same9of patte 17 rn of changes for plasma ApoC1 (Figure 7A,B,G).

A GDX shRNA B fl/fl Dhep fl/fl Dhep fl/fl Dhep fl/fl Δhep 8

s l

ApoC1 e $$$ $$$ v

e 6 L

ApoC2

1 C

o 4

ApoC3 p A

e v

ApoE i

t 2

l e

ApoA1 R 0 Ponceau S Intact GDX shRNA

C D E 2.0 1.5 1.5 fl/fl Δhep

s fl/fl Δhep l

fl/fl Δhep s

v v

e 1.5 e

e ##

1.0

2 1.0

o C

o p

1.0 p

e v

e 0.5

0.5 i

t a

0.5 l

e R

R 0.0 0.0 0.0 Intact GDX shRNA Intact GDX shRNA Intact GDX shRNA F G fl/fl Δhep H. Chow I. Fructose $$

1.5 $$ fl/fl 800 *

)

s fl/fl Δhep

4 l l

) 500 Δhep

)

n t

m 600

a L

400 m

(

U h 3 i

1.0

(

l r o

e 300 400

t e

A F

A a

(

e A

200 s

0.5 L

v 200

1 L

w h

m 100

i R

R 0 w 0.0 A 0 0 fl/fl Δhep Intact GDX shRNA Intact GDX Intact GDX shRNA

Figure 7. Effect of hepatic deletion of SHP on lipoprotein lipase activities. (A–F) Plasma ApoC1, ApoC2, ApoC3, ApoE, Figure 7. Effect of hepatic deletion of SHP on lipoprotein lipase activities. (A–F) Plasma ApoC1, ApoC2, ApoC3, ApoE, and ApoA1 levels were determined with immunoblotting and blot quantifications. (G) Liver mRNA levels of AR in intact and ApoA1 levels were determined with immunoblotting and blot quantifications. (G) Liver mRNA levels of AR in intact or GDX fl/fl and SHP∆hep mice. (H,I) Plasma from chow (H) and fructose (I) fed mice was used to evaluate lipoprotein or GDX fl/fl and SHPΔhep mice. (H,I) Plasma from chow (H) and fructose (I) fed mice was used to evaluate lipoprotein lipase activity. Data shown are mean ± SD (n = 6~8/group), # p < 0.05 and ## p < 0.01 for genotype effect, and $$ p < 0.01 lipase activity. Data shown are mean ± SD (n = 6~8/group), # p < 0.05 and ## p < 0.01 for genotype effect, and $$ p < 0.01 and and $$$ p < 0.001 for treatment effects (2-way ANOVA). * p < 0.05 (t-test). $$$ p < 0.001 for treatment effects (2-way ANOVA). * p < 0.05 (t-test). 3. Discussion WeHere, next we examined demonstrate lipase that liver activities SHP regulates and if they plasma were TGs impacted via a male-specific by the ApoC1 pathway. changes inducedPlasma TGsby hepatic were higher SHP deletion. in male mice Plasma than ApoC1 female inhibits mice, and lipase hepatic activity deletion andof TG SHP clearance [46,47]lowered. The plasma plasma TGs from and VLDL-TGSHPΔhep mice content did in not males significantly but not in females.increase Removallipase activity of male relative tosex the hormones plasma from abolished SHPfl/fl plasma littermate TGs loweringcontrols effect(Figure of 7 hepaticH), which SHP is deletion in line with in males. our obser- vationHepatic that deletion TG clearance of SHP altered was thenot expressiondifferent in of severalmice fed targets a chow of liver diet TG (data metabolism, now shown). Whenyet the hypertriglyceridemia changes were similar wasin males induced and females, by a fructose arguing administration, against their mechanistic the decrease in importance since the TG lowering was only seen in males. Hepatic deletion of SHP plasma ApoC1 caused by hepatic deletion of SHP was associated with increased lipase reduced plasma TGs by decreasing the lipase inhibitor ApoC1 in plasma and increasing Δhep fl/fl activitypostprandial and faster TG clearance, TG clearance which in was SHP associated mice with than decreased in SHPAr micemRNA (Figure levelss in 5B the and 7I). Gonadectomyliver. Furthermore, was Hepatic associated deletion with of a SHP four failed-to-six to-fold further increase decrease in ApoC1 plasma and ApoC1 lower levels, whichplasma was TGs associated when liver with AR waslower knocked plasma down. lipase Taken activity together, relative these to intact data indicate mice (Figure that 7H). Afterhepatic gonadectomy, SHP regulates hepatic plasma de TGsletion by modifying of SHP did plasma not lower ApoC1 ApoC1 activity or and impact postprandial lipase activity

Metabolites 2021, 11, x FOR PEER REVIEW 9 of 16

(Figure 7A,B,H). Our results together indicate that hepatic deletion of SHP may enhance plasma TG clearance in males by suppressing ApoC1 and subsequently enhancing lipase activity.

3. Discussion Here, we demonstrate that liver SHP regulates plasma TGs via a male-specific pathway. Plasma TGs were higher in male mice than female mice, and hepatic deletion of SHP lowered plasma TGs and VLDL-TG content in males but not in females. Removal of male sex hormones abolished plasma TGs lowering effect of hepatic SHP deletion in males. Hepatic deletion of SHP altered the expression of several targets of liver TG metabolism, yet the changes were similar in males and females, arguing against their mechanistic importance since the TG lowering was only seen in males. Hepatic deletion of SHP reduced plasma TGs by decreasing the lipase inhibitor ApoC1 in plasma and increasing postprandial TG clearance, which was associated with decreased Ar mRNA levels in the liver. Fur-

Metabolites 2021thermore,, 11, 330 Hepatic deletion of SHP failed to further decrease ApoC1 and lower plasma10 of 17 TGs when liver AR was knocked down. Taken together, these data indicate that hepatic SHP regulates plasma TGs by modifying plasma ApoC1 activity and postprandial TG clearance in maleTG clearancemice through in male micea pathway through aassociated pathway associated with liver with AR liver mRNA AR mRNA expression expression (Figure 8). (Figure8).

SHP△hep

shAR

mRNA of AR TG Clearance GDX

Promoting ApoC1 Lipase Inhibiting Indirect promoting Figure 8. Graphic Model. Hepatic deletion of SHP (SHP∆hep) leads to the downregulation of liver Δhep Figure 8. Graphicandrogen Model. receptor Hepatic (AR) deletion mRNA, of decreased SHP (SHP plasma) ApoC1 leads proteinto the downregulation levels, increased lipase of liver activity, androgen receptorand (AR) increased mRNA, triglyceride decreased (TG) plasma clearance. ApoC1 Reduction protein of liver levels, AR mRNA increased by shRNA lipase or activity, androgen and increased triglyceridelevels by gonadectomy (TG) clearance. (GDX) respectivelyReduction decreasesof liver AR or increases mRNA ApoC1 by shRNA protein or levels androgen and blunts levels by gonadectomythe effect (GDX) of hepatic respectively deletion of SHP decreases on blood or TG increases levels. ApoC1 protein levels and blunts the effect of hepatic deletion of SHP on blood TG levels. Our results suggest that a male-specific pathway contributes to sex differences in plasma TG metabolism. The elevated plasma TGs may contribute to an increased risk of car- Our resultsdiovascular suggest diseasethat a in male men vs.-specific women pathway [23–26]; however, contributes the mechanisms to sex differences for the increased in plasma TG metabolism.risk in males The are notelevated fully understood. plasma TGs While may estrogen contribute regulation to ofan lipid increased metabolism risk has of cardiovascular beendisease well studiedin men [48 vs.,49 ],women male sex [23 hormone-specific–26]; however, regulation the mechanisms of lipid metabolism for the needs increased risk in tomales be better are explored.not fully Testosteroneunderstood. has While been an estrogen attractive regulation explanation of for lipid the increased metab- cardiovascular risk and plasma TGs in men, although testosterone supplementation in olism has been healthywell studied men or testosterone[48,49], male replacement sex hormone in men-specific with hypogonadal regulation hypogonadism of lipid metab- has olism needs to shownbe better minimal explored. effects onTestostero plasma TGne levels has been [50–52 an]. In attractive the current explanation study using male for andthe increased cardiovascularfemale mice, risk we showand plasma that hepatic TGs SHP in men, may mediate although sex differencestestosterone in plasmasupplemen- TGs in tation in healthymales men but or not testosterone in females. Prior replacement studies may in have men missed with thehypogonadal sex specificity hypogonad- of the hepatic ism has shownSHP minimal pathway effects in plasma on lipidplasma metabolism TG levels since [50 only–52] male. In animals the current were used study [30,33 using,46,53] or there was little information available for females [31]. Although SHP may regulate the male and femaleexpression mice, we of estrogenshow that receptor hepatic and consequentlySHP may mediate modify plasma sex differences and liver TGs in [ 52plasma,54,55], TGs in males butwe not did notin females. find a significant Prior studies impact ofmay hepatic have SHP missed on TG the metabolism sex specificity in females of thatthe hepatic SHP pathwaywere fed a in chow plasma diet. Multiple lipid me female-specifictabolism since pathways only may male exist animalsto promote were TG delivery used [30,33,46,53] orinto there peripheral was little tissues information due to the evolutionaryavailable for pressure, females which [31] results. Although in low SHP plasma may TG levels in females [23–26]. Although it has been reported that estrogens may modify SHP regulate the expressionexpression of [54 ],estrogen we did not receptor observe significantand consequently differences modify in hepatic plasma SHP mRNA and levelsliver between wild type male and female mice (data not shown), indicating that the lower TG levels in females were independent of hepatic SHP. Additionally, ovariectomy in female mice did not unmask the effect of hepatic SHP on plasma TGs. Thus, hepatic SHP regulates plasma TGs in a male-specific pathway. Data presented here support a male-specific pathway that hepatic SHP regulates postprandial plasma TG clearance. Prior global SHP knockout models have shown an increase [31,56], a decrease [30,40], or no effect on plasma TGs [32,33,46,57], indicating that the model used for the study may be of particular importance. Additionally, SHP has been shown to have adipose-specific functions [32,36,37], suggesting that tissue-specific functions of SHP have disparate effects on TG metabolism. Using hepatic specific knockout Metabolites 2021, 11, 330 11 of 17

of SHP, our data implicates that hepatic SHP increases plasma TGs in males by impairing TG clearance without changing TG production. It does not seem that lipid catabolism contributes to the decreases in plasma TGs because the energy expenditure and RQ were similar between hepatic SHP knockout male mice and their wild-type male littermates when they were fed a high-fat diet in a separate study (unpublished data). We used chow- fed mice in the current study to avoid the confounding effects of insulin resistance and obesity on plasma TG clearance. We observed differences in plasma TGs in the ad lib fed, indicating that TG clearance during the postprandial state is regulated by hepatic SHP. This was also supported by the results that the decreased plasma TGs were contributed to decreases in VLDL-TG content in hepatic SHP knockout mice. TG clearance during fasting evaluated by fat tolerance test was not signiﬁcantly different in chow-fed mice (data not shown). However, hepatic SHP deletion signiﬁcantly promoted TG clearance during fasting when hypertriglyceridemia was induced either by fructose diet or in a genetic hypertriglyceridemic background (Figure5). Our data highlight the role of hepatic SHP in plasma TG metabolism and TG clearance. This work demonstrates a novel pathway contributing to elevated TGs in males, which is governed by hepatic SHP and requires liver AR signaling. We show that plasma TGs decreased by hepatic deletion of SHP was associated with a downregulation of liver Ar mRNA in male mice. The hypotriglyceridemic effect of hepatic SHP deletion was lost in GDX and shAR liver Ar knockdown mice, suggesting the male sex hormones and liver AR are involved in hepatic SHP regulation of plasma TG. Several liver apolipoproteins are known to regulate plasma TG clearance (reviewed [58]). Of these proteins, we show that ApoC1 may play a role in plasma TG clearance mediated by hepatic SHP in males. We observed that changes of plasma ApoC1 and lipase activities fell in the same pattern of changes of liver Ar mRNA levels in the current study. ApoC1 is a 57 AA protein and acts on lipoprotein receptors by inhibiting ApoE’s binding to suppress tissue lipid uptake [46,59]. With regard to lipid lipase activities for plasma TG clearance, ApoC1 inhibits the activities of multiple lipases including lipoprotein lipase, hepatic lipase, and phospholipase A2 [53,55,60]. Transgenic mice of ApoC1 have impaired plasma TG clearance and severe hypertriglyceridemia [57]. ApoC1 is highly expressed in the liver and a lesser degree in the adrenal glands [46]. We show that plasma ApoC1 levels are decreased by hepatic deletion of SHP, which was associated with a downregulation of liver AR mRNA. Using the mouse model with the liver Ar knockdown, we show that AR was required for liver SHP to regulate plasma ApoC1 levels. In the absence of male gonadal hormones by gonadectomy, hepatic SHP failed to regulate ApoC1 levels. Interestingly, gonadectomy increased ApoC1 levels, associated with compensatory upregulation of liver Ar mRNA. Data presented here highlight a novel pathway that may contribute to sex differences in TG metabolism and, potentially, risk of cardiovascular disease. Our study implicates hepatic SHP in sex differences in TG metabolism. Information on the regulatory mechanism for ApoC1 by androgen receptor is scarce in the literature but of great interest in future studies. Further understanding of this pathway may further elucidate mechanisms of sex differences in lipid metabolism and potentially cardiovascular disease risk. A better understanding of sex differences in lipid metabolism and cardiovascular disease risk may lead to additional therapies that mitigate cardiovascular disease in both men and women.

4. Materials and Methods 4.1. Animals, Genotyping, and Viral Knockdown All mouse experiments were approved by the Vanderbilt University Institutional Animal Care and Use Committee (The animal welfare assurance number is A-3227-01). Mice were housed in 12-h light/dark cycles in temperature and humidity-controlled fa- cilities with ad-libitum access to chow diet and water. Mice with homozygous ﬂoxed Shp allele were crossed with mice with Cre recombinase under control of the albumin promoter to generate hepatocyte-speciﬁc knockout of Shp (∆hep; SHP∆hep). These mice Metabolites 2021, 11, 330 12 of 17

were generously provided by Dr. David Moore at Baylor, were back-crossed on a C57BL/6J background, and have been previously described [44]. Floxed littermates lacking Cre were controls (fl/fl, SHPfl/fl) in all experiments. All strains were backcrossed at least 10 gen- erations onto the C57BL/6J background (Jax Stock No: 000664). Genotyping was done from tail DNA. Detection of the SHPflox allele was done using a multiplex reaction with primers SHP-F (GCCTTTAACTCAAGTACTAGGGAGGCAG), SHP-R1 (CTACCCAGAGC- GACATGGTGAGAC), and SHP-R2 (AGTTGTGTCTGGTTCCTGACCTTGG). Once the SHPflox allele was bred to homozygosity, only detection of Cre recombinase was done. Cre recombinase was detected using primers Cre-F (GAACCTGATGGACATGTTCAGG) and Cre-R (AGTGCGTTCGAACGCTAGAGCCTGT) in a multiplex reaction with control primers Myogenin-F (TTACGTCCATCGTGGACAGC) and Myogenin-R (TGGGCTGGGT- GTTAGCCTTA). Mice were 14 ± 2 weeks old to ensure complete sexual development. All animals were sacrificed between 8 and 11 a.m. to minimize circadian variation in gene expression. Androgen receptor knockdown was done using an adeno-associated virus, serotype 8 (AAV8) containing short-hairpin RNA (shRNA) specific to mouse androgen receptor under control of a U6 promoter with a GFP reporter under control of a CMV promoter (shADV-252885, Vector Biolabs, Philadelphia, PA, USA). AAV8 was chosen for its liver tropism [45]. 1.8E12 GC/mouse was injected intravenously under brief isoflurane anesthesia. We have previously shown that this dose of viral vector did not affect plasma TG metabolism [61].

4.2. Gonadectomy and Ovariectomy Surgery In males, midline scrotal excision was used to externalize testes, which were ligated with single interrupted 5-0 suture and excised. Skin was closed with 9 mm autoclips. In females, midline dorsal skin incision was made followed by two lateral incisions of the dorsal peritoneal wall to remove each ovary. Single simple interrupted stitches with 5-0 suture were used to close peritoneal incisions and 9 mm autoclips were used to close the dorsal skin incision. In all mice, prophylactic antibiotic was given once postoperatively (ceftriaxone, 15–25 mg/kg) and analgesic was given once preoperatively and every 24 h postoperatively for 2 days (ketoprofen, 5–10 mg/kg). Mice were housed individually for 3–4 days to allow sufﬁcient wound healing and then returned to original littermate housing. Mice were allowed to recover for 2 weeks prior to the study. Mice weighing less than 90% of their pre-surgical mass were euthanized and excluded.

4.3. Lipid and Lipoprotein Analysis Plasma TG and cholesterol were measured using colorimetric kits (Infinity, Ther- moFisher, Asheville, NC, USA). Lipoproteins were separated by fast-performance liquid chromatography (FPLC, Superose6 column, GE Healthcare, Fort Myers, FL, USA) from pooled plasma samples (150 µL total pooled plasma used). Liver TG content and liver cholesterol content were determined by the Vanderbilt Hormone Assay Core. Briefly, 50–100 mg liver was Folch extracted and separated by thin layer chromatography, which was then analyzed by gas chromatography with internal standards used to control for extraction efficiency.

4.4. In Vivo TG Production and Clearance TG production was measured in 3-h fasted mice after intravenous administration of Triton WR-1339 (500 mg/kg, Sigma, Saint Louis, MO, USA), an inhibitor of lipolysis. Postprandial TG clearance was measured after 10 weeks of ad libitum access to 20% fructose supplementation to drinking water or with transgenic expression of Cholesteryl Ester Transfer Protein (CETP), a genetic model of impaired TG clearance [44]. Transgenic CETP mice (C57BL/6-Tg(CETP)UCTP20Pnu/J, Strain: 001929, Jackson Laboratories), were bred with ∆hep mice to generate fl/fl (CETP+/SHPfl/fl) and ∆hep (CETP+/SHP∆hep) mice. TG clearance was measured in 12-h fasted mice after oral gavage of olive oil (200 µL/mouse) with serial tail blood samples over 7–8 h. Metabolites 2021, 11, 330 13 of 17

4.5. Western Blotting Four microliters of serum/plasma were used for immunoblotting to quantify plasma levels of ApoC1, ApoC2, and ApoC3 with a protocol we published previously [62]. Ponceau S staining was used for normalization. Rabbit anti-mouse ApoC1 antibody was from Abcam (ab231570); rabbit anti-mouse ApoC2 (PA5102480) and anti-mouse ApoC3 (PA578802) antibodies were from Invitrogen (ThermoFisher, Asheville, NC, USA), rabbit anti-mouse ApoA1 (K23100R) and ApoE (K23500R) antibodies were from Meridian (Memphis, TN, USA). IRDye-800CW goat anti-rabbit IgG was from LI-COR Biosciences (ThermoFisher, Asheville, NC, USA).

4.6. Blood Lipase Activities To quantify the regulatory activity of plasma lipase regulators including ApoC1, ApoC2, and ApoC3, we used a Lipase Assay Kit (Cat#STA-610, Cell Biolabs, San Diego, CA, USA) with a 2-step protocol. Brieﬂy, in step A, two microliters of each plasma sample were used to measure blood total lipase activity following the manufacture’s protocol (data not shown). In step B, two microliters of each plasma sample were used to measure lipase activity in the presence of 1.4 mUnit of LPL from Cell Biolabs. Data from step B are shown for regulatory activity of plasma lipase regulators.

4.7. Liver and Adipose mRNA Quantification Liver and adipose samples were stored in RNA-Later at 4 ◦C overnight and then −20 ◦C according to the manufacturer’s instructions (ThermoFisher, Asheville, NC, USA). A small piece of tissue was bead homogenized and mRNA was isolated according to the manufacturer’s instructions (Trizol, Qiagen, Germantown, MD, USA). Complementary DNA was synthesized from 1 µg of mRNA (iScript, Bio-Rad, Hercules, CA, USA). RT-PCR was done in triplicate from 10 ng cDNA (JumpStart Taq ReadyMix, Sigma, Saint Louis, MO, USA). All primers Table1) were validated using a melting curve and annealing tem- peratures were optimized using gradient RT-PCR. Expression of all genes was calculated using the efficiency corrected Pfaffl method with normalization to cyclophilin A (Ppia)[63]. Efficiency was measured from amplification curves by the program LinRegPCR according to Ruijter et al [64].

Table 1. Primer probes for qPCR.

Gene Forward Primer Reverse Primer Abcg5 CCTGCAGAGCGACGTTTTTC GCATCGCTGTGTATCGCAAC Abcg8 TGGATAGTGCCTGCATGGATC AATTGAATCTGCATCAGCCCC Apob GCCCATTGTGGACAAGTTGATC CCAGGACTTGGAGGTCTTGGA Ar GGACCATGTTTTACCCATCG TCGTTTCTGCTGGCACATAG Cd36 TGGCCTTACTTGGGATTGG CCAGTGTATATGTAGGCTCATCCA Cyp7a1 AGCAACTAAACAACCTGCCAGTACTA GTCCGGATATTCAAGGATGCA Cyp7b1 TAGCCCTCTTTCCTCCACTCATA GAACCGATCGAACCTAAATTCCT Cyp8b1 GCCTTCAAGTATGATCGGTTCCT GATCTTCTTGCCCGACTTGTAGA Fxr TCCGGACATTCAACCATCAC TCACTGCACATCCCAGATCTC Gpihbp1 TACCTACTCCATGTGGTGTACTG AGGATGTCTAGTCCCACTTTCC Ldlr GCATCAGCTTGGACAAGGTGT GGGAACAGCCACCATTGTTG Lipc GACGGGAAGAACAAGATTGGAA GCATCATCAGGAGAAAGG Lrp1 TCAGACGAGCCTCCAGACTGT ACAGATGAAGGCAGGGTTGGT Mttp CAAGCTCACGTACTCCACTGAAG TCATCATCACCATCAGGATTCCT P4hb GCCGCAAAACTGAAGGCAG GGTAGCCACGGACACCATAC Pdia3 CGCCTCCGATGTGTTGGAA CAGTGCAATCCACCTTTGCTAA Pdia4 TCCCATTGCTGTAGCGAAGAT GGGGTAGCCACTCACATCAAAT Pparα TATTCGGCTGAAGCTGGTGTAC CTGGCATTTGTTCCGGTTCT Ppia CGATGACGAGCCCTTGG TCTGCTGTCTTTGGAACTTTGTC Scarb1 TCAGAAGCTGTTCTTGGTCTGAAC GTTCATGGGGATCCCAGTGA Sdc1 CTTTGTCACGGCAGACACCTT GACAGAGGTAAAAGCAGTCTCG Shp CGATCCTCTTCAACCCAGATG AGGGCTCCAAGACTTCACACA Vldlr CCACAGCAGTATCAGAAGTCAGTGT CACCTACTGCTGCCATCACTAAGA Metabolites 2021, 11, 330 14 of 17

4.8. Statistical Analysis Data are summarized using mean and standard deviation. Statistical tests between two groups were analyzed by unpaired Student’s t-test. Data with more than two groups were analyzed by 1-way ANOVA with Bonferroni post-hoc comparisons. Repeated measures 1-way ANOVA was used for measures of plasma TG over time with Bonferroni post-test comparisons. Genotype or sex effects were determined by 2-way ANOVA. p-values of <0.05 were considered statistically signiﬁcant.

Author Contributions: B.T.P. and L.Z. designed and executed experiments, analyzed data and wrote the manuscript. S.Y., A.B., B.L., T.N.L., U.A., E.M.E. and J.C.N. assisted with completion of experiments and writing the manuscript. J.M.S. assisted with experimental design and writing the manuscript. J.M.S. is the guarantor of this work, and accordingly, has had full access to the data presented and takes full responsibility for the integrity of the data and its analysis. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by The Vanderbilt Medical Scientist Training Program (T32GM07347) and the NIH (F30DK104514) provided support to B.T.P.The Department of Veterans Affairs (BX002223) and NIH (R01DK109102, R01HL144846) provided support to J.M.S. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. Institutional Review Board Statement: All mouse experiments were approved by the Vanderbilt University Institutional Animal Care and Use Committee. The animal welfare assurance number is A03227-01. Informed Consent Statement: Not applicable. Data Availability Statement: The data presented in this study are available in article. Acknowledgments: The authors acknowledge the helpful assistance of the Vanderbilt Hormone Assay Core (supported by NIH grant DK020593 to the Vanderbilt Diabetes Research Center). We also acknowledge excellent support by the Vanderbilt Mouse Metabolic Phenotyping Core (supported by NIH grant DK59637). The energy expenditure study was supported by 1S10OD028455-01. Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results. J.C.N. is currently a Novo Nordisk Inc. employee. This work was completed in full during his postdoctoral training with Stafford and is not related to his current position.

References 1. Frick, M.H.; Elo, O.; Haapa, K.; Heinonen, O.P.; Heinsalmi, P.; Helo, P.; Huttunen, J.K.; Kaitaniemi, P.; Koskinen, P.; Manninen, V.; et al. Helsinki Heart Study: Primary-Prevention Trial with Gemfibrozil in Middle-Aged Men with Dyslipidemia. N. Engl. J. Med. 1987, 317, 1237–1245. [CrossRef][PubMed] 2. Keech, A.C.; Simes, R.J.; Barter, P.J.; Best, J.D.; Scott, R.A.P.; Taskinen, M.R.; Forder, P.M.; Pillai, A.; Davis, T.M.; Glasziou, P.; et al. Effects of long-term fenofibrate therapy on cardiovascular events in 9795 people with type 2 diabetes mellitus (the FIELD study): Randomised controlled trial. Lancet 2005, 366, 1849–1861. [CrossRef] 3. Rubins, H.B.; Robins, S.J.; Collins, D.; Fye, C.L.; Anderson, J.W.; Elam, M.B.; Faas, F.H.; Linares, E.; Schaefer, E.J.; Schectman, G.; et al. Gemfibrozil for the Secondary Prevention of Coronary Heart Disease in Men with Low Levels of High-Density Lipoprotein Cholesterol. N. Engl. J. Med. 1999, 341, 410–418. [CrossRef][PubMed] 4. Bezafibrate Infarction Prevention Study Group. Secondary prevention by raising HDL cholesterol and reducing triglycerides in patients with coronary artery disease. Circulation 2000, 102, 21–27. [CrossRef] 5. Holmes, M.V.; Asselbergs, F.W.; Palmer, T.M.; Drenos, F.; Lanktree, M.B.; Nelson, C.P.; Dale, C.E.; Padmanabhan, S.; Fi- nan, C.; Swerdlow, D.I.; et al. Mendelian randomization of blood lipids for coronary heart disease. Eur. Heart J. 2015, 36, 539–550. [CrossRef] 6. Liu, D.J.; Peloso, G.M.; Yu, H.; Butterworth, A.S.; Wang, X.; Mahajan, A.; Saleheen, D.; Emdin, C.; Alam, D.; Alves, A.C.; et al. Exome-wide association study of plasma lipids in >300,000 individuals. Nat. Genet. 2017, 49, 1758–1766. [CrossRef] 7. Thomsen, M.; Varbo, A.; Tybjærg-Hansen, A.; Nordestgaard, B.G. Low Nonfasting Triglycerides and Reduced All-Cause Mortality: A Mendelian Randomization Study. Clin. Chem. 2014, 60, 737–746. [CrossRef] Metabolites 2021, 11, 330 15 of 17

8. Sarwar, N.; Sandhu, M.S.; Ricketts, S.L.; Butterworth, A.S.; Di Angelantonio, E.; Boekholdt, S.M.; Ouwehand, W.H.; Watkins, H.; Samani, N.J.; Saleheen, D.; et al. Triglyceride-mediated pathways and coronary disease: Collaborative analysis of 101 studies. Lancet 2010, 375, 1634–1639. [CrossRef][PubMed] 9. Adiels, M.; Olofsson, S.-O.; Taskinen, M.-R.; Borén, J. Overproduction of Very Low–Density Lipoproteins Is the Hallmark of the Dyslipidemia in the Metabolic Syndrome. Arter. Thromb. Vasc. Biol. 2008, 28, 1225–1236. [CrossRef] 10. Sparks, J.D.; Sparks, C.E.; Adeli, K. Selective Hepatic Insulin Resistance, VLDL Overproduction, and Hypertriglyceridemia. Arter. Thromb. Vasc. Biol. 2012, 32, 2104–2112. [CrossRef] 11. Chandler, C.E.; Wilder, D.E.; Pettini, J.L.; Savoy, Y.E.; Petras, S.F.; Chang, G.; Vincent, J.; Harwood, H.J. CP-346086: An MTP inhibitor that lowers plasma cholesterol and triglycerides in experimental animals and in humans. J. Lipid Res. 2003, 44, 1887–1901. [CrossRef][PubMed] 12. Raal, F.J.; Santos, R.D.; Blom, D.J.; Marais, A.D.; Charng, M.-J.; Cromwell, W.C.; Lachmann, R.H.; Gaudet, D.; Tan, J.L.; Chasan- Taber, S.; et al. Mipomersen, an apolipoprotein B synthesis inhibitor, for lowering of LDL cholesterol concentrations in patients with homozygous familial hypercholesterolaemia: A randomised, double-blind, placebo-controlled trial. Lancet 2010, 375, 998–1006. [CrossRef] 13. Nordestgaard, B.G.; Benn, M.; Schnohr, P.; Tybjaerg-Hansen, A. Nonfasting Triglycerides and Risk of Myocardial Infarction, Ischemic Heart Disease, and Death in Men and Women. JAMA 2007, 298, 299–308. [CrossRef][PubMed] 14. Boquist, S.; Ruotolo, G.; Tang, R.; Björkegren, J.; Bond, M.G.; de Faire, U.; Karpe, F.; Hamsten, A. Alimentary Lipemia, Postprandial Triglyceride-Rich Lipoproteins, and Common Carotid Intima-Media Thickness in Healthy, Middle-Aged Men. Circulation 1999, 100, 723–728. [CrossRef][PubMed] 15. Carstensen, M.; Thomsen, C.; Gotzsche, O.; Holst, J.J.; Schrezenmeir, J.; Hermansen, K. Differential Postprandial Lipoprotein Responses in Type 2 Diabetic Men with and without Clinical Evidence of a Former Myocardial Infarction. Rev. Diabet. Stud. 2004, 1, 175. [CrossRef] 16. Ginsberg, H.N.; Jones, J.; Blaner, W.S.; Thomas, A.; Karmally, W.; Fields, L.; Blood, D.; Begg, M.D. Association of Postprandial Triglyceride and Retinyl Palmitate Responses with Newly Diagnosed Exercise-Induced Myocardial Ischemia in Middle-Aged Men and Women. Arter. Thromb. Vasc. Biol. 1995, 15, 1829–1838. [CrossRef] 17. Groot, P.H.; Van Stiphout, W.A.; Krauss, X.H.; Jansen, H.; Van Tol, A.; Van Ramshorst, E.; Chin-On, S.; Hofman, A.; Cresswell, S.R.; Havekes, L. Postprandial lipoprotein metabolism in normolipidemic men with and without coronary artery disease. Arter. Thromb. A J. Vasc. Biol. 1991, 11, 653–662. [CrossRef] 18. Sharrett, A.R.; Chambless, L.E.; Heiss, G.; Paton, C.C.; Patsch, W. Association of Postprandial Triglyceride and Retinyl Palmitate Responses With Asymptomatic Carotid Artery Atherosclerosis in Middle-aged Men and Women. Arter. Thromb. Vasc. Biol. 1995, 15, 2122–2129. [CrossRef] 19. Gaudet, D.; Gipe, D.A.; Pordy, R.; Ahmad, Z.; Cuchel, M.; Shah, P.K.; Chyu, K.-Y.; Sasiela, W.J.; Chan, K.-C.; Brisson, D.; et al. ANGPTL3 Inhibition in Homozygous Familial Hypercholesterolemia. N. Engl. J. Med. 2017, 377, 296–297. [CrossRef] 20. Graham, M.J.; Lee, R.G.; Brandt, T.A.; Tai, L.-J.; Fu, W.; Peralta, R.; Yu, R.; Hurh, E.; Paz, E.; McEvoy, B.W.; et al. Cardiovascular and Metabolic Effects of ANGPTL3 Antisense Oligonucleotides. N. Engl. J. Med. 2017, 377, 222–232. [CrossRef][PubMed] 21. Gaudet, D.; Alexander, V.J.; Baker, B.F.; Brisson, D.; Tremblay, K.; Singleton, W.; Geary, R.S.; Hughes, S.G.; Viney, N.J.; Graham, M.J.; et al. Antisense Inhibition of Apolipoprotein C-III in Patients with Hypertriglyceridemia. N. Engl. J. Med. 2015, 373, 438–447. [CrossRef][PubMed] 22. Schaefer, E.J.; Lamon-Fava, S.; Cohn, S.D.; Schaefer, M.M.; Ordovas, J.M.; Castelli, W.P.; Wilson, P.W. Effects of age, gender, and menopausal status on plasma low density lipoprotein cholesterol and apolipoprotein B levels in the Framingham Offspring Study. J. Lipid Res. 1994, 35, 779–792. [CrossRef] 23. Couillard, C.; Bergeron, N.; Prud’homme, D.; Bergeron, J.; Tremblay, A.; Bouchard, C.; Mauriege, P.; Despres, J.P. Gender difference in postprandial lipemia: Importance of visceral adipose tissue accumulation. Arterioscler. Thromb. Vasc. Biol. 1999, 19, 2448–2455. [CrossRef][PubMed] 24. Mittendorfer, B.; Patterson, B.W.; Klein, S. Effect of sex and obesity on basal VLDL-triacylglycerol kinetics. Am. J. Clin. Nutr. 2003, 77, 573–579. [CrossRef][PubMed] 25. Cianﬂone, K.; Zakarian, R.; Couillard, C.; Delplanque, B.; Despres, J.-P.; Sniderman, A. Fasting acylation-stimulating protein is predictive of postprandial triglyceride clearance. J. Lipid Res. 2004, 45, 124–131. [CrossRef] 26. Horton, T.J.; Commerford, S.R.; Pagliassotti, M.J.; Bessesen, D.H. Postprandial leg uptake of triglyceride is greater in women than in men. Am. J. Physiol. Metab. 2002, 283, E1192–E1202. [CrossRef] 27. Båvner, A.; Sanyal, S.; Gustafsson, J.-Å.; Treuter, E. Transcriptional corepression by SHP: Molecular mechanisms and physiological consequences. Trends Endocrinol. Metab. 2005, 16, 478–488. [CrossRef] 28. Zhang, Y.; Hagedorn, C.H.; Wang, L. Role of nuclear receptor SHP in metabolism and cancer. Biochim. Biophys. Acta Mol. Basis Dis. 2011, 1812, 893–908. [CrossRef] 29. Lu, T.T.; Makishima, M.; Repa, J.J.; Schoonjans, K.; Kerr, T.A.; Auwerx, J.; Mangelsdorf, D.J. Molecular Basis for Feedback Regulation of Bile Acid Synthesis by Nuclear Receptors. Mol. Cell 2000, 6, 507–515. [CrossRef] 30. Park, Y.J.; Kim, S.C.; Kim, J.; Anakk, S.; Lee, J.M.; Tseng, H.-T.; Yechoor, V.; Park, J.; Choi, J.-S.; Jang, H.C.; et al. Dissociation of diabetes and obesity in mice lacking orphan nuclear receptor small heterodimer partner. J. Lipid Res. 2011, 52, 2234–2244. [CrossRef] Metabolites 2021, 11, 330 16 of 17

31. Huang, J.; Iqbal, J.; Saha, P.K.; Liu, J.; Chan, L.; Hussain, M.M.; Moore, D.D.; Wang, L. Molecular characterization of the role of orphan receptor small heterodimer partner in development of fatty liver. Hepatology 2007, 46, 147–157. [CrossRef] 32. Wang, L.; Liu, J.; Saha, P.; Huang, J.; Chan, L.; Spiegelman, B.; Moore, D.D. The orphan nuclear receptor SHP regulates PGC-1α expression and energy production in brown adipocytes. Cell Metab. 2005, 2, 227–238. [CrossRef][PubMed] 33. Watanabe, M.; Houten, S.; Wang, L.; Moschetta, A.; Mangelsdorf, D.J.; Heyman, R.A.; Moore, D.D.; Auwerx, J. Bile acids lower triglyceride levels via a pathway involving FXR, SHP, and SREBP-1c. J. Clin. Investig. 2004, 113, 1408–1418. [CrossRef] 34. Seol, W.; Hanstein, B.; Brown, M.; Moore, D.D. Inhibition of Estrogen Receptor Action by the Orphan Receptor SHP (Short Heterodimer Partner). Mol. Endocrinol. 1998, 12, 1551–1557. [CrossRef][PubMed] 35. Gobinet, J.; Auzou, G.; Nicolas, J.-C.; Sultan, C.; Jalaguier, S. Characterization of the Interaction between Androgen Receptor and a New Transcriptional Inhibitor, SHP. Biochem. Us 2001, 40, 15369–15377. [CrossRef] 36. Tseng, H.-T.; Park, Y.J.; Lee, Y.K.; Moore, D.D. The orphan nuclear receptor small heterodimer partner is required for thiazolidine- dione effects in leptin-deficient mice. J. Biomed. Sci. 2015, 22, 1–8. [CrossRef][PubMed] 37. Zou, A.; Magee, N.; Deng, F.; Lehn, S.; Zhong, C.; Zhang, Y. Hepatocyte nuclear receptor SHP suppresses inflammation and fibrosis in a mouse model of nonalcoholic steatohepatitis. J. Biol. Chem. 2018, 293, 8656–8671. [CrossRef][PubMed] 38. Magee, N.; Zou, A.; Ghosh, P.; Ahamed, F.; Delker, D.; Zhang, Y. Disruption of hepatic small heterodimer partner induces dissociation of steatosis and inflammation in experimental nonalcoholic steatohepatitis. J. Biol. Chem. 2020, 295, 994–1008. [CrossRef] 39. Kerr, T.A.; Saeki, S.; Schneider, M.; Schaefer, K.; Berdy, S.; Redder, T.; Shan, B.; Russell, D.W.; Schwarz, M. Loss of Nuclear Receptor SHP Impairs but Does Not Eliminate Negative Feedback Regulation of Bile Acid Synthesis. Dev. Cell 2002, 2, 713–720. [CrossRef] 40. Wang, L.; Han, Y.; Kim, C.-S.; Lee, Y.-K.; Moore, D.D. Resistance of SHP-null Mice to Bile Acid-induced Liver Damage. J. Biol. Chem. 2003, 278, 44475–44481. [CrossRef] 41. Park, Y.J.; Qatanani, M.; Chua, S.S.; LaRey, J.L.; Johnson, S.A.; Watanabe, M.; Moore, D.D.; Lee, Y.K. Loss of orphan receptor small heterodimer partner sensitizes mice to liver injury from obstructive cholestasis. Hepatology 2008, 47, 1578–1586. [CrossRef] 42. Anakk, S.; Watanabe, M.; Ochsner, S.A.; McKenna, N.J.; Finegold, M.J.; Moore, D.D. Combined deletion of Fxr and Shp in mice induces Cyp17a1 and results in juvenile onset cholestasis. J. Clin. Investig. 2011, 121, 86–95. [CrossRef][PubMed] 43. Xiao, G.; Zhang, T.; Yu, S.; Lee, S.; Calabuig-Navarro, V.; Yamauchi, J.; Ringquist, S.; Dong, H.H. ATF4 Protein Deficiency Protects against High Fructose-induced Hypertriglyceridemia in Mice. J. Biol. Chem. 2013, 288, 25350–25361. [CrossRef][PubMed] 44. Palmisano, B.T.; Le, T.D.; Zhu, L.; Lee, Y.K.; Stafford, J.M. Cholesteryl ester transfer protein alters liver and plasma triglyceride metabolism through two liver networks in female mice. J. Lipid Res. 2016, 57, 1541–1551. [CrossRef][PubMed] 45. Tenney, R.M.; Bell, C.L.; Wilson, J.M. AAV8 capsid variable regions at the two-fold symmetry axis contribute to high liver transduction by mediating nuclear entry and capsid uncoating. Virology. 2014, 454–455, 227–236. [CrossRef] 46. Fuior, E.V.; Gafencu, A.V. Apolipoprotein C1: Its Pleiotropic Effects in Lipid Metabolism and Beyond. Int. J. Mol. Sci. 2019, 20, 5939. [CrossRef] 47. Jong, M.C.; Dahlmans, V.E.; Van Gorp, P.J.; Breuer, M.L.; Mol, M.J.; Van Der Zee, A.; Frants, R.R.; Hofker, M.H.; Havekes, L.M. Both Lipolysis and Hepatic Uptake of VLDL Are Impaired in Transgenic Mice Coexpressing Human Apolipoprotein E*3Leiden and Human Apolipoprotein C1. Arter. Thromb. Vasc. Biol. 1996, 16, 934–940. [CrossRef][PubMed] 48. Zhu, L.; Brown, W.C.; Cai, Q.; Krust, A.; Chambon, P.; McGuinness, O.P.; Stafford, J.M. Estrogen Treatment After Ovariectomy Protects Against Fatty Liver and May Improve Pathway-Selective Insulin Resistance. Diabetes 2012, 62, 424–434. [CrossRef] 49. Wang, X.; Lu, Y.; Wang, E.; Zhang, Z.; Xiong, X.; Zhang, H.; Lu, J.; Zheng, S.; Yang, J.; Xia, X.; et al. Hepatic estrogen receptor α improves hepatosteatosis through upregulation of small heterodimer partner. J. Hepatol. 2015, 63, 183–190. [CrossRef] 50. Thompson, P.D.; Cullinane, E.M.; Sady, S.P.; Chenevert, C.; Saritelli, A.L.; Sady, M.A.; Herbert, P.N. Contrasting Effects of Testosterone and Stanozolol on Serum Lipoprotein Levels. JAMA 1989, 261, 1165–1168. [CrossRef] 51. Snyder, P.J.; Peachey, H.; Berlin, J.A.; Hannoush, P.; Haddad, G.; Dlewati, A.; Santanna, J.; Loh, L.; Lenrow, D.A.; Holmes, J.H.; et al. Effects of Testosterone Replacement in Hypogonadal Men. J. Clin. Endocrinol. Metab. 2000, 85, 2670–2677. [CrossRef][PubMed] 52. Singh, A.B.; Hsia, S.; Alaupovic, P.; Sinha-Hikim, I.; Woodhouse, L.; Buchanan, T.A.; Shen, R.; Bross, R.; Berman, N.; Bhasin, S. The Effects of Varying Doses of T on Insulin Sensitivity, Plasma Lipids, Apolipoproteins, and C-Reactive Protein in Healthy Young Men. J. Clin. Endocrinol. Metab. 2002, 87, 136–143. [CrossRef][PubMed] 53. Conde-Knape, K.; Bensadoun, A.; Sobel, J.H.; Cohn, J.S.; Shachter, N.S. Overexpression of apoC-I in apoE-null mice. J. Lipid Res. 2002, 43, 2136–2145. [CrossRef][PubMed] 54. Lai, K.; Harnish, D.C.; Evans, M.J. Estrogen Receptor α Regulates Expression of the Orphan Receptor Small Heterodimer Partner. J. Biol. Chem. 2003, 278, 36418–36429. [CrossRef][PubMed] 55. Poensgen, J. Apolipoprotein C-1 inhibits the hydrolysis by phospholipase A2 of phospholipids in liposomes and cell membranes. Biochim. Biophys. Acta Lipids Lipid Metab. 1990, 1042, 188–192. [CrossRef] 56. Pan, X.; Zhang, Y.; Wang, L.; Hussain, M.M. Diurnal Regulation of MTP and Plasma Triglyceride by CLOCK Is Mediated by SHP. Cell Metab. 2010, 12, 174–186. [CrossRef] 57. Berbée, J.F.P.; van der Hoogt, C.C.; Sundararaman, D.; Havekes, L.M.; Rensen, P.C.N. Severe hypertriglyceridemia in human APOC1 transgenic mice is caused by apoC-I-induced inhibition of LPL. J. Lipid Res. 2005, 46, 297–306. [CrossRef] 58. Rosenson, R.S.; Davidson, M.H.; Hirsh, B.J.; Kathiresan, S.; Gaudet, D. Genetics and Causality of Triglyceride-Rich Lipoproteins in Atherosclerotic Cardiovascular Disease. J. Am. Coll. Cardiol. 2014, 64, 2525–2540. [CrossRef] Metabolites 2021, 11, 330 17 of 17

59. Marcel, Y.; Bergseth, M.; Nestruck, A. Preparative isoelectric focussing of apolipoproteins C and E from human very low density lipoproteins. Biochim. Biophys. Acta Lipids Lipid Metab. 1979, 573, 175–183. [CrossRef] 60. Simonet, W.; Bucay, N.; Pitas, R.; Lauer, S.; Taylor, J. Multiple tissue-specific elements control the apolipoprotein E/C-I gene locus in transgenic mice. J. Biol. Chem. 1991, 266, 8651–8654. [CrossRef] 61. Palmisano, B.T.; Anozie, U.; Yu, S.; Neuman, J.C.; Zhu, L.; Edington, E.M.; Luu, T.; Stafford, J.M. Cholesteryl Ester Transfer Protein Impairs Triglyceride Clearance via Androgen Receptor in Male Mice. Lipids 2021, 56, 17–29. [CrossRef] 62. Zhu, L.; Luu, T.; Emfinger, C.H.; Parks, B.A.; Shi, J.; Trefts, E.; Zeng, F.; Kuklenyik, Z.; Harris, R.C.; Wasserman, D.H.; et al. CETP Inhibition Improves HDL Function but Leads to Fatty Liver and Insulin Resistance in CETP-Expressing Transgenic Mice on a High-Fat Diet. Diabetes 2018, 67, 2494–2506. [CrossRef][PubMed] 63. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [CrossRef][PubMed] 64. Ruijter, J.M.; Ramakers, C.; Hoogaars, W.M.H.; Karlen, Y.; Bakker, O.; Hoff, M.J.B.V.D.; Moorman, A.F.M. Amplification efficiency: Linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009, 37, e45. [CrossRef][PubMed]