Effect of Two Nonsynonymous Variants of the GABAergic Enzyme Genes, GAD1 and ALDH5A1, on Processing Speed in Healthy Controls and Schizophrenia Patients
Item Type dissertation
Authors Whittaker, Clare
Publication Date 2013
Abstract Schizophrenia has been associated with altered GABAergic function in the brain. Gamma aminobutyric acid (GABA) is synthesized by GAD67 (glutamate decarboxylase weighing 67kDa) and GAD65, encoded in GAD1 and GAD2 genes, respectively, and degraded by s...
Keywords gamma-Aminobutyric Acid; Polymorphism, Single Nucleotide; Schizophrenia
Download date 28/09/2021 00:40:16
Link to Item http://hdl.handle.net/10713/2984 Curriculum Vitae
Name: Clare Louise Whittaker
Contact Information: [email protected]
Degree and Date to be Conferred: Masters, 2013
Major: Human Genetics
Collegiate Institutions Attended:
Master’s in Human Genetics from University of Maryland Baltimore, 2011-2013
Bachelor’s in Cellular Biology and Molecular Genetics from University of Maryland, College Park, 2006-2010
Professional Positions Held:
Research Assistant for Dr. Elliot Hong, Maryland Psychiatric Research Center, Catonsville, MD, June 2012 – September 2012
Biological Assistant to Dr. Stephen Rehner, Agricultural Research Service, U.S. Department of Agriculture, Systematic Mycology and Microbiology Lab, Beltsville, MD, July 2007- August 2011
Student Worker in Dr. Mary Catherine Aime’s Lab, Louisiana State University, Dep. Of Plant Pathology and Crop Physiology, June 2010- August 2010
Biological Assistant to Dr. Mary Catherine Aime, Agricultural Research Service, U.S. Department of Agriculture, Systematic Botany and Mycology Lab, Beltsville, MD, July 2006- July 2007
Research Experience:
Master’s Thesis Research with Dr. John McLenithan, University of Maryland Baltimore, Baltimore, MD, June 2012 – present
Master’s Thesis Research with Dr. Elliot Hong, Maryland Psychiatric Research Center, Catonsville, MD, January 2012- present
Special Recognitions:
Secretary of the local chapter of the National Marfan Foundation, November 2009 - June 2010
Primannum Honor Society, August 2007- December 2010
National Society of Collegiate Scholars, May 2007- December 2010
Maryland Delegates Scholarship, 2006-10 and 2011-12
Genetic Alliance Scholarship to attend Annual Conference, July 2005
Skills:
Software: SPSS, Haploview, SAS, SigmaPlot, Sequencer, EditSeq, Megalign, Word, Excel, PowerPoint
Lab: o Data analysis on GWAS data (basic linear regression, ANOVA, χ2 test, etc.), o Autoclaving o DNA extraction o Polymerase Chain Reaction (PCR) . Primer design . Exosap of PCR product o Sanger sequencing . Primer design . Editing sequence data o Cell culturing with fungi and human cells . Preparing and using slants and glycerol stocks
. Preparing culture media o ELISA o Site-directed mutagenesis o Western blot o Plasmid transformation o Protein over-expression resulting from transfection with genomic construct o Protein quantitation using FluorChem Q Imager o Immunofluorescence microscopy o Enzyme assay development
Abstract
Title of Thesis: Effect of Two Nonsynonymous Variants of the GABAergic Enzyme
Genes, GAD1 and ALDH5A1, on Processing Speed in Healthy Controls and
Schizophrenia Patients
Clare Whittaker, Master of Science, 2013
Thesis Directed by: Dr. Elliot Hong, Professor, Department of Psychiatry
Schizophrenia has been associated with altered GABAergic function in the brain.
Gamma aminobutyric acid (GABA) is synthesized by GAD67 (glutamate decarboxylase weighing 67kDa) and GAD65, encoded in GAD1 and GAD2 genes, respectively, and degraded by succinic semialdehyde dehydrogenase (SSADH) encoded in ALDH5A1.
Previous research suggests that individuals with schizophrenia have an elevated level of
GABA and also have a processing speed deficit. We hypothesized that the GAD1 variant,
Arg532Gln, and the ALDH5A1 variant, His180Tyr, could alter these enzymes’ functions and be associated with the processing speed deficit seen in individuals with schizophrenia. The ALDH5A1 variant His180Tyr is known to reduce the enzyme function of SSADH; while the effect of the GAD1 variant, Arg532Gln is currently unknown. The
Digit Symbol coding task was used to measure processing speed in 153 healthy controls and 158 patients with schizophrenia. Both groups were genotyped for GAD1 Arg532Gln and ALDH5A1 His180Tyr missense SNPs. Using this clinical information, we attempted to determine the amount of variation in Digit Symbol coding score between patients and controls that could be explained by these GAD1 and ALDH5A1 SNPs. Case-control analysis was also performed to determine if either SNP was associated with a diagnosis of schizophrenia. A GAD67 functional enzyme assay was developed to determine if
Arg532Gln is a functional mutation and therefore partially responsible for the processing speed deficit present in many individuals with schizophrenia. Results showed that GAD1
Arg532Gln was significantly associated with reduced digit symbol score in the control group (R2=4.9%, p=0.006) and the schizophrenic group (R2=3.7%, p=0.015); however, only the association with the control population remained significant after the Bonferroni correction. The functional GAD67 enzyme assay showed that Arg532Gln results in increased GABA production. ALDH5A1 His180Tyr was also significantly associated with reduced digit symbol score in the control group (R2=5.6%, p=0.003), but not the schizophrenic group (R2=1.5%, p=0.131). Neither SNP was associated with schizophrenia in either the Caucasian or African American population. In conclusion, the
GAD1 and ALDH5A1 variants are not significantly associated with schizophrenia, but are significantly associated with processing speed. We also found that Arg532Gln results in increased GAD67 activity.
Effect of Two Nonsynonymous Variants of the GABAergic Enzyme Genes, GAD1 and ALDH5A1, on Processing Speed in Healthy Controls and Schizophrenia Patients
by Clare Whittaker
Thesis submitted to the Faculty of the Graduate School of the University of Maryland, Baltimore in partial fulfillment of the requirements for the degree of Master of Science 2013
Dedication
To my mother, Mary Ahearn, for her constant love and support. Thank you for the inspiration and motivation.
To my father, Jerry Whittaker, for his love and encouragement. Thank you for spending so many hours teaching me Chemistry.
To my sister, Anna Whittaker, for believing I could do it. Thank you for putting a smile on my face after a long day.
To Alex Brand for his encouragement and kindness. Thank you for being confident in my abilities and for helping me keep things in perspective.
iii
Acknowledgements
Thank you to:
My mentor, Dr. Elliot Hong, for teaching me and allowing me work in such a productive and welcoming environment. I am very grateful to have such an encouraging and supportive mentor.
Dr. John McLenithan, my unofficial mentor, for spending many hours brain storming with me and instructing me in the laboratory. It was a pleasure working with you.
Dr. Toni Pollin for participating in my thesis committee and for spending the time editing my work and responding to all my inquiring emails. Thank you for connecting me with
Dr. McLenithan and being an excellent teacher.
The faculty, staff, and students in the Epidemiology and Human Genetics Program for always being helpful and kind.
iv
Table of Contents
Chapter Page
DEDICATION ...... iii
ACKNOWLEDGEMENTS ...... iv
LIST OF TABLES ...... vii
LIST OF FIGURES ...... viii
I. INTRODUCTION AND LITERATURE REVIEW ...... 1 A. Schizophrenia ...... 1 B. Symptoms of Schizophrenia ...... 1 C. Effect of GABA Level on Cognition ...... 2 D. Genes Responsible for GABA Level ...... 3 E. Variants in Genes Responsible for GABA Synthesis and Degradation ... 4 F. GABA Level in Individuals with Schizophrenia ...... 6 G. Summary ...... 6
GOALS AND SPECIFIC AIMS ...... 8
II. ASSOCIATION ANALYSIS OF GAD1 (ARG532GLN) AND ALDH5A1 (HIS180Tyr) WITH SCHIZOPHRENIA AND PROCESSING SPEED ...... 10
A. Introduction ...... 10 B. Materials and Methods ...... 12 1. Subjects ...... 12 2. Genotyping ...... 15 3. Neuropsychology Laboratory Procedures ...... 16 4. Analysis...... 16 C. Results ...... 17 1. Schizophrenia and Processing Speed ...... 17 2. GAD1 and ALDH5A1 SNPs and Processing Speed ...... 19 3. GAD1 Arg532Gln and ALDH5A1 His180Tyr and Schizophrenia ...... 23 4. Verbal Intelligence as Estimated by WTAR ...... 26 D. Discussion ...... 27
III. GAD ENZYME ASSAY DEVELOPMENT FOR THE MEASRUREMENT OF RECOMBINANT OVER-EXPRESSED GAD67 ACTIVITY ...... 32 A. Introduction ...... 32 B. Materials and Methods ...... 36 1. GAD1 (GAD67) cDNA Expression Construct ...... 36 2. GAD67 Over-expression in HEK-293 Cells...... 36
v
3. Western Blotting to Detect and Quantify Over-expressed GAD67 ...... 37 4. GAD Assay and GABA Measurement ...... 38 5. Determining Correct pH level for Assay ...... 39 6. GAD Enzyme Assay Normalization ...... 39 C. Results ...... 40 1. Cell Line Determination ...... 40 2. Transfection Efficiency ...... 41 3. GAD67-GFP Fusion Protein ...... 42 4. GAD67 Primary Antibody Used for Western Blot ...... 43 5. Cell Morphology ...... 44 6. Cell Lysate Determination for GAD67 Enzyme Assay .. 45 7. Over-expression of GAD67 without GFP Fusion ...... 48 8. Sample Dilution in Enzyme Assay ...... 48 9. Quenching Enzyme Assay ...... 50 10. Determination of Optimal pH for Enzyme Assay………51 11. GABA Production………………………………………51 D. Discussion ...... 53
IV. COMPARING WILDTYPE AND ARG532GLN GAD67 ENZYME ACTIVITY ...... 57 A. Introduction ...... 57 B. Materials and Methods ...... 57 1. Creating Arg532Gln GAD67 ...... 57 2. Determining Reaction Rate of Wildtype and Arg532Gln GAD67 Enzymes ...... 58 C. Results ...... 59 1. Cell Morphology ...... 59 2. Normalization of GABA Concentration ...... 60 3. Determination of Enzyme Reaction Rates ...... 60 D. Discussion ...... 66
V. CLOSING REMARKS ...... 69
REFERENCES ...... 72
vi
List of Tables
Table Page
Table 1. Clinical information of the sample ...... 14
Table 2. Contribution of all genotypes on normalized digit symbol score ...... 20
Table 3. Effect size between genotypes ...... 22
Table 4. Significance between fresh wildtype and Arg532Gln GABA levels at
various time points in the enzyme assay ...... 63
Table 5. Reaction rate ratios at 20mM and 6.1mM glutamate ...... 64
Table 6. Significance between frozen wildtype and Arg532Gln GABA levels at
various time points in the enzyme assay ...... 65
vii
List of Figures
Figure Page
Figure 1. GABA synthesis and degradation ...... 4
Figure 2. Mean DSCT score for normal controls and individuals with schizophrenia ...... 19
Figure 3. Association of digit symbol score with GAD1 and ALDH5A1 Genotypes ...... 21
Figure 4. GAD1 and ALDH5A1 allele frequency by ethnicity...... 24
Figure 5. Case-control association of GAD1 Arg532Gln and ALDH5A1 His180Tyr Genotypes ...... 25
Figure 6. Determination of appropriate cell line to be used for transfection ...... 40
Figure 7A. Image of untransfected HEK-293 cells by immunofluorecence microscopy ...... 41
Figure 7B. Image of GAD1 transfected HEK-293 cells by immunofluorecence microscopy ...... 41
Figure 8. Western blot showing GAD67-GFP fusion protein produced from the originally purchased GAD1 plasmid ...... 43
Figure 9. Western blot results using mouse or rabbit GAD67 primary antibody ...... 44
Figure 10. HEK-293 cells under microscope (100X) at day 2 ...... 45
Figure 11. Determination of appropriate sample for assay and ELISA ...... 47
Figure 12. Western blot with control and wildtype samples ...... 48
Figure 13. Determination of appropriate sample dilution in enzyme assay ...... 49
Figure 14. Determination of appropriate assay termination method ...... 50
Figure 15. Standard curve of GABA ELISA data ...... 52
Figure 16. GABA ELISA performed with fresh control and wildtype samples ...... 53
Figure 17. HEK-293 cells under microscope (100X) at day 2 ...... 59
viii
Figure 18. Western blot with control, wildtype and mutant samples ...... 60
Figure 19. GABA ELISA performed with fresh wildtype and mutant samples ...... 62
Figure 20. GABA ELISA performed with frozen wildtype and mutant samples ...... 65
ix
Chapter 1: Introduction and Literature Review
Schizophrenia
Schizophrenia is a mental illness that affects approximately 1.1% of the United
States population over age 18 (Regier et al, 1993). Average age of disease on-set is between 16 and 30 years (Mueser and McGurk, 2004). The cost of schizophrenia to society is substantial. It was estimated that the cost of schizophrenia in the United States was $62.7 billion in 2002 (Wu et al, 2005). This financial cost comes from a combination of direct and indirect costs of the disease. Direct costs include price of medication, medical services, and homeless shelters; indirect costs include increased unemployment, premature death of patients, and family member caregiving time.
Symptoms of Schizophrenia
Schizophrenia is traditionally characterized by positive and negative symptoms.
Positive symptoms include hallucinations, delusions, and disorganized thoughts and behaviors, commonly called psychosis. Negative symptoms include lack of motivation, flat affect, and loss of social drive. Besides these traditional symptoms, the wide range of cognitive deficits identified in individuals with schizophrenia are increasingly seen as the critical clinical characteristics of the disease. Among them, impaired processing speed appears the most robust in differentiating individuals with schizophrenia from normal controls (Brébion et al, 1998; Dickinson et al, 2007; Heinrichs and Zakzanis, 1998;
Knowles, E. et al, 2010; Reichenberg and Harvey, 2008). Processing speed can be generically defined as speed of completion of a task with demand for accuracy, typically measured during performance of relatively simple behavioral and cognitive tasks.
1
Though simple, processing speed is thought to provide a critical constraint on many cognitive processes because many cognitive performances are speed-dependent
(Salthouse, 1996). Meta-analysis of 37 neuropsychological studies on schizophrenia showed that the digit symbol coding task (DSCT), a task widely used to measure processing speed, has a significantly larger effect size for differentiating individuals with schizophrenia from normal controls when compared with other widely used measures of episodic memory, executive functioning, and working memory (Dickinson et al, 2007).
Two additional meta-analyses that included a wide range of cognitive measures collected in individuals with schizophrenia were also consistent in one finding: processing speed, as measured by DSCT, has the largest effect size compared with other cognitive measures in separating individuals with schizophrenia from normal controls (Henry and Crawford,
2005; Knowles et al, 2010). There are different opinions on how to precisely interpret this finding (Knowles et al 2010), although the robustness and consistence of this finding strongly suggest that processing speed is a “central feature of the cognitive deficit in schizophrenia” (Dickinson et al, 2007). The DSCT from the Wechsler intelligence scales is a concise, well accepted assessment for processing speed (Wechsler, 1997). The biological mechanism of the prominent processing speed deficit in schizophrenia is unknown. Identifying the biological basis of this deficit may expedite our understanding the pathophysiological pathway on the cognitive deficits in schizophrenia.
Effect of GABA Level on Cognition
One known mechanism that influences processing speed is gamma-aminobutyric acid (GABA). GABA is the primary inhibitory neurotransmitter in the central nervous system. GABA signaling is closely associated with many cognitive performances, (Gao
2 et al, 2003; Goldman-Rakic, 1990; Menzies et al, 2007; Seamans et al, 2004) particularly processing speed (Gooday et al, 1995). Previous research has shown the opposing effects of GABAergic drugs on cognitive reaction times in humans, such that antagonism of the benzodiazepine binding site on GABAa receptor by flumazenil was associated with enhanced cognition-related reaction time (Gooday et al, 1995). In comparison, enhancement of GABA neurotransmitter at the GABAa receptor by benzodiazepines impaired processing speed (Stewart et al, 2005). Performance of processing speed requires accuracy and speed that demand precise control. Excess inhibition by over- activation of GABAergic receptors could be one of the reasons for the impaired processing speed performance in individuals with schizophrenia. This opposite effect associated with GABAa agonist versus antagonist is likely not limited to processing speed, but similar in other cognitive functions. Menzies et al found that flumazenil
(GABAa receptor antagonist) improves working memory performance while lorazepam
(GABAa receptor agonist) impairs it (Menzies et al, 2007).
Genes Responsible for GABA Level
Alterations of GABA pathway function and genetic variances have been associated with schizophrenia (Hyde et al, 2011; Lewis and Hashimoto, 2007). Several studies have found that individuals with schizophrenia have reduced expression
(decreased mRNA levels) of GAD67 in the brain (Akbarian et al, 1995; Guidotti et al,
2000; Hashimoto et al, 2005; Mellios et al, 2009; Mirnics et al, 2000; Vawter et al, 2002;
Volk et al, 2000). Daskalakis et al found that unmedicated individuals with schizophrenia demonstrated significant cortical inhibition deficits compared to healthy controls
(Daskalakis et al, 2002). As stated earlier, the neurotransmitter primarily responsible for
3 cortical inhibition is GABA; therefore these findings suggest that individuals with schizophrenia have altered levels of GABA. Marenco et al studied 6 GAD1 SNPs previously associated with risk of schizophrenia and found that 2 of these SNPs
(rs1978340 located in 5’ flanking region and rs769390 in intron 6) showed effects on
GABA levels (Marenco et al, 2010). GABA level in the brain is directly controlled by its synthesis and degradation. GABA synthesis is controlled by glutamate decarboxylase 67
(GAD67) and GAD65 enzymes encoded in the GAD1 and GAD2 genes. GABA degradation is controlled by the succinate semialdehyde dehydrogenase (SSADH) enzyme encoded in the ALDH5A1 (aldehyde dehydrogenase 5 family, member A1) gene
(Figure 1).
Figure 1. GABA synthesis and degradation. Enzymes responsible for each reaction are in bold.
Variants in Genes Responsible for GABA Synthesis and Degradation
To our knowledge, the function of the GAD1 SNP rs769402 has not been systematically studied. Its MAF is much lower than 5% in people of European ancestries
(approximately 1%) although it is a relatively common polymorphism in people of
African ancestry (approximately 15-20%), according to dbSNP. The G to A mutation changes the translated amino acid from arginine to glutamine at protein position 532
4
(Arg532Gln). It is unclear whether this missense mutation is functional; and if so, whether it increases or decreases GAD67 enzyme activities. Mutations previously found in the GAD1 gene have been associated with cognition; these variants have been located in the 5’ flanking region (Addington et al, 2005; Straub et al, 2007), exons (Straub et al,
2007), and introns (Straub et al, 2007) of the gene.
The mutations on the ALDH5A1 gene have been thoroughly investigated in the context of ALDH5A1 deficiency syndromes. The functionality of many mutations on the enzyme is known. Multiple very rare missense mutations have been identified that led to loss of ALDH5A1 function and SSADH deficiency syndrome, in which individuals may present with seizures, ataxia, psychomotor retardation, language delay, and hypotonia
(Gibson et al, 1997). These rare mutations are not the focus of this study. Five common polymorphisms in the 10 exons of ALDH5A1 have been described, including 4 missense mutations; among them, only the SNP rs2760118 is consistently above 5% in MAF
(Malaspina et al, 2009). The minor allele T of rs2760118 codes for amino acid tyrosine at position 180, which confers 82.5% of the normal ALDH5A1 enzyme function of the C allele, which codes for amino acid histamine (Blasi et al, 2002). Importantly, the C allele is the derived allele in this SNP because histidine is never observed in other eukaryotes, even primates. The C allele is apparently in the process of replacing the ancestral T allele in human populations, suggesting the possibility of a recent positive selection for maximal ALDH5A1 enzyme activity, i.e. reducing GABA availability, that is specific to humans (Blasi et al, 2006; Leone et al 2006; Malaspina et al, 2009). The rs2760118 T allele has been associated with decreased cognitive ability in the general population (De
Rango et al, 2008; Plomin et al, 2004), suggesting that a reduced enzyme functionality of
5
ALDH5A1, which should increase GABA availability, would be associated with reduced cognitive function (De Rango et al, 2008).
GABA Level in Individuals with Schizophrenia
In a recent study by Kegeles et al, researchers found that individuals with schizophrenia have a 30% elevated level of GABA in the medial prefrontal cortex compared to healthy controls (Kegeles et al, 2012). This is consistent with other studies showing increased GABA in multiple cortical grey matter locations in individuals with chronic schizophrenia (Ongür et al, 2010) and that antipsychotic medications may have limited, if any, effects on the GABA level (Goto et al, 2010). A study by Marenco et al also found elevated GABA levels in the anterior cingulate cortex in individuals with schizophrenia compared to healthy controls (Marenco et al, 2010).
Summary
As stated earlier, GABA level has previously been associated with cognitive functioning. There has not been a great deal of research previously performed to determine the effect of GABA level on one cognitive function in particular, processing speed. The genetic effect of many variants in the genes responsible for GABA synthesis and degradation on processing speed is unknown. Further research is required to determine if elevated or reduced enzyme activity of the enzymes encoded by the GABA synthesis and degradation genes has an effect on processing speed. Once the relationship between variants in GABA synthesis and degradation genes and activity of enzymes encoded in these genes is known, we might better be able to understand the contribution
6 of these variants on the processing speed deficit observed in individuals with schizophrenia.
7
Goals and Specific Aims
Assuming genetic variants are at least partially causal of the elevated GABA levels observed in individuals with schizophrenia, genetic variants on genes coding for enzymes that control GABA level should lead to increased GABA. Therefore, we tested the hypothesis that missense mutations Arg532Gln in GAD1 and His180Tyr in
ALDH5A1, by presumably altering enzyme activities and therefore GABA availability, contribute to cognitive impairment, especially processing speed deficits in individuals with schizophrenia. It has previously been found that His180Tyr is associated with decreased cognitive functioning and results in decreased SSADH enzyme activity, and should therefore increase available GABA. The effect of Arg532Gln is unknown; based on initial processing speed data that suggested that Arg532Gln is associated with processing speed deficit, we hypothesized that this variant results in increased GAD67 enzyme activity and therefore increased available GABA. To pursue these hypotheses, the following specific aims were completed:
1) Determined that there was an association between GAD1 Arg532Gln and/or ALDH5A1
His180Tyr and processing speed using digit symbol coding task (DSCT) scores from
individuals with schizophrenia and healthy controls
2) After an association was found between variants of interest and DSCT score, GAD1
Arg532Gln was functionally characterized by:
a) Developing a GAD67 enzyme assay so that the GABA levels could be
quantified at varying reaction times
8 b) Mutagenizing the GAD1 cDNA and determining if there was a difference in
enzyme activity between the over-expressed wildtype and mutant GAD67
9
Chapter 2: Association Analysis of GAD1 (Arg532Gln) and ALDH5A1 (His180Tyr)
with Schizophrenia and Processing Speed
Introduction
In order to determine the effect of altered GABA level on processing speed, we examined the effect of missense variants in GABA synthesizing and degrading enzyme genes. By examining the association between these variants and processing speed, we hope to determine the role, if any, of these variants on the processing speed deficit observed in individuals with schizophrenia.
We focused only on the genes that affect GABA level, not necessarily on genes that are associated with schizophrenia. We also focused only on SNPs that alter amino acid (i.e., nonsynonymous or missense) and thus more likely altered enzyme function.
We searched in several public databases for all nonsynonymous SNPs from GAD1,
GAD2, and ALDH5A1 genes. We identified common variants that 1) were contained in an exon, 2) were missense, and 3) had a minor allele frequency (MAF) of 5% or more due to limited sample size. Only one GAD1 SNP, rs769402 (Arg532Gln), met these criteria. Multiple ALDH5A1 SNPs met these criteria; however, we chose to only genotype rs2760118 (His180Tyr).
Two other missense variants located in ALDH5A1 have a MAF just below 5%
(Malaspina et al, 2009). According to HapMap LD analysis, one of these mutations, rs3765310, is in linkage disequilibrium (D’=1) but low r2 (r2=0.113) with rs2760118 due to their different frequencies. The other missense variant, rs4646832, identified using
1000 Genomes data, has a similar relationship with rs2760118 (D’=1, r2=0.049). The
10 previous report of “complete LD” between rs2760118 and these other two SNPs
(Malaspina et al, 2009) was likely based on the D’. The reason that these other two alleles have D’s=1 but low r2 values is because the MAF is about 30.7% in rs2760118 but only
4.5% and 4.6%, respectively, for each of the other two SNPs. The D’ and r2 values for rs2760118 with rs3765310 and rs4646832, mean that the alleles with lower frequency, rs3765310 and rs4646832 in this case, will not be observed without rs2760118; however, rs2760118 will be observed without rs3765310 and rs4646832. Using 1000 Genomes data, it was discovered that rs3765310 and rs4646832 are in linkage disequilibrium
(D’=1, r2=0.886) with each other as well; this high r2 value may make distinguishing the individual effects of each variant difficult if both variants are genotyped. All three of these variants could be genotyped to determine if rs2760118 is driven by a large effect of one of the less frequent variants. We chose to only genotype rs2760118 because this variant had the highest MAF. However, it is possible that genotyping rs3765310 instead of rs2760118 could have resulted in greater statistical power, even though rs3765310 has a lower MAF, because it was previously found that rs3765310 decreased SSADH enzyme activity by 47.6%, as opposed to the 82.5% or 86.7% decrease observed by rs2760118 and rs4646832 respectively (Blasi et al, 2002). This study focuses on the correlation between GABA level and processing speed; since all three variants result in decreased SSADH enzyme activity (Blasi et al, 2002) we chose to only genotype rs2760118.
To determine if there is an association between GAD1 Arg532Gln and/or
ALDH5A1 His180Tyr and processing speed, Maryland Psychiatric Research Center
(MPRC) staff asked healthy controls and individuals with schizophrenia for a blood
11 sample and to complete the digit symbol coding task. Blood samples were then sent to
University of Maryland Genomics Core Facility where DNA was extracted from the blood samples to genotype individuals for the GAD1 (Arg532Gln) and ALDH5A1
(His180Tyr) variants. Participants’ DSCT scores were then used to determine individual processing speeds; a higher DSCT score corresponded to a faster processing speed. Allele and genotype frequencies of cases versus controls were compared to determine if one or both variants were associated with schizophrenia. Next DSCT score was compared between those with the variant and those without to see if one or both variants were associated with an increased or decreased processing speed.
Materials and Methods
Subjects. Genotyping was carried out in 755 unrelated individuals with ages ranging from 18 to 79 years; average age was 42.5±13.4 (mean±sd). Of these, 54.0%
(n=408) were non-schizophrenic and 46.0% (n=347) were schizophrenic subjects. There was proportionally more males in the patient group compared with the control group
(52.7% vs. 68.9%, respectively, χ2=20.5, p<0.001). 53.4% were Caucasian; 41.8% were
African American; 4.8% were other/unknown. Details are in Table 1. Patients were recruited from the Maryland Psychiatric Research Center outpatient clinics and the neighboring community clinics following IRB approved protocols. MPRC staff administered the Structured Clinical Interview for DSM-IV (SCID) to all subjects.
Patients were individuals with DSM-IV schizophrenia. Patients were clinically stable as defined as no change in antipsychotic medications for 4 weeks or more and no exacerbation of psychotic symptoms as judged by the treating clinicians. Non- schizophrenia controls were recruited using local community newspaper advertisements.
12
The controls had no DSM IV Axis I diagnosis, no Axis II cluster A personality disorder, and no family history of psychosis in 3 generations. Family history of psychotic illness was based on Family History Research Diagnostic Criteria (FH-RDC) considering three generations. Two master level research clinicians carried out the initial interviews, followed by consensus diagnosis meeting chaired by a research psychiatrist. The inter- rater reliabilities among the clinical interviewers were above 0.80 (kappa) on these instruments. All subjects gave written informed consent in accordance with University of
Maryland Institutional Review Board guidelines.
13
Chi- Square Individuals P value with Healthy or F (2- Schizophrenia Controls value* sided)
Entire Sample N 347 408
Age (mean±s.d.) 42.49±12.29 42.51±14.31 1.458 0.016
Ethnicity (% cauc vs. afri vs. others) 49:49:2 53:39:8 13.47 0.001
Gender (%male) 68.9 52.7 20.47 7x10-6
Years of education 13.23±9.53 14.52±6.45 7.607 1x10-17
Processing Speed Sample N 158 153
Age 38.73±11.58 41.44±12.55 1.590 0.015
Ethnicity (% cauc vs. afri vs. others) 48:48:4 56:40:4 1.843 0.398
Gender (%male) 65.2 50.3 7.043 0.008
Years of education 13.01±7.24 14.16±2.45 4.286 1x10-6
Table 1. Clinical information of the sample. * ANOVA test was performed on continuous variables (Age and Years of Education) and chi-square test was performed on discrete variables (Ethnicity and Gender).
Among the 755 subjects, 311 were tested on processing speed (153 controls and
158 individuals with schizophrenia) by MPRC staff. The 158 patients tested for processing speed were on the following medications: 18 patients were on first generation antipsychotic medications [mean±s.d.: 972.2±453.8 mg in chlorpromazine equivalents
(CPZ)], 117 patients were on second generation antipsychotic medications, including 24 on clozapine (430.2±197.7 mg); 21 on olanzapine (17.6±10.8 mg), 29 on risperidone 14
(4.2±1.7 mg), 16 on quetiapine (678.1±262.6 mg), 21 on aripiprazole (17.1±6.0 mg), and
6 on ziprasidone (166.7±10.3 mg). Three patients were not on antipsychotic medications.
The remaining 20 patients were on two or more antipsychotic medications. Patients on any benzodiazepine, mood stabilizer, and anti-seizure medications that are known to directly target the GABA system were excluded from the processing speed assessment.
Medical conditions likely to affect cognition were excluded, including neurological conditions, substance dependence within the past 12 months or current substance abuse except smoking and marijuana use. Subjects with occasional marijuana use were not excluded if they did not smoke for 24 hours or more before testing. Smokers were asked to refrain from smoking for one hour before testing. Symptoms in patients were measured with the 20-item Brief Psychiatric Rating Scale (BPRS) using 1 – 7 scores on each item,
7 being severe psychiatric disorder.
Genotyping. Each subject was asked to give a blood sample for DNA extraction.
Samples were then sent to University of Maryland Genomics Core Facility where genotyping was conducted in DNA isolated from whole blood using the QIAamp DNA
Blood Maxi Kit (Qiagen). Genotyping was performed using 5' exonuclease assays from
Taqman Assays-on-Demand (Applied Biosystems, Foster City, California). Genotyping was performed according to the manufacturer’s protocol and genotypes were determined at the end-point using an ABI 7900HT Sequence Detection System. Genotyping accuracy was determined empirically by duplicate genotyping of 10% of the samples selected randomly. The error rate was <0.005. Genotypes conformed to Hardy-Weinberg equilibrium for GAD1 SNP rs769402 (p=1.0 in Caucasians and p=0.88 in African
15
Americans) and ALDH5A1 SNP rs2760118 (p=0.82 in Caucasians and p=0.85 in African
Americans).
Neuropsychology laboratory procedures. Processing speed was tested in 311 subjects, including 153 controls and 158 individuals with schizophrenia, who were enrolled in the later stage of the study when the digit symbol coding task (DSCT) for the processing speed phenotype was added. Testing was done in a quiet room by a trained master level clinician. The DSCT requires the subject to initially observe a key containing numbers from 1 to 9 and a corresponding geometric symbol under each number. The subject is then asked to copy the corresponding geometric symbol under each number. It is a simple task except that the transcription is timed and the subject is to copy as fast as possible. The task lasted 90 seconds. The raw score is the number of correct items completed within the 90 seconds. Scores were weighed according to gender and age to convert the raw score to scaled score, as a measure of processing speed. To compare with general intelligence ability, the Wechsler Test of Adult Reading (WTAR) was also administered during the same session. The standard score of the WTAR is known to be highly correlated with verbal and full scale IQ (Spreen et al 2006).
Analysis. Processing speed data distributions were assessed for normality by
Kolmogorov-Smirnov goodness-of-fit test. Scaled DSCT and WTAR scores were used in analysis. Univariate ANOVA was used to assess diagnosis (patient-control difference), gender by diagnosis, ethnic group by diagnosis interactions on processing speed. Chi- square tests were used to compare observed genotype frequencies with those expected under Hardy-Weinberg equilibrium. Differences in genotype and allele frequencies between schizophrenia cases and controls were assessed by Chi-square test, as
16 implemented in Haploview. The effect of genotype on processing speed was tested by linear regression based on an additive model in which processing speed was the dependent variable and the genotypes were predictors (coded as 0, 1, 2 for homozygous major alleles, heterozygous, and homozygous minor alleles, respectively). Linear regression models tested the association between genotype and processing speed. To test the additive effect from rs769402 + rs2760118 risk alleles, a combined genotype score was calculated based on additive of minor allele counts (coded as 0, 1, 2, 3, or 4) from the two SNPs. For the calculation of relative risk and attributable risk, processing speed was defined as abnormal if the value was below the mean minus 1 s.d. of the processing speed in the control sample. All tests were two-tailed. Univariate ANOVA tests were performed to determine if there was interaction between variables.
Results
Schizophrenia and processing speed. We observed no differences in key clinical characteristics, including age, gender, or ethnicity, between individuals phenotyped for processing speed and those not phenotyped (all p>0.05). There was no significant diagnosis x gender interaction (β= -0.322 arbitrary units, CI (-1.613-0.970),
F(3,307)=0.240, p=0.625), but there was a significant diagnosis main effect (β= 1.712, CI
(1.081-2.343), F(1,309)=28.500, p<0.001) and a significant gender main effect (β= 0.754,
CI (0.092-1.416), F(1,309)=5.018, p=0.026) on processing speed. These results supported a robust patient-control difference on processing speed in this sample as that described in the literature. Females have a significantly higher mean DSCT score (8.26±3.120) than males (7.51±2.786), (χ2=20.477 and p<0.001). There was no diagnosis x ethnic group interaction (β= -0.703, CI (-4.063-2.656), F(5,305)=0.085, p=0.918) or ethnic group main
17 effect (β=0.61, CI (-1.128-2.339), F(2,308)=1.536, p=0.217) on processing speed.
Comparing only Caucasian and African Americans (removing other ethnic groups), there was also no significant diagnosis x ethnic group interaction (β=0.041, CI (-1.249-1.330),
F(3,295)=0.004, p=0.951) or ethnic group main effect (β=0.584, CI (-0.084-1.251),
F(1,297)=2.962, p=0.086); while the diagnosis main effect was again significant
(β=1.687, CI (1.047-2.328), F(1,297)=26.863, p<0.001) on processing speed. Figure 2 shows DSCT score among different ethnic groups (all p≤0.001). Processing speed as measured by DSCT was significantly impaired in individuals with schizophrenia compared with controls (6.98±2.60 vs. 8.69±3.04, respectively, F(1,309)=28.50, p<0.001). Age and processing speed were inversely correlated, insignificantly in controls
(Pearson’s r= -0.117, p=0.148) but significantly in patients (r= -0.245, p=0.002).
Processing speed and dosages of medications were not significantly correlated as measured by correlations with daily CPZ in patients on first generation antipsychotics (r=
-0.111, p=0.171) or with daily dosages of any of the second generation antipsychotics
(all│r│≤0.410, all p.≥0.061). Processing speed was nominally significantly correlated with psychiatric symptom total score as measured by BPRS (r=-0.187, p=0.031, n=133) and BPRS withdrawal symptoms subscale score (r=-0.257, p=0.003, n=132) in individuals with schizophrenia, but not significant with any other symptom subscales (all p≥0.117). After Bonferroni correction for seven comparisons (total score and six subscale scores, p<0.0071), only the correlation with withdrawal symptoms was statistically significant.
18
All Subjects Caucasian Subjects African American Subjects
-7 -4 10 p=1x10 10 p=2x10 10 p=0.001
8 8 8
6 6 6
4 4 4
2 2 2
Mean Digit Symbol Score Symbol Digit Mean
Mean Digit Symbol Score Symbol Digit Mean 0 Score Symbol Digit Mean 0 0 Normal Schizophrenic Normal Schizophrenic Normal Schizophrenic Controls Patients Controls Patients Controls Patients Figure 2. Mean DSCT score for normal controls and individuals with schizophrenia. There is not a significant difference in score between Caucasian and African American subjects.
GAD1 and ALDH5A1 SNPs and processing speed. When comparing all three genotypes together, GAD1 rs769402 was significantly associated with processing speed in controls (R2=4.9%, F=7.78, p=0.006) and individuals with schizophrenia (R2=3.7%,
F=6.05, p=0.015) (Table 2), suggesting that this GAD1 mutation contributes to approximately 3.7 - 4.9% of the variances of processing speed as shown in two independent groups. The R2 of the two groups were not significantly different (p=0.795).
Processing speed was lowest in homozygous minor alleles, intermediate in heterozygous, and highest in homozygous major allele carriers (Figure 3). The effect size between genotypes can be seen in Table 3.
19
GAD1 rs769402 ALDH5A1 rs2760118 rs769402 + rs2760118
Individuals Individuals Individuals Healthy Healthy Healthy with with with Controls Controls Controls Schizophrenia Schizophrenia Schizophrenia
N 153 158 153 158 153 158
R2 4.9% 3.7% 5.6% 1.5% 8.4% 3.4%
F 7.78 6.05 9.00 2.31 13.80 5.45 value
P 0.006* 0.015* 0.003* 0.131 <0.001* 0.021* value
Table 2. Contribution of all genotypes on normalized digit symbol score. In both healthy control and schizophrenia groups, for both variants, the number of minor alleles (coded as 0, 1, or 2 copies) was negatively correlated with digit symbol scores such that risk alleles were associated with poorer processing speed. rs769402 + rs2760118: calculated based on additive of minor allele counts (coded as 0, 1, 2, 3, or 4) from the two SNPs. *Statistically significant.
20
p=0.062 12 12 p=0.029 p=0.698 10 p=0.238 10 p=0.007 p=0.624 8 8
6 6
4 4 124 27 2 135 21 2 2 2
Mean Digit Symbol Score Symbol Digit Mean Mean Digit Symbol Score Symbol Digit Mean 0 0 Arg/Arg Arg/Gln Gln/Gln Arg/ArgArg/Gln Gln/Gln Control GAD1 Genotype Schizophrenic GAD1 Genotype
p=0.010 12 12 p=0.010 p=0.105 p=0.605 10 10 p=0.597 p=0.188 8 8
6 6 4 4 68 57 28 52 81 25 2 2
Mean Digit Symbol Score Symbol Digit Mean Mean Digit Symbol Score Symbol Digit Mean 0 0 His/His His/Tyr Tyr/Tyr His/His His/Tyr Tyr/Tyr Control ALDH5A1 Genotype Schizophrenic ALDH5A1 Genotype
Figure 3. Association of digit symbol score with GAD1 and ALDH5A1 genotypes. Numbers in center of bars are number of individuals with that genotype (N). Error bars are standard error.
21
GAD1 rs769402 ALDH5A1 rs2760118 Individuals Individuals Normal with Normal with Controls Schizophrenia Controls Schizophrenia Arg/Arg His/His vs. 0.466 0.636 vs. 0.453 0.090 Arg/Gln His/Tyr Arg/Gln His/Tyr vs. 0.966 -0.388 vs. 0.125 0.325 Gln/Gln Tyr/Tyr Arg/Arg His/His vs. 1.313 0.275 vs. 0.583 0.382 Gln/Gln Tyr/Tyr Table 3. Effect size between genotypes.
ALDH5A1 rs2760118 was significantly associated with processing speed in controls (R2=5.6%, F=9.00, p=0.003) but not in individuals with schizophrenia
(R2=1.5%, F=2.31, p=0.131) although the genotype effect was in the same direction
(Table 2). The R2 of the two groups were not significantly different (p=0.303).
Processing speed was lowest in homozygous minor alleles, intermediate in heterozygous, and highest in homozygous major allele carriers (Figure 3).
Interestingly, the minor alleles of these two SNPs appeared to have the same detrimental effect on proceeding speed even though the two genes should function in
'opposite directions' in terms of GABA level. To test whether these two risk alleles were additive on processing speed, we recoded the genotypes from 0 to 4 based on the combined count of minor alleles from the two SNPs. The combined genotype explained
8.4% of the variance of processing speed in controls, much larger than the effect of the individual SNPs (4.9% and 5.6%), suggesting an additive effect. However, this additive effect was not apparent in individuals with schizophrenia (Table 2).
22
GAD1 Arg532Gln and ALDH5A1 His180Tyr and schizophrenia. The distribution of both genotypes were consistent with those predicted under Hardy
Weinberg equilibrium in both the control and patient groups (all p>0.436). Case-control association analysis was performed separately in Caucasians and African Americans due to different allele frequencies in these populations. In Caucasians, GAD1 rs769402
(χ2=0.643, p=0.584) and ALDH5A1 rs2760118 genotypes (χ2=1.750, p=0.417) were not over represented in individuals with schizophrenia compared with controls. In African
Americans, GAD1 rs769402 (χ2=0.877, p=0.645) and ALDH5A1 rs2760118 (χ2=0.857, p=0.651) were also not over-represented in individuals with schizophrenia compared with controls (Figure 4 and 5). Therefore, our data does not show a significant association between these two SNPs and schizophrenia.
23
Normal Controls (N=408) Schizophrenia Patients (N=347) 1.0 1.0
0.8 0.8
0.6 0.6
0.4 0.4
Caucasian (%) Caucasian 0.2 0.2
African American (%) American African
0.0 0.0 A G A G GAD1 rs769402 Allele GAD1 rs769402 Allele 1.0 1.0
0.8 0.8
0.6 0.6
0.4 0.4
Caucasian (%) Caucasian 0.2 0.2
African American (%) American African
0.0 0.0 C T C T ALDH5A1 rs2760118 Allele ALDH5A1 rs2760118 Allele
Figure 4. GAD1 and ALDH5A1 allele frequency by ethnicity.
24
Normal Controls (N=217) Normal Controls (N=160) Schizophrenic Patients (N=169) Schizophrenic Patients (N=169)
100 100 chi2=0.643 chi2=0.877 80 p=0.423 80 p=0.645
60 60
40 40
Caucasian (%) Caucasian 20 20
African American (%) American African 0 0 Gln/Gln Arg/Gln Arg/Arg Gln/Gln Arg/Gln Arg/Arg GAD1 rs769402 Genotype
Normal Controls (N=217) Normal Controls (N=160) Schizophrenic Patients (N=169) Schizophrenic Patients (N=169)
100 100 2 2 chi =1.750 chichi=0.8572=0.857 80 p=0.417 80 p=0.651p=0.651
60 60
40 40
Caucasian (%) Caucasian 20 20
African American (%) American African 0 0 Tyr/Tyr His/Tyr His/His Tyr/Tyr His/Tyr His/His ALDH5A1 rs2760118 Genotype
Figure 5. Case-control association of GAD1 Arg532Gln and ALDH5A1 His180Tyr genotypes. Neither variant was significantly associated with schizophrenia in either Caucasian or African American samples.
Testing of genotype effect on symptoms as measured by BPRS total and the six subscale scores, we found that GAD1 rs769402 did not significantly contribute to any symptom scores (all p>0.12). However, ALDH5A1 rs2760118 was significantly and positively associated with BPRS hostility score (p=0.007) and psychosis subscale score
25
(p=0.006); the latter was significant after Bonferroni correction for 7 comparisons
(p<0.0071).
Verbal intelligence as estimated by WTAR. DSCT scores were weakly/moderately and similarly correlated with WTAR scores in controls (r=0.341, p<0.001) and in individuals with schizophrenia (r=0.382, p<0.001). There was no significant gender x diagnosis interaction (β= 2.84, CI (-4.496-10.184), F(3,307)=0.581, p=0.446) and no significant main effect of gender (β= -2.81, CI (-6.516-0.903),
F(1,309)=2.216, p=0.138). There was significant diagnosis x ethnic group [(Caucasian
Americans (CA) vs. African Americans (AA)] interaction (β= 6.71, CI (0.420-13.000),
F(3, 295)=4.408, p=0.037), a significant main effect of ethnic group (β= 17.73, CI
(14.531-20.935), F(1,297)=118.77, p<0.001) and a main effect of diagnosis (β= 6.56, CI
(2.859-10.265), F(1,297)=12.16, p=0.001). Post-hoc tests showed that CA had higher
WTAR compared with AA in both controls (β= 20.78, CI (16.528-25.024),
F(1,145)=93.45, p<0.001) and individuals with schizophrenia (β= 14.07, CI (9.415-
18.716), F(1,150)=35.71, p<0.001). Therefore, unlike processing speed, WTAR scores were significantly related to ethnicity and not to gender, besides being significantly different between controls and patients. In regression analysis of each diagnosis stratified by ethnic group, GAD1 rs769402 was not significantly associated with WTAR scores in controls and patients of either CA or AA subgroups (all p≥0.242), except in CA individuals with schizophrenia (R2=8.7%, F=7.05, p=0.010). ALDH5A1 rs2760118 was also not significantly associated with WTAR scores in controls and patients of either CA or AA subgroups (all p≥0.289), except in CA individuals with schizophrenia (R2=5.8%,
F=4.60, p=0.035).
26
Discussion
In this chapter, we described the investigation of missense variants in GABA synthesizing and degrading enzyme genes and the possible role they play in the processing speed deficit in individuals with schizophrenia. We found a significant association between processing speed performance and two missense mutations in these genes, although neither of these variants was found to be associated with a schizophrenia diagnosis itself. Instead, both the GAD1 Arg532Gln and the ALDH5A1 His180Tyr mutations numerically affect processing speed more in normal controls compared to individuals with schizophrenia, although the differences were not statistically significant.
Overall, our finding did not support that either SNP is associated with the prominent processing speed deficit in schizophrenia, although interesting, it provided first evidence that GABA genetic mechanism may play a role in processing speed performance in general.
This effect appears to be specific to processing speed rather than general cognitive capacity, because we found no significant association between the proxy ID test WTAR, and GAD1 Arg532Gln or ALDH5A1 His180Tyr. While the relationship between IQ and
GAD1 Arg532Gln is unknown, ALDH5A1 His180Tyr has previously been associated with reduced IQ. In a study of about 1000 subjects, ALDH5A1 His180Tyr minor allele T was associated with reduced IQ, estimated to have a small effect of 1.5 IQ points per minor allele (Plomin et al, 2004). Because minor allele T (codon translates to tyrosine) is associated with reduced SSADH activity by about 82.5% of the major allele C (codon translates to histidine), it suggests that higher SSADH activity is associated with higher intelligence. Our insignificant association with WTAR could be due to small sample size,
27 although recent meta-analysis appears consistent with our observation that the association between ALDH5A1 His180Tyr and general intelligence, if any, is likely small (Chabris et al, 2012). In comparison, the association with processing speed appeared more robust in this study, suggesting an interesting possibility that ALDH5A1 may have a more specific effect on this cognitive phenotype.
The function of GAD1 Arg532Gln (rs769402) was unknown. However, the 1000
Human Genome data was used to perform a linkage disequilibrium (LD) search using
Haploview and found that rs769402 was in LD with rs769390 (D’= 0.83), an intronic
SNP previously studied (Marenco et al, 2010; Straub el al, 2007). Straub el al found that the C allele at this position is associated with increased risk for schizophrenia (Straub el al, 2007) and Marenco et al observed that rs769390 risk allele for schizophrenia was associated with elevated GABA levels in subjects with a CC genotype (Marenco et al,
2010). We did not find an association between rs769402 and schizophrenia, although the
LD between rs769402 and rs769390 suggests that the rs769402 nonsynonymous mutation could be associated with increased GABA level. Therefore, it seems plausible that minor alleles from GAD1 rs769402 or ALDH5A1 rs2760118 may influence processing speed in the same direction (Figure 3) because these variants have the same effect of increasing
GABA level.
Why increased GABA would reduce processing speed is an interesting and likely critical issue in the study of the biological basis of cognition. GABAergic antagonism in humans was associated with enhanced cognition-related reaction time (Gooday et al,
1995). The digit symbol coding task (DSCT) is widely accepted as a reliable measure of processing speed. A higher DSCT score corresponds with a faster processing speed. We
28 found that on average, healthy controls have a higher DSCT score than individuals with schizophrenia. Our data also suggest that both control and schizophrenic subjects with a
Arg/Arg genotype in the GAD1 gene have a higher processing speed. Control subjects with a His/His genotype in the ALDH5A1 gene have a higher processing speed than other genotypes. There does not appear to be a difference in processing speed between genotypes in the ALDH5A1 gene in individuals with schizophrenia; this could be due to the slower processing speed of individuals with schizophrenia in general or the larger amount of variance present in the schizophrenic population.
The GABA system is implicated in schizophrenia. Reduced GAD67 expression is one of the common findings across gene and protein expression studies in schizophrenia post-mortem brain tissue studies (Akbarian et al, 1995; Costa et al, 2004; Fatemi et al,
2005; Guidotti et al, 2000; Hashimoto et al, 2008; Volk et al, 2000) although non- replications exist (Dracheva et al, 2004; Hakak et al, 2001). It has been estimated that
GAD67 is reduced by 15% in transcript and 10% in protein expression levels in the total grey matter of individuals with schizophrenia (Curley et al, 2011). Reduced GAD67 expression is associated with reduced GABA level (Asada et al, 1997; Rimvall et al,
1993). Therefore, the relatively consistent reports of reduced GAD67 in schizophrenia in post-mortem brain studies are not consistent with some recent in vivo MRS reports showing increased GABA level in individuals with schizophrenia (Kegeles et al, 2012;
Marenco et al, 2010; Ongür et al, 2010). However, in two earlier MRS studies, GABA level was found reduced in individuals with schizophrenia (Goto et al, 2009; Yoon et al,
2010). It is unclear whether the inconsistencies are due to differences in disease chronicity, medication, anatomic location, or other methodology issues. Because GAD67
29 is also under the control of negative feedback and reduced GABA degradation and subsequent GABA increase has shown to reduced GAD67 protein expression (Mason et al, 2001), a conclusive interpretation on the GAD67 and GABA in schizophrenia may require additional studies. Our studies do not directly address this important issue, and did not identify genetic variants that are associated with schizophrenia, but instead suggest that processing speed could be a useful phenotype to tag the pathway from
GABAergic genetic variants, GABA level, to behaviors.
Finally, several studies have examined gene variants in GABAergic enzymes and receptors and their association with schizophrenia. Several studies have been published on GAD SNPs in association with schizophrenia. Three of the studies showed no nominally significant markers in GAD genes (De Luca et al, 2004; Ikeda et al, 2007;
Lundorf et al, 2005). Other studies have found nominally significant SNPs in GAD in association with schizophrenia (Addington et al, 2005; Straub et al, 2007; Zhao et al,
2007), although none was consistently replicated. None of these studies have reported examination of GAD1 Arg532Gln, the only nonsynomyous SNP in this gene considered to be a ‘common’ SNP. It is unclear why most studies of GAD1 and schizophrenia do not target this variant. A number of SNPs in other GABAergic genes, especially GABA receptor genes, have also been associated with schizophrenia. Beyond GAD1, an investigation of a group of GABA(A) receptor subunit genes shown that SNPs in
GABRA1, GABRP, and GABRA6 were associated with schizophrenia in a Portuguese sample, with GABRA1 and GABRP SNPs replicated in a German sample (Petryshen et al, 2005). Suggestive evidence between receptor gene GABRR1, GABRA4, GABRB3,
GABRA5 and GABRR3 and schizoaffective disorder was also reported (Green et al,
30
2010; Craddock et al, 2010). GABRB2, GABRG2 were also associated with schizophrenia in one study (Lo et al, 2004; Lo et al, 2007; Zai et al, 2009). GABA(A) receptors are the primary targets of GABA in the brain; understanding the dynamic interactions between GABA level regulation and GABAA signaling would be needed for therapeutic development that aims to correct cognitive deficits associated with the
GABAergic system dysfunction in schizophrenia (Charych et al, 2009; Lewis et al,
2008).
Our study is limited by a small sample size and much of the findings require replication. In this regard, some of the findings were at least replicable across normal controls and individuals with schizophrenia. This study is also limited by a focus on only genes of two enzymes, and we did not find that these two missense mutations can explain the impaired processing speed in schizophrenia. GABA mechanism is also directly and indirectly influenced by many other proteins including GABA transporters and receptors and other neurotransmitter systems. Variants in regulatory regions and epigenetic modulations on the genes are also known to regulate the overall GABA metabolism. In conclusion, no study has systemically examined the nonsynonymous SNP on these critical GABA pathway genes and their impact on cognition in schizophrenia. Our study provided first evidence that GABA genetic mechanism may play a role in processing speed performance in general. Comprehensive genotyping and epigenetic studies of the involved genes in larger sample is needed to reveal the complex interactions on how together genetic variants may regulate GABA levels and processing speed, which may provide leads to understand the specific variants associated with the reduced processing speed in schizophrenia.
31
Chapter 3: GAD Enzyme Assay Development for the Measurement of Recombinant
Over-expressed GAD67 Activity
Introduction
Predictive analysis tools were used to infer whether or not Arg532Gln is a functional mutation. PolyPhen2 predicted that Arg532Gln is a benign mutation, with a score of 0.009 (sensitivity: 0.96, specificity: 0.77). SIFT (using Homo sapiens GRCh37
Ensembl 63) also predicted that Arg532Gln is a tolerated mutation, with a score of 0.62
(median information content: 2.87, # of seqs at position: 162). While we considered these predictions, we also considered that this is the only common missense mutation in a critical enzyme for cognition and brain function yet no published functional assay on this
SNP is available. Our clinical investigation showed that this SNP is significantly associated with processing speed. Therefore, empirically testing on potential effect or the lack thereof on GAD67 enzyme function is critical, to determine whether this SNP is functional by altering the GAD67 enzyme activity, or not, which would implicate other variants in LD with Arg532Gln that may be responsible for the observed association with processing speed. To determine if the Arg532Gln polymorphism in GAD67 alters enzyme activity and therefore may result in an abnormal level of GABA, an enzyme assay was developed and a commercially available GABA ELISA kit (Rocky Mountain
Diagnostics) was utilized for the measurement of over-expressed GAD67 enzyme product.
In a study by Asada et al, GAD65 -/- mice were produced at expected Mendelian frequency; meaning the knockout is not initially lethal (Asada et al, 1996). These mice
32 had normal behavior in general and presented without any gross morphological defects; however, seizures were more easily induced (Asada et al, 1996; Kash et al, 1997). No difference in GABA concentration in the brains of GAD65 +/+, +/-, and -/- mice was detected. This suggests that the GAD67, but not GAD65, enzyme produces the basal levels of GABA required in the brain, as GAD65 and GAD67 are the major GAD isoforms in the mammalian brain (Erlander et al, 1991). This was confirmed when
GAD67 -/- mice were developed at expected Mendelian frequency but then died in the first morning after birth due to severe cleft palate (Asada et al, 1997). GABA content in the cerebral cortex was reduced by 7% in these GAD67 -/- mice compared to GAD67 +/+ mice. These studies suggest that GAD67 is responsible for producing basal GABA levels in the brain, while GAD65 is activated when additional GABA is required. Soghomonian et al came to a similar conclusion after completing a thorough review on GAD enzyme research that had been completed at the time (Soghomonian et al, 1998).
Pyridoxal-5'-phosphate (PLP) is the enzyme cofactor for GAD65 and GAD67
(Martin, 1987; Porter et al, 1985). GAD65 and GAD67 activation and inactivation are regulated by the binding and release of PLP respectively. When PLP is present, GAD enzymes are going through a continuous cycle of holoenzyme (GAD bound with PLP) to apoenzyme (GAD not bound to PLP) and back. When holoenzyme GAD converts glutamate to GABA, it also catalyzes a slower reaction that produces inactive apoGAD.
ApoGAD can reassociate with PLP to become holoGAD again. Battaglioli et al found that within cells, GAD65 is mainly apoenzyme (approximately 93%) and GAD67 is mainly holoenzyme (approximately 72%). They attributed this difference in enzyme state to kinetic differences. It was found that the conversion of holoenzyme to apoenzyme for
33
GAD65 was approximately 15 times faster than for GAD67 at saturating levels of glutamate. A similar effect was seen at saturating levels of GABA and aspartate. It was also found that ATP and inorganic phosphate affected the rate of GAD65 activation, but had little effect on GAD67. Therefore it was concluded that the cycle of inactivation and reactivation is more important in regulating GAD65 activity than GAD67 activity
(Battaglioli et al, 2003). This finding supports the theory that GAD67 is responsible for basal levels of GABA, while GAD65 is more closely regulated so that this enzyme is only activated when an increased GABA level is required.
As stated earlier, GABA level has an effect on enzyme state; at high levels of
GABA, holoGAD enzymes are converted to apoGAD by the removal of PLP. This provides a negative feedback mechanism for controlling GABA synthesis in the brain.
The GABA concentration resulting in the half-maximal rate of inactivation (Kinact) is
16mM. The Ki (change in GAD binding affinity) for GABA is 15.8mM (Porter and
Martin, 1984).
Previous studies have shown that sulfhydryl reactive reagents could greatly impair
GAD activity, which indicated the importance of cysteine residues in GAD decarboxylation function (Wu et al, 1974). It is now known that cysteine 455 in human
GAD67 plays an important role in enzyme function and that this cysteine is present as a free sulfhydryl group (Wei and Wu, 2005). To prevent the oxidation of cysteine 455 and other important cysteines on the enzyme, a reducing environment must be maintained in a
GAD67 assay. If a reducing environment is not maintained, cysteine 455 may become oxidized, which will then significantly decrease GAD67 activity so that very low levels of GABA will be produced and a GAD67 assay will be unsuccessful. AET (Wei and Wu,
34
2005; Wu et al, 1974; Wu et al, 1985) or DTT (Ilg et al, 2013) have previously been used to maintain a reducing environment in GAD assays.
There are several previous studies that have utilized a High-Performance Liquid
Chromatography (HPLC) to measure GABA production by the GAD67 enzyme with various mutations other than Arg532Gln (Fengyun et al, 1999; Mejia-Toiber et al, 2012;
Pan et al, 2012). However, this type of assay can be time-consuming to complete and requires specialized instrumentation and training. Wu et al used the more traditional
14 radioisotopic assay that measures CO2 production to determine GAD activity. Their enzyme assay buffer included 4mM sodium glutamate, 50mM potassium phosphate buffer at a pH of 7.2, 0.2mM PLP, and 1mM 2-aminoethylisothiouronium bromide
(AET) (Wu et al, 1985). In a recent study by Ilg et al, a discontinuous coupled enzymatic spectrophotometric assay was developed for GAD65 and GAD67 (Ilg et al, 2013).
Researchers determined GAD activity by detecting GABA levels using a cascade of purified recombinant E. coli GABA-TA/SSADH enzymes and measuring NAD(P)+ conversion to NAD(P)H; NAD(P)H is created by SSADH (Figure 1). The assay buffer that we utilized was a combination of the Ilg et al and Wu et al methods.
BSA was included in Ilg et al’s assay because this will give the proteases present in the cell lysate something to degrade that is not the targeted GAD67 enzyme; this is a way to prevent the degradation of GAD67 protein. PLP was included in the buffer because it is the enzyme cofactor; PLP must be bound to GAD67 for the enzyme to convert glutamate to GABA. Glutamate was included in the buffer because this is the substrate GAD67 uses to create GABA; for our purposes, it is best if the enzyme has ample amount of glutamate so that time-dependent GABA production can be measured.
35
DTT or AET were included in the buffer to maintain a reducing environment to prevent oxidation of cysteine residues in GAD67.
Materials and Methods
GAD1 (GAD67) cDNA expression construct. GAD1 cDNA (GeneCopoeia) was ordered in a eukaryotic expression vector, driven by a cytomegalovirus (CMV) promoter containing an internal ribosome entry site (IRES) followed by the eGFP gene. The vector also has a Neomycin resistance gene for eukaryotic drug selection and an Ampicillin gene for prokaryotic drug selection. We transformed the plasmid into DH5α competent cells, E. coli bacteria that have a high transformation frequency (Invitrogen). Once the purchased plasmids were transformed into these cells using the manufacturer’s protocol
(Invitrogen), we plated the cells on Luria Broth (LB) agar plates that contained
Ampicillin (100µg/mL). After drug selection, one colony was chosen and grown up in liquid culture (LB and Ampicillin) to amplify the purchased plasmids. The plasmids were then isolated from these cultures using a purchased Endo-free plasmid purification Maxi kit (Qiagen). Plasmid preparations were quantified using NanoDrop8000
Spectrophotometer (Thermo Scientific).
GAD67 over-expression in HEK-293 cells. HEK-293 cells (human kidney cells) were used to over-express the GAD1 plasmid. HEK-293 cells were grown in Dulbecco's
Modification of Eagle's Medium (DMEM), 10% Fetal Bovine Serum, Glutamax 1X
(10mM), and Penicillin/Streptomycin 1X (10mM). The HEK-293 cell line was used because of the high transfection efficiency. The purchased GAD1 plasmid was transfected into the HEK-293 cells using 2020 Transfection Reagent (Mirus). Cells were transfected
36 when they were 50-70% confluent and allowed to incubate in 30μL 2020 Transfection
Reagent (Mirus), 10μg DNA, and 10mL media for 24 hours; after the first 24 hours, this media was removed and fresh media was added. Fluorescence microscopy was used to visually determine transfection efficiency. This is possible because the plasmid contains a
GFP gene; a higher concentration of green fluorescence corresponds to higher transfection efficiency. For reasons discussed in the Results section of this paper, we purchased another GAD1 cDNA expression plasmid identical to the original cDNA except that it did not contain a GFP gene (Genecopoeia). Later transfections and enzyme assays were performed with this construct.
Western blotting to detect and quantify over-expressed GAD67. We quantified expression of the GAD1 gene using a western blot (Pierce West Femto Kit).
Samples were boiled in equal volume of Laemmli sample buffer (Bio-Rad) containing
30mg/mL Dithiothreitol (DTT) (Bio-Rad) for 5 minutes. Samples were run on a 7.5%
Tris-HCl polyacrylamide gel (Bio-Rad) in 1X Tris/Glycine/SDS buffer (Bio-Rad); the gel was run at 80 Volts for 30 minutes and then 120 Volts for approximately 1.5 hours. The gel was transferred overnight (16 hours) to a Immobilon-PVDF membrane (Millipore) in cold buffer consisting of 1X Tris/Glycine buffer and 20% (200mM) methanol and run at
0.2 Amps. The membrane is then incubated in StartingBlock Blocking Buffer (Thermo
Scientific) with 0.05% (0.5mM) Tween20 for at least 1 hour. This buffer is then removed and primary antibody buffer is added for at least 1.5 hours. The original primary antibody used was mouse monoclonal anti-human GAD67 antibody (R&D Systems); this antibody was diluted 1:200 in StartingBlock (Thermo Scientific) with 0.05% Tween20. However, we later found a rabbit monoclonal anti-human GAD67 antibody (Epitomics) that bound
37 more efficiently to GAD67 protein; this antibody was diluted 1:3,000 in StartingBlock
(Thermo Scientific) with 0.05% Tween20. The membrane was then washed three times, 7 minutes each, with 1X TPBS. Secondary antibody used with this rabbit primary antibody was peroxidase labeled goat anti-rabbit antibody (Kirkegaard & Perry Laboratories); this antibody was diluted 1:100,000 in StartingBlock (Thermo Scientific). The membrane was blotted in secondary antibody for 45 minutes then washed three times again with 1X
TPBS. SuperSignal West Femto Maximum Sensitivity substrate (Thermo Scientific) was used to produce a chemiluminescent signal.
GAD assay and GABA measurement. To complete aim 2a, we performed an in vitro enzyme assay to determine the amount of GABA produced by GAD67 when the enzyme is 100% functional. This in vitro assay was performed on HEK-293 cells that had or had not been transfected with GAD1 cDNA. The cells that had not been transfected served as a control. Cells were harvested on ice using the 4°C buffer we developed
(50mM KPO4 pH 7.2, 0.2mM PLP, 1mM DTT) without protease inhibitors. Cells were then homogenized (2mL/10cm dish) with a tight glass homogenizer (Wheaton) and then centrifuged at 12,000 x g. The supernatant (post-mitochondrial supernatant) was then used to perform the enzyme assay. To begin the enzyme assay, cell-lysates were first added to a test tube that was then moved to a 37°C water bath. To determine which cell- lysate to use in the enzyme assay, we utilized results from western blots that we performed on various cell-lysate samples (see Results section). To start the enzyme reaction, 2mLs pre-warmed (37°C) assay buffer (50mM KPO4 pH 8.0, 0.2mM PLP,
1mM AET, 0.1% detergent, 100μg/mL (1.5µM) BSA) containing 20mM sodium glutamate was added to the test tube with cell-lysate. Triplicate one hundred microliter
38 aliquots were removed from these tubes at 10, 30, 60, and 120 minutes after the reaction was initiated. Aliquots were immediately placed into labeled tubes already sitting in boiling water. Samples were left in boiling water for 10 minutes to terminate the reaction by denaturing the enzyme. Next, a GABA ELISA (Rocky Mountain Diagnostics) was immediately performed to quantify GABA formation in cell lysate samples. Samples were included in triplicates each time an ELISA was performed to ensure accuracy of results.
Determining correct pH level for assay. Originally the GAD67 enzyme assay was performed at a pH of 7.2 because this was the pH level that multiple papers reported using in their GAD67 assay (Porter and Martin, 1984; Wu et al, 1985). After performing the enzyme assay several times at a pH of 7.2, we decided to increase our assay pH level to 8, as in the publication by Ilg et al, in which the authors successfully used an optimal pH of 8.0 in their GAD67 assay (Ilg et al, 2013).
GAD enzyme assay normalization. GABA levels detected by the ELISA were normalized to over-expressed GAD67 or GAPDH protein concentration as determined by western blot. Chemilumenescent bands were quantified using FluorChem Q Imager
(ProteinSimple). This normalization is necessary because the enzyme concentration determines the amount of GABA present, which we are measuring to ultimately determine enzyme function and rate of reaction. When comparing control to wildtype samples, we normalized GABA levels by GAPDH protein concentration. GAPDH is a housekeeping protein naturally present in HEK-293 cells. When comparing wildtype and mutant samples, we normalized GABA levels by GAD67 concentration.
39
Results
Cell line determination. To determine which cell line had the highest transfection efficiency and the lowest endogenous GAD67 expression, we transiently transfected 3 different cell lines (CHO, HeLa, and HEK-293) with the GAD67 eukaryotic expression plasmid for 48 hours, lysed the cells in SDS-sample buffer, electrophoresed the cell lysates on 7.5% SDS-polyacrylamide gel, and western blotted with anti-human
GAD67 antibodies. The gel showed that HEK-293 cells have higher transfection efficiency because greater protein expression can be seen in this cell line after transfection (Figure 6).
Figure 6: Determination of appropriate cell line to be used for transfection. Lanes 1-4 are CHO cells, lanes 5-8 are HeLa cells, and lanes 9-12 are HEK-293 cells. Samples are run in duplicate; the first 2 lanes of each cell line are controls/untransfected and the last 2 lanes of each cell line are cell transfected with wildtype GAD1 plasmid. Cells were grown in DMEM 10% Fetal Bovine Serum media. This western blot shows that HEK- 293 cells are transfected most effectively with our GAD1 plasmid, as we can see greater protein expression at 67kDa (indicated by arrow).
40
Transfection efficiency. After transfecting HEK-293 cells with the purchased
GAD1 plasmid that contained GFP, we observed high transfection efficiency as indicated by the sum level of fluorescence in the majority of the cells (Figure 7A,B). We made this observation using immunofluorescence microscopy to visually detect green fluorescence due to GFP protein expression.
Figure 7A. Image of untransfected HEK-293 cells by immunofluorecence microscopy. No fluorescence is observed.
Figure 7B. Image of GAD1 transfected HEK-293 cells by immunofluorecence microscopy. Green fluorescence is due to GFP protein expression, indicating high transfection efficiency.
41
GAD67-GFP fusion protein. After transfecting our original plasmid into 293 cells, harvesting these cells, lysing them, running them on a western blot, and blotting with GAD67 primary antibody, we saw that one of the primary proteins being expressed was approximately 95kDa in weight. This is much larger than expected since the GAD1 protein, GAD67, is 67kDa. We suspected that the protein observed was a fusion protein, encoded by the GAD1 gene and the GFP gene in the plasmid to make a single protein. To prove this, the membrane from the western blot was re-blotted with GFP primary antibody. The re-blotted membrane showed that the GFP antibody bound to the 95kDa protein we saw previously and to a new band at 27kDa (the weight of GFP protein)
(Figure 8). This confirmed our suspicion that we were seeing a GAD67-GFP fusion protein likely due to an in-frame read through of the stop codon that was confirmed by
Genecopoeia to be present by sequencing the region. To solve this problem we purchased a new plasmid that contained the GAD1 gene, but did not contain the GFP gene. From this point on, we were unable to utilize immunofluorescence microscopy to visually determine transfection efficiency before cell harvesting and assaying because the GFP gene was no longer present in the plasmid. However, successful transfection was still determined by western blotting for GAD67. Western blot results showed that GAD67 wildtype and Arg532Gln were correctly over-expressed in transfected cells and not in control/untransfected cells (results shown later).
42
Figure 8. Western blot showing GAD67-GFP fusion protein produced from the originally purchased GAD1 plasmid. The left blot was produced by blotting with GFP primary antibody. The left lane is the control/untransfected cell lysate (C); the right lane is the transfected cell lysate (T). The right blot was produced by blotting with GAD67 primary antibody. The two left lanes are the control/untransfected cell lysates (C); the 2 right lanes are the transfected cell lysates (T). These findings support our suspicion that GAD67 and GFP proteins are fused together since both GFP and GAD67 primary antibody bind to the 95kDa protein.
GAD67 primary antibody used for western blot. The first GAD67 primary antibody we used when performing western blots was a mouse monoclonal antibody
(R&D Systems). However, we found that a rabbit monoclonal antibody (Epitomics) resulted in more specific GAD67 binding (Figure 9A,B). From this point on, the rabbit
GAD67 primary antibody was always used when performing western blots.
43
Figure 9: Western blot results using mouse or rabbit GAD67 primary antibody. Identical samples were run in parallel on a single gel. After the gel was transferred to a membrane, half of the membrane was blotted with mouse primary antibody, while the other was blotted with rabbit antibody. Samples include control 293 cells (C), transiently transfected 293 cells (TT), stable (incubated with G418) transfected 293 cells (TS), cytosol of transiently transfected 293 cell lysate (Cyto), and pellet of transiently transfected 293 cells lysate (P). A) GAD67 mouse primary antibody (R&D Systems) binding is not as specific because a GAD67 signal is only seen when there is a large amount of GAD67 protein present. B) GAD67 rabbit primary antibody (Epitomics) has more specific binding because we see a stronger GAD67 signal (white bands are overexposed) than we did with the same samples using the mouse GAD67 antibody. This antibody also produces less background binding than the mouse antibody.
Cell morphology. After transfecting HEK-293 cells with the new GAD1 plasmid that did not contain GFP, we noticed a morphological change in these transfected cells that was not observed in control/untransfected cells (Figure 10A,B). This morphological difference was not seen in cells transfected with the previously purchased GAD1 plasmid that contained GFP (data not shown).
44
Figure 10. HEK-293 cells under microscope (100X) at day 2. A) Control/untransfected cells. B) Cells transfected with wildtype GAD1 plasmid 2 days after transfection. Transfected cells are present in lower density and have an atypical rounded cell shape compared to control cells.
Cell lysate determination for GAD67 enzyme assay. To determine which cell fraction to use for an enzyme assay, various cell fractions were run on a western blot to determine which lysate had the largest amount of specific GAD67 activity, meaning the greatest amount of GAD67 protein expression and the least amount of alternative protein.
We wanted the least amount of non-GAD67 protein as possible because these non- descript proteins will increase background noise in the GABA ELISA. First, total sample was ultracentrifuged at 38,200 rpm for 1 hour to pellet all membranes and unbroken cells.
However, after running these samples on a western blot it was apparent that GAD67 proteins were present in both the pellet and supernatant (cytosol) but the supernatant had fewer non-descript proteins (Figure 11A). GAD67 could also be more easily degraded during this long processing/centrifugation. Since GAD67 was present in both the supernatant and pellet samples after centrifugation, low and high salt washes were performed on the ultracentrifuged pellet sample to determine if GAD67 was peripherally associated with membranes. If GAD67 was peripherally associated with membranes, the
45 high salt wash would force GAD67 to dissociate from membranes and float freely in the sample. We found that when pellet samples were washed with low salt and centrifuged again that the majority of GAD67 protein was still present in the pellet and basically none in the supernatant (Figure 11B). However, when the pellet was washed with high salt and centrifuged, there is much less GAD67 present in the pellet. The supernatant from the high salt wash was not run on the gel because the high salt content would have affected the running of the gel. However, we can assume that there is more GAD67 in the supernatant as the high salt wash forced GAD67 from peripherally associating with membranes so that the protein remained in the supernatant after centrifugation. Due to these findings and to reduce the time required to assay, from this point on, after homogenization, samples were centrifuged at 12,000 x g to pellet unbroken cells, lysosomes, mitochondria, nuclei, and some plasma membrane. The post-mitochondrial supernatant (PMS) contained microsomes (such as ER and golgi), cytosol, and partial plasma membrane. This way, the supernatant would contain more GAD67 and less lysosomal proteases, while still avoiding as much non-GAD67 protein as possible
(Figure 11C).
46
Figure 11. Determination of appropriate sample for assay and ELISA. The middle band is 67kDa (GAD67 protein indicated by arrow). The band above 67kDa is the GAD67- GFP fusion protein discussed later. A) Samples include supernatant of transfected cell extract after ultracentrifugation (S) and pellet of transfected cell extracts after ultracentrifugation (P). There are fewer non-GAD67 proteins present in the supernatant than the pellet, which is desirable because this will result in less background noise in the ELISA. B) Samples were run in duplicate and include total cell lysate untransfected/control (C), transfected total cell lysate (T), transfected cytosol/supernatant after ultracentrifugation (Cyto), transfected membrane pellet after ultracentrifugation (TMP), supernatant of transfected re-homogenized pellet after low salt wash and centrifugation (LSS), pellet of transfected re-homogenized pellet after low salt wash and centrifugation (LSP), and pellet of transfected re-homogenized pellet after high salt wash and centrifugation (HSP). There is significantly less GAD67 present in the pellet after a high salt wash, suggesting that GAD67 was peripherally associated with membranes. The high salt supernatant was not run because the high salt content would have affected the running of the gel. C) Comparison of post-mitochondrial supernatant (PMS) versus pellet (P) samples in control/untransfected and transfected cell extracts.
47
Over-expression of GAD67 without GFP fusion. The GAD1 plasmid without
GFP was transfected into HEK-293 cells. To ensure that the correct protein size was translated, these transfected cells and control/untransfected cells were harvested and cell lysates were run on a western blot with GAD67 rabbit primary antibody (Figure 12).
Transfected samples show that GAD67 is correctly over-expressed at 67kDa and there is no protein over-expressed at 95kDa.
Figure 12. Western blot with control and wildtype samples. Membrane was blotted with GAD67 rabbit primary antibody. Lanes 1-3 are untransfected/control samples (no proteins seen), lanes 4-6 are wildtype GAD67 samples. This blot shows that wildtype samples are correctly over-expressing GAD67, while control samples are not.
Sample dilution in enzyme assay. To develop a successful enzyme assay, the correct dilution of cell lysate in assay buffer was required. If samples are not diluted enough, endogenous GABA production added with GABA produced in the assay will be outside the range of the ELISA. If samples are too diluted, the ELISA will not be sensitive enough to show a difference in GABA production between samples, if there is one. We performed the enzyme assay with 1:10, 1:100, and 1:1,000 dilutions and then
48 performed a GABA ELISA. ELISA results showed, as expected, approximately a ten- fold difference in GABA levels between these three samples (Figure 13). We found that a 1:10 dilution was out of range of the ELISA; the level of GABA detected was significantly larger than the highest standard in the ELISA. We did not see time- dependent levels of GABA in the ELISA data shown in Figure 13, meaning that the
GABA levels we saw from this ELISA are solely due to endogenous GABA produced before assay initiation. Therefore, we determined that a 1:50 dilution is best when performing the enzyme assay because this will dilute endogenous GABA, while still allowing us to detect significant amounts of GABA produced during the enzyme assay.
[GABA] in Transfected PMS Samples at Various Dilutions
1/1,000
1/100
1/10
0 1 2 3 4 5 log([GABA]) (ng/mL)
Figure 13. Determination of appropriate sample dilution in enzyme assay. Graph shows GABA concentration detect by GABA ELISA. There is approximately a ten-fold difference in GABA concentration between the three differently diluted PMS samples. All samples are from cells transfected with wildtype GAD1 plasmid without GFP.
49
Quenching enzyme assay. To determine the most appropriate method of terminating the enzymatic reaction, we tried two methods. Both methods terminate the reaction by denaturing the enzyme. We attempted to quench the reaction by putting the sample in a 1.5mL microcentrifuge tube in boiling water for 10 minutes or by adding
SDS directly to the sample and boiling. We were unsure if boiling would denature the enzyme enough to completely stop the reaction. We were confident that SDS would terminate the reaction, but were unsure if SDS would interfere with binding in the GABA
ELISA. We found that SDS does in fact interfere with protein binding in the ELISA by performing the assay and ELISA with identical samples, except that one was denatured by boiling and the other by SDS (Figure 14). We also found that boiling the sample for
10 minutes was enough to denature the enzyme and stop the reaction.
[GABA] After Different Assay Termination Methods were Used
Boiled
SDS
0 0.5 1 1.5 2 log([GABA]) (ng/mL)
Figure 14. Determination of appropriate assay termination method. Graph shows GABA concentration detect by GABA ELISA. Identical samples were assayed for 30 minutes. Reactions were terminated with by boiling or by addition of SDS and boiling. Data suggests that SDS interferes with GABA detection because samples should have equivalent levels of GABA.
50
Determination of optimal pH for enzyme assay. When we first began GAD67 assay development, we maintained a pH of 7.2 in assay buffer. However, at this pH we were not seeing time-dependent GABA levels, suggesting that over-expressed GAD67 less active than expected during the assay. We then performed an ELISA with identical samples at a pH of 7.2 or pH 8. We saw higher GAD67 activity at pH 8 so remaining assays were performed at this pH. We were later able to achieve time-dependent GABA concentrations at this pH 8.
GABA production. Two ELISAs were performed that showed time-dependent
GABA production. Prism 4 software was used to graph the standard curves and determine unknown values. The standard curves produced from both ELISAs fit a second order quadratic polynomial curve well, with an R2 value of approximately 0.98 (Figure
15). Duplicate samples were included of standards in both ELISAs; both samples were used to calculate the standard curve formula. The standard curve from an ELISA was used to calculate GABA levels of unknown samples using samples’ OD values. ELISA results showed that control samples produced very little GABA, while transfected samples produced much higher levels (Figure 16). As the assay was permitted to continue longer, samples with over-expressed wildtype GAD67 showed increasing levels of GABA, while control samples did not. Figure 16 was normalized by GAPDH protein concentration determined by western blot. Assays were only permitted to continue for 10,
30, 60, and 120 minutes. To determine starting GABA levels (at 0 minutes) we assumed
GABA production was linear for the first 30 minutes of the assay (or first 60 minutes when a 30 minute time point was unavailable). We used the linear line formula of GABA level from 10 to 30 minutes and extrapolated to 0 minutes.
51
Standard Curve of GABA ELISA 1.6 1.4 1.2 1.0 0.8 0.6
Absorbance 0.4 0.2 0.0 0 2000 4000 6000 8000
GABA (ng/mL)
Figure 15. Standard curve of GABA ELISA data. The ELISA data fits a quadratic curve well, with a R2 value of approximately 0.98. Standard curve of the other ELISA (not shown) is similar. The graph shown here was developed in SigmaPlot for purposes of presentation, although Prism 4 was used to develop the standard curves and calculate unknowns.
52
GAD67 Activity from Fresh Cell Extracts (20mM Glutamate) 2000 1500
1000 Control Wildtype 500
GABA (ng/mL) GABA 0 0 20 40 60 80 100 120
Time (minutes) Figure 16. GABA ELISA performed with fresh control and wildtype samples. Samples assayed with 20mM glutamate. Data shows that control cell extracts maintain low levels of GABA, while cell extracts that contain over-expressed GAD67 show high endogenous GABA and time-dependent GABA production. Samples were normalized to GADPH protein, not GAD67 because control samples did not have detectable levels of GAD67.
Discussion
This chapter described the development of a GAD67 functional enzyme assay.
During this development, the most appropriate lysis method for our purposes had to be determined. We attempted cell lysis by freezing, dounce homogenization, and bead- mediated cell breakages. However, a tight glass homogenizer was used to lyse the cells because there is a greater chance that the other methods may liberate more proteolytic enzymes and destroy GAD67. Maintaining enzyme activity is of vital importance because cell lysis is performed shortly before the enzyme assay, in which we attempt to measure enzyme activity by GABA production.
53
One of the difficulties encountered when developing a GAD67 assay was the creation of a GAD67-GFP fusion protein from the original plasmid purchased. Use of a new plasmid that contained the GAD1 cDNA but not the GFP cDNA successfully prevented the translation of a GAD67-GFP fusion protein. However, without a GFP gene present in the plasmid, we were no longer able to visually determine transfection efficiency using immunofluorescence microscopy. Thus, we performed the assay and
ELISA first, then later performed a western blot that included the samples used in the assay and ELISA to quantitate the protein present. In this chapter we only compared control to wildtype samples so we quantitated using GAPDH (a house-keeping protein seen in HEK-293 cells). GAPDH was used instead of GAD67 because control samples did not have high enough levels of GAD67 to be detected by western blot, but both control and wildtype samples had detectable levels of GAPDH. Quantifying the number of cell equivalents present in each sample was especially necessary in this project because we saw a morphological change in cell structure after over-expression of wildtype GAD67. We saw that cells over-expressing wildtype GAD67 had a slower growth rate and rounded morphology, meaning wildtype GAD67 samples had fewer cell equivalents present in them, compared to control samples, when the enzyme assay was performed. This morphological difference was not seen in cells transfected with the previously purchased GAD1 plasmid that contained GFP. This suggests that the GAD67-
GFP fusion protein was not functional because if it was, it also should have been producing high levels of GABA, resulting in the same morphological difference in these transfected cells that we saw in cells transfected with the new GAD1 plasmid without
GFP.
54
It is known that GABA may act as a competitive inhibitor for GAD67. If this inhibition were to occur during the GAD67 assay, results would be difficult to interpret, as GAD67 enzyme might be capable of being more active than detected GABA levels would suggest. However, this is not the case in our assay because the amount of GABA produced in our assay was only between 10 and 20μM, while the Ki for GABA is
15.8mM (Porter and Martin, 1984). Also, including high levels of PLP can reactivate
GAD67 very quickly even if the GABA concentration is at or above Ki. The concentration of PLP required to reactive GAD67 in such an environment is 10μM
(Porter and Martin, 1984); we included 0.2mM PLP. Therefore, negative feedback caused by GABA does not need to be considered when interpreting our results.
In this experiment we did not utilize a method that would allow us to distinguish between endogenous GABA and GABA produced during the assay so that starting levels of GABA in the assay are not zero. An HPLC assay and the assay developed by Ilg et al would also have this problem (Ilg et al, 2013). Reducing the amount of endogenous
GABA would decrease the potential error in the experiment because it would be easier to determine if normalization by cell equivalent is correct because we would expect levels of GABA at time 0 to be zero for both wildtype and mutant samples. One method that would allow us to detect only GABA produced in the assay is to use radio-labeled 14C-
14 glutamate as substrate and detect CO2 production. Another method is to use low glutamate media after cells are transfected. We assume that the majority of endogenous
GABA is produced in the 48 hours after transfection and before cell harvesting; if the enzyme did not have access to high amounts of glutamate it would not be able to produce high levels of endogenous GABA and the level of background GABA would therefore be
55 reduced. Another method to prevent measuring endogenous GABA is to immunoprecipitate GAD67 from the cell extract; this would separate the enzyme from the endogenous GABA so that when GABA mass was measured by ELISA, only the
GABA produced during the assay would be measured and initial GABA levels would be at zero. Epitope tagging GAD67 is another method that would allow us to specifically immunoprecipitate the over-expressed GAD67, measure activity, and bypass endogenous
GABA complications. However, we chose not to tag the enzyme because we feared that a tag might interfere with enzyme function. Also since Arg532Gln has not been functionally studied, it is unknown if this mutant enzyme would be affected differently than the wildtype by a tag, which would destroy the integrity of the assay.
56
Chapter 4: Comparing Wildtype and Arg532Gln GAD67 Enzyme Activity
Introduction
A GAD67 enzyme assay was described in the previous chapter using the wildtype
GAD67. In this chapter, an Arg532Gln GAD67 mutation is introduced into the GAD67 expression construct and the rate of reaction for the wildtype and the mutant GAD67 enzymes are determined and compared. Comparing enzyme activities will allow us to conclude if Arg532Gln results in a functional change in GAD67.
Fresh and frozen samples were assayed at a substrate concentration well above the
Km value, at 20mM glutamate. Fresh samples were also assayed at the Km value. Ilg et al determined that 6.1mM glutamate is the Km for GAD67 (Ilg et al, 2013).
Materials and Methods
Creating Arg532Gln GAD67. A mutagenesis kit (Stratagene QuikChange II XL) was purchased to produce a Arg532Gln mutagenized GAD1 plasmid. Primers were designed using NCBI’s GenBank GAD1 reference genome and the plasmid sequence provided by Genecopoeia. Forward (GGCTGAATACCTCTATGCC) and reverse
(TAATACGACTCACTATAGGG) primers were used for mutagenesis. Twenty four colonies were picked containing the putative mutated GAD1 plasmid, grown up, purified
(QIAprep Spin MiniPrep Kit, Qiagen) and made into glycerol stocks to be used after confirmatory sequencing. The region harboring the mutation was purified (EdgeBio
Performa DTR Gel Filtration Cartridges) and sequenced in all 24 plasmid preparations to determine which samples were correctly mutagenized with a G to A mutation. Two samples were chosen at random from the samples that were determined to have the
57 desired mutation to perform complete sequencing of the GAD1 cDNA to ensure that the correct Arg532Gln GAD67 protein would be translated.
Determining reaction rate of wildtype and Arg532Gln GAD67 enzymes. After the Arg532Gln GAD67 cDNA was produced, the enzyme assay developed in Chapter 3
(Assay, GABA ELISA, and western blot) was repeated with wildtype and mutant enzyme to quantitatively compare the activity of these two GAD67 enzymes. Two enzyme assays were performed to ensure accuracy of results. Both ELISAs included fresh samples that were assayed in 20mM glutamate; the second ELISA also included fresh samples at the
Km substrate value (6.1mM glutamate) as another way to replicate the experiment. Frozen samples were also assayed at 20mM glutamate.
GABA levels were normalized to GAD67 protein levels in the PMS extracts as determined by western blot. When comparing wildtype to control samples, we normalized GABA concentration by GAPDH protein concentration. GAPDH is a housekeeping protein naturally present in HEK-293 cells. When comparing wildtype and mutant GAD67, samples were normalized to GAD67 protein concentration because this protein was over-expressed in both samples.
The formula used to determine reaction rate is: rate= GABA production (ng/mL)/ time (min), normalized to GAD67 protein expression. Reaction rate was calculated using the normalized GABA levels at 60 minutes and 10 minutes after assay initiation. This interval was chosen because ELISA data showed that the greatest linearity of GABA production was between these two time points, after which GABA levels started to plateau. To determine the GABA level produced per minute, the normalized GABA level
58 at 60 minutes was subtracted by the normalized GABA level at 10 minutes and then divided by 50 minutes.
Results
Cell morphology. HEK-293 cells transfected with wildtype or with Arg532Gln
GAD1 showed differential cell morphology and less cell confluency compared to control/untransfected cells (Figure 17A,B,C).
Figure 17. HEK-293 cells under microscope (100X) at day 2. A) Control/untransfected cells. B) Cells transfected with wildtype GAD1 plasmid 2 days after transfection. C) Cells transfected with mutant GAD1 plasmid 2 days after transfection. Wildtype and mutant cells have similar rounded cell morphology. Control cells are present in higher density and have a typical cell shape compared to wildtype and mutant transfected cells.
59
Normalization of GABA concentration. GABA levels were normalized by comparing GAD67 concentration between wildtype and mutant cell extracts. Western blot was used to determine GAD67 concentration by blotting with GAD67 rabbit primary antibody. Results showed that mutant samples had 17% less GAD67 than wildtype samples for this experiment (Figure 18). Mutant GABA values were then divided by
0.83 to determine the appropriate GABA production given the GAD67 concentration.
Figure 18. Western blot with control, wildtype and mutant samples. Membrane was blotted with GAD67 rabbit primary antibody. Samples include control/untransfected cell extracts (Con), cell extracts transfected with wildtype GAD1 cDNA (Wt), and cell extracts transfected with Arg532Gln GAD1 cDNA (Mut). Results show that GAD67 is correctly over-expressed in wildtype and mutant samples, but not in control samples. Mutant samples show a slightly lower GAD67 concentration than wildtype samples.
Determination of enzyme reaction rates. The reaction rates for fresh wildtype and mutant samples assayed at 20mM glutamate were calculated. We found the rate of reaction of fresh wildtype GAD67 to be 9.72ng/mL GABA produced per minute. We found the rate of reaction of Arg532Gln GAD67 to be 12.69ng/mL GABA produced per minute (Figure 19A). A repeat measure ANOVA test was performed. ANOVA test
60 results show that there is significant interaction between time and genotype (genotype meaning wildtype versus mutant GAD67) (F(3,4)=5.66, p=0.012), significant genotype main effect (F(1,4)=140.01, p<0.001), and significant time main effect (F(3,4)=251.25, p<0.001). Post hoc analysis was then performed using t-tests for each time point and found that mutant GAD67 had significantly higher GABA levels than wildtype GAD67 at 3 out of 4 time points (Table 4). Figure 19A also shows that Arg532Gln GAD67 samples produce a greater amount of endogenous GABA (GABA produced before the assay is begun).
61
A) GAD67 Activity from Fresh Cell Extracts (20mM Glutamate)
2400 2200 B) 2000 1800 Wildtype 1600 Arg532Gln
GABA (ng/mL) GABA 1400 0 20 40 60 80 100 120 Time (minutes)
B) GAD67 Activity from Fresh Cell Extracts (6.1mM Glutamate) 2400 2200 2000 1800 1600 Wildtype
GABA (ng/mL) GABA 1400 Arg532Gln 0 10 20 30 40 50 60
Time (minutes) Figure 19. GABA ELISA performed with fresh wildtype and mutant samples. ELISA data was normalized using quantitation of GAD67 protein. Time zero GABA concentration was calculated using the linear line from time 10 to 30 minutes. A) At 20mM glutamate, Arg532Gln GAD67 produces GABA at a faster rate and also produces higher levels of endogenous GABA than wildtype GAD67. B) At 6.1mM glutamate, Arg532Gln GAD67 also produces GABA at a higher rate than wildtype GAD67.
62
Time t- test t- test point significance significance (min) at 20mM at 6.1mM 10 0.0056* 0.0458* 30 0.1236 0.0221* 60 0.0244* 0.0471* 120 0.0413* -
Table 4. Significance between fresh wildtype and Arg532Gln GABA levels at various time points in the enzyme assay. Assay was performed with 20mM or 6.1mM glutamate. Significance was calculated by 2-tailed t-tests. * Statistically significant
This finding was replicated when fresh wildtype and Arg532Gln samples were assayed at the Km substrate concentration of 6.1mM glutamate (Figure 19B). The reaction rate calculated for wildtype GAD67 at this concentration is 5.42ng/mL GABA produced per minute. The reaction rate calculated for Arg532Gln GAD67 is 7.44ng/mL
GABA produced per minute. The GABA levels produced at 6.1mM glutamate are about half of what was produced at 20mM glutamate. This is expected because the Km should produce enzyme product, by definition, at half the maximum velocity, meaning about half the potential enzyme product is produced when compared to an assay proceeding at maximum velocity, as it occurred at 20mM glutamate. The ratio of mutant GAD67 reaction rate to wildtype GAD67 reaction rate is 1.31 for fresh samples at 20mM glutamate and 1.37 at 6.1mM glutamate (Table 5). Repeat measure ANOVA test results show that there is significant interaction between time and genotype (genotype meaning wildtype versus mutant GAD67) (F(2,4)=8.31, p=0.011), significant genotype main effect (F(1,4)=12.035, p=0.026), and significant time main effect (F(2,4)=41.46, p<0.001). Post hoc analysis was then performed using t-tests for each time point and
63 found that mutant GAD67 had significantly higher GABA levels than wildtype GAD67 at 3 out of 3 time points (Table 4).
Glutamate Reaction Rate Concentration Ratio (Mt/Wt) 20mM 1.31 6.1mM 1.37
Table 5. Reaction rate ratios at 20mM and 6.1mM glutamate. Rate ratios were calculated by dividing mutant reaction rate by wildtype reaction rate. Reaction rates were calculated using 60 and 10 minute time points. *statistically significant
Wildtype and mutant frozen samples were also assayed at 20mM glutamate.
These samples were frozen shortly after harvesting without protease inhibitors. These samples were also thawed for the second time when they were used for a second assay.
The reaction rate calculated for frozen wildtype GAD67 is 4.18ng/mL GABA per minute
(Figure 20). The reaction rate calculated for frozen Arg532Gln GAD67 is 10.62ng/mL
GABA per minute. The ratio of mutant to wildtype GAD67 reaction rate is 2.54, quite a bit higher than the ratio of fresh samples at 20mM glutamate and at 6.1mM glutamate.
Repeat measure ANOVA test results show that there is significant interaction between time and genotype (F(3,4)=3.65, p=0.044), significant genotype main effect
(F(1,4)=71.35, p=0.001), and significant time main effect (F(3,4)=57.81, p<0.001). Post hoc analysis was then performed using t-tests for each time point and found that mutant
GAD67 had significantly higher GABA levels than wildtype GAD67 at 3 out of 4 time points (Table 6).
64
GAD67 Activity from Frozen Cell Extracts (20mM Glutamate)
2600 2400 2200 2000 1800 Wildtype
GABA (ng/mL) GABA 1600 Arg532Gln 1400 0 20 40 60 80 100 120
Time (minutes)
Figure 20. GABA ELISA performed with frozen wildtype and mutant samples. Assay was performed with 20mM glutamate. The reaction rate of Arg532Gln GAD67 is greater after normalization than the reaction rate of wildtype GAD67.
Time point t- test (min) significance 10 0.0563 30 0.0009* 60 0.0029* 120 0.0235*
Table 6. Significance between frozen wildtype and Arg532Gln GABA levels at various time points in the enzyme assay. Assay was performed with 20mM glutamate. In 3 out of 4 time points, Arg532Gln GAD67 had significantly higher levels of GABA than wildtype GAD67. * Statistically significant
65
Discussion
In this chapter we discussed our attempt to compare enzyme activity between wildtype and Arg532Gln GAD67 enzyme. To do this, we calculated reaction rates of each of these enzymes and compared them. Reaction rate was determined by measuring the enzyme product (GABA) over time, such that, the greater slope of the linear part of the curve would correspond to higher enzyme activity. The enzyme assay was terminated at various time points to allow us to determine the GABA concentration curve. As the time of the reaction increases, so should GABA production until the enzyme reaches its maximum (Vmax). We found that Arg532Gln results in a higher rate of GABA production by GAD67 compared to wildtype GAD67. This suggests that Arg532Gln does result in a functional change in GAD67 enzyme by increasing GABA production, which the clinical data also suggested. We feel confident in the fresh sample reaction rates calculated because they were replicated in two conditions: at 20mM glutamate and 6.1mM glutamate. This finding is also supported by the differential cell morphology seen in cells transfected with wildtype and mutant GAD1 compared to untransfected/control cells because this morphological difference is likely the cells’ response to an increased level of
GABA.
The reaction rate ratio of mutant to wildtype was significantly higher in frozen samples than fresh samples at 20mM, 2.54 versus 1.31. The frozen rate ratio could be artificially inflated due to preferential degradation of the mutant enzyme. Arg532Gln might make GAD67 more susceptible to proteolysis. Since protease inhibitors are not added to samples to prevent interference during the ELISA, proteins are susceptible to protein degradation. This is compounded by the fact that the frozen samples used in this
66 experiment were thawed twice; with each thaw and re-freeze, more proteolysis occurs.
The GAD67 primary antibody used in the western blot will not bind to completely degraded proteins, meaning the mutant samples will produce an artificially low protein signal, but GABA levels will still be detected accurately. This means that it will appear as though fewer mutant enzymes are producing the detected amount of GABA, therefore when the mutant reaction rate is calculated it appears as though the mutant enzyme has a higher rate of reaction than it does in actuality. This artificially higher mutant rate will lead to the higher rate ratio that was calculated, compared to the fresh sample rate ratio.
In the future, protease inhibitor should be added to samples after they are used in the initial assay before freezing, to prevent proteolysis when they are thawed to quantify
GAD67 protein levels.
Samples were normalized to cell fraction determined by western blot. When comparing wildtype and mutant samples, a GAD67 primary antibody was used. If the mutant enzyme is more susceptible to protein degradation and the GAD67 signal was therefore weaker than it is in actuality, the normalization we performed is incorrect. We found that the ratio of mutant to wildtype GAD67 protein concentration was 0.83, meaning there was a higher concentration of GAD67 in wildtype samples than in mutant samples. More research is needed on Arg532Gln GAD67 to determine if this enzyme truly is more susceptible to proteolysis. If Arg532Gln GAD67 is degraded at a faster rate than wildtype GAD67, the normalization we performed is incorrect and Arg532Gln and wildtype GAD67 could be producing similar levels of GABA.
It is important to remember that the time 0 points on the ELISA results graphs were calculated by extrapolating, not from directly acquired data. For ELISA graphs with
67 a 30 minute time point, the 0 minute time point was calculated by assuming GABA production was occurring at a linear rate from 0 to 30 minutes in the assay. If this is not true, the 0 minute time points are incorrect. Some ELISAs were not performed with a 30 minute time point, only 10, 60, and 120 minutes. To calculate a 0 minute time point for these graphs, we assumed GABA creation was linear from 0 to 60 minutes.
68
Chapter 5: Closing Remarks
Our clinical data suggest that Arg532Gln in GAD1 and His180Tyr in ALDH5A1 significantly affect processing speed. An enzyme assay was performed on the GAD67 enzyme and not SSADH enzyme because the SSADH enzyme had already been well characterized in previous papers, while the Arg532Gln mutation in GAD67 had not. Our
GAD67 enzyme assay suggested that Arg532Gln does result in a functional change in the
GAD67 enzyme. We found that our results support our hypothesis that Arg532Gln
GAD67 produces GABA at an increased rate compared to wildtype GAD67. This finding is significant because it is uncommon to find a mutation that increases enzyme function; reported functional mutations more often result in a decrease in enzyme activity. We hypothesized this because the clinical data suggested that both Arg532Gln in GAD1 and
His180Tyr in ALDH5A1 were both associated with processing speed deficit. Since
GAD67 and SSADH enzymes are responsible for GABA synthesis and degradation respectively, this suggested that both variants affect GABA level; either by increasing or decreasing it. The DSCT findings suggested that the variants had opposing effects. As it was already established that His180Tyr decreases SSADH activity, the logical hypothesis was that Arg532Gln increases GAD67 activity.
The interpretation of ELISA results was dependent on the normalization we performed on detected GABA levels. Normalization was performed using GAD67 concentration determined by western blot. Western blot was performed using frozen mutant and wildtype samples. As stated earlier, it seems as though Arg532Gln GAD67 might be more susceptible to proteolysis than wildtype GAD67. If this is the case, the western blot would detect a lower mutant GAD67 concentration after freezing and
69 thawing than what was present during assaying. This means that we normalized mutant
GABA concentrations by a greater amount than necessary and mutant GABA levels would appear greater than they were in actuality. This means that our conclusion that
Arg532Gln increases GAD67 activity might be incorrect. In the future, a way to prevent proteolytic activity is to add protease inhibitor to samples after assaying, before freezing.
Protease inhibitor was not added to samples directly after harvesting because it could potentially affect enzyme activity. However if protease inhibitors were added after the
ELISA was performed, this could possibly prevent major enzyme degradation before these samples were used to perform a western blot.
Future research on GAD67 should be performed to determine if wildtype and
Arg532Gln GAD67 have similar Km values. It is possible that Arg532Gln alters the Km value of the enzyme. Complete substrate curves of these enzymes should be performed to determine this.
The GAD67 enzyme assay developed here is the first GAD67 assay, that we are aware of, that does not use HPLC or radioactivity to detect enzyme activity. The GAD67 assay developed here can be used to determine functionality of other variants within this enzyme. The GABA detection system used here, a GABA ELISA, can also be used in assays with other GABAergic enzymes to determine if other variants in these enzymes result in a functional change.
These findings are important because they relate to GABA regulation. GABA is an inhibitory neurotransmitter that plays an important role in cognitive functioning. In this study, we focused on the effect of GABA level on processing speed. We found that
70
Arg532Gln in GAD67 increases enzyme activity and results in increased levels of
GABA, while His180Tyr in SSADH results in decreased enzyme activity, which also leads to increased levels of GABA. Since we found that both of these mutations are associated with slower processing speed, these results suggest that higher levels of
GABA are associated with slower processing speed.
In this study, we investigated two variants in genes responsible for GABAergic pathway regulation. Future research should examine more variants in these genes, as it is likely that other variants in these genes also have an effect on processing speed or other cognitive functions. Through clinical data, we found an association between altered
GABA level and processing speed. Future research should be done to further understand the role of excess GABA on other cognitive abilities.
71
References
Addington, AM et al. (2005) GAD1 (2q31.1), which encodes glutamic acid decarboxylase (GAD67), is associated with childhood-onset schizophrenia and cortical gray matter volume loss. Molecular Psychiatry, 10, 581-588.
Akbarian, S. et al. (1995). Gene expression for glutamic acid decarboxylase is reduced without loss of neurons in prefrontal cortex of schizophrenics. Archives of General Psychiatry, 52, 258-266.
Asada, H. et al. (1996). Mice lacking the 65 kDa isoform of glutamic acid decarboxylase (GAD65) maintain normal levels of GAD67 and GABA in their brains but are susceptible to seizures. Biochemical and Biophysical Research Communications, 229(3), 891–895.
Asada, H. et al. (1997). Cleft palate and decreased brain gamma-aminobutyric acid in mice lacking the 67-kDa isoform of glutamic acid decarboxylase. Proceedings of the National Academy of Sciences of the USA, 94(12), 6496–6499.
Battaglioli, Gino et al. (2003). Kinetic differences between the isoforms of glutamate decarboxylase: implications for the regulation of GABA synthesis. Journal of Neurochemistry, 86, 879-887.
Blasi, P. et al. (2002). Structure of human succinic semialdehyde dehydrogenase gene: identification of promoter region and alternatively processed isoforms. Molecular Genetics and Metabolism, 76, 348–362.
Blasi, P. et al. (2006). SSADH variation in primates: Intra and interspecific data on a gene with a potential role in human cognitive functions. Journal of Molecular Evolution, 63, 54–68.
Brébion, G. et al. (1998). Memory impairment and schizophrenia: the role of processing speed. Schizophrenia Research 30(1), 31-39.
Chabris, CF et al. (2012). Most reported genetic associations with general intelligence are probably false positives. Psychological Science 23(11), 1314-23.
Charych, EI et al. (2009). GABA(A) receptors and their associated proteins: implications in the etiology and treatment of schizophrenia and related disorders. Neuropharmacology 57(5-6), 481-95.
Costa, E. (2004). A GABAergic cortical deficit dominates schizophrenia pathophysiology. Critical Reviews in Neurobiology, 16(1-2), 1-23.
Craddock, N et al. (2010). Strong genetic evidence for a selective influence of GABAA receptors on a component of the bipolar disorder phenotype. Molecular Psychiatry 15(2), 146-53.
72
Curley, AA et al. (2011). Cortical deficits of glutamic acid decarboxylase 67 expression in schizophrenia: clinical, protein, and cell type-specific features. The American Journal of Psychiatry, 168(9), 921-9.
Daskalakis, ZJ et al. (2002). Evidence for impaired cortical inhibition in schizophrenia using transcranial magnetic stimulation. Archives of General Psychiatry, 59(4), 347-54.
De Luca, V. (2004). Polymorphisms in glutamate decarboxylase genes: analysis in schizophrenia. Psychiatric Genetics, 14(1), 39-42.
De Rango, F et al. (2008). Cognitive functioning and survival in the elderly: the ALDH5A1 C538T polymorphism. Annals of Human Genetics, 72, 630-635.
Dickinson, Dwight et al. (2007). Overlooking the Obvious: A Meta-analytic Comparison of Digit Symbol Coding Tasks and Other Cognitive Measures in Schizophrenia. Archives of General Psychiatry, 64, 532-542.
Dracheva, S et al. (2004). GAD67 and GAD65 mRNA and protein expression in cerebrocortical regions of elderly patients with schizophrenia. Journal of Neuroscience Research 76(4), 581-92.
Erlander et al. (1991). Two genes encode distinct glutamate decarboxylases. Neuron, 7, 91-100.
Fatemi, SH. (2005). GABAergic dysfunction in schizophrenia and mood disorders as reflected by decreased levels of glutamic acid decarboxylase 65 and 67 kDa and Reelin proteins in cerebellum. Schizophrenia Research, 72(2-3), 109-122.
Fengyun, Ji et al. (1999). GABA and histogenesis in fetal and neonatal mouse brain lacking both the isoforms of glutamic acid decarboxylase. Neuroscience Research, 33, 187-194. Gao, WJ et al. (2003). Selective modulation of excitatory and inhibitory microcircuits by dopamine. Proceedings of the National Academy of Sciences of the USA, 100(5), 2836- 2841.
Gibson, KM et al. (1997). The clinical phenotype of succinic semialdehyde dehydrogenase deficiency (4-hydroxybutyric aciduria): case reports of 23 new patients. Pediatrics, 99(4), 567-574.
Goldman-Rakic, PS. (1990). Cellular and circuit basis of working memory in prefrontal cortex of nonhuman primates. Progress in Brain Research, 85, 325-35; discussion 335- 326.
Gooday, R et al. (1995). Benzodiazepine receptor antagonism improves reaction time in latent hepatic encephalopathy. Psychopharmacology, 119(3), 295-8.
73
Goto, N et al. (2009). Reduction of brain gamma-aminobutyric acid (GABA) concentrations in early-stage schizophrenia patients: 3T proton MRS study. Schizophrenia Research, 112(1-3), 192–193.
Goto, N et al. (2010). No alterations of brain GABA after 6 months of treatment with atypical antipsychotic drugs in early-stage first-episode schizophrenia. Progress in Neuro-psychopharmacology & Biological Psychiatry, 34(8), 1480-3.
Green, EK et al. (2010). Variation at the GABAA receptor gene, Rho 1 (GABRR1) associated with susceptibility to bipolar schizoaffective disorder. American Journal of Medical Genetics. Part B, Neuropsychiatric Genetics, 153B(7), 1347-9.
Guidotti, A. et al. (2000). Decrease in reelin and glutamic acid decarboxylase67 (GAD67) expression in schizophrenia and bipolar disorder: a postmortem brain study. Archives of General Psychiatry, 57(11), 1061-1069.
Hashimoto, T. et al. (2005). Relationship of brain-derived neurotrophic factor and its receptor TrkB to altered inhibitory prefrontal circuitry in schizophrenia. The Journal of Neuroscience, 25(2), 372-383.
Hashimoto, T. et al. (2008). Alterations in GABA-related transcriptome in the dorsolateral prefrontal cortex of subjects with schizophrenia. Molecular Psychiatry, 13(2), 147-161.
Heinrichs, R and Zakzanis, K. (1998). Neurocognitive deficit in Schizophrenia: A quantitative review of the evidence. Neurophysiology, 12(3), 426-445.
Henry, JD and Crawford, JR. (2005). A meta-analytic review of verbal fluency deficits in schizophrenia relative to other neurocognitive deficits. Cognitive Neuropsychiatry, 10(1), 1–33.
Hyde, Thomas et al. (2011). Expression of GABA signaling molecules KCC2, NKCC1, and GAD1, in cortical development of schizophrenia. The Journal of Neuroscience, 31(30), 11088-11095.
Ikeda, M. (2007). No association between the glutamate decarboxylase 67 gene (GAD1) and schizophrenia in the Japanese population. Schizophrenia Research, 91(1-3), 22-26.
Ilg, Thomas et al. (2013). Glutamate decarboxylase of the parasitic arthropods Ctenocephalides felis and Rhipicephalus microplus: Gene identification, cloning, expression, assay development, identification of inhibitors by high throughput screening and comparison with the orthologs from Drosophila melanogaster and mouse. Insect Biochemistry and Molecular Biology, 43, 162-177.
Hakak, Y. (2001). Genome-wide expression analysis reveals dysregulation of myelination-related genes in chronic schizophrenia. Proceedings of the National Academy of Sciences of the USA, 98(8), 4746-51.
74
Kash, S.F. et al. (1997). Epilepsy in mice deficient in the 65-kDa isoform of glutamic acid decarboxylase. Proceedings of the National Academy of Sciences of the USA, 94, 14060-14065.
Knowles, Emma E.M. et al. (2010). Processing speed deficits in schizophrenia: Reexamining the evidence. The American Journal of Psychiatry, 167(7), 828-835.
Kegeles, Lawrence S et al. (2012). Elevated Prefrontal Cortex γ-Aminobutyric Acid and Glutamate-Glutamine Levels in Schizophrenia Measured In Vivo With Proton Magnetic Resonance Spectroscopy. Archives of General Psychiatry, 69(5), 449-459.
Leone, O et al. (2006). A human derived SSADH coding variant is replacing the ancestral allele shared with primates. Annals of Human Biology, 33(5-6), 593-603.
Lewis, DA and Hashimoto, T. (2007). Deciphering the disease process of schizophrenia: the contribution of cortical GABA neurons. International Review of Neurobiology, 78, 109-131.
Lewis, DA et al. (2008). Subunit-selective modulation of GABA type A receptor neurotransmission and cognition in schizophrenia. The American Journal of Psychiatry, 165(12), 1585-93.
Lo, WS et al. (2004). Association of SNPs and haplotypes in GABAA receptor beta2 gene with schizophrenia. Molecular Psychiatry, 9(6), 603-8.
Lo, WS et al. (2007). GABRB2 association with schizophrenia: commonalities and differences between ethnic groups and clinical subtypes. Biological Psychiatry, 61(5), 653-60.
Lorenz, S et al. (2006). Candidate gene analysis of the succinic semialdehyde dehydrogenase gene (ALDH5A1) in patients with idiopathic generalized epilepsy and photosensitivity. Neuroscience Letters, 397(3), 234-9.
Lundorf, MD. (2005). Mutational screening and association study of glutamate decarboxylase 1 as a candidate susceptibility gene for bipolar affective disorder and schizophrenia. American Journal of Medical Genetics. Part B, Neuropsychiatric Genetics, 135B(1), 94-101.
Malaspina, P et al. (2009). Comparative genomics of aldehyde dehydrogenase 5a1 (succinate semialdehyde dehydrogenase) and accumulation of gamma-hydroxybutyrate associated with its deficiency. Human Genomics, 3(2), 106-120.
Marenco, S et al. (2010). Genetic modulation of GABA levels in the anterior cingulate cortex by GAD1 and COMT. Neuropsychopharmacology, 35(8), 1708-17.
Martin, DL. (1987). Regulatory properties of brain glutamate decarboxylase. Cell and Molecular Neurobiology, 7(3), 237-53.
75
Mason, GF et al. (2001). Decrease in GABA synthesis rate in rat cortex following GABA-transaminase inhibition correlates with the decrease in GAD(67) protein. Brain Research, 914(1-2), 81–91.
Mejia-Toiber, J et al. (2012). In vivo GABA release and kinetics of transgene loss in a GABAergic cell line after long-term transplantation into the rat brain. Neuroscience, 203, 244-254.
Mellios, N et al. (2009). Molecular determinants of dysregulated GABAergic gene expression in the prefrontal cortex of subjects with schizophrenia. Biological Psychiatry, 65(12), 1006-14.
Menzies, L et al. (2007). Effects of gamma-aminobutyric acid-modulating drugs on working memory and brain function in patients with schizophrenia. Archives of General Psychiatry, 64(2), 156-67.
Mirnics, K et al. (2000). Molecular characterization of schizophrenia viewed by microarray analysis of gene expression in prefrontal cortex. Neuron, 28(1), 53-67.
Mueser, Kim and McGurk, Susan. (2004). Schizophrenia. Lancet, 363, 2063-72.
Ongür, D et al. (2010). Elevated gamma-aminobutyric acid levels in chronic schizophrenia. Psychiatry, 68(7), 667-70.
Pan, Y et al. (2012). Strain dependent gene expression and neurochemical levels in the brain of zebrafish: Focus on a few alcohol related targets. Physiology & Behavior, 107(5), 773-780. Petryshen, TL. (2005). Genetic investigation of chromosome 5q GABAA receptor subunit genes in schizophrenia. Molecular Psychiatry, 10(12), 1074-88, 1057.
Plomin, R et al. (2004). A functional polymorphism in the succinate-semialdehyde dehydrogenase (aldehyde dehydrogenase 5 family, member A1) gene is associated with cognitive ability. Molecular Psychiatry, 9(6), 582–586.
Porter, TG and Martin, DL. (1984). Evidence for feedback regulation of glutamate decarboxylase by γ-aminobutyric acid. Journal of Neurochemistry, 43(5), 1464-1467.
Porter, TG et al. (1985). Transaminations catalysed by brain glutamate decarboxylase. The Biochemical Journal, 231(3), 705-12.
Regier, DA et al. (1993). The de facto US mental and addictive disorders service system. Epidemiologic catchment area prospective 1-year prevalence rates of disorders and services. Archives of General Psychiatry, 50(2), 85-94.
Reichenberg, A and Harvey, PD. (2008). Neuropsychological impairments in schizophrenia: integration of performance-based and brain imaging findings. Psychological Bulletin, 133(5), 833–858.
76
Rimvall, K et al. (1993). Effects of increased gamma-aminobutyric acid levels on GAD67 protein and mRNA levels in rat cerebral cortex. Journal of Neurochemistry, 60(2), 714–720.
Salthouse, TA. (1996). The processing-speed theory of adult age differences in cognition. Psychological Review, 103(3), 403-428.
Seamans, JK et al. (2004). The principal features and mechanisms of dopamine modulation in the prefrontal cortex. Progress in Neurobiology, 74(1), 1-58.
Soghomonian, JJ et al. (1998). Two isoforms of glutamate decarboxylase: why? Trends in Pharmacological Sciences, 19(12), 500-505.
Stewart, SA. (2005). The effects of benzodiazepines on cognition. Journal of Clinical Psychology, 66(Suppl 2), 9-13.
Straub, BK et al. (2007). Allelic variation in GAD1 (GAD67) is associated with schizophrenia and influences cortical function and gene expression. Molecular Psychiatry, 12, 854-869.
Vawter, M.P. et al. (2002). Microarray analysis of gene expression in the prefrontal cortex in schizophrenia: a preliminary study. Schizophrenia Research, 58(1), 11-20.
Volk, D.W. et al. (2000). Decreased glutamic acid decarboxylase67 messenger RNA expression in a subset of prefrontal cortical gamma-aminobutyric acid neurons in subjects with schizophrenia. Archives of General Psychiatry, 57(3), 237-245.
Wechsler, D. (1997). Wechsler Adult Intelligence Scale. 3rd ed. San Antonio: Psychological Corp.
Wei, Jianning and Wu Jang-Yen. (2005). Structural and functional analysis of cysteine residues in human glutamate decarboxylase 65 (GAD65) and GAD67. Journal of Neurochemistry, 93, 624-633.
Wu, EQ et al. (2005). The economic burden of schizophrenia in the United States in 2002. Journal of Clinical Psychiatry, 66(9), 1122-9.
Wu, J.Y. and Roberts, E. (1974). Properties of brain L-glutamate decarboxylase: Inhibition studies. Journal of Neurochemistry, 23, 759-767.
Wu, Jang-Yen et al. (1985). L-Glutamate Decarboxylase from Brain. Methods in Enzymology, 113, 3-9.
Yoon, JH et al. (2010). GABA concentration is reduced in visual cortex in schizophrenia and correlates with orientation-specific surround suppression. The Journal of Neuroscence, 30(10), 3777–3781.
77
Zai, CC et al. (2009). Association study of the gamma-aminobutyric acid type a receptor gamma2 subunit gene with schizophrenia. Schizophrenia Research, 114(1-3), 33-8.
Zhao, X et al. (2007). Systematic study of association of four GABAergic genes: glutamic acid decarboxylase 1 gene, glutamic acid decarboxylase 2 gene, GABA(B) receptor 1 gene and GABA(A) receptor subunit beta2 gene, with schizophrenia using a universal DNA microarray. Schizophrenia Research, 93(1-3), 374-84.
78