HORTSCIENCE 46(11):1456–1459. 2011. plant crop to the U.S. nursery industry. Total sales of Viburnum were $19,500,000 in 1998 (U.S. Dept. of Agr., 1998), and sales increased Screening and Characterization to $24,647,000 in 2007 (USDA-NASS, 2010). Growing awareness and ongoing breeding ef- of 11 Novel Microsatellite Markers forts have led to increasing consumer demand for viburnum shrubs. Viburnum dilatatum,a from Viburnum dilatatum common and versatile species that is native to Asia, was introduced to the United States in Deborah Dean and Phillip A. Wadl 1846 and is valued for its vibrant fall color, Department of Entomology and Plant Pathology, University of Tennessee, leaf color retention, and outstanding cherry- 2431 Joe Johnson Drive, Knoxville, TN 37996 red fruit production that persists into winter. For these reasons, it has become increasingly Xinwang Wang prevalent in horticultural commerce (Dirr, 2007). Texas AgriLife Research and Extension Center, Texas A&M University, At maturity, the shrub reaches 1.5 to 3.0 m (5 to 10 feet) tall and exhibits lustrous dark System, 17360 Coit Road, Dallas, TX 75252 green leaves. William E. Klingeman There are striking diversity among horti- cultural characteristics in Viburnum species, Department of Plant Sciences, University of Tennessee 2431 Joe Johnson including leaf shape, fruit and flower color, Drive, Knoxville, TN 37996 fertility, and plant growth habit (Dirr, 2007; Winkworth and Donoghue, 2004). Erected by Bonnie H. Ownley Linnaeus in 1753, the genus has undergone Department of Entomology and Plant Pathology, University of Tennessee, more than 10 taxonomic revisions, and de- 2431 Joe Johnson Drive, Knoxville, TN 37996 spite those classification efforts, evolutionary relationships and geographical relatedness Timothy A. Rinehart of the species have been largely unaddressed USDA-ARS, Southern Horticultural Laboratory, 810 Highway 26 West, (Winkworth and Donoghue, 2005). Winkworth Poplarville, MS 39470 and Donoghue (2005) combined molecular data using two chloroplast genes (trnK intron Brian E. Scheffler and psbA-trnH IGS) and three nuclear loci USDA-ARS-CGRU MSA Genomics Laboratory, 141 Experiment Station Road, (nrIts, WAXY1, and WAXY2) to provide a bio- Stoneville, MS 39470 geographical analysis of the genus. Although 12 well-supported species groups, or clades, Robert N. Trigiano1 were identified using the molecular data, is- Department of Entomology and Plant Pathology, University of Tennessee, sues within this eclectic genus still linger. For example, the relationship between the section 2431 Joe Johnson Drive, Knoxville, TN 37996 Pseudotinus and the species V. clemensiae Additional index words. Adoxaceae, genomic library, ornamentals, invasive species, poly- and V. urceolatum is not well supported. In morphism information content, SSRs addition, the rates of diversification remain unclear, and there is a persistent lack of re- Abstract. Viburnum dilatatum is a popular and economically important ornamental solution at the base of the phylogenetic tree shrub. The wide range of desirable horticultural traits, paired with a propensity for (Winkworth and Donoghue, 2004, 2005). Not seedlings to become invasive, has created interest in the genetics and breeding of this surprisingly, a plethora of cultivars and hybrids species. To investigate the genetic diversity of V. dilatatum, microsatellite loci were further complicate the organization of this vast identified from a GT-enriched genomic library constructed from V. dilatatum ‘Asian genus (Dirr, 2007). Beauty’. Eleven microsatellite loci have been characterized on a group of 16 different Although many ornamental plants, includ- related V. dilatatum cultivars and hybrids. Two to 12 alleles were identified per locus, and ing V. dilatatum, make important contribu- the polymorphism information content (PIC) values ranged from 0.36 to 0.87. Expected tions to regional environmental health and heterozygosity (He) ranged from 0.48 to 0.88 and observed heterozygosity (Ho) ranged diversity, certain non-native species have es- from 0 to 0.73. This set of molecular markers also exhibited expected transferability caped cultivation and are causing economic between various V. dilatatum cultivars and two hybrids with V. japonicum. As a conse- damage. During a period of 85 years (1906 quence, these markers will aid in breeding for new cultivar development, assist with early to 1991), 79 exotic plant species have been detection and screening of plants that have escaped cultivation, and are expected to help in deemed responsible for almost $97 billion in refining the phylogenetic relationship of V. dilatatum to other species and genera within the damages in the United States (Office of Tech- Adoxaceae. nology Assessment, 1993). Many of the plants listed on invasive species lists such as Celas- trus orbiculatus, Euonymus alatus, and Pyrus The genus Viburnum includes more than calleryana remain economically important and 160 species of shrubs and small trees distrib- popular nursery plants (The University of uted widely throughout the Northern hemi- Georgia, 2010). Regardless, invasive plants sphere and into the Southern hemisphere cause significant economic damage and can Received for publication 11 July 2011. Accepted (Winkworth and Donoghue, 2004). Collec- lead to considerable reductions in populations for publication 2 Sept. 2011. tively, Viburnum species provide many ideal of native flora and fauna, often in response to This study was supported by the U.S. Department year-round ornamental qualities. The attrac- competition for limited resources (Anonymous, of Agriculture Grant #58-6404-7-213. tive flowers and glossy green leaves of spring 2008). Unfortunately, current methods of non- We thank the following persons for plant material and assistance: Michael S. Dosmann, Joan Feely, and summer give way to an array of bright native plant management, which include phys- Kunso Kim, Dr. Margaret Pooler, Dr. Thomas G. berries and vibrant fall foliage with colors ical removal, herbicidal and biological con- Ranney, and Kathryn Richardson. ranging from yellow to red to dark purple. The trol methods, have not been practical or 1To whom reprint requests should be addressed; multiseasonal allure of plants in this genus effective in controlling extensive proliferation e-mail [email protected]. makes Viburnum an important ornamental of many invasive ornamental plants (Li et al.,
1456 HORTSCIENCE VOL. 46(11) NOVEMBER 2011 2004). Indeed, the increase in commercial a biotin enrichment protocol (Wang et al., fragments were transformed into Escherichia availability of potentially problematic plants 2007). From the library, 11 polymorphic coli TOP 10 Electrocompä cells (Invitrogen, makes early characterization of potential pest markers were developed and used to charac- Carlsbad, CA) using the Gene Pulser XcellÒ plants and their cultivars a high priority. The terize a group of V. dilatatum accessions and Electroporation System (Bio-Rad, Hercules, New Jersey Invasive Species Strike Team cultivars. It is envisioned that these markers CA) and then grown in petri dishes containing placed V. dilatatum on a 2010 Watch List of will be useful in discerning taxonomic re- Luria-Bertani-ampicillin (LB) medium and the invasive species that identifies plants that lationships and will be used in future efforts indicator IPTG and X-gal following the manu- may pose a threat to native plant communities to track and identify the origins of V. dilata- facturer’s recommendations. The petri dishes (Anonymous, 2010). Viburnum dilatatum can tum plants within populations that have es- were then incubated overnight at 37 Cand form thickets after escaping cultivation that caped cultivation. evaluated for color expression and cell growth may displace or prevent growth of less com- (Sambrook et al., 1989). petitive native herbs, shrubs, and trees. Shrubs Materials and Methods Detection of putative microsatellites within yield an abundance of viable seed from a typ- the cloned DNA fragments was completed as ically heavy seasonal fruit set (Dirr, 2007). In Genomic DNA from unopened flower buds previously described (Wang et al., 2007) with turn, viable seeds aid in the rapid coloniza- or young leaves of 16 samples (Table 1) was minor modifications. Cells from white colo- tion of land previously not colonized with extracted using DNeasyÒ Plant Mini Kit nies with putative inserts were placed in a 10- V. dilatatum. (Qiagen, Germantown, MD) and quantified mL PCR reaction mixture containing 1 · PCR Ò Some invasive species, including V. dila- using a NanoDrop ND-1000 ultraviolet-Vis gold buffer, 0.2mM dNTPs, 2.0 mM MgCl2, tatum, may be difficult to discern from native Spectrophotometer (NanoDrop Technologies, 0.3 U AmpliTaq Gold DNA polymerase (Ap- vegetation (Anonymous, 2008). Dirr (2007) Wilmington, DE). The quality of DNA was plied Biosystems, Foster City, CA), 0.25 mM stated that V. dilatatum is difficult to identify visually assessed on 2% agarose gels, stained each of the following three primers: T3, T7, based on foliage, because some specimens with ethidium bromide, and visualized in a and (GT)12, and sterile water. Conditions dur- may have branches with two differently shaped 2000 Gel Doc System (Bio-Rad Laboratories, ing PCR were: one cycle at 96 C for 2 min leaves comingling. Indeed, V. dilatatum has Hercules, CA). Microsatellite sequences were followed by 35 cycles of 94 C for 1 min, been observed along the woodland edges of attained from the genomic library and en- 50 Cfor1min,72 Cfor1min,andonecycle the National Arboretum, often growing un- riched for (GT)n using biotin hybridization of 72 C for 1 min. PCR amplicons were detected until old enough to display their based on previous methods by Wang et al. visualized on a 2% agarose gel containing unmistakable red fruits (J. Feely, personal com- (2007). DNA (2.5 mg) was digested at 37 C ethidium bromide. Amplicons with a DNA munication). Moreover, there is anecdotal evi- for 5 min with AluI, HaeIII, RsaI, and StuI to smear were considered putatively positive for dence to suggest that V. dilatatum may be generate blunt-end fragments that ranged from having a microsatellite insert (Wang et al., escaping cultivation and hybridizing with the 250 to 800 bp. Fragments were ligated to SNX 2007). Colonies of interest were collected and natively occurring V. dentatum (J. Feely, per- linkers and recovered using the SNX forward duplicated in 100 mL of LB-ampicillin freez- sonal communication). This caveat necessi- primer adaptors: 5# CTAAGGCCTTGCTAG ing medium (Sambrook et al., 1989). Plasmid tates the availability of a reliable method for CAGAAGC 3# and 3#AAAAGATTCCGGAA DNA from the putative positive colonies was identification of this popular ornamental shrub CGATCGTCTTCGp 5# (Hamilton et al., 1999). isolated using a modified alkaline lysis method and its hybrids. Column-purified PCR products were hybrid- and was sequenced (ABI Big-Dye Version 3.1 A group identified as the Invasive Plant ized to (GT)12 biotinylated oligonucleotides to terminators) on a Model ABI 3730XL capil- Research and Partnerships with Ornamental enrich fragments that contained (GT)n micro- lary electrophoresis DNA sequencer (Applied Horticulture and Natural Resource Manage- satellite sequences (QIAquick PCR purification Biosystems). ment convened for a workshop in 2008 to Kit, Valencia, CA). Streptavidin MagnesphereÒ Putative microsatellite-containing colonies discuss the problem of invasive plant species. Paramagnetic Particles (Promega, Madison, were sequenced (n = 198), 47 primer pairs were Research areas were identified and included WI) were used to capture the biotinylated designed from the resultant sequences using the following priorities: develop scientific desired motifs (Hamilton et al., 1999; Wang Primer 3.0 (Rozen and Skaletsky, 1998), and means to evaluate the persistence and spread et al., 2004, 2007). The enriched PCR fragment synthesized by Integrated DNA Technolo- of invasive plants; enhance detection methods products were column-purified and ligated to gies (Coralville, IA). Primer pairs were opti- for invasive taxa; and acquire a means to iden- the EcoRV digested pBluescript II SK (+) mized for PCR using DNA from V. dilatatum tify invasive species, cultivars, and hybrids of vector, (Stratagene, Hanover, MD) at an 8:1 ‘Asian Beauty’ and ‘Erie’. Microsatellite am- cultivars such as genetic markers (Anonymous, insert to vector ratio. The vector and ligated plification was completed using the following 2008). Molecular markers provide a means of enriched simple sequence repeat-containing 10-mL PCR reaction mixture: 4 ng of genomic meeting these criteria. Molecular tools have become a superior method for interspecific and intraspecific hy- Table 1. Accessions of Viburnum dilatatum and other taxa and their sources. brid analysis and cultivar identification of or- z namental plants (Pounders et al., 2007; Wadl Species/cultivars/forma analyzed Specimen origin/accession number et al., 2008, 2009; Wang et al., 2010). Micro- V. dilatatum NA 56670 satellites are ubiquitous throughout genomes V. dilatatum NA 80690 V. dilatatum ‘Asian Beauty’ NCSU and codominant markers, often used in both V. dilatatum ‘Asian Beauty’ MA 503-99*1 L-31/52-07 interspecific and intraspecific diversity stud- (V. japonicum · V. dilatatum ‘Catskill’) ‘Chippewa’ NCSU ies (Gupta and Varshney, 2000). These ge- V. dilatatum ‘Erie’ NCSU netic markers exhibit hypervariabilty and are V. dilatatum ‘Erie’ MA 784-2005*1 76-10 easily detected using polymerase chain re- V. dilatatum ‘Henneke’ MA 153-2004*1 M-43/12-47 action (PCR) and two unique primers (Powell V. dilatatum forma hispidum AA 1120-86 *B et al., 1996). Microsatellite markers are ideal V. dilatatum ‘Iroquois’ MA 640-2006*1 FF-016/70-95 for identification and genetic fingerprinting V. dilatatum forma pilosulum NA 55216 of plants because of the high levels of poly- V. dilatatum forma pilosulum NA 66267 V. dilatatum forma pilosulum AA 77-90 *B morphism they possess (Datta et al., 2010). V. dilatatum forma pilosulum AA 36-72 *A Based on searches of the literature and Gen- V. dilatatum ‘Michael Dodge’ NCSU Bank, there is a dearth of microsatellite markers (V. japonicum· V. dilatatum) ‘Fugitive’ NCSU that can be applied to the genus Viburnum.In zSpecimen origin: AA = Arnold Arboretum of Harvard University, Jamaica Plain, MA; MA = Morton this study, we created a small insert genomic Arboretum, Lisle, IL; NA = National Arboretum, Washington, DC; NCSU = Department of Horticultural library from V. dilatatum ‘Asian Beauty’ using Science, North Carolina State University, Raleigh, NC.
HORTSCIENCE VOL. 46(11) NOVEMBER 2011 1457 DNA, 0.25 mM forward and reverse primers, Results and Discussion programs and patent protection. Moreover, 2.0 mM MgCl2, 0.2 mM dNTPs, 1 · PCR gold early and accurate identification of invasive buffer, 0.4 U AmpliTaq Gold DNA poly- A total of 81 alleles were observed across species could be a useful tool in combating merase, and sterile water. The following PCR the 11 loci. The number of alleles per locus plant invasiveness. As more ornamental plant conditions were used: one cycle of 94 C for 3 ranged from two (VD006, VD0017) to 11 cultivars, including selections that offer re- min and 35 cycles of 94 C for 40 s, 58 C for (VD005, VD012, VD014) and the mean value productive sterility, are developed and become 40 s, 72 C for 30 s, and one cycle of 72 C for was 7.36. Observed heterozygosity values were available, germplasm identification will be- 4 min. The PCR products were sized on the 0 to 0.73 and He ranged from 0.48 to 0.88. All come more complex. Inaccurate identifica- QIAxcel Capillary Electrophoresis System loci, except for VD004, had Ho values that tion of plants can be problematic throughout (Qiagen) using a 25- to 300-bp DNA size were lower than the He. The majority of our botanic gardens and commercial nurseries in ladder. Unambiguous reproducible electro- markers did not conform to Hardy-Weinberg the United States. Using plastid sequences, pherograms were generated from all loci. The equilibrium (Table 2) as a result of the non- most specimens of a popular fern marketed raw allele length data were placed into allelic random mating and clonal reproduction that as Cheilanthes wrightii were in fact the pro- classes using FlexiBinV2, an automated mi- occurs with selection of plants for specific lific self-regenerating species, C. distans (Pryer crosatellite binning program that converts raw characteristics in cultivar development. The et al., 2010). Accurate identification can re- allele size data into allelic size classes (Amos PIC values of the microsatellite loci VD006 duce mislabeling in the nursery and assist in et al., 2007). A conservative ± 2-bp allele size and VD017 were 0.36; all other loci had PIC germplasm management. Moreover, accurate determination error rate was used as a result of values greater than 0.50. and early identification is important when in- the 2-bp resolution limitation of the QIAxcel This set of microsatellite markers had a vestigating plant species with invasive poten- ethidium-based system to allow reproducibil- high level of polymorphism and genetic diver- tial. Before establishment in the environment, ity between various laboratories and to avoid sity. The ability of a set of molecular markers many invasive species undergo lag periods of false inflation of diversity within the data. Of to delineate between different cultivars de- varying length, during which time between these, the 11 primer pairs (Table 2) that am- pends on the level of polymorphism that can the species’ initial arrival and rapid coloni- plified the greatest number of microsatellite be detected (Datta et al., 2010). In a study of zation of a new area may be delayed. A study alleles were selected for analysis of 16 dif- the usefulness of codominant markers in link- of alien woody plant species revealed that ferent accessions of V. dilatatum and related age analysis studies, markers were described 51% of all plants had lag periods extending taxa. Allele sizes can vary by only one or 2 as being highly informative if PIC values up to 200 years with shrubs having a mean bps, which can lead to errors in placing al- were greater than 0.50, and the majority of lag period of 131 years (Kowarik, 1995). Con- leles into the proper allelic class when the this group of markers meet these criteria versely, certain invasive plant species such size is rounded. The resulting allelic classes (Botstein et al., 1980). Additionally, the num- as Schefflera actinophylla presented a short were used to determine the number of al- ber of alleles per loci was another important lag period of only 17 years (Daehler, 2009). leles per locus. Twenty-three of the loci were factor in determining the usefulness of markers. Microsatellite markers have become a useful polymorphic. However, the 11 most poly- Loci with many alleles and PIC values close tool for identifying plants in the ornamental morphic loci (Table 2) were selected to anal- to 1.0 are most informative and provide the horticultural trade as well as for food crops yze 16 different accessions of V. dilatatum most value in linkage map analyses (Botstein (Bassil et al., 2010; Wadl et al., 2008). and related taxa (Table 1). After converting et al., 1980). We intend to use our markers to Accurate characterization and identifica- the raw data to allelic classes, the number of assess cross-transferability to other Viburnum tion of some Viburnum species, however, may alleles per locus (A), He,Ho,PICforall species. If future work reveals cross-amplification be confounded in the absence of distinct mor- microsatellite loci were calculated using to other taxa, these markers are expected to phological characteristics presented by fruit PowerMarker Version 3.23 software (Liu be useful for identifying Viburnum species, and flowers making V. dilatatum and its cul- and Muse, 2005). Deviations from the hybrids, and resolving phylogenetic relation- tivars and hybrids difficult to identify while Hardy-Weinberg equilibrium were calculated ships among species in the genus. in their juvenile stage. Indeed, Viburnum spe- using GENEPOP Version 4.0.10 (Rousset, Correct identification of plant species and cies generally have juvenility periods lasting 2008). hybrid parentage is essential for breeding from 1 to 3 years (Thomas G. Ranney, personal
Table 2. Characterization of 11 microsatellite loci isolated from Viburnum dilatatum ‘Asian Beauty’. z Locus Primer sequence (5#-3#) Repeat motif Tm ( C) Allelic size (bp) AHe Ho PIC y VD003 F: TGGCTCAGATGCATTGAAGAATAG (CA)12 58 105–143 6 0.61 0.19 0.58 R: GCTGCATGCATCTTCAAATAGG y VD004 F: GCTGCATGCATCTTCAAATAGG (AC)16 58 108–156 5 0.70 0.73 0.66 R: ATATCTCGAGGGAGACTGCAACAG VD005 F: TTTTAAAACTTTGCACCCTTGCAC (CA)7 58 115–178 11 0.87 0.72 0.81 R: AGAATAAAGTCCAGCTCCCTGACC y VD006 F: ATAACCATATGCGTGTGTATGTTGG (GT)8 58 137–141 2 0.48 0.00 0.36 R: GACGTTGCAGGAGCTTCTTATCTC y VD009 F: GTTTGGGACATGTTCAGTTCTTCC (TG)12 58 116–163 9 0.79 0.67 0.76 R: AATGTCAGCAAATCAAAATCCAAAC y VD012 F: TCGACTCTACATTCACTACCCTCC (AC)16 58 128–174 11 0.85 0.47 0.84 R: CATACGGGTATACGCACACATGC y VD014 F: GCAAACCAAACCACACAAACAC (CT)6 (CA)7 58 142–204 11 0.88 0.56 0.87 R: ATCTAGGTCGGCTGCTACTGATTG y VD016 F: TACCCCTCACAAACACAAACACTG (AC)12 58 71–129 10 0.81 0.60 0.79 R: AACAATAATGGTGTGGGGTGTTG y VD017 F: ACCAACCCAATTGCTCAATATCAC (AC)6 58 165–170 2 0.48 0.00 0.36 R: GGTTGTCCGCCAGAAGTAGTAGTG y VD018 F: CTTGCTCGATTTCCCTTATTTGTC (CA)16 58 93–112 4 0.60 0.50 0.54 R: ATCTCAAGCAAGTCTCACTCCCTC y VD019 F: AAAGTTGCAAATTACACGCTGATG (TG)16 58 125–167 10 0.86 0.60 0.84 R: TACCTCCAATTTCACGGTTCTCTC zGenBank accession numbers HQ997898-HQ997908. ySignificant deviation from Hardy-Weinberg equilibrium (P < 0.05). Tm = annealing temperature; A = allele numbers per locus; He= expected heterozygosity; Ho = observed heterozygosity; PIC = polymorphic information content.
1458 HORTSCIENCE VOL. 46(11) NOVEMBER 2011 communication). If genetic tools were avail- Datta, J., N. Lal, M. Kaashyap, and P.P. Gupta. 2010. Windows and Linux. Mol. Ecol. Resources. 8: able, both the environmental lag time and Efficiency of three PCR based marker systems 103–106. juvenility periods (before seedlings mature for detecting DNA polymorphism in Cicer Rozen, S. and H.J. Skaletsky. 1998. Primer3. 1 Nov. and produce seeds) would be ideal times dur- arietinum L. and Cajanus cajan L. Millspaugh. 2010.
HORTSCIENCE VOL. 46(11) NOVEMBER 2011 1459