As a Modulator of DNA Demethylation Through a Functional Genomics Screen

Identiﬁcation of RING ﬁnger protein 4 (RNF4) as a modulator of DNA demethylation through a functional genomics screen

Xiaoyi V. Hua, Tânia M. A. Rodriguesb, Haiyan Taoc, Robert K. Bakerb, Loren Miragliac, Anthony P. Orthc, Gary E. Lyonsb,1, Peter G. Schultza,1, and Xu Wuc,1

aDepartment of Chemistry, Scripps Research Institute, La Jolla, CA 92037; bDepartment of Anatomy, School of Medicine and Public Health, University of Wisconsin, Madison, WI 53706; and cInstitute of the Novartis Research Foundation, San Diego, CA 92121

Contributed by Peter G. Schultz, June 29, 2010 (sent for review June 15, 2010) DNA methylation is an important epigenetic modification involved In plants, genetic and biochemical experiments suggest that in transcriptional regulation, nuclear organization, development, active DNA demethylation is mediated through a base excision aging, and disease. Although DNA methyltransferases have been repair (BER) pathway initiated by m5C-specific DNA glycosylases characterized, the mechanisms for DNA demethylation remain (16, 17). It is possible that active demethylation in mammals uses poorly understood. Using a cell-based reporter assay, we per- similar mechanisms. However, the mammalian counterpart of the formed a functional genomics screen to identify genes involved in m5C-specific DNA glycosylase has yet to be identified. Sponta- DNA demethylation. Here we show that RNF4 (RING finger protein neous or enzymatic m5C deamination would generate a G:T 4), a SUMO-dependent ubiquitin E3-ligase previously implicated in mismatch in DNA duplex, and subsequent G:T mismatch repair maintaining genome stability, plays a key role in active DNA has, therefore, been proposed as a possible mechanism for active demethylation. RNF4 reactivates methylation-silenced reporters demethylation in mammalian cells (8, 18). and promotes global DNA demethylation. Rnf4 deficiency is embry- Functional genomics approaches have been used to identify onic lethal with higher levels of methylation in genomic DNA. factors that are involved in diverse biological processes (19–21).

Mechanistic studies show that RNF4 interacts with and requires Here we use a cell-based functional genomics screen to reveal CELL BIOLOGY the base excision repair enzymes TDG and APE1 for active deme- a key role for RNF4 in active DNA demethylation. Rnf4 de- thylation. This activity appears to occur by enhancing the enzymatic ficiency is embryonic lethal, resulting in a higher content of m5Cin activities that repair DNA G:T mismatches generated from methyl- genomic DNA. Furthermore, RNF4 interacts with and requires cytosine deamination. Collectively, our study reveals a unique func- BER enzymes for demethylation. tion for RNF4, which may serve as a direct link between epigenetic DNA demethylation and DNA repair in mammalian cells. Results Genome-Wide Gain-of-Function Screen Identifies RNF4 as a Regulator epigenetics | DNA repair | base excision repair of DNA Demethylation. To identify genes that promote DNA demethylation, we carried out a gain-of-function genome-wide NA methylation plays important roles in transcriptional reg- screen using a cell-based assay in which the methylation-silenced Dulation, genomic imprinting, and mammalian development p16INK4a promoter drives the expression of a luciferase reporter. (1). Deregulation of this important epigenetic modification has The p16INK4a promoter is known to be aberrantly silenced by been implicated in a number of diseases, including cancer and DNA methylation in many cancers (22). The reporter construct developmental defects (2). Methylation of DNA occurs at the 5C was methylated in vitro, purified, and cotransfected into HEK293 position of the CpG dinucleotide and is mediated by DNA cells in 384-well format with an arrayed cDNA expression library methyltransferases (DNMTs) (3). The de novo methyltransferases composed of 9,624 mouse and 6,415 human full-length cDNAs DNMT3a and DNMT3b are mainly responsible for introducing from the Mammalian Gene Collection (MGC) (23). GADD45a cytosine methylation at previously unmethylated CpG sites, was used as a positive control based on its previously reported whereas the maintenance methyltransferase DNMT1 copies pre- demethylation activity and gave a 10-fold increase in luciferase existing methylation patterns into the newly synthesized DNA activity 48 h posttransfection (10). From the primary screen, 19 strand during DNA replication (4). genes were found to induce luciferase activity greater than 10-fold Dynamic DNA methylation is critical during development (1, 5). and were subsequently reconfirmed using an in vitro methylated Although maintenance and de novo methylation mediated by pFMR1-luc reporter (24) (full hit list in Table S1). Among them, DNMTs are relatively well understood (4), the mechanisms of DNA GADD45g has been reported to be involved in DNA methylation demethylation are still elusive (6). Passive demethylation can occur regulations (9, 10). Other genes with DNA repair activities have through the inhibition of DNMT1 activity, causing a loss in the also been identified (25). methylation pattern during DNA replication. Rapid genome-wide RNF4 (RING finger protein 4, or SNURF) was one of the most demethylation is observed during gametogenesis and postfertiliza- active hits in our screen with a >20-fold increase in reporter action, suggesting an active demethylation mechanism independent of tivity (Table S1). RNF4 has a conserved function in genome sta- DNA replication. Recent studies have identified several factors that bility and DNA repair in eukaryotes (26, 27). In addition, we found are involved in active DNA demethylation, including the activation- induced cytidine deaminase (AID), an enzyme catalyzing 5-methyl cytidine (m5C) deamination in single-stranded DNA to generate Author contributions: X.V.H., A.P.O., G.E.L., P.G.S., and X.W. designed research; X.V.H., – T.M.A.R., H.T., R.K.B., and L.M. performed research; X.V.H., G.E.L., P.G.S., and X.W. ana- thymine and a G:T mismatch (7 9), and GADD45a, a nuclear pro- lyzed data; and X.V.H., G.E.L., P.G.S., and X.W. wrote the paper. tein involved in the maintenance of genomic stability and DNA The authors declare no conflict of interest. repair (9–11). However, neither AID- nor Gadd45a-deficient mice 1To whom correspondence may be addressed. E-mail: [email protected], schultz@scripps. (12, 13) exhibit catastrophic developmental defects (14, 15), sug- edu, or [email protected]. gesting other factors might be involved in the regulation of active This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. DNA demethylation. 1073/pnas.1009025107/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1009025107 PNAS | August 24, 2010 | vol. 107 | no. 34 | 15087–15092 Downloaded by guest on September 26, 2021 that several methylation-silenced luciferase and GFP reporters Analysis of the methylation status of endogenous CpG islands in were also reactivated by RNF4 overexpression in different cell the p16INK4a promoter by bisulfite sequencing revealed that RNF4 lines (SV40-Luc, pOct4-Luc, and CMV-eGFP reporters; Fig. 1 A overexpression significantly reduces the methylation level of the INK4a and B), indicating that the activity of RNF4 is both reporter and p16 promoter in the HCT116 colorectal cancer cell line, with complete demethylation in >80% of clones analyzed (Fig. 1C). We next examined the methylation status of the p16INK4a promoters 2000 70000 U U SV40 40000 Oct4 A 1500 M using methylation-specific PCR (28). Overexpression of either 600 M 30000 GADD45a or RNF4 increases unmethylated-specific PCR prod- U U 400 20000 uct and decreases methylated-specific PCR product (Fig. 1D). RL RL 200 10000 Furthermore, removal of the repressive DNA methylation marks by RNF4 transfection led to partial reactivation of gene expres- 0 0 INK4a Ctrl GFP GADD45a RNF4 Ctrl GFP GADD45a RNF4 sion, as shown by 40% higher p16 mRNA levels (P < 0.001) measured by qRT-PCR (Fig. 1E).

B Rnf4 Deﬁciency Is Embryonic Lethal, and Loss of RNF4 Results in an Increase in Global DNA Methylation. To address whether RNF4 plays an essential role in mammalian development, we took advantage of a recessive lethal gene-trap insertion mutation (29, 30) to generate Rnf4 knockout mice (Fig. S1A). Although het- Ctrl Gadd45a Rnf4 erozygous animals exhibited no obvious phenotype, homozygous null embryos were stunted and failed to develop to term (SI C Materials and Methods, Figs. S1–S3, and Table S2). The embryos died between E14 and E15, and exhibited ventricular septal defects and cardiac insufﬁciency, which probably accounted for − − PFG lethality. Genomic DNA from the Rnf4+/+, and Rnf4 / mouse

+/+ 50% 4FNR

78% *** D E 1.4

H 1.2 GFP GADD45a RNF4

APD 1.0

p16 U G 0.8 6/ B +/+ +/ - - / - C p16 M p1 0.6 HMHM H M 0.4 100

p16 WT mRNA 0.2 0.0 80 *

GFP RNF4 P

CM 60 5

Fig. 1. RNF4 promotes DNA demethylation. (A) Luciferase reporter assays m

transiently transfected with pCMV-sport6 (Ctrl) or the indicated genes. Lu- fd 40

ciferase expression was driven by the SV40 promoter in HEK293 cells, or the %o 20 Oct4 promoter in P19 cells. Reporter plasmids were unmethylated (U) or in vitro methylated (M). Error bars indicate SEM (n = 6). (B) GFP reporter assay 0 in HEK293 cells transiently transfected with the indicated genes. pEGFP-N1 +/++ /- -/ - vector was in vitro methylated. (Scale bar: 20 μm.) (C) Bisulfite sequence analysis of the p16INK4a promoter in HCT116 cells transiently transfected with the indicated genes. White and black circles represent unmethylated and Fig. 2. Rnf4 deficiency increases global methylation level. (A) Bisulfite se- methylated CpG, respectively. Images are representative result of three in- quencing of a maternal imprinted locus, Peg3 (paternal expressed gene 3), − − dependent experiments. (D) Methylation-specific PCR was performed using on genomic DNA from Rnf4+/+ or Rnf4 / MEFs. Representative results from bisulfate-treated genomic DNA as template with primers specificfor three independent experiments are shown. (B) Southern blot of DNA unmethylated CpG template (p16 U) and methylated CpG template (p16 M) methylation in minor satellite region. Genomic DNA was digested with the in HCT116 cells. Untreated genomic DNA was used as a loading control (p16 methylation-sensitive enzyme HpaII (H) or methylation-insensitive enzyme WT). (E) p16 mRNA was determined by qRT-PCR in HCT116 cells. GAPDH MspI (M), blotted, and probed by minor satellite pMR-150 probe. (C)m5C mRNA was used for normalization. P = 0.001; error bar indicate SEM (n =3). content on CCGG sequences in genomic DNA is determined using the end- labeling assay followed by TLC separation. The intensity of the spot corresponding to dm5CMP is quantified by scintillation counting. Representative cell-type independent. Therefore, we focused our efforts on fur- results from three independent experiments are shown. P < 0.05; error bars ther characterization of the role of RNF4 in DNA demethylation. indicate SEM (n =3).

15088 | www.pnas.org/cgi/doi/10.1073/pnas.1009025107 Hu et al. Downloaded by guest on September 26, 2021 embryonic fibroblast (MEF) cells was extracted to analyze the control, unmethylated pGL3 plasmid was readily digested by global DNA methylation. Bisulfite sequencing analysis was per- HpaII and released the 240-bp fragment (Fig. 3A, lane 2). Ac- formed for the representative maternally imprinted genes, Peg1 cordingly, methylated pGL3, as negative control, was resistant to and Peg3, where ∼50% methylation was observed from wild-type HpaII digestion and did not release the 240-bp fragment (the genomic DNA; 75% and 78% of methylation was detected for two bands detected in lane 1 are presumably the supercoiled and Peg1 and Peg3, respectively, in Rnf4-deficient samples (Fig. 2A nicked pGL3 plasmids; Fig. 3A). Next, we sought to determine if and Fig. S4A). Second, we performed Southern blot to probe the RNF4-induced demethylation is an active process or if it oc- methylation status on minor satellite regions in genomic DNA curred passively during cell division. To this end, transiently (31). Global DNA hypermethylation was observed in DNA from transfected pGL3 plasmid was recovered from HEK293 cells and − − Rnf4 / MEFs, as shown by an increase in DNA fragment size digested with HpaII. Whereas plasmids recovered from GFP- from the methylation-sensitive HpaII digestion (Fig. 2B). Finally, overexpressing cells did not change their methylation status (Fig. the level of m5C in CCGG sites was measured with radioactive 3A, lanes 3 and 4), those recovered from RNF4-overexpressing − − end-labeling and separation by TLC (14, 32). DNA from Rnf4 / cells were susceptible to HpaII digestion (Fig. 3A, lanes 5 and 6), MEFs was found with higher (P < 0.05) m5C content (76%) than indicating a loss of DNA methylation in these plasmids. Fur- that of DNA from wildtype MEFs, in which about 60% of all thermore, we found that plasmids recovered from serum-starved CCGG sites were methylated (Fig. 2C). The content of m5Cin nonproliferating cells were also demethylated upon RNF4 the DNA of the heterozygous MEFs was similar to that of wild coexpression (Fig. S4B). Based on these experiments, demethy- type. Collectively, these findings suggest that RNF4 is critical for lation by RNF4 is independent of DNA replication and cell embryonic development, and loss of RNF4 results in an increase proliferation, which suggests that RNF4 functions through an in global DNA methylation. active demethylation process. RNF4 is a SUMO-targeted ubiquitin E3 ligase (STUbL) with RNF4 Regulates Active Demethylation. The reporter plasmids used four N-terminal SUMO-interacting motifs (SIM) that trigger in- in this study contain only bacterial replication origins, which are teraction with SUMOylated proteins, and a C-terminal RING unable to replicate in mammalian cells. Therefore, we hypoth- finger motif critical for ubiquitination activity (33–35). Directed esized that the reactivation of methylation-silenced reporters by mutagenesis was used to generate the SIM and CS3 loss-of- RNF4 may involve an active demethylation process independent function mutants that correspond to the SUMO-interacting of DNA replication. To address this issue, we designed a probe motifs and RING motif, respectively (Fig. S5A). Both SIM and

for Southern blot analysis that hybridizes to a 240-bp fragment in CS3 mutants were unable to reactivate the methylation-silenced CELL BIOLOGY between two HpaII sites on the pGL3 plasmid. As positive luciferase reporter (Fig. S5B). In a Southern blot experiment

Me-pGL3 + ++ APE1-myc A UN-pGL3 + ++ B C Flag- GFP ++ GFP RNF4 SIM CS3 RNF4 ++ HpaII ++++++ IP: Flag myc GFP-Flag RNF4-Flag SIM-Flag CS3-Flag myc (bp) TDG 2000 Input Flag IP: APE1 1500 Flag TDG-myc Flag- Flag GFP RNF4 SIM CS3

600 IP: Flag TDG myc Input myc APE1 200 Input Flag 165432

RNF4 +++ D E Me-pGL3 +++ HpaII +++ F RNF4 ++++ GFP +++ Me-pGL3 ++++ RNF4 +++ HpaII ++++ Me-pGL3 ++ + + ++ HpaII ++ + + + + GFP APE1 TDG (bp) 2000 (bp) 1500 2000 (bp) 1500 2000 600 1500 600

600 200 200 TDG APE1 -tubulin -tubulin 200 sc #1 #2 TDG #1 #2 #3 #4 123456 shRNA APE1 shRNA

Fig. 3. RNF4 interacts and requires BER pathway enzymes for active demethylation. (A) RNF4 overexpression induces demethylation of pGL3 plasmid. Methylated or unmethylated pGL3 plasmids were used as negative or positive controls, respectively (lanes 1 and 2). Plasmids recovered from cell culture were digested with HpaII, and the products were analyzed by Southern blot. Arrow, methylated plasmid; Arrowhead, unmethylated fragment. (B) RNF4 interacts with TDG and APE1 in cells. Endogenous TDG and APE1 were coimmunoprecipitated from Flag-tagged RNF4-transfected HEK293 cells. (C) Reverse Co-IP detected RNF4 association with myc-tagged TDG and APE1. (D) TDG and APE1 can synergize with RNF4 for active demethylation. Methylated pGL3 plasmid was recovered from cells cotransfected with suboptimal amounts of RNF4 (0.5 μg) and the designated genes (0.5 μg), digested with HpaII, and analyzed by Southern blot. Arrow, methylated plasmid; arrowhead, unmethylated fragment. (E and F) TDG and APE1 are required for RNF4-induced active demethylation. shRNAs targeting TDG and APE1 were used to knock down the expression of the corresponding protein (Western blot, Lower). Active demethylation by RNF4 is analyzed by Southern blot using recovered plasmids from cells cotransfected with corresponding shRNAs (Upper). Arrow, methylated plasmid; arrowhead, unmethylated fragment.

Hu et al. PNAS | August 24, 2010 | vol. 107 | no. 34 | 15089 Downloaded by guest on September 26, 2021 using HpaII-digested recovered plasmids, the small fragments alyze cellular G:T mismatch repair activity, the luciferase start representing demethylated plasmid were not observed with either codon ATG was engineered to pair with TAT on the template the SIM or CS3 mutants (Figs. S4B and S5C). These findings strand in the pGL3 plasmid (named pGL3G:T hereafter). Failure suggest that both motifs are essential for the demethylation to repair the G:T mismatch and convert TAT back to CAT would function of RNF4. transcribe an ATA codon in mRNA, which would not be recognized by the ribosome for translation initiation. The luciferase reading is, RNF4 Regulates DNA Demethylation Through BER Pathway and therefore, an indirect indication of the G:T mismatch repair effi- Enhances DNA G:T Mismatch Repair. Although genetic and bio- ciency in cells. pGL3G:T cotransfected with RNF4 resulted in sig- chemical evidence has suggested that DNA demethylation in fi > < 5 ni cantly higher ( 8-fold, P 0.01) relative response ratio (RRR) plants is mediated through a BER pathway initiated by a m C- than cotransfection with GFP, indicating that RNF4 overexpression specific DNA glycosylase, the corresponding mammalian glyco- fi fi 5 increases G:T mismatch repair ef ciency (Fig. 4B). Using a probe sylase has not been identi ed (16, 17). Instead, m C deamination (ARP) that reacts specifically with the aldehyde group in the generates a G:T mismatch in DNA duplex in mammalian DNA open-ring form of the AP sites, the damage on genomic DNA was (36, 37). This mismatch is recognized and removed by DNA quantified by a colorimetric detection. As shown in Fig. 4C,DNA glycosylases, such as thymine DNA glycosylase (TDG), to create damage in RNF4-overexpressing cells was significantly less than an apurinic/apyrimidinic (AP) site, which is then processed by an − − that in control cells (P < 0.01), whereas DNA damage in Rnf4 / AP endonuclease (APE1) through the BER pathway. In- MEFs was 2-fold higher than that in the wild-type/heterozygous terestingly, we found that RNF4 interacts with both TDG and < APE1 in coimmunoprecipitation experiments (Fig. 3 B and C). controls (P 0.01; Fig. 4D). These observations suggest that RNF4 However, mutations in all four SIMs and the RING domain did induces DNA demethylation by enhancing DNA repair in mam- not interfere with TDG and APE1 association (Fig. 3 B and C). malian cells. Interestingly, we observed that the N-terminal 100-aa fragment, Discussion which contains all of the SIMs, is sufficient for interaction with both TDG and APE1 (Fig. S4C), suggesting sequences other Gain-of-function screens have been used to successfully identify than the SUMO-interacting motifs in the N-terminal region are demethylating factors (10). Our studies extend these efforts to the fi mediating the interaction (38). identi cation of genes involved in mammalian DNA demethyla- To investigate whether TDG and APE1 play a role in active tion on a genome-wide scale. We show here that RNF4 plays a key demethylation, we examined the synergistic effects of these genes role in active DNA demethylation through the BER pathway in when combined with a low level of RNF4, which by itself is not mammalian cells. Indeed, previous studies have indicated a role sufficient for demethylation (Fig. S6A). Methylated plasmid was for the BER pathway in active DNA demethylation in other recovered from cells cotransfected with suboptimal amounts of organisms (9, 17). RNF4 interacts with and requires both BER RNF4 and either TDG or APE1. The release of a small fragment enzymes TDG and APE1 for demethylation, likely by enhancing from HpaII-digested TDG and APE1 samples indicated TDG/ their enzymatic activities to repair G:T mismatch in DNA APE1 enhanced RNF4-induced demethylation (Fig. 3D). The duplexes. Consistent with this notion, we observed that DNA same synergy was observed in the reactivation of methylation- damage in RNF4-overexpressing cells is significantly less than that silenced luciferase reporter assay (pFMR-Luc; Fig. S6B). The AID/ Apobec (activation-induced deaminase/apolipoprotein B RNA- editing complex) family of RNA cytidine deaminases has been re- A B ported to have m5C deaminase activities (7). G:T mismatches could 50 ** also be generated by such enzymatic catalysis. However, no syn- 40 0.10

ergistic effects were observed between RNF4 and AID or APO- ng 30

BEC1 in both reporter and Southern blot experiments. cki fi i To con rm that TDG and APE1 are required for demethy- 20 0.05 lation, we used shRNAs to specifically silence the endogenous %n 10 GF P Fir e fly/Re nilla) RNF4 expression of TDG and APE1 in HEK293 cells. Methylated RRR (T:G mismatch plasmids were recovered from cells transfected with both RNF4 0 0 10 20 30 0.00 and shRNAs targeting TDG (90% knockdown efficiency; Fig. Time (min ) GFP RNF4 3E). The recovered methylated plasmid was resistant to HpaII digestion (Fig. 3E), indicating the methylation marks are intact C D and that RNF4 failed to induce demethylation upon TDG 150 100 *** knockdown. We observed similar results in samples recovered 80 from cells transfected with RNF4 and APE1 shRNAs (50% bp DNA 100 bp DNA 5 knockdown efficiency; Fig. 3F). Both shRNAs also inhibited 5 60 RNF4-induced reactivation of methylation-silenced luciferase 40 reporter (pFMR-Luc; Fig. S6 C and D). Together, these findings 50 suggest that RNF4 interacts with and requires both BER path- *** 20 AP sites per 10 way enzymes TDG and APE1 for active demethylation. AP sites per 10 0 0 We next examined the enzymatic activities of TDG and APE1 in GFP RNF4 +/+ +/- -/- processing G:T mismatch lesions. A fluorescein-labeled, synthetic duplex (60 bp) carrying a G:T mismatch 24 bp away from the labeled Fig. 4. RNF4 promotes DNA G:T mismatch repair. (A) The time-dependent 5′ end was used as substrate and incubated with immunoprecipi- generation of DNA nicking was assayed by incubation of immunoprecipi- tated Flag-tagged TDG and APE1 (39). As expected, TDG rec- tated TDG and APE1 with double-stranded 60-mer substrate (50 nM) con- ognized the lesion site G:T mismatch and removed the thymine taining a single G:T mismatch (39). Average numbers of three independent assays were graphed. (B) Relative response ratio for G:T mismatch firefly base. This generated an abasic site that was subsequently processed luciferase reading vs. Renilla luciferase reading (Materials and Methods). P = by APE1, and the cleaved 24-bp product was separated from the 0.01; error bars indicate SEM (n = 6). The number of AP sites per 105-bp substrate by denaturing gels. RNF4 overexpression significantly genomic DNA was assayed using aldehyde reactive probe and colorimetric increased the enzymatic activities of both TDG and APE1, com- detection (Materials and Methods). P < 0.0001; error bars indicate SEM (n = pared with those of the GFP control (Fig. 4A and Fig. S7). To an- 6). HEK293 genomic DNA (C) and RNF4 MEFs genomic DNA (D) were assayed.

15090 | www.pnas.org/cgi/doi/10.1073/pnas.1009025107 Hu et al. Downloaded by guest on September 26, 2021 in GFP-overexpressing control cells, whereas higher content of methylated using the CpG DNA methylase M.SssI (New England BioLabs). All − − DNA damage sites is observed in Rnf4 / MEFs. luciferase readings were acquired following addition of Bright-Glo reagent Due to the lack of base coding information, and susceptibility to (Promega) on the CLIPR instrument (Molecular Devices). Each experiment was single-strand breaks in DNA, the AP sites generated during BER repeated at least three times. repair are both mutagenic and cytotoxic (40). This could explain Southern Blot. Southern blot analysis was carried out using 4–20% TBE PAGE the fact that many DNA glycosylases remain tightly bound to their (Invitrogen) gel electrophoresis and transferred to Nylon+ membrane (0.45-μm AP-DNA product, which greatly reduces their enzymatic turnover pore size; Invitrogen) according to manufacturer’s instructions. 32P-labeled (41). Recent studies have shown that human APE1 is able to probe was hybridized at 65 °C overnight, washed, and developed by phos- stimulate TDG activity >42-fold on G:T mismatch substrates by phorimager using the Noth2South system (Pierce) according to manufacturer’s disrupting the TDG-product complex in vitro (42). However, instructions. The minor satellite methylation was carried out using the pMR- a stable molecular interaction between TDG and APE1 has not 150 probe according to Zhu et al. (31). been detected in previous studies (43, 44). Our observation that To analyze methylation status of the recovered plasmid, pGL3-promoter RNF4 interacts with both TDG and APE1 suggests that RNF4 plasmid was in vitro methylated by M.SssI (New England BioLabs) and may function as a molecular scaffold to bring together the BER cotransfected into HEK293 cells with effector genes. The plasmids were re- enzymes for efficient DNA repair in cells. covered after 48 h by Miniprep Kit (ZymoResearch). Recovered plasmids were fi subject to HpaII or MspI (New England BioLabs) restriction digestion, puri- Proteins with RING nger motifs are involved in diverse cellu- fication, and Southern blot using probe 5′-CCATTCTATCCGCTGGAAGATG- lar processes. For example, RNF8 was found to recognize DNA GAACCGCTGG. Each Southern experiment was repeated three times. double-strand breaks and promote assembly of repair proteins (45, 46). Yeast homologs (Rfp1 and Rfp2) of RNF4 are essential for G:T Mismatch Repair Activity. Generation of the G:T mismatch repair reporter DNA repair (26), and mammalian RNF4 is required for arsenic- in cells was adapted from Lei et al. (53). Point mutagenesis was used to insert induced promyelocytic leukemia (PML) protein degradation in an EcoRI site on pGL3-promoter plasmid where a Glu was introduced between acute promyelocytic leukemia (33, 34). Although RNF4 is charac- Pro13 and Phe14. Luciferase activity for this construct is not affected by this terized as the only STUbL member in mammalian cells, recent insertion. This plasmid DNA was then digested with HindIII and EcoRI, treated ′ yeast genetics studies suggest that SUMOylation is not required for with phosphatase (New England BioLabs) to remove the 5 phosphates before RNF4-mediated substrate ubiquitination (38). Nonetheless, both ligation. A mismatch was introduced at the ATG codon matching with TAT fi where the G:T are underlined. Annealed oligos corresponding to the HindIII/ SIMs and RING nger motif are essential for RNF4-induced active EcoRI-released fragment (74 bp) were treated with PNK (New England BioL- demethylation, indicating that a SUMOylated unknown substrate abs) to add the 5′ phosphyl group. of RNF4 may be involved. Interestingly, SUMOylation of PML is CELL BIOLOGY ′ required for the maturation of PML nuclear body (PML-NB), HindIII oligo: 5 -AGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATG which recruits a number of nuclear proteins involved in gene tran- GAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCAG EcoRI oligo: 5′-AATTCTGGCGCCGGGCCTTTCTTTATGTTTTTGGCGTC scription (47), apoptosis (48), DNA damage and repair (49), and TTCTATGGTGGCTTTACCAACAGTACCGGAATGCCA virus infection (50). TDG has been reported to colocalize with PML in the cell nucleus in a SUMO-dependent manner (51), and PML Ligation was carried out with T4 DNA ligase (New England BioLabs) at 16 °C exhibits repressive functions for genes in the BER repair pathway overnight. The ligation products were then treated with plasmid-safe ATP- dependent DNase (Epicenter) to remove the linear vector substrates before (52), suggesting that PML may negatively regulate the DNA repair purification. Purified plasmid (designated as pGL3G:T) was cotransfected with pathway and that SUMO-dependent polyubiquitination of PML renilla luciferase and effector genes for 48 h before both firefly and renilla by RNF4 may account for the enhanced BER repair for active luciferase activities were read using Dual-Glo reagents (Promega). RRR was demethylation. calculated according to manufacturer’s instructions. Our study shows that RNF4, a gene essential for mammalian embryonic development, plays a critical role in active DNA ACKNOWLEDGMENTS. We thank Drs. Y. N. Chen (Novartis Institutes for demethylation through mechanisms that involve the BER path- BioMedical Research, Cambridge, MA), D. Reines (Emory University, Atlanta), fi and R. Hay (University of Dundee, Dundee, Scotland) for constructs and Drs. E. Li way. These ndings suggest that active demethylation requires the (Novartis Institutes for BioMedical Research, Shanghai, China), D. Schübeler DNA repair machinery, a mechanism likely conserved in both (Friedrich Miescher Institute, Basel), S. Gasser (Friedrich Miescher Institute, plant and mammalian cells. Basel), T. Hunter (Salk Institute, La Jolla, CA), C. Cho (Genomics Institute of the Novartis Foundation, San Diego), and C. A. Lyssiotis (The Scripps Research Materials and Methods Institute) for helpful discussions. X.V.H. is a Gilead Fellow of the Life Sciences Research Foundation. R.K.B. was supported by postdoctoral fellowships from Luciferase Reporter Assay. HEK293 and P19 cells were transiently transfected in the American Heart Association. This work is supported by the Skaggs Institute 384-well plates with a total of 50 ng DNA per well, containing 25 ng luciferase of Chemical Biology (P.G.S.), National Institutes of Health (G.E.L.), and Novartis reporter and 25 ng effector plasmid. Luciferase reporter plasmids were pro- Research Foundation (P.G.S. and X.W.). This article is Manuscript 19948 of the duced in the dam−/dcm− bacteria strain SCS110 (Stratagene) and in vitro Scripps Research Institute.

1. Reik W (2007) Stability and flexibility of epigenetic gene regulation in mammalian 11. Schmitz KM, et al. (2009) TAF12 recruits Gadd45a and the nucleotide excision repair development. Nature 447:425–432. complex to the promoter of rRNA genes leading to active DNA demethylation. Mol 2. Feinberg AP (2007) Phenotypic plasticity and the epigenetics of human disease. Cell 33:344–353. Nature 447:433–440. 12. Salvador JM, et al. (2002) Mice lacking the p53-effector gene Gadd45a develop fi 3. Esteller M (2007) Cancer epigenomics: DNA methylomes and histone-modi cation a lupus-like syndrome. Immunity 16:499–508. – maps. Nat Rev Genet 8:286 298. 13. Revy P, et al. (2000) Activation-induced cytidine deaminase (AID) deficiency causes the 4. Goll MG, Bestor TH (2005) Eukaryotic cytosine methyltransferases. Annu Rev Biochem autosomal recessive form of the Hyper-IgM syndrome (HIGM2). Cell 102:565–575. – 74:481 514. 14. Li E, Bestor TH, Jaenisch R (1992) Targeted mutation of the DNA methyltransferase 5. Bird A (2002) DNA methylation patterns and epigenetic memory. Genes Dev 16:6–21. gene results in embryonic lethality. Cell 69:915–926. 6. Ooi SK, Bestor TH (2008) The colorful history of active DNA demethylation. Cell 133: 15. Okano M, Bell DW, Haber DA, Li E (1999) DNA methyltransferases Dnmt3a and Dnmt3b 1145–1148. are essential for de novo methylation and mammalian development. Cell 99:247–257. 7. Morgan HD, Dean W, Coker HA, Reik W, Petersen-Mahrt SK (2004) Activation-induced 16. Gehring M, Reik W, Henikoff S (2009) DNA demethylation by DNA repair. Trends cytidine deaminase deaminates 5-methylcytosine in DNA and is expressed in – pluripotent tissues: Implications for epigenetic reprogramming. J Biol Chem 279: Genet 25:82 90. 52353–52360. 17. Zhu JK (2009) Active DNA demethylation mediated by DNA glycosylases. Annu Rev – 8. Popp C, et al. (2010) Genome-wide erasure of DNA methylation in mouse primordial Genet 43:143 166. germ cells is affected by AID deficiency. Nature 463:1101–1105. 18. Duncan BK, Miller JH (1980) Mutagenic deamination of cytosine residues in DNA. 9. Rai K, et al. (2008) DNA demethylation in zebrafish involves the coupling of Nature 287:560–561. a deaminase, a glycosylase, and gadd45. Cell 135:1201–1212. 19. Liu J, et al. (2005) Identification of the Wnt signaling activator leucine-rich repeat in 10. Barreto G, et al. (2007) Gadd45a promotes epigenetic gene activation by repair- Flightless interaction protein 2 by a genome-wide functional analysis. Proc Natl Acad mediated DNA demethylation. Nature 445:671–675. Sci USA 102:1927–1932.

Hu et al. PNAS | August 24, 2010 | vol. 107 | no. 34 | 15091 Downloaded by guest on September 26, 2021 20. Luesch H, et al. (2006) A functional genomics approach to the mode of action of 38. Xie Y, Rubenstein EM, Matt T, Hochstrasser M (2010) SUMO-independent in vivo apratoxin A. Nat Chem Biol 2:158–167. activity of a SUMO-targeted ubiquitin ligase toward a short-lived transcription factor. 21. Willingham AT, et al. (2005) A strategy for probing the function of noncoding RNAs Genes Dev 24:893–903. finds a repressor of NFAT. Science 309:1570–1573. 39. Hardeland U, Bentele M, Jiricny J, Schär P (2000) Separating substrate recognition 22. Baylin SB, Herman JG (2000) DNA hypermethylation in tumorigenesis: Epigenetics from base hydrolysis in human thymine DNA glycosylase by mutational analysis. J Biol joins genetics. Trends Genet 16:168–174. Chem 275:33449–33456. 23. Chanda SK, et al. (2003) Genome-scale functional profiling of the mammalian AP-1 40. Boiteux S, Guillet M (2004) Abasic sites in DNA: Repair and biological consequences in signaling pathway. Proc Natl Acad Sci USA 100:12153–12158. Saccharomyces cerevisiae. DNA Repair (Amst) 3:1–12. 24. Smith KT, Coffee B, Reines D (2004) Occupancy and synergistic activation of the FMR1 41. Dizdaroglu M (2003) Substrate specificities and excision kinetics of DNA glycosylases – promoter by Nrf-1 and Sp1 in vivo. Hum Mol Genet 13:1611–1621. involved in base-excision repair of oxidative DNA damage. Mutat Res 531:109 126. 25. Matsuoka S, Huang M, Elledge SJ (1998) Linkage of ATM to cell cycle regulation by 42. Fitzgerald ME, Drohat AC (2008) Coordinating the initial steps of base excision repair. the Chk2 protein kinase. Science 282:1893–1897. Apurinic/apyrimidinic endonuclease 1 actively stimulates thymine DNA glycosylase by – 26. Kosoy A, Calonge TM, Outwin EA, O’Connell MJ (2007) Fission yeast Rnf4 homologs disrupting the product complex. J Biol Chem 283:32680 32690. are required for DNA repair. J Biol Chem 282:20388–20394. 43. Waters TR, Gallinari P, Jiricny J, Swann PF (1999) Human thymine DNA glycosylase 27. Sun H, Leverson JD, Hunter T (2007) Conserved function of RNF4 family proteins in binds to apurinic sites in DNA but is displaced by human apurinic endonuclease 1. J Biol Chem 274:67–74. eukaryotes: Targeting a ubiquitin ligase to SUMOylated proteins. EMBO J 26: 44. Privezentzev CV, Saparbaev M, Laval J (2001) The HAP1 protein stimulates the 4102–4112. turnover of human mismatch-specific thymine-DNA-glycosylase to process 3,N(4)- 28. Herman JG, Graff JR, Myöhänen S, Nelkin BD, Baylin SB (1996) Methylation-specific ethenocytosine residues. Mutat Res 480-481:277–284. PCR: A novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA 45. Mailand N, et al. (2007) RNF8 ubiquitylates histones at DNA double-strand breaks and 93:9821–9826. promotes assembly of repair proteins. Cell 131:887–900. 29. Friedrich G, Soriano P (1991) Promoter traps in embryonic stem cells: A genetic screen 46. Huen MS, et al. (2007) RNF8 transduces the DNA-damage signal via histone to identify and mutate developmental genes in mice. Genes Dev 5:1513–1523. ubiquitylation and checkpoint protein assembly. Cell 131:901–914. 30. Soriano P, Montgomery C, Geske R, Bradley A (1991) Targeted disruption of the c-src 47. Shima Y, et al. (2008) PML activates transcription by protecting HIPK2 and p300 from proto-oncogene leads to osteopetrosis in mice. Cell 64:693–702. SCFFbx3-mediated degradation. Mol Cell Biol 28:7126–7138. 31. Zhu H, et al. (2006) Lsh is involved in de novo methylation of DNA. EMBO J 25: 48. Bernardi R, Papa A, Pandolfi PP (2008) Regulation of apoptosis by PML and the PML- – 335 345. NBs. Oncogene 27:6299–6312. 32. Bestor TH, Hellewell SB, Ingram VM (1984) Differentiation of two mouse cell lines is 49. Conlan LA, McNees CJ, Heierhorst J (2004) Proteasome-dependent dispersal of PML – associated with hypomethylation of their genomes. Mol Cell Biol 4:1800 1806. nuclear bodies in response to alkylating DNA damage. Oncogene 23:307–310. 33. Lallemand-Breitenbach V, et al. (2008) Arsenic degrades PML or PML-RARalpha 50. Chelbi-Alix MK, Quignon F, Pelicano L, Koken MH, de Thé H (1998) Resistance to virus through a SUMO-triggered RNF4/ubiquitin-mediated pathway. Nat Cell Biol 10: infection conferred by the interferon-induced promyelocytic leukemia protein. J Virol 547–555. 72:1043–1051. 34. Tatham MH, et al. (2008) RNF4 is a poly-SUMO-specific E3 ubiquitin ligase required for 51. Takahashi H, Hatakeyama S, Saitoh H, Nakayama KI (2005) Noncovalent SUMO-1 arsenic-induced PML degradation. Nat Cell Biol 10:538–546. binding activity of thymine DNA glycosylase (TDG) is required for its SUMO-1 35. Prudden J, et al. (2007) SUMO-targeted ubiquitin ligases in genome stability. EMBO J modification and colocalization with the promyelocytic leukemia protein. J Biol Chem 26:4089–4101. 280:5611–5621. 36. Walsh CP, Xu GL (2006) Cytosine methylation and DNA repair. Curr Top Microbiol 52. Alcalay M, et al. (2003) Acute myeloid leukemia fusion proteins deregulate genes Immunol 301:283–315. involved in stem cell maintenance and DNA repair. J Clin Invest 112:1751–1761. 37. Pfeifer GP (2006) Mutagenesis at methylated CpG sequences. Curr Top Microbiol 53. Lei X, Zhu Y, Tomkinson A, Sun L (2004) Measurement of DNA mismatch repair Immunol 301:259–281. activity in live cells. Nucleic Acids Res 32:e100.

15092 | www.pnas.org/cgi/doi/10.1073/pnas.1009025107 Hu et al. Downloaded by guest on September 26, 2021