USOO9255264B2

(12) United States Patent (10) Patent No.: US 9.255.264 B2 Taguchi et al. (45) Date of Patent: Feb. 9, 2016

(54) HAIR SHAPE SUSCEPTIBILITY GENE FOREIGN PATENT DOCUMENTS JP 2002-23.8577 8, 2002 (75) Inventors: Hiroyuki Taguchi, Tochigi (JP); Hiroshi JP 2005-5324O7 10/2005 Yoshida, Tochigi (JP); Chie Fuse, JP 2006-042735 2, 2006 Tochigi (JP); Tadao Arinami, Ibaraki JP 2006-254735 9, 2006 (JP) WO WO 02/068649 A2 9, 2002 WO WO 2007/086526 A1 8, 2007 WO WO 2008/O16356 A2 2, 2008 (73) Assignee: Kao Corporation, Tokyo (JP) WO WO 2008/021290 A2 2, 2008 WO WO 2008/043644 A1 4/2008 (*) Notice: Subject to any disclaimer, the term of this OTHER PUBLICATIONS patent is extended or adjusted under 35 U.S.C. 154(b) by 228 days. Jiang et al., Oral cancer overexpressed 1 (ORAOV1): A regulator for the cell growth and tumor angiogenesis in oral squamous cell carci (21) Appl. No.: 13/500,462 noma; Int. J. Cancer, vol. 123, ppl 1779-1786, 2008.* Ku et al., Genomic profiling of decreased DNA damage response in human squamous carcinoma cells; Molecular Medicine Reports, vol. (22) PCT Filed: Oct. 5, 2010 1, pp. 105-117, 2008.* Hattori et al., GenBank Accession No. AP001888.4, Submitted Mar. (86). PCT No.: PCT/UP2O1 O/O67444 15, 2003: Accessed Sep. 3, 2014.* GenBank Accession No. NM 153451.2, ORAOV1 nucleotide S371 (c)(1), sequence, accessed Sep. 3, 2014. (2), (4) Date: Jun. 1, 2012 GenPept Accession No. NP 703152.1 ORAOV1 protein sequence, accessed Sep. 3, 2014.* Extended European search report including the Supplementary Euro (87) PCT Pub. No.: WO2011/043333 pean search report and the European search opinion, mailed May 17, PCT Pub. Date: Apr. 14, 2011 2013, for EP Application No. 10822000.5, the European Patent Office, Rijswijk, Netherlands. (65) Prior Publication Data Yusuke: “Submitted SNP (ss) Details: ss4940242.” NCBI-dbSNP database, NCBI. Bethesda, MD. Submitted Aug. 1, 2002, retrieved US 2012/O276.536A1 Nov. 1, 2012 from the internet: www.ncbi.nlm.nih.gov/SNP/Snp ss.cgi?subsnp id=4940242 retrieved on Apr. 16, 2013. International Search Report (ISR) for PCT/JP2010/067444, I.A. fl: (30) Foreign Application Priority Data Oct. 5, 2010, mailed Dec. 7, 2010 from the Japanese Patent Office, Tokyo, Japan. Oct. 5, 2009 (JP) ...... 2009-231998 International Preliminary Report on Patentability (IPRP), Chapter I Oct. 5, 2009 (JP) ...... 2009-232OOO of the Patent Cooperation Treaty, including the Written Opinion for Oct. 5, 2009 (JP) ...... 2009-232O3O PCT/JP2010/067444, I.A. fl: Oct. 5, 2010, issued May 8, 2012, from Oct. 5, 2009 (JP) ...... 2009-232O31 the International Bureau of WIPO, Geneva, Switzerland. Oct. 5, 2009 (JP) ...... 2009-232O34 Homo sapiens organic anion transporter 3 (OAT3), mRNA, complete cds. Uploaded Mar. 9, 1999. NCBI Entrez Nucleotide. Accession No. AFO97491 (GI:4378058), retrieved on Nov. 29, 2010, from the (51) Int. Cl. internet, www.ncbi.nlm.nih.gov/nuccore/4378058>. CI2N 15/09 (2006.01) CI2O I/68 (2006.01) (Continued) GOIN33/5 (2006.01) GOIN33/50 (2006.01) Primary Examiner — Addison D Ault GOIN33/53 (2006.01) (74) Attorney, Agent, or Firm — Sterne, Kessler, Gold (52) U.S. Cl. Stein & Fox PL.L.C. CPC CI2N 15/09 (2013.01); C12O 1/68 (2013.01); G0IN33/15 (2013.01); G0IN33/50 (2013.01); (57) ABSTRACT G0IN33/53 (2013.01) A genetic polymorphism and a hair shape Susceptibility gene (58) Field of Classification Search that are related to hair shape, and a method for determining None the genetic Susceptibility to hair shape in individual test Sub See application file for complete search history. jects are provided. Disclosed is a hair shape Susceptibility gene, which overlaps with a haplotype block in in the 11q12.2 to 11q13.2 region (D11S4191 and D11S987) of human chro (56) References Cited mosome 11 and comprises a portion or the entirety of the base U.S. PATENT DOCUMENTS sequence of the haplotype block, wherein the haplotype block is determined by a linkage disequilibrium analysis conducted 6,812,330 B2 11/2004 Burton et al. on a single nucleotide polymorphism (SNP) marker whose 6,812,339 B1 11/2004 Venter et al. allele frequency differs statistically significantly between a 2002fOO45188 A1* 4/2002 Kamb et al...... 435.7.1 group having a curly hair trait and a group having a non-curly 2005/020801.0 A1 9, 2005 De Lacharriere et al. 2005/025O180 A1 11/2005 Jacobs et al. hair trait, and consists of a base sequence set forth in any one 2007/0065389 A1 3/2007 De Lacharriere et al. of SEQ ID NO: 1 to NO:5. 2012fO231094 A1 9/2012 Taguchi et al. 2012,0329726 A1 12/2012 Taguchi et al. 17 Claims, 14 Drawing Sheets US 9.255.264 B2 Page 2

(56) References Cited Hanis, CL et al., “A genome-wide search for human non-insulin dependent (type 2) diabetes genes reveals a major Susceptibility locus OTHER PUBLICATIONS on chromosome 2.” Nat Genet 13(2): 161-166 (Jun. 1996), Nature Homo sapiens phosphofurin acidic cluster sorting protein 1 (PACS 1), Pub. Co, New York, NY. mRNA, complete cds. Uploaded Sep. 20, 2009, NCBI Entrez Kjaer, KW et al., “Novel Connexin 43 (GJA1) mutation causes oculio Nucleotide. Accession No. NM 018026 (GI:30089915), retrieved dento-digital dysplasia with curly hair.” Am J Med Genet A, 127A(2): on Nov. 29, 2010, from the internet, www.ncbi.nlm.nih.gov/nuccore? 152-157 (Jun. 2004), Wiley-Blackwell, Hoboken, N.J. 3.0089915?sat=NCBI&satkey=326985.03>. Mann, GB et al., “Mice with a null mutation of the TGF alpha gene Homo sapiens kinesin light chain 2 (KLC2), transcript variant 2, have abnormal skin architecture, wavy hair, and curly whiskers and mRNA, Uploaded Sep. 3, 2009, NCBI Entrez Nucleotide. Accession often develop corneal inflammation.” Cell 73(2): 249-261 (Apr. No. NM 001134774 (GI: 198041727), retrieved on Nov. 29, 2010, 1993), MIT Press, Cambridge, MA. from the internet, www.ncbi.nlm.nih.gov/nuccore? Medland, SE et al., “Common variants in the trichohyalin gene are 198041727?sat=NCBI&satkey=32519240>. associated with straight hair in Europeans.” Am J Hum Genet 85(5): Homo sapiens RAB1B, member RS oncogene family (RAB1B), 750-755 (Nov. 2009), American Society of Human Genetics, Balti mRNA, Uploaded Feb. 1, 2009, NCBI Entrez Nucleotide. Accession more, MD. No. NM 030981 (GI: 116014337), retrieved on Nov. 29, 2010, from Moller, LB et al., “Identification and analysis of 21 novel disease the internet, www.ncbi.nlm.nih.gov/nuccore? 116014337?sat=NCBI causing amino acid Substitutions in the conserved part of ATP7A.” &satkey=27780408>. Hum Mutat 26(2): 84-93 (Aug. 2005), Wiley-Liss, New York, NY. Homo sapiens cornichonhomolog2 (Drosophila)(CNIH2), mRNA, Norgett, EE et al., “Recessive mutation in desmoplakin disrupts Uploaded Aug. 6, 2009, NCBI Entrez Nucleotide. Accession No. desmoplakin-intermediate filament interactions and causes dilated NM 182553 (GI:32698937), retrieved on Nov. 29, 2010, from the cardiomyopathy, woolly hair and keratoderma.” Hum Mol Genet 9: internet, www.ncbi.nlm.nih.gov/nuccore/32698937?sat=NCBI 2761-2766 (Nov. 2000), IRL Press at Oxford University Press, &satkey=31931907>. Oxford, England. Homo sapiens Yip interacting factor homolog A (S. cerevisiae) Rostand, J et al., “An Atlas of Human Genetics.” Hutchinson Scien tific & Technical, London, England, pp. 26-29, 1964. (YIF1A), mRNA, Uploaded Aug. 2, 2009, NCBI Entrez Nucleotide, Sabeti, PC et al., “Genome-wide detection and characterization of Accession No. NM 020470 (GI: 170932463), retrieved on Nov. 29, positive selection in human populations.” Nature 449(7164): 913 2010, from the internet, www.ncbi.nlm.nih.gov/nuccore? 918 (Oct. 2007), Nature Publishing Group, Basingstoke, England. 170932463?sat=NCBI&satkey=31767219). Sulem, Pet al., “Genetic determinants of hair, eye and skin pigmen Homo sapiens transmembrance protein 151A (TMEM151A), tation in Europeans.” Nat Genet 39(12): 1443-1452 (Dec. 2007), mRNA, Uploaded Aug. 6, 2009, NCBI Entrez Nucleotide. Accession Nature Pub.Co., New York, NY. No. NM 153266 (GI:221 136815), retrieved on Nov. 29, 2010, from Thibaut, S, et al., “Human hair shape is programmed from the bulb.” the internet, www.ncbi.nlm.nih.gov/nuccore/NM 153266.3. Br J Dermatol 152(4): 632-638 (Apr. 2005), Blackwell Scientific Homo sapiens CD248 molecule, endosialin (CD248), mRNA, Publications, Oxford, England. Uploaded Feb. 1, 2009, NCBI Entrez Nucleotide. Accession No. Extended European search report including the Supplementary Euro NM 020404 (GI:45387956), retrieved on Nov. 29, 2010, from the pean search report and the European search opinion, mailed Jun. 7. internet, www.ncbi.nlm.nih.gov/nuccore/45387956?sat=NCBI 2013, for EP Application No. 10822003.9, the European Patent &satkey=27783461 >. Office, Munich, Germany. Homo sapiens oral cancer overexpressed 1 (ORAOV1), mRNA, International Search Report (ISR) for PCT/JP2010/067441, I.A. fl: Uploaded Aug. 6, 2009, NCBI Entrez Nucleotide. Accession No. Oct. 5, 2010, mailed Nov.30, 2010 from the Japanese Patent Office, NM 153451 (GI:56676315), retrieved on Nov. 29, 2010, from the Tokyo, Japan (PCT phase of U.S. Appl. No. 13/500,439). internet, www.ncbi.nlm.nih.gov/nuccore/56676315?sat=NCBI International Preliminary Report on Patentability (IPRP), Chapter I &satkey=31931818>. of the Patent Cooperation Treaty, including the Written Opinion for PCT/JP2010/067441, I.A. fl: Oct. 5, 2010, issued May 8, 2012, from Homo sapiens keratin associated protein 5-8 (KRTAP5-8), mRNA, the International Bureau of WIPO, Geneva, Switzerland (PCT phase Uploaded May 1, 2008, NCBI Entrez Nucleotide. Accession No. of U.S. Appl. No. 13/500,439). NM 021046 (GI: 123173776), retrieved on Nov. 29, 2010, from the International Search Report (ISR) for PCT/JP2010/067443, I.A. fl: internet, www.ncbi.nlm.nih.gov/nuccore/123173776?sat=NCBI Oct. 5, 2010, mailed Dec. 7, 2010, from the Japanese Patent Office, &satkey=2224,5774>. Tokyo, Japan (PCT phase of U.S. Appl. No. 13/500,442). Homo sapiens keratin associated protein 5-9 (KRTAP5-9), mRNA, International Preliminary Report on Patentability (IPRP), Chapter I Uploaded Feb. 26, 2008, NCBI Entrez Nucleotide. Accession No. of the Patent Cooperation Treaty, including the Written Opinion for NM 00:5553 (GI: 123702037), retrieved on Nov. 29, 2010, from the PCT/JP2010/067443, I.A. fl: Oct. 5, 2010, issued May 8, 2012, from internet, www.ncbi.nlm.nih.gov/nuccore/123702037?sat=NCBI the International Bureau of WIPO, Geneva, Switzerland (PCT phase &satkey=20831 141 >. of U.S. Appl. No. 13/500.442). Homo sapiens keratin associated protein 5-10 (KRTAP5-10), Notification of First Office Action, for Chinese Patent Application mRNA, Uploaded May 1, 2008, NCBI Entrez Nucleotide. Accession No. CN 201080044858.8, mailed Dec. 24, 2012, from the Patent No. NM 001012710 (GI:60593039), retrieved on Nov. 29, 2010, Office of the People's Republic of China, Beijing, China (counterpart from the internet, www.ncbi.nlm.nih.gov/nuccore? to U.S. Appl. No. 13/500.439). 60593.039?sat=NCBI&satkey=22247595>. Extended European search report for EP Appl. No. 10822002. 1, Altshuler, D et al., “The common PPARgamma Pro12Ala including the Supplementary European search report and the Euro polymorphism is associated with decreased risk of type 2 diabetes.” pean search opinion, dated Feb. 12, 2013, European Patent Office, Nat Genet26(1): 76-80 (Sep. 2000), Nature Pub.Co., New York, NY. Munich, Germany (counterpart to U.S. Appl. No. 13/500.442). Cullen SI et al., “Acquired Progressive Kinking of the Hair.” Arch Homo sapiens annexin A9 (ANXA9), mRNA, Uploaded May 1, Dermatol 125: 252-255 (Feb. 1989), American Medical Assn., Chi 2008, NCBI Entrez Nucleotide. Accession No. NM 003568 cago, IL. (GI: 145864464), retrieved on Nov. 15, 2010, from the internet, www. Du, X et al., “Velvet, a Dominant Egfr Mutation That Causes Wavy incbi.nlm.nih.gov/nuccore? 145864464?sat=NCBI Hair and Defective Eyelid Development in Mice.” Genetics 166: &satkey=22246716>. 331-340 (Jan. 2004), Genetics Society of America, Bethesda, MD. Homo sapiens family with sequence similarity 63, member A Fujimoto, A. et al., “A Scan for genetic determinants of human hair (FAM63A), transcript variant 2, mRNA, Uploaded Aug. 5, 2009, morphology: EDAR is associated with Asian hair thickness.” Hum NCBI Entrez Nucleotide. Accession No. NM 00 1040217 Mol Genet 17: 835-843 (Mar. 2008), IRL Press at Oxford University (GI:253795485), retrieved on Nov. 15, 2010, from the internet, www. Press, Oxford, England. incbi.nlm.nih.gov/nuccore/NM 001040217.2>. US 9.255.264 B2 Page 3

(56) References Cited Klacansky, I. et al., "Cell-type-specific patterns of gene expression, GenBank: lucus FW48121.1” Feb. 21, 2008, XP055052019, OTHER PUBLICATIONS Retrieved from the internet: www.ncbi.nlm.nih.gov/nuccore/ fwS48121, retrieved Feb. 1, 2013. Homo sapiens late cornified envelope 5A (LCE5A), mRNA, Mou, C. et al., "Enhanced ectodysplasin-A receptor (EDAR) signal Uploaded Sep. 20, 2009, NCBI Entrez Nucleotide. Accession No. ing alters multiple fiber characteristics to produce the East Asian hair NM 178438 (GI: 110578661), retrieved on Nov. 15, 2010, from the internet, www.ncbi.nlm.nih.gov/nuccore/110578661?sat=NCBI form.” Hum Mutat, 29(12): 1405-1411 (Dec. 2008), Wiley-Liss, New &satkey=32699481>. York, NY. Homo sapiens cysteine-rich C-terminal 1 (CRCT1), mRNA, Notification of First Office Action, for Chinese Patent Application Uploaded Oct. 9, 2008, NCBI Entrez Nucleotide, Accession No. No. CN 201080044857.3, mailed Dec. 24, 2012, from the Patent NM 019060 (GI:209180483), retrieved on Nov. 15, 2010, from the Office of the People's Republic of China, Beijing, China (counterpart internet, www.ncbi.nlm.nih.gov/nuccore/209180483?sat=NCBI to U.S. Appl. No. 13/500.462). &satkey=255.19550>. Notification of First Office Action, for Chinese Patent Application Homo sapiens late cornified envelope 2B (LCE2B), mRNA, No. CN 201080044856.9, mailed Dec. 25, 2012, from the Patent Uploaded Feb. 22, 2009, NCBI Entrez Nucleotide, Accession No. Office of the People's Republic of China, Beijing, China (counterpart NM 014357 (GI:223633914), retrieved on Nov. 15, 2010, from the to U.S. Appl. No. 13/500.442). internet, www.ncbi.nlm.nih.gov/nuccore/223633914?sat=NCBI Tand, D. et al., "Advances in Methods for SNP Detection.” J. Shang &satkey=284.60288>. hai Jiaotong University (Agricultural Science) 25(2):405-418 (Apr. Homo sapiens late cornified envelope 2A (LCE2A), mRNA, 2007), China Academic Journal Electronic Publishing House, Uploaded Feb. 13, 2009, NCBI Entrez Nucleotide, Accession No. Beijing, China. NM 178428 (GI:57242769), retrieved on Nov. 15, 2010, from the Wang, Q-S. et al., “Review of Association Analyses of Haplotype internet, www.ncbi.nlm.nih.gov/nuccore/57242769?sat=NCBI with Traits.” J. Shanghai Jiaotong University (Agricultural Science) &satkey=283933204>. 26(3):255-257 (Jun. 2008),China Academic Journal Electronic Pub Homo sapiens sperm mitochondria-associated cysteine-rich protein lishing House, Beijing, China. (SMCP), nuclear gene encoding mitochondrial protein, mRNA, Stoll, Metal. "Genetic variation in DLG5 is associated with inflam Uploaded Feb. 11, 2008, NCBI Entrez Nucleotide, Accession No. matory bowel disease.” Nat Genet, May 2004; 36(5): 476-480, NM 030663 (GI:25121988), retrieved on Nov. 15, 2010, from the Nature Pub. Co, New York, NY. internet, www.ncbi.nlm.nih.gov/nuccore/25121988?sat=NCBI Shimomura, Yet al., “Disruption of P2RY5, an orphan G protein &satkey=20570171>. coupled receptor, underlies autosomal recessive woolly hair.” Nat Homo sapiens involucrin (IVL), mRNA, Uploaded Sep. 20, 2009, Genet, Mar. 2008; 40(3): 335-339, Nature Pub. Co, New York, NY. NCBI Entrez Nucleotide, Accession No. NM 005547 Schlake, T. "Segmental Igfbp5 expression is specifically associated (GI:44890.058), retrieved on Nov. 15, 2010, from the internet, www. with the bent structure ofzigzag hairs.” Mech Dev, Sep. 2005; 122(9): ncbi.nlm.nih.gov/nuccore/44890.058?sat=NCBI 988-997, Elsevier, Limerick, Ireland. &satkey=32.698100>. Excerpted file history of U.S. Appl. No. 13/500,439: Final Office Homo sapiens cysteine and glycine-rich protein 1, mRNA (cDNA action mailed Nov. 24, 2014; Amendment and Reply filed Oct. 17, clone MGC:40335 IMAGE:5244276, complete cds. Uploaded Jul. 2014; Office action mailed Apr. 22, 2014; reply to Restriction/elec 15, 2006, NCBI Entrez Nucleotide. Accession No. BC032493 tion of species requirements filed Jan. 23, 2014 and Restriction/ (GI:21595.351) Retrieved on Nov. 24, 2010, from the internet, www. election of species requirements mailed Nov. 27, 2013. incbi.nlm.nih.gov/nuccore/21595351D. Excerpted file history of U.S. Appl. No. 13/500.442: Final Office Homo sapiens neuron navigator 1 (NAV 1) mRNA, complete cds. action mailed Sep. 10, 2014; Reply to Office action filed Aug. 21, Uploaded Jul. 1, 2002, NCBI Entrez Nucleotide, Accession No. 2014; Office action mailed Apr. 21, 2014; reply to Restriction/elec AY043013 (GI:21654876) Retrieved on Nov. 24, 2010, from the tion of species requirements filed Jan. 23, 2014; and Restriction/ internet, www.ncbi.nlm.nih.gov/nuccore/21654876>. election of species requirement mailed Nov. 27, 2013. Homo sapiens importin9 (IPO9), mRNA, Uploaded Feb. 11, 2008, Hindorff, LA et al., "Genetic architecture of cancer and other com NCBI Entrez Nucleotide. Accession No. NM 018085 plex diseases: lessons learned and future directions.” Carcinogenesis, (GI: 112734865) Retrieved on Nov. 24, 2010, from the internet, Jul. 2011; 32: 945-954, IRL Press, Oxford, England. www.ncbi.nlm.nih.gov/nuccore/112734865?sat=NCBI Liu, X et al., "Genetic variants at 5p12 and risk of breast cancer in &satkey=20569420>. Han Chinese.” J. Hum Genet, Oct. 2012; 57(10): 638-641, Nature Homo sapiens shisa homolog4 (Xenopus laevis) (SHISA4), mRNA, Pub. Group, London, England. Uploaded Sep. 3, 2009, NCBI Entrez Nucleotide. Accession No. Homo sapiens cysteine and glycine-rich protein 1 (CSRP1), tran NM 198149 (GI:39930574) Retrieved on Nov. 24, 2010, from the script variant 1, mRNA, NCBI Accession NM 004078, version internet, www.ncbi.nlm.nih.gov/nuccore/39930574?sat=NCBI NM 004078.2 (GI:221316625), Jun. 24, 2009, last modification &satkey=32433675>. Feb. 26, 2014, printed from www.ncbi.nlm.nih.gov/nuccore/NM Homo sapiens nuclear casein kinase and cyclin-dependent kinase 004078. substrate 1 (NUCKS1), mRNA, Uploaded Feb. 1, 2009, NCBI Entrez Xie, Ji-sheng et al., “Difference in the polymorphism of exon Nucleotide. Accession No. NM 022731 (GI: 181336713)|Retrieved 5 +3953C/T of interleukin-1 beta gene between Guangxi Zhuang on Nov. 24, 2010, from the internet, www.ncbi.nlm.nih.gov/nuccore/ population and Han population.” Chinese J. Clin. Rehabilitation 181336713?sat=NCBI&satkey=27783208>. 10:154-156 (Oct. 2006), Shenyang Shi, China. Botchkarev, VA et al., "Edar signaling in the control of hair follicle Excerpted file history of U.S. Appl. No. 13/500.442: Amendment and development.” J Investig Dermatol Symp Proc 10(3): 247-251, Dec. reply filed Mar. 9, 2015. 2005), Nature Publishing Group, New York, New York. Excerpted file history of U.S. Appl. No. 13/500,439: Amendment and Kimura, K. et al., “Diversification of transcriptional modulation: Reply filed Mar. 20, 2015, filed with the United States Patent and Large-scale identification and characterization of putative alternative Trademark Office, Alexandria, VA. promoters of human gene.” Genome Research 16:55-65, Jan. 2006, Cold Spring Harbor Laboratory Press, Woodbury, NY. * cited by examiner U.S. Patent Feb. 9, 2016 Sheet 1 of 14 US 9.255.264 B2

------. ------'''''''''''',

U.S. Patent Feb. 9, 2016 Sheet 2 of 14 US 9.255.264 B2

.**.-

~~~~~~~

U.S. Patent Feb. 9, 2016 Sheet 4 of 14 US 9.255.264 B2

U.S. Patent Feb. 9, 2016 Sheet 5 of 14 US 9.255.264 B2

3.38... x &k. U.S. Patent Feb. 9, 2016 Sheet 6 of 14 US 9.255.264 B2

w

a-a-a-a-a-a-a-a------''''''''''''''''

U.S. Patent Feb. 9, 2016 Sheet 7 of 14 US 9.255.264 B2

''''''...'...------m------

, , , , , , .

W. W. i. W.

S. S

S S U.S. Patent Feb. 9, 2016 Sheet 8 of 14 US 9.255.264 B2

U.S. Patent Feb. 9, 2016 Sheet 9 of 14 US 9.255.264 B2

s : 8

U.S. Patent Feb. 9, 2016 Sheet 10 of 14 US 9.255.264 B2

X------

U.S. Patent Feb. 9, 2016 Sheet 11 of 14 US 9.255.264 B2

U.S. Patent Feb. 9, 2016 Sheet 12 of 14 US 9.255.264 B2

U.S. Patent Feb. 9, 2016 Sheet 13 of 14 US 9.255.264 B2

*****Mwww.www-as-a-a-a-a-a-a-a-, U.S. Patent Feb. 9, 2016 Sheet 14 of 14 US 9.255.264 B2

US 9.255.264 B2 1. 2 HAR SHAPE SUSCEPTIBILITY GENE not only for so-called genetic diseases that are defined by variation or abnormality of a single gene, but also for poly REFERENCE TO SEQUENCE LISTING genic diseases characterized by low penetrance (the ratio of SUBMITTED ELECTRONICALLY onset of a certain disease in an individual having a variation in a certain gene), such as highly frequent common diseases The content of the electronically submitted substitute including lifestyle diseases Such as diabetes and hyperten sequence listing, file name 2537 0690005SequenceListin Sion, search for causative genes using non-parametric linkage g ascii.txt, size 431,187 bytes; and date of creation Apr. 4. analysis techniques such as affected sib-pair linkage analysis 2012, filed herewith, is incorporated herein by reference in its is frequently carried out (see, for example, Non-Patent Docu entirety. 10 ment 7). Further, based on the hypothesis that the variation of a disease-associated gene for a common disease is a highly FIELD OF THE INVENTION frequent genetic polymorphism (common variant), and that although the variation is present in healthy persons as well, The present invention relates to a gene related to hair shape, the prevalence is significantly high in patients (Common Dis determination of genetic Susceptibility to hair shape, detec 15 ease-Common Variant), search for causative genes by means tion and/or determination of the type of hair shape, a marker of linkage disequilibrium analysis using a genetic polymor for screening an ingredient effective for the regulation of hair phism (for example, SNP (Single Nucleotide Polymor shape, and a use of the marker. phism)) is also actively carried out throughout the world (see, for example, Non-Patent Document 8). BACKGROUND OF THE INVENTION More recently, with the progress in the international Hap Map Project, a database of general polymorphisms (SNP) of The natural shape of human hair is generally classified into high frequencies such as one million loci or more in four straight hair, wavy hair (wave hair), curled hair, and kinky human populations has been established, and research is hair (or coiled hair), depending on the degree of curl of the being conducted on common diseases as well as on general hair. Since the shape of hair and hairstyle constitutes one of 25 traits in which the phenotype varies with the human race or the traits that can be easily recognized as physical features of population, for example, skin color, hair color, and eye color human being, and also serve as an important factor that deter (see, for example, Non-Patent Documents 9 and 10). mines the first impression of a person, the shape of hair and Similarly, also in regard to the natural shape of human hair, hairstyle is a matter of great interest from a cosmetic view it can be contemplated that the natural hair shape is a general point, irrespective of gender and age. In the case of kinky hair 30 trait in which the phenotype varies with the human race or or curled hair with a high degree of curl, the person has population. In general, many Asian people have straight hair, trouble that the degree of freedom in hairstyle is limited so while African people predominantly have kinky hair (or that desired styling cannot be achieved. On the other hand, curled hair). Indo-European people have a high ratio of hav even in the case of straight hair, the person also has trouble ing a trait of wavy hair (wave hair), which is intermediate of that the hair cannot be volumized, and bare skin is easily 35 the two. The mode of inheritance was first observed by Ros shown through. tand, J., et al., and they reported that curly hair is an autosomal As methods for changing the shape of hair and hairstyle, (semi) dominant trait over straight hair (Non-Patent Docu hairdressing using various hairstyling agents or hair dryers/ ment 11). Furthermore, descriptions on the curly hair trait hair irons, wavefstraight permanent treatments, and the like may also be found in the human Mendelian inheritance data are being extensively carried out. However, although these 40 base of the NCBI (OMIM, http://www.ncbi.nlm.nih.gov/ operations can effectively modify the shape of hair, the opera omim/). However, in regard to causative genes that determine tions have no effect on the causative factor that determines the the natural shape of human hair, systematic research on hair shape. These operations, which are solutions to the above genome analysis has not been completed, and no such genes described troubles, are not fundamental solutions but are have been found yet. merely temporary, and in order to maintain the shape of hair 45 and hairstyle, these operations must be repeated frequently. PRIOR ART DOCUMENTS However, on the contrary, these operations cause increased damage to hair, and consequently impair the cosmetic value. Non-Patent Documents For this reason, there is a demand for the development of a method for the intrinsic regulation of hair shape, by which the 50 Non-Patent Document 1: Norgett E E et al., Hum. Mol. Genet. hair shape can be changed from the beginning of hair growth. 9(18), p. 2761-2766, 2000 Searching for a causative factor that determines the hair Non-Patent Document 2: Moller L. Bet al., Hum. Mutat. 26 shape and identifying a causative genethereofare expected to (2), p. 84-93, 2005 provide useful information in the development of a method Non-Patent Document 3: Kjaer KWetal. Am.J.Med. Genet. for the intrinsic regulation of hair shape. In regard to the 55 A. 127A(2), p. 152-157, 2004 factors or genes related to hair shape, there have been reports Non-Patent Document 4: Cullen S I et al., Arch. Dermatol. on the genetic diseases that bring changes to the shape of hair 125(2), p. 252-255, 1989 (Non-Patent Documents 1 to 3), acquired kinky hair caused Non-Patent Document 5: Du X at al. Genetics. 166(1), p. by drugs (Non-Patent Document 4), curly hair model animals 331-340, 2004 (Non-Patent Documents 5 and 6), and the like. However, the 60 Non-Patent Document 6: Mann G B at al., Cell. 73(2), p. factors or genes disclosed in these documents are merely a 249-61, 1993 special example that affect the hair shape, and are not Non-Patent Document 7: Hanis C L et al., Nat. Genet. 13(2), adequate to be considered as causative factors that determine p 161-166, 1996 the natural shape of human hair. Non-Patent Document 8: Altshuler D et al., Nat. Genet. 26(1), Meanwhile, along with the rapid progress in the genome 65 p. 76-80, 2000 analysis technology in recent years, the correlation between Non-Patent Document 9: Sulem P et al., Nat. Genet. 39(12), diseases and genes is being gradually clarified. Particularly, p. 1443-1452, 2007 US 9.255.264 B2 3 4 Non-Patent Document 10: Sabeti P C et al., Nature. 449 TABLE 1 (7164), p. 913–918, 2007 Nucleotide (i) Nucleotide (ii) Non-Patent Document 11: Rostand J at al., “An Atlas of Nucleotide (having (no Human Genetics”, Hutchinson Scientific & Technical, SEQID NO. Number predisposition) predisposition) London, pp. 26-29, 1964 1 1 7633 9315 SUMMARY OF THE INVENTION 2 1 16722 10 19992 The present invention provides a hair shape Susceptibility 21051 gene, which overlaps with a haplotype block in the 11q12.2 to 21927 2S269 11 q13.2 region (D11S4191 and D11S987) of human chro 27032 mosome 11 and includes a portion or the entirety of the base 35997 15 49537 sequence of the haplotype block, wherein the haplotype block 55405 is determined by a linkage disequilibrium analysis conducted 6918O 84627 on a single nucleotide polymorphism (SNP) marker whose 86.185 allele frequency differs statistically significantly between a 90221 group having a curly hair trait and a group having a non-curly 91247 92398 hair trait, and consists of a base sequence set forth in any one 981SO of SEQ ID NO:1 to NO:5. OO779 O1730 The present invention also provides a hair shape determin O2920 ing marker, which is an oligo- or polynucleotide containing a OS310 25 26,741 partial base sequence of the base sequence of the haplotype 33917 block described above, or a complementary strand thereof, 34786 wherein the partial base sequence consists of a contiguous 42991 44254 base sequence containing one or more single nucleotide poly 47896 morphisms (SNPs), wherein the SNPs include an SNP whose 30 SOO43 allele frequency differs statistically significantly between a 52853 68931 group having a curly hair trait and a group having a non-curly 72500 hair trait and an SNP linked to the SNP. 75003 Furthermore, the present invention provides a method for 8453S 35 89853 determining the genetic Susceptibility of a test Subject to hair 944OS shape, the method including the following steps (a) to (c): 202111 3 5297 (a) preparing a genomic DNA derived from a test Subject; 1828O 18933 (b) detecting, from the genomic DNA, in the haplotype 4 1 block, a single nucleotide polymorphism (SNP) which exists 40 8378 in the haplotype block described above and whose allele 12624 frequency differs statistically significantly between a group 20147 22.309 having a curly hair trait and a group having a non-curly hair 24512 trait, and a single nucleotide polymorphism (SNP) that is 26599 45 5 17OOO linked to the SNP; and 18895 (c) determining, if the allele frequency of the detected 26143 relevant SNP is statistically significantly higher in the group 27090 of curly hairpeople than in the group of non-curly hair people, 27751 that the test Subject has a genetic predisposition to curly hair, 50 30274 and if the allele frequency of the detected SNP is statistically significantly higher in an arbitrary group of non-curly hair Furthermore, the present invention provides a reagent for people than in the group of curly hair people, that the test the determination of the genetic susceptibility of a test subject Subject does not have a genetic predisposition to curly hair. to hair shape, the reagent including a probe and/or a primer, The present invention also provides a method for determin 55 which hybridizes with the hair shape determining marker of ing the genetic Susceptibility of a test Subject to hair shape, the the present invention under stringent conditions. method including: The present invention also provides a kit for the determi identifying, for any one or more nucleotides of the nucle nation of the genetic Susceptibility of a test Subject to hair otide numbers as indicated in the following table that are 60 shape, the kit including the reagent described above. present in the base sequences set forth in SEQ ID NO:1 to Furthermore, the present invention provides a method for NO:5 in the genomic DNA derived from a test subject, screening a hair shape regulating agent, the method including whether the nucleotide is nucleotide (i) or nucleotide (ii); and the following steps (a) and (b): determining, when the nucleotide is nucleotide (i), that the (a) administering a test Substance to a cell containing the test Subject has a predisposition to curly hair, and when the 65 hair shape Susceptibility gene of the present invention; and nucleotide is nucleotide (ii), that the test subject does not have (b) selecting, among the administered test Substances, a a predisposition to curly hair. substance which converts the type of the polymorphism of the US 9.255.264 B2 5 6 nucleotide in a marker with a single nucleotide polymor present invention, a fusion gene of the regulatory region of the phism (SNP) that is present on the hair shape susceptibility hair shape Susceptibility gene and a reporter gene, and cul gene or in the vicinity thereof, and the allele frequency of turing the cell in the presence and in the absence of a test which differs statistically significantly between a group hav Substance; ing a curly hair trait and a group having a non-curly hair trait, (b) measuring the amount of expression of an expression or a single nucleotide polymorphism (SNP) that is linked to product of the reporter gene in the cell culture cultured in the the SNP to other polymorphisms, as a hair shape regulating presence of the test Substance, and comparing the amount agent. with the amount of expression of an expression product of the Furthermore, the present invention provides a marker for reporter gene in the cell culture cultured in the absence of the the type of hair shape, consisting of a polynucleotide consist 10 ing of a base sequence set forth in SEQID NO:34, SEQ ID test Substance; and NO:36, SEQID NO:38 or SEQID NO:40, or a base sequence (c) selecting, based on the comparison results obtained complementary thereto, or a partial polynucleotide of the from step (b), a test Substance which increases or decreases polynucleotide, or consisting of a polypeptide consisting of the amount of the expression product of the reporter gene, as a hair shape regulating agent. an amino acid sequence set forth in SEQID NO:35, SEQID 15 NO:37, SEQ ID NO: 39 or SEQ ID NO: 41, or a partial The present invention also provides a method for evaluat polypeptide thereof. ing or selecting a hair shape regulating agent, the including The present invention also provides a primer for amplify the following steps (a) to (c): ing the marker for the type of hair shape of the present inven (a) contacting a test Substance with an aqueous Solution, a tion, the primer including a partial polynucleotide of a poly cell or a cell fraction prepared from the cell containing a nucleotide consisting of a base sequence set forth in SEQID protein encoded by the hair shape susceptibility gene of the NO:34, SEQID NO:36, SEQID NO:38 or SEQID NO:40, or present invention; a base sequence complementary thereto. (b) measuring the function or activity of the protein in the The present invention also provides a probe for detecting aqueous solution, cell or cell fraction that has been contacted the marker for the type of hair shape of the present invention, 25 with the test Substance, and comparing the function or activity the probe including a polynucleotide consisting of a base with that in a control aqueous solution, a control cell or a sequence set forthin SEQID NO:34, SEQID NO:36, SEQID control cell fraction, which has not been contacted with the NO:38 or SEQID NO:40, or a base sequence complementary test Substance; and thereto, or a partial polynucleotide of these polynucleotides. (c) selecting, based on the comparison results obtained The present invention also provides an antibody for detect 30 ing the marker for the type of hair shape of the present inven from step (b), a test Substance which increases or decreases tion, the antibody being capable of specifically recognizing a the function or activity of the protein, as a hair shape regulat polypeptide consisting of an amino acid sequence set forth in ing agent. SEQID NO:35, SEQID NO:47, SEQID NO:39 or SEQ ID The present invention also provides a method for regulat NO:41, or a partial polypeptide of the polypeptide. 35 ing the type of hair shape, the method including controlling Furthermore, the present invention provides a method for the expression of the hair shape Susceptibility gene of the detecting and/or determining the type of hair shape, the present invention in the human hair root area. method including the following steps (a) to (c): According to an embodiment, the hair shape Susceptibility (a) measuring the amount of expression of the marker for gene of the present invention is selected from SLC22A8, the type of hair shape of the present invention in a sample 40 PACS1, KLC2, RAB1B, CNIH2, YIF1A, MGC33486, derived from a test subject; CD248, ORAOV1, KRTAP5-8, KRTAP5-9, and KRTAP5 (b) comparing the measurement results obtained from step 10. (a) with the measurement results of non-curly hair people; According to an embodiment of the hair shape determining and marker of the present invention, the SNP is a SNP for a (c) determining the type of hair shape based on the results 45 nucleotide selected from the group consisting of the follow obtained from (b). ing bases: The present invention also provides a method for evaluat (1) in the base sequence set forth in SEQID NO:1, nucle ing or selecting a hair shape regulating agent, the method otides represented by Nucleotide Numbers 1 (dbSNP Data including the following steps (a) to (d): base ID:rs 10792367, G or C), 7633 (rs2276299, A or T), and (a) contacting a test Substance with a cell capable of 50 9315 (rs4149182, G or C): expressing the hair shape Susceptibility gene of the present (2) in the base sequence set forth in SEQID NO:2, nucle invention or a protein encoded by the gene; otides represented by Nucleotide Numbers 1 (rs11227403, C (b) measuring the amount of expression of the gene or the or T), 16722 (rs11607393, A or C), 19992 (rs3825067, T or protein in the cell contacted with the test substance: C), 21051 (rs11227411, T or C), 21927 (rs10896081, T or A), (c) comparing the amount of expression measured in step 55 25269 (rs11227413, A or G), 27032 (rs11227415, C or T), (b) with the amount of expression of the gene or the protein in 35997 (rs3862386, C or G), 49537 (rs9645684, A or G), a control cell that has not been contacted with the test Sub 554.05 (rs10896085, TorA), 69180 (rs918299, Tor C), 84627 stance; and (rs7943911, A or G), 86.185 (rs2177054, A or C), 90221 (d) selecting, based on the results obtained in step (c), a test (rs10750778, C or T), 91247 (rs6591207, A or T), 92398 Substance which increases or decreases the amount of expres 60 (rs10896091, C or T), 98150 (rs7946917, G or A), 100779 sion of the gene or the protein, as a hair shape regulating (rs10896094, T or C), 101730 (rs7941431, A or G), 102920 agent. (rs2293121, G or T), 105310 (rs10791855, G or A), 126741 The present invention also provides a method for evaluat (rs512421. A or G), 133917 (rs2155201, C or T), 134786 ing or selecting a hair shape regulating agent, the method (rs7925123, C or G), 142991 (rs2236651, T or C), 144254 including the following steps (a) to (c): 65 (rs2236652, A or G), 147896 (rs476551, C or G), 150043 (a) introducing, to a cell capable of expressing the hair (rs10791861, A or G), 152853 (rs22.98466, C or T), 168931 shape Susceptibility gene for the type of hair shape of the (rs10791863, T or C), 172500 (rs2155031, T or C), 175003 US 9.255.264 B2 7 8 (rs2276036, T or C), 184535 (rs22.98468, A or G), 189853 NO:2, which contains SNP:rs 11227447 and SNP: rs2282568, (rs11227447, C or G), 194405 (rs2282568, G or C), and and extends from SNP:rs 11227403 to SNP:rs3814738: 202111 (rs3814738, T or G): FIG. 7 is a conceptual diagram of a 18.933-bp haplotype (3) in the base sequence set forth in SEQID NO:3, nucle block represented by a base sequence set forth in SEQ ID otides represented by Nucleotide Numbers 5297 (rs523583, NO:3, which contains SNP: rs3741367 and SNP: rs3741368, A or C), 18280 (rs3741367, T or C), and 18933 (rs3741368, and extends from SNP:rs531784 to SNP: rs3741368; G or A); FIG. 8 is a conceptual diagram of a 27.375-bp haplotype (4) in the base sequence set forth in SEQID NO:4, nucle block represented by a base sequence set forth in SEQ ID otides represented by Nucleotide Numbers 1 (rs1789165. A NO:4, which contains SNP:SNP: rs17891.65 and extends 10 from SNP:rs1789 165 to SNP: rs1789170; or G), 8378 (rs10796828, GorT), 12624 (rs1789172, Tor C), FIG. 9 is a conceptual diagram of a 35,979-bp haplotype 20147 (rs1192921, G or C), 22309 (rs1192923, A or T), block represented by a base sequence set forth in SEQ ID 24512 (rs1192924, T or C), and 26599 (rs1789168, T or C): NO:5, which contains SNP: rs2664, and extends from SNP: and rs7395845 to SNP: rs9651754; (5) in the base sequence set forth in SEQID NO:5, nucle 15 FIG. 10-1 is a graph showing the amounts of expression of otides represented by Nucleotide Numbers 17000 (rs2664, T the hair shape Susceptibility gene in the Scalp hair roots of a or C), 18895 (rs793.4055, T or G), 26143 (rs17363723, Gor curly hair group and a straight hair group, A: CNIH2 gene, B: A), 26545 (rs11234174, Aor G), 27090 (rs10792781, CorT), YIF1A gene: 27751 (rs7107678, G or A), and 30274 (rs7106362, T or C). FIG. 10-2 is a graph showing the amounts of expression of According to another embodiment, the hair shape deter the hair shape Susceptibility gene in the Scalp hair roots of a mining marker consists of a contiguous base sequence having curly hair group and a straight hair group, C: ORAOV1 gene, a length of 10 to 601 nucleotides. D: KRTAP5-9 gene: According to an embodiment of the reagent of the present FIG. 11 is a set of photographs showing the images of hair invention for the determination of the genetic susceptibility of follicle tissue of various human races, while the arrows indi a test Subject to hair shape, the probe and/or the primer 25 cate curved regions; hybridizes with a region containing the SNP described in the FIG. 12 is a set of photographs showing the changes in the items (1) to (5) described above. shape of a hair follicle during culturing in a human hair According to an embodiment of the marker for the type of follicle organ culture system; and hair shape of the present invention, the partial polynucleotide FIG. 13 is a graph showing the effect of a hair shape is a polynucleotide of 15 bases or more in length. 30 Susceptibility gene expression regulating agent on the hair According to an embodiment of the method of the present follicle shape, A: Morning glory, B: Round cardamom. invention for detecting and/or determining the type of hair shape, the sample derived from a test subject is an RNA DETAILED DESCRIPTION OF THE INVENTION prepared from a biological sample collected from the test Subject, or a complementary polynucleotide transcribed from 35 The present invention relates to the provision of a genetic the RNA. polymorphism and a hair shape Susceptibility gene that are According to another embodiment of the method of the related to the natural shape of human hair such as curly hair or present invention for detecting and/or determining the type of straight hair, and the provision of a method for determining hair shape, the step (a) is a step of bringing a biological the genetic susceptibility of individual test subjects to hair sample collected from a test Subject into contact with an 40 shape based on this information. Furthermore, the present antibody for detecting the marker for the type of hair shape of invention relates to the provision of a reagent and a reagent the present invention, and measuring the amount of the kit, which are useful for conveniently carrying out the marker for the type of hair shape of the present invention in method. In addition, the present invention relates to the pro the biological sample that has been bound with the antibody. vision of a marker (polynucleotide or polypeptide) for detect According to another embodiment of the method of the 45 ing and determining the natural shape of human hair such as present invention for detecting and/or determining the type of curly hair or straight hair, and to the use of the marker, Such as hair shape, the biological sample collected from the test sub the detection and/or determination of the type of hair shape, ject is derived from an epithelial tissue or epithelial cell. or the evaluation and selection of an ingredient effective for the regulation of hair shape using the marker. BRIEF DESCRIPTION OF THE DRAWINGS 50 The inventors of the present invention set a goal of finding a causative gene that determines the natural shape of human FIG. 1 is a set of images of the phenotypes of hair shape; hair, and conducted a genome analysis directed to Japanese FIG. 2 is a diagram showing microsatellite markers and the family lines having curly hair, a group of Japanese curly hair maximum LODs obtained by an affected sib-pair linkage people and a group of Japanese non-curly hair people. As a analysis on chromosome 1: 55 result, the inventors identified genetic polymorphisms related FIG.3 is a diagram showing microsatellite markers and the to hair shape, that is, hair shape susceptibility SNP markers, maximum LODs obtained by an affected sib-pair linkage and also identified hair shape Susceptibility genes in the analysis on chromosome 11; 11q12.2 to 11q13.2 region of chromosome 11. The inventors FIG. 4 is a diagram showing microsatellite markers and the of the present invention also investigated the relations maximum LODs obtained by an affected sib-pair linkage 60 between hair shape and the gene expression of various genes analysis on chromosome 11; in the hair root area, and found that the amount of expression FIG. 5 is a conceptual diagram of a 12.590-bp haplotype of the hair shape Susceptibility genes in the hair root area block represented by a base sequence set forth in SEQ ID differs significantly between non-curly hair people and curly NO:1, which contains SNP: rs2276299 and extends from hair people. These genes are hair shape Susceptibility genes, SNP: rs10792367 to SNP: rs11231299; 65 and can serve as markers for detecting and/or determining the FIG. 6 is a conceptual diagram of a 202,111-bp haplotype type of hair shape. Based on these findings, the inventors of block represented by a base sequence set forth in SEQ ID the present invention finally completed the present invention. US 9.255.264 B2 10 According to the present invention, a hair shape Suscepti the “gene' or “DNA represented by a specific base sequence, bility gene related to the natural shape of human hair such as provided that they have a biological function equivalent to curly hair or straight hair, a hair shape susceptibility SNP that of the protein. marker, and a hair shape determining marker utilizing these Furthermore, according to the present invention, the terms are provided. When the hair shape susceptibility gene, the 5 “nucleotide”, “oligonucleotide' and “polynucleotide' have SNP marker, and the hair shape determining marker of the the same meanings as nucleic acid, and they are intended to present invention are analyzed in detail, research on the encompass both DNA and RNA. The DNA encompasses all mechanism of the hairformation related to the hair shape, and of cDNA, genomic DNA and synthetic DNA. The RNA application research Such as the development of an adequate encompasses all of total RNA, mRNA, rRNA and synthetic method for promoting the regulation of hair shape are made 10 RNA. Further, the “nucleotide”, “oligonucleotide' and available. "polynucleotide' may be double-stranded or single-stranded, According to the method for determining the genetic Sus and in the case of a “nucleotide' (or an "oligonucleotide' or ceptibility to hair shape of a test subject of the present inven "polynucleotide’) having a certain sequence, unless particu tion, search for a gene that serves as a main factor that deter larly stated otherwise, the “nucleotide' is intended to collec mines the hair shape of individual test Subjects, and 15 tively mean “nucleotide' (or an "oligonucleotide' or “poly determination of the susceptibility of individual test subjects nucleotide’) having a sequence complementary to the to the acquired changes of hair shape, that is, the degree of risk sequence. Furthermore, when the “nucleotide' (or "oligo of the future change in the hair shape, can be more conve nucleotide' or “polynucleotide') is RNA, the nucleotide niently and rapidly carried out. Furthermore, based on the symbol “T” indicated in the base sequence may be replaced results, an adequate method for regulating the hair shape for With U. individual persons can be provided. Further, the determina The term “polynucleotide having a complementary base tion method can be carried out more conveniently and rapidly, sequence” means a polynucleotide that is in a complementary by the reagent for the determination of genetic Susceptibility relation in terms of nucleotide (i.e., complementary strand or of a test subject to hair shape of the present invention and the anti-sense Strand), to a polynucleotide having an arbitrary kit including the reagent. 25 base sequence (sense Strand). A complementary base According to the present invention, the shape or nature of sequence encompasses a sequence that is completely comple hair such as curly hair or kinky hair can be detected and mentary to the Subject base sequence, as well as a base determined without damaging the hair. Furthermore, a Sub sequence that can be hybridized with the subject base stance selected according to the method of the present inven sequence under Stringent conditions. Here, the stringent con tion for Screening an ingredient effective for the regulation of 30 ditions may conventionally refer to washing conditions of hair shape can be used as a hair shape regulating agent that is approximately “1xSSC, 0.1% SDS, 37° C., and more strin effective for the regulation of hair shape, and can also be used gent hybridization conditions may be approximately '0.5x for the preparation of a pharmaceutical product, a quasi SSC, 0.1% SDS, 42°C., and even more stringent hybridiza drugs, cosmetic materials, health foods and the like, which all tion conditions may be approximately “0.1 xSSC, 0.1% SDS, contain the agent. Further, according to the present invention, 35 65°C.. Furthermore, a person having ordinary skill in the art a method for regulating the hair shape using the hair shape can determine stringent hybridization conditions according to susceptibility SNP marker obtained by the present invention general textbooks (for example, Sambrook, J. & Russell, D., can be provided. 2001, Molecular Cloning: a Laboratory Manual, 3" edition, Cold Spring Harbor, N.Y.: cold Spring Harbor Laboratory). 1. DEFINITIONS OF TERMS USED IN PRESENT 40 An example of a base sequence that can be hybridized with a INVENTION Subject base sequence under stringent conditions may be a base sequence having a homology of 90% or higher, and The indication of base sequences (nucleotide sequences), preferably 95% or higher, with the subject base sequence. nucleic acids and the like by means of abbreviations in the The term “protein’ or “polypeptide' encompasses a “pro present specification is as recommended by the specifications 45 tein' or “polypeptide' represented by a specific base of IUPAC-IUB (IUPAC-IUB Communication on Biological sequence or amino acid sequence, as well as a fragment, a Nomenclature (Eur. J. Biochem. 138, 9, 1984), “Guidelines homologue, a derivative and a variant thereof, provided that for the preparation of specifications containing base they all have a biological function equivalent to that of the sequences or amino acid sequences” (edited by the Japanese “protein’ or “polypeptide'. Meanwhile, the variant encom Patent Office), and the symbols conventionally used in the 50 passes a naturally occurring allele Variant, a variant that does art. not occur naturally, and a variant having an amino acid The term “DNA as used in the present specification sequence modified by artificial deletion, Substitution, addi encompasses not only a double-strand DNA, but also single tion and insertion. In addition, examples of the variant include Strand DNAS Such as a sense strand, and an anti-sense Strand those having a homology in the amino acid sequence of 80% constituting the double-strand DNA. Unless particularly 55 or higher, preferably 90% or higher, more preferably 95% or stated otherwise, the term 'gene' as used herein encompasses higher, and even more preferably 98% or higher, with a pro all of a double-stranded DNA including human genome tein or polypeptide having no variation. DNA, a single-stranded DNA (sense strand) and a single According to the present specification, the homology of Stranded DNA having a sequence complementary to the sense amino acid sequences and base sequences is calculated by the Strand (anti-sense strand), and fragments thereof. Unless par 60 Lipman-Pearson method (Science, 227, 1435, 1985). Specifi ticularly stated otherwise, the term “gene' as used herein is, cally, the homology is calculated by performing an analysis unless particularly stated otherwise, intended to indicate any using a homology analysis (Search homology) program in the of a regulatory region, a coding region, an exon and an intron genetic information processing software Genetyx-Win (Soft without discrimination. Further, the “gene' or “DNA ware Development Co., Ltd.), and by setting the parameter, encompasses a “gene' or “DNA represented by a specific 65 Unit size to compare (ktup), at 2. base sequence, as well as a “gene' or “DNA” which encodes The term “antibody encompasses a polyclonal antibody, a a homologue, a derivative or a variant of a protein encoded by monoclonal antibody, a chimeric antibody, a single-chain US 9.255.264 B2 11 12 antibody, and portions of the antibodies described above, these family lines, and the genetic locus regions of the marker which have antigen-binding properties. Such as Fab frag linked to the disease (or the particular trait) are narrowed ments, and fragments produced by a Fab expression library. down. In the case of a group of general (i.e., not affected, or In regard to the term 'genetic polymorphism' as used not having a particular trait) sibs, in one genetic locus, a child herein, when there are two or more genetically determined receives one of the two alleles of one parent (even if the one alleles, the term refers to such an allele gene. Specifically, in parent is a homozygote, the alleles are considered to be dif a human population, when variations such as Substitution, ferent from each other). Therefore, in this case, there exist a deletion, insertion, dislocation, and inversion of one or plural case in which the sibs receive the same allele, and a case in nucleotides exist at a specific region in the genome of one or which the sibs receive differentalleles. Since each of the two plural individuals, with respect to the genomic sequence of 10 one certain individual, the variation is called "genetic poly alleles of a child originates one allele from each of the parents, morphism' if it is statistically ensured that the variation is not when the question of how many identical alleles sibs will a mutation occurring in the one or plural individuals, or if it receive from their parents is considered, there are three cases can be genetically demonstrated that the variation is not a such as 0, 1 and 2. These three cases are said to have an IBD specific variation in the individuals but occurs in the popula 15 (Identity By Descent) of 0, 1 and 2, respectively. When a tionata frequency of 1% or greater. Examples of the 'genetic number of sib-pairs are considered, the numbers of the pairs polymorphism' as used herein include substitution of one having an IBD=0, the pairs having an IBD=1, and the pairs nucleotide with another nucleotide, that is, a single nucleotide having an IBD=2 should be counted, and the proportion of the polymorphism (SNP); deletion or insertion of one to several numbers constitutes a certain proportion (1:2:1) according to tens of nucleotides (DIP); a region includes repetition of units the probability laws. On the contrary, when sibs that are of sequence consisting of 2 to several tens of nucleotides as affected (or have a particular trait) are collected, and the same one unit, where the number of the repetition is different (when investigation is carried out with this group, if an observed the unit repeated in the region consists of 2 to 4 nucleotides, marker gene is linked to the disease (or the particular trait), it is referred to as a microsatellite polymorphism, and when this ratio (1:2:1) is deviated (i.e., the number of the pairs the unit repeated in the region consists of several to several 25 having an IBD=2 increases, and the number of the pairs tens of nucleotides, it is referred to as a VNTR (Variable having an IBD=0 decreases). In addition, for a marker gene Number of Tandem Repeat); and the like. which is not linked to a gene that is related to the disease (or The term “hair shape’ as used herein refers to the tendency the particular trait), it can be considered that the ratio has the of the overall shape of hair in the head area, which attributes same distribution (1:2:1) as any arbitrary sib. In the affected to the shape of individual hairs, such as straight hair, wavy 30 sib-pairlinkage analysis, the likelihood of observation data is hair or wave hair, curled hair, or kinky hair or coiled hair. calculated by utilizing this hypothesis, by taking the differ The term "curly hair as used herein is, unless particularly ence of the ratio of shared alleles in affected sib-pairs as an stated otherwise, a term which collectively refers to the shape index. The likelihood is represented by the following for other than Straight hair in the case of contrasting with Straight mula: hair. Therefore, according to the present specification, in the 35 case of contrasting with the "curly hair, unless particularly stated otherwise, the “straight hair and the “non-curly hair W are considered to have the same meaning. The "curly hair”, “non-curly hair and “straight hair are of relative nature, and can be defined by various methods that 40 will be described below. The "curly hair trait”, “non-curly wherein Wij represents the probability that the affected hair trait”, and “straight hair trait” refer to the phenotypes sib-pair of the j' family line has an IBD-i. The variable is representing the "curly hair”, “non-curly hair' and “straight Z=(Z0, Z1, Z2), and the degree of freedom is 2 (Z2=1-Z1 hair, respectively. Z0, there are only two independent variables of ZO and Z1). The term “hair shape susceptibility gene' as used herein 45 The ratio with the likelihood in the case where a marker gene refers to a causative gene that determines the hair shape which and a gene associated with a disease (or a particular trait) are is a polygenic trait, and the term "hair shape Susceptibility not linked (that is, Z0=0.25, Z1 =0.5, Z2=0.25) is taken, and SNP marker” refers to the nucleotide at a site which repre the value of Zwhich gives the maximum likelihood is deter sents an SNP associated with the trait of hair shape of the mined by the likelihood maximization method (maximum individual. 50 likelihood estimation). According to the present specification, the terms “genetic The term “gene frequency” as used herein refers to the Susceptibility to hair shape', 'hair shape determining proportion occupied by the allele at a genetic locus among the marker” and “marker for the type of hair shape” respectively total number of genes present in a group. refer to the genetic predisposition related to the specific hair The term “haplotype' as used herein means a combination shape possessed by an individual, and a marker for determin 55 of genetic variations existing in one allele (haploid). ing the predisposition. The term “linkage disequilibrium analysis” or “haplotype The term “Affected Sib-Pair Linkage Analysis' as used analysis’ as used herein means an analysis of the degree of the herein refers to one technique for estimating the location of a intensity of linkage disequilibrium in a genomic region. target gene (e.g., disease Susceptibility gene or the like) using The term “linkage disequilibrium' as used herein refers to linkage, and is a representative analysis technique for non 60 a phenomenon in the population genetics, in which a non parametric linkage analysis which does not assume any mode random correlation is observed in a group between alleles or of inheritance (e.g., autosomal dominant inheritance, reces genetic markers (polymorphisms) at plural genetic loci, that sive heredity, sex-linked gene, or the like) or the penetrance. is, the frequency of such a particular combination (haplotype) In the affected sib-pair linkage analysis, family lines includ is significantly increased. They are generally on the same ing sibs (e.g., brothers and sisters) that are affected (or have a 65 chromosome and constitute genetic linkage, but there are particular trait) are collected, calculation of the likelihood is occasions in which even if the alleles are linked, linkage carried out on the basis of the data obtained by observation of disequilibrium is not observed. Further, in some exceptional US 9.255.264 B2 13 14 cases, linkage disequilibrium may be seen over different effectively selected through the identification of curly hair chromosomes. For example, when a genetic locus X has trait loci by an affected sib-pair linkage analysis, and a case alleles a and b (these exist at the same frequency), and a control association analysis on the curly hair trait loci, and a neighboring genetic locus Y has alleles c and d (these exist at gene present in a haplotype block containing the SNP(S) can the same frequency), the haplotype ac, which is a combina 5 be identified as a hair shape Susceptibility gene. tion of the respective genetic polymorphisms, is expected to The identification of the hair shape susceptibility gene and exist at a frequency of 0.25 in the group. When the frequency the hair shape susceptibility SNP marker of the present inven of the haplotype ac is higher than Such an expected value, that tion can be carried out, as will be described specifically in is, when a specific genotype denoted as ac appears frequently, Examples below, by performing an identification method it is said that the allele ac is in linkage disequilibrium. Link 10 having the following steps: age disequilibrium is occurred as a result that the time of (i) a step of defining hair shapes, and collecting curly hair natural selection or introduction into a group of a particular family lines, people having a curly hair trait (case), and combination of alleles is evolutionarily recent, and may be people having a straight hair trait (control); occurred as a result that linked alleles have not reached equi (ii) a step of performing an affected sib-pair linkage analy librium. Therefore, the mode of linkage disequilibrium varies 15 sis directed to the entire genome using samples derived from with different groups, such as nations or races, and even in the the curly hair family lines, and identifying a curly hair trait case where the allele ac in a certain group is in linkage locus; disequilibrium, there are occasions in which the allele ad is in (iii) a step of selecting plural SNP markers which are not a relation of linkage disequilibrium in other groups. The unevenly distributed over the entire region in the curly hair detection of genetic polymorphism in the linkage disequilib trait locus identified in step (ii); rium is effective in detecting the Susceptibility to a disease, (iv) a step of performing typing of the SNP markers regardless of whether the polymorphism itself directly causes selected in step (iii) using case-derived and control-derived the disease. For example, in regard to an allele a of a certain samples, comparing the results of the typing through a statis genetic locus X, although the allele is not a causative genetic tical processing, and identifying a SNP marker that is recog factor of a disease, the allele may exhibit susceptibility to a 25 nized to have a significant difference, as a hair shape Suscep disease through the linkage disequilibrium with an allele c of tibility SNP marker; a genetic locus Y. (v) a step of determining, in the hair shape Susceptibility The “haplotype block” as used herein is defined as a region SNP marker, a region (haplotype block) where linkage dis that is categorized as a genome region for which most of the equilibrium is recognized within the object candidate region historical recombination has not been acknowledged, and 30 and a hair shape susceptibility SNP marker is contained (Hap includes strong linkage disequilibrium. Identification of a lotype block), using the HapMap PHASE data of the Inter haplotype block can be appropriately achieved by those hav national HapMap Project Database, and thereby identifying a ing ordinary skill in the art based on the strength of the linkage hair shape Susceptibility gene; and disequilibrium, but for example, the identification can be (vi) a step of determining, for the haplotype extracted from carried out according to the report of Gabriel, et al. (Gabriel, 35 the haplotype block specified in step (v), aSNP locus that is S. B., et al., Science, 296 (5576), p. 2225-2229, 2002). The linked with the hair shape susceptibility SNP marker locus term "strong linkage disequilibrium' as used herein means determined in step (iv) using the HapMap PHASE data of the the state in which the upper limit of the 95% confidence International HapMap Project Database, and additionally interval of the linkage disequilibrium coefficient D', which is identifying the SNP thus-determined as an additional hair calculated in a linkage disequilibrium analysis, exceeds 0.98, 40 shape susceptibility SNP marker. and the lower limit is higher than 0.7. The phrase “there is an The step (i) is a step of defining hair shapes (curly hair or evidence of strong historical recombination” means a state in straight hair) and collecting analysis objects for trait map which the upper limit of the 95% confidence interval of the ping. In regard to the trait mapping, it is necessary to handle linkage disequilibrium coefficient D' is lower than 0.9. the Subject trait quantitatively to a certain extent, and thus, the The term “minor allele' as used herein means an allele 45 operation of defining hair shape, by which the objects are having a low gene frequency when two alleles exist in one defined to have a curly hair trait or a straight hair trait, con genetic locus. stitutes an important step when the trait mapping is carried According to the present specification, the terms “gene out. There area variety of human hair shapes, and the method frequency” and “allele frequency” are used for the same for measurement thereof and the method for classification or meaning, and are terms meaning the proportion occupied by 50 defining are also various. For instance, examples of the a particular allele in an arbitrary group of genes. method of defininghair shapes include a method of binarizing The phrase “statistically significantly different as used the hair shape, in Such a manner that curly hair-1 and straight herein means a state in which when a test is carried out hair-0; a method of measuring the degree of curly hair by any according to any statistical technique, the risk (p value) is less method and quantifying the degree; and a method that is well than 0.1%, preferably less than 0.07%, even more preferably 55 known to those having ordinary skill in the art (for example, less than 0.05%, and still more preferably less than 0.01%. see, Japanese Patent Application Laid-Open (JP-A) No. 2005-350801, JP-A No. 2008-268229, Japanese Patent No. 2. IDENTIFICATION OF HAIR SHAPE 4159515, and the like), but the method is not limited to these. SUSCEPTIBILITY GENE AND HAIR SHAPE As a more specific example of the method of defining hair SUSCEPTIBILITY SNP MARKER 60 shapes, there may be mentioned a method of classifying hair shapes into several grades (for example, 2 to 10 grades, pref Search and identification of a causative gene that deter erably 3 to 8 grades, and more preferably 5 to 7 grades) based mines the natural shape of human hair which is a multifacto on the features such as the overall shape, the degree of curl of rial general trait (hair shape Susceptibility gene), can be car the hair (radius of curl), the frequency of the appearance of ried out by a genetic statistical analysis using a technique for 65 curl, and/or the synchrony of curl with the groups of hair in trait mapping. That is, SNP(S) that are in the linkage disequi the Surroundings; and defining, in regard to Such classifica librium state with the hair shape susceptibility gene can be tions, a hair shape having a tendency of a small radius of curl, US 9.255.264 B2 15 16 Such as kinky hair and curled hair or strongly wavy hair, as a products having an identical size are obtained, plural ampli curly hair trait, and defining a hair shape having a tendency of fication primers can be rapidly detected by separately dis a large radius of curl. Such as wavy hair, almost straight hair criminating the various fluorescent colors. or slightly wavy hair, or straight hair, as a straight hair trait. A statistical test of the linkage can be carried out using The step (ii) is a step of carrying out an affected sib-pair commercially available or publicly disclosed genetic statistic linkage analysis on the entire genome using samples derived Software programs which are capable of non-parametric from a curly hair family line. The constituent members of the analysis (for example, Genehunter, Linkage Package, Map curly hair family line for carrying out the affected sib-pair maker/sibs, and the like). linkage analysis are sibs (a pair among brothers and sisters, The determination of the region where linkage is recog two people) determined to have the curly hair trait by the step 10 (i). More preferably, the constituent members consist of a nized was based on the criteria for obtaining a false positive family of 4 people (or 3 people) including the parents of the linkage, according to the guidelines provided by Lander and sibs, and other brothers and sisters (irrespective of the hair Kruglyak (Nat. Genet., 11(3), 241-247, 1995) shown below. shape) or grandparents may also be further added. Further The guidelines by Lander and Kruglyak (linkage analysis more, the number of the curly hair family lines needed to 15 over the entire genome in a multifactorial disease) have come carry out the affected sib-pair linkage analysis can be deter to be actively carried out, but in the linkage analysis of indi mined by estimating and/or observing the frequency in the vidual genes, the determination of whether the gene function population of the curly hair trait, the frequency of the caus can be causative is also added. However, since the gene func ative gene (allele frequency), the sib relative risk, or the like, tion is not taken into consideration in that stage in the analysis and calculating the number by through simulation. However, of the entire genome, determination criteria (threshold) of the number of the curly hair family line needed is generally 50 significant purely in terms of mathematical genetics are family lines to several hundred family lines. required. Thus, they provided criteria for significance of link The genetic marker used in the affected sib-pair linkage age as shown in the following Table 2 according to simula analysis is not particularly limited as long as it is a genetic tions. polymorphism, but a microsatellite that exists uniformly in 25 the genome and has a large number of alleles is used with TABLE 2 preference. Akit for amplifying and detecting a microsatellite Suggestive Linkage P < 7.4 x 10 (linkage mapping set) is commercially available from (Criteria for obtaining a result of one false LOD > 2.2 positive linkage from the entire genome) Applied Biosystems Corp. (ABI). Meanwhile, in the present Significant Linkage P < 2.2 x 10 invention, ABI PRISM Linkage Mapping Set-MD 10 v2.5 30 (Criteria for obtaining a result of 0.05 false LOD > 3.6 (manufactured by ABI) which covers human chromosome at positive linkages from the entire genome) an average interval of 9.2 cM, and ABI PRISM Linkage High Significant Linkage P< 3.0 x 107 Mapping Set-HD 5 v2.5 (manufactured by ABI) which covers (Criteria for obtaining a result of 0.01 false LOD > S4 human chromosome at an average interval of 5 cMwere used. positive linkages from the entire genome) Furthermore, the microsatellite that serves as a genetic 35 marker can be arbitrarily selected, and can be retrieved from Through this process, the whole chromosome can be the Comprehensive Human Genetic Maps of the Mammalian screened, and a region on the chromosome where linkage Genotyping Service (http://research.marshfieldclinic.org/ge with the curly hair trait is recognized can be detected. netics/GeneticResearch/compMaps.asp), NCBI (http://ww Through further detailed mapping, a specific region on the w.ncbi.nlm.nih.gov/) and the like. In this case, it is preferable 40 chromosome can be identified as a curly hair trait locus. The to select a microsatellite which exists in the genome at an region identified as such is a region where the presence of a interval of 0.1 to several cM, and has many alleles and high hair shape Susceptibility gene is strongly suggested. heterozygosity. Furthermore, microsatellite markers can be The step (iii) is a step of selecting, in the curly hair trait added to a chromosome in which linkage has been recog locus region identified in the step (ii), plural SNP markers nized, and the linkage region can be narrowed (detailed map 45 which are not unevenly distributed over the entire region. The ping). Meanwhile, for the PCR primer for amplifying and SNP markers can be selected by using various databases detecting the microsatellites that have been arbitrarily related to SNP, such as the dbSNP database (http://ww selected and added, the base sequence can be retrieved from w.ncbi.nlm.nih.gov/SNP?) and the JSNP database (http://sn the NCBI (http://www.ncbi.nlm.nih.gov/), and the primerican p.ims.u-tokyo.ac.jp/index ja.html). be produced based on the retrieved sequence according to an 50 Upon the selection of the SNP marker, a SNP which is ordinary method using, for example, a commercially avail useful for the identification of a hair shape susceptibility gene able nucleotide synthesizer. At this time, it is preferable to is selected. Specifically, in a Japanese group, a SNP having a label the probe with a radioactive substance, a fluorescent gene frequency of minor allele of 10% or greater, and more Substance, a chemiluminescent Substance, an enzyme or the preferably 15% or greater, is selected. When a SNP having like so that the detection of the amplification product can be 55 Such a gene frequency is used, a SNP marker having high achieved rapidly and easily. reliability can be selected. In the affected sib-pair linkage analysis, PCR is carried out In addition, when a SNP marker is selected by using the using a genomic DNA derived from a curly hair family line as gene frequency as an index, there are occasions in which the a template, and using a linkage mapping set (ABI) or an SNP marker is unevenly distributed in a specific narrow amplification primer of a microsatellite marker arbitrarily 60 region. In this case, if all of the selected SNP markers are used selected, and thus an amplification product (fragment) is in the identification of a hair shape Susceptibility gene, the detected. The operations of PCR and the detection of the experiment becomes complicated, and it is also not very amplification product can be carried out according to ordi effective that SNPs which are neighboring with each other are nary methods. At this time, when various amplification prim in the state of linkage disequilibrium. Therefore, it is prefer ers are labeled with different fluorescent dyes (for example, 65 able to select and use SNP markers which are present at a any dyes emitting different fluorescent light, such as 6-FAM certain interval from one another. As such, when uneven (blue), VIC (green), or NED (yellow)), even if amplification distribution of markers is eliminated by providing a certain US 9.255.264 B2 17 18 interval between them, a comprehensive association analysis 44-p. 54, Yodosha Co., Ltd., 2001). For example, it is effective can be carried out over the entire object candidate region, and to utilize TaqMan SNP Genotyping Assays (registered trade the identification of the hair shape susceptibility gene can be mark) (manufactured by ABI), and to employ a SNP typing easily carried out. The distance between adjacent SNP mark method which utilizes a TaqMan system. ers that are selected as such is preferably 5 kb or greater, and 5 The association analysis is typically achieved by compar more preferably 5 kb to 10kb. If this distance is too long, there ing the gene frequency of each of the SNP markers between is a possibility that a region may occur where the extent of the the case group and the control group, and carrying outay test strength of mutual linkage disequilibrium between SNP on whether the difference in the frequency is statistically markers cannot be checked. Furthermore, if this distance is meaningful or not (see, University of Tokyo, College of Arts too short, there are so many SNPs for which strong mutual 10 and Sciences, Department of Social Sciences, Statistics Sec linkage disequilibrium is recognized, and therefore, it is not tion, Edited, “Tokeigaku Nyumon-Kisotokeigaku I (Intro efficient. duction to Statistics—Fundamental Statistics I), University In the comprehensive selection of SNP markers over the of Tokyo Press, 1991). However, the association analysis may entire object candidate region, apart from this distance also be carried out based on the genotype frequency for each between SNP markers, the state of scattering of markers in the 15 SNP marker, the genotype frequency in the case of employing object candidate region, that is, the number of markers per a dominant (or recessive) model, the frequency of allele in unit distance of genome, can be expressed as “marker den terms of positive ratio, and the like. Furthermore, in addition sity.” The marker density is 0.5 SNPs or more, preferably 1 to the X test, the association analysis can be carried out by SNP or more, and more preferably 1 SNP to 2 SNPs, per 10 kb any other well-known statistical processing, as long as it is of genome. If the marker density is too low, the distance possible to compare the case group and the control group, that between markers is too long, and there is a possibility that a is, to test the relations between a phenotype that can be region may occur where the degree of the strength of linkage divided into plural groups, such as a trait and a disease, and a disequilibrium between SNP markers cannot be checked, as genetic polymorphism. described above. On the other hand, if the marker density is Meanwhile, in order to evaluate the typing error of a geno too high, the distance between markers is too short, and as 25 type, and the validity of sampling, a Hardy-Weinberg equi described above, markers are selected overcrowdedly, so that librium test is carried out. Hardy-Weinberg equilibrium is in the case of identifying a hair shape Susceptibility gene, a well known in the field of genome statistics, and in which large amount of experiment is needed, which is not so effi when two alleles (for example, C and T) exists as in an SNP cient. or the like, and the respective frequencies in a group are The step (iv) is a step of carrying out a case-control asso 30 represented by p and q (p+q-1), the genotype frequencies of ciation analysis for the SNP markers selected in step (iii). The C/C homo, C/T hetero and T/Thomo may be represented by case-control association analysis is a method of comparing p, 2pg and q, respectively (p+2pq+q=1). When an asso the allele frequencies for a certain hereditary marker between ciation analysis is carried out, it is desirable that the Hardy a case (affected people: people having the curly hair trait) Weinberg equilibrium is established for the control group. group and a control (control people: people having the 35 However, the selected SNP marker can be evaluated as valid straight hair trait), and detecting a marker which can exhibit a as long as the number of alleles, whose genotype frequency is significant difference in the allele frequency between the two statistically significantly different from Hardy-Weinberg groups. For example, Samples derived from people having the equilibrium, is in a predictable range of the significance level curly hair trait (case) and people having the straight hair trait (typically, p=0.01 to 0.05). (control) are used, and typing is carried out. The results are 40 According to an embodiment, typing is carried out for the compared by statistical processing, and a SNP marker with respective samples obtained from a case group and a control which a significant difference is recognized is identified as a group, and a significant difference test is carried out by aX hair shape susceptibility SNP marker. The sample required test by four methods involving the genotype, allele type, for trait mapping is not particularly limited as long as the dominance model and recessive model. That is, if a certain sample contains genomic DNA, but examples include blood 45 genetic variation is causative of hair shape change, the differ Such as peripheral blood, body fluids such as saliva and Sweat, ence in the allele frequency or the like between the case and Somatic cells, and tissues or organs including somatic cells. the control can be predicted. In regard to the test, when the The number of case-control required to perform a case con association analysis is carried out on a relatively small num trol association analysis can be estimated based on the fre ber of objects, or when the power of test of the significant quency in a population having the curly hair trait, the gene 50 difference between the objects is increased, the level of sig frequency (allele frequency) causative of the trait, the geno nificance is set loose. When the number of objects is relatively type relative risk, and the like, but the number is generally 50 large, or when the significant difference is strictly deter to several thousand people. Furthermore, it is possible to mined, the level of significance can be set strict. A SNP which obtain a relatively high power of test by a stepwise refinement exhibits a significant difference in the gene frequency by a test method under the conditions of limited sample size, limited 55 is identified as a hair shape susceptibility SNP marker. number of typing operations or the like. Furthermore, the case The step (v) that is Subsequently carried out is a step of and the control are preferably constituted of the same human identifying a hair shape Susceptibility gene by determining, in race as the race for which the hair shape Susceptibility gene is connection with the hair shape susceptibility SNP marker specified, and for example, in order to identify a hair shape determined as described above, a region where linkage dis Susceptibility gene of Japanese people, it is preferable that the 60 equilibrium is recognized in an object candidate region and object of analysis be constituted of Japanese people. the hair susceptibility SNP marker is included (haplotype As the method for SNP typing, methods that are well block), using the HapMap PHASE data of the International known to those having ordinary skill in the art, such as PCR HapMap Project Database. SSCP, PCR-RLFP, PCR-SSO, PCR-ASP, a direct sequencing The analysis of haplotype (linkage disequilibrium analy method, SNaPshot, dHPLC, a Sniper method, and a MALDI 65 sis) is a method well known to those having ordinary skill in TOF/MS method, can be used (see, for example, Nojima, the art, and can be carried out by various linkage disequilib Hiroshi, Ed., “Forefront of Genomic Drug Discovery', p. rium analyses that are conventionally carried out (for US 9.255.264 B2 19 20 example, Kamatani, Naoyuki, Edited., “Post-Genome Jidai including a region sandwiched between the remotest SNPs no Iden Tokeigaku (Genetic Statistics in Post-Genomic Era), among them are detected. Subsequently, D' is calculated p. 183-201, Yodosha Co., Ltd., 2002). The haplotype analysis between three consecutive SNPs that are adjacent to the can be carried out using various genetic statistics Software region in the outside of the detected region, and the SNPs in programs that are commercially available or made public (for 5 the region. Even among any combinations thus calculated, example, Haploview, Arlequin, SNP disease-associated when it is verified that D' is 0.9 or less, the region is specified analysis software, SNPalyze (registered trademark) (manu as a “haplotype block.” factured by Dynacom Co., Ltd.), and the like). More specifi When a haplotype block is determined in this manner, for cally, the linkage disequilibrium coefficient D' (pair-wise LD example, in connection with that region, genes present in the coefficient) is calculated and an analysis is carried out, 10 haplotype block under attention can be determined using a through a linkage disequilibrium analysis based on the EM database associated with the genome, or the like. Further algorithm (Laird, N.: “The EM Algorithm”. Chap. 14, pp. more, even in the case of not using a database, the base 509-520, Handbook of Statistics, Vol. 9, Computational Sta sequence in the vicinity of SNP markers present in the hap tistics, C. R. Rao (ed.), Elsevier Science Publishers B.V., lotype block region are determined by an ordinary methods, 1993). More specifically, in the haplotype analysis, it is ana 15 and genes can also be determined from the base sequence. lyzed whether linkage disequilibrium exists between the hair The step (vi) is a step of determining, for the haplotype shape susceptibility SNP marker specified above and another extracted from the haplotype block specified in step (v), a SNP marker, and the region where linkage disequilibrium SNP locus that is linked to the locus of the hair shape suscep exists is identified as the haplotype block. The other SNP tibility SNP marker identified in the step (iv) using the Hap marker used in the linkage disequilibrium analysis can be Map PHASE data of the International HapMap Project Data freely selected among the SNPs existing in the upstream and base, and additionally identifying the SNP thus-determined the downstream of the genome sequence with respect to the as an additional hair shape susceptibility SNP marker. hair shape susceptibility SNP marker. For example, the link In the step (V), it is possible to extract all haplotypes con age disequilibrium analysis may be sequentially carried out sisting of the respective nucleotides of the SNP marker group for the SNPs present from proximal positions to distal posi 25 used in the haplotype analysis, while simultaneously deter tions of the hair shape susceptibility SNP marker, or the mining the haplotype block, and to thereby determine the linkage disequilibrium analysis may be carried out for arbi frequency of the haplotype or the like. trarily selected SNPs at distal positions to determine an When the combinations of the respective nucleotides of the approximate haplotype block region, and then be carried out extracted haplotype, that is, the SNP marker group, are com for SNPs at more proximal positions to determine a more 30 pared, a SNP locus that is linked to the locus of the hair shape specific haplotype block region. The number of the other SNP susceptibility SNP marker identified in the step (iv) can be markers used in the linkage disequilibrium analysis is 4 SNPs identified, and the SNP locus thus identified can be desig or more including the hair shape susceptibility SNP marker, nated as an additional hair shape susceptibility SNP marker. preferably 20 SNPs or more, and even more preferably 32 Through the steps (i) to (vi), a chromosome region where SNPs or more, and the analysis is carried out for a series of 35 linkage with curly hair is recognized is determined, and then SNP marker groups including these plural SNP markers. a hair shape susceptibility SNP marker is selected from the Here, the linkage disequilibrium coefficient D' is obtained chromosome region. Furthermore, through a haplotype from the following equation when, in two SNPs, the respec analysis of the selected SNP marker, a haplotype block and tive alleles of a first SNP are designated as (A, a), the respec gene in the chromosome region that are related to hair shape tive alleles of a second SNP are designated as (B, b), and the 40 in the chromosome region are identified. Thereafter, a SNP respective frequencies of four haplotypes (AB, Ab, aEB, ab) locus that is linked to the locus of the hair shape susceptibility are designated as P. P. P., and P. Furthermore, Min SNP marker is further determined, and thereby, a hair shape (P+P) (P+P), (P +P) (P +P) in the equation susceptibility SNP marker that is present in the haplotype means that the Smaller value between the values of (P + block or gene can be identified. (P)(P+P) and (P +P) (P+P) is taken. 45 Examples of the chromosome region where linkage to curly hair is recognized, which region is determined in the steps described above, include chromosome 1 and chromo Some 11, more specifically the 11q12.2 to 11 q13.2 region of The number of markers in the SNP marker group may chromosome 11 (a region between microsatellites D11S4191 appropriately vary with the size of the region forming the 50 and D11 S987) (maximum LOD score=2.81). These regions haplotype block related to the hair shape Susceptibility gene are determined as curly hair trait loci, and it is strongly Sug to be identified (linkage disequilibrium block). Furthermore, gested that hair shape Susceptibility genes exist in these when a discontinuity of blocks can be predicted in advance, it regions. is also possible to carry out the analysis on about 6 SMPs Examples of the haplotype block specified by the steps located over the blocks. Furthermore, it is also acceptable to 55 described above include, among the genomic regions of carry out a linkage disequilibrium analysis for a hair Suscep human chromosome 11, a 12.590-bp region represented by tibility SNP marker and 5 SNPs each existing on both sides of the base sequence set forth in SEQ ID NO:1, a 202,111-bp the SNP marker, 11 SNPs in total. If necessary, the number of region represented by the base sequence set forth in SEQID markers to be analyzed may be increased. NO:2, a 18,933-bp region represented by the base sequence As the linkage disequilibrium analysis is carried out, a 60 set forth in SEQID NO:3, a 27,375-bp region represented by region where SNPs are linked within an object candidate the base sequence set forth in SEQID NO:4, and a 35,979-bp region (a haplotype block including the group of SNP mark region represented by the base sequence set forth in SEQID ers among which strong linkage disequilibrium is recog NO:5. nized) is determined. For example, the linkage disequilibrium A gene which overlaps with Such a haplotype block, and coefficient D' is calculated for all combinations between 2 65 contains a portion or the entirety of the base sequence of the SNPs for the selected SNP markers, combinations showing haplotype block, is identified as a hair shape Susceptibility the relation: D'>0.9 are selected, and a series of regions gene. Here, the “gene which overlaps with the haplotype US 9.255.264 B2 21 22 block’ means both a gene which has the same base sequence (rs22.98466, C or T), 168931 (rs10791863, T or C), 172500 as that of a partial region of the haplotype block, and a gene (rs2155031, T or C), 175003 (rs2276036, T or C), 184535 which has the same base sequence as the base sequence of the (rs22.98468, A or G), 189853 (rs11227447, C or G), 194405 entire region of the haplotype block. Further, a single nucle (rs2282568, G or C), and 202111 (rs3814738, T or G). Pre otide polymorphism (SNP) which exists in such a haplotype ferred examples include nucleotides represented by Nucle block, and whose allele frequency is statistically significantly otide Numbers 189853 (rs11227447. C or G), and 194405 different between a group having a curly hair trait and a group (rs2282568, G or C). having a non-curly hair trait, and an SNP that is linked to the Examples of the gene which overlaps with the 18.933-bp SNP are identified as hair shape susceptibility SNP markers. haplotype block represented by the base sequence set forth in An example of the gene which overlaps with the 12,590-bp 10 SEQID NO:3 include CD248 gene on human chromosome haplotype block represented by the base sequence set forth in 11. CD248 gene is a gene represented by GeneID:57124 in SEQ ID NO: 1, may be SLC22A8 gene on human chromo the Entrez, Gene Database, and as shown in Example 5 and some 11. SLC22A8 gene is a gene represented by GeneID: FIG. 7, a portion of the base sequence overlaps with the 9376 in the Entrez, Gene Database (http://www.ncbi.nlm.ni haplotype block described above. h.gov/gene), and as shown in Example 5 and FIG. 5, a portion 15 Examples of the hair shape susceptibility SNP marker of the base sequence overlaps with the haplotype block present in the base sequence set forth in SEQID NO:3 include described above. nucleotides represented by Nucleotide Numbers 5297 Examples of the hair shape susceptibility SNP marker (rs523583, A or C), 18280 (rs3741367, T or C), and 18933 present in the base sequence set forth in SEQID NO:1 include (rs3741368, G or A). Preferred examples include nucleotides nucleotides represented by Nucleotide Numbers 1 (dbSNP represented by Nucleotide Numbers 18280 (rs3741367, Tor Database ID:rs10792367, G or C), 7633 (rs2276299, A or T), C), and 18933 (rs3741368, G or A). and 9315 (rs4149182, G or C). A preferred example is a Examples of the gene which overlaps with the 27.375-bp nucleotide represented by Nucleotide Number 7633 haplotype block represented by the base sequence set forth in (rs2276299, A or T). SEQ ID NO:4 include ORAOV1 gene on human chromo Examples of the gene which overlaps with the 202,111-bp 25 some 11. ORAOV1 gene is a gene represented by GeneID: haplotype block represented by the base sequence repre 220064 in the Entrez, Gene Database, and as shown in sented by SEQ ID NO:2 include PACS1 gene, KLC2 gene, Example 5 and FIG. 8, a portion of the base sequence overlaps RAB1B gene, CNIH2 gene, YIF1A gene, and MGC33486 with the haplotype block described above. gene on human chromosome 11. PACS1 gene is a gene rep Examples of the hair shape susceptibility SNP marker resented by GeneID:55690 in the Entrez, Gene Database, and 30 present in the base sequence set forth in SEQID NO:4 include as shown in Example 5 and FIG. 6, a portion of the base nucleotides represented by Nucleotide Numbers 1 sequence overlaps with the haplotype block described above. (rs1789165. A or G), 8378 (rs10796828, G or T), 12624 Further, KLC2 gene is a gene represented by GeneID:64837 (rs1789172, T or C), 20147 (rs1192921, G or C), 22309 in the Entrez, Gene Database, and as shown in Example 5 and (rs1192923, A or T), 24512 (rs1192924, T or C), and 26599 FIG. 6, the entire length of the base sequence overlaps with 35 (rs1789168, Tor C). A preferred example may be a nucleotide the haplotype block described above. RAB1B gene is a gene represented by Nucleotide Number 1 (rs1789165. A or G). represented by GeneID:81876 in the Entrez, Gene Database, Examples of the gene which overlaps with the 35,979-bp and as shown in Example 5 and FIG. 6, the entire length of the haplotype block represented by the base sequence set forth in base sequence overlaps with the haplotype block described SEQID NO:5 include KRTAP5-8 gene, KRTAP5-9 gene, and above. CNIH2 gene is a gene represented by GeneID: 254263 40 KRTAP5-10 gene on human chromosome 11. KRTAP5-8 in the Entrez, Gene Database, and as shown in Example 5 and gene is a gene represented by GeneID:57830 in the Entrez FIG. 6, the entire length of the base sequence overlaps with Gene Database, and as shown in Example 5 and FIG. 9, a the haplotype block described above. YIF1A gene gene is a portion of the base sequence overlaps with the haplotype gene represented by GeneID: 10897 in the Entrez, Gene Data block described above. KRTAP5-9 gene is a gene represented base, and as shown in Example 5 and FIG. 6, the entire length 45 by GeneID:3846 in the Entrez, Gene Database, and as shown of the base sequence overlaps with the haplotype block in Example 5 and FIG. 9, the entire length of the base described above. Furthermore, MGC33486 gene is a gene sequence overlaps with the haplotype block described above. represented by GeneID:256472 in the Entrez, Gene Database, Furthermore, KRTAP5-10 gene is a gene represented by and as shown in Example 5 and FIG. 6, a portion of the base GeneD:387273 in the Entrez, Gene Database, and as shown sequence overlaps with the haplotype block described above. 50 in Example 5 and FIG. 9, the entire length of the base Examples of the hair shape susceptibility SNP marker sequence overlaps with the haplotype block described above. present in the base sequence set forth in SEQID NO:2 include Examples of the hair shape susceptibility SNP marker nucleotides represented by Nucleotide Numbers 1 present in the base sequence set forth in SEQID NO:5 include (rs11227403, C or T), 16722 (rs11607393, A or C), 19992 nucleotides represented by Nucleotide Numbers 17000 (rs3825067, T or C), 21051 (rs11227411, T or C), 21927 55 (rs2664, T or C), 18895 (rs793.4055, T or G), 26143 (rs10896081, T or A), 25269 (rs11227413, A or G), 27032 (rs17363723, G or A), 26545 (rs11234174, A or G), 27090 (rs11227415, C or T), 35997 (rs3862386, C or G), 49537 (rs10792781, CorT), 27751 (rs7107678, GorA), and 30274 (rs9645684, A or G), 55405 (rs10896085, T or A), 69180 (rs7106362, Tor C). A preferred example may be a nucleotide (rs918299, T or C), 84627 (rs7943911, A or G), 86.185 represented by Nucleotide Number 17000 (rs2664, T or C). (rs2177054, A or C), 90221 (rs10750778, C or T), 91247 60 (rs659 1207, A or T), 92398 (rs10896091, C or T), 98150 3. HAIR SHAPE DETERMINING MARKER (rs7946917, G or A), 100779 (rs10896094, T or C), 101730 (rs7941431, A or G), 102920 (rs2293121, G or T), 105310 The present invention also provides a hair shape determin (rs10791855, G or A), 126741 (rs512421. A or G), 133917 ing marker which is an oligo- or polynucleotide in the (rs2155201, C or T), 134786 (rs7925123, C or G), 142991 65 11q12.2 to 11q13.2 region (D11S4191 and D11S987) of (rs2236651, T or C), 144254 (rs2236652, A or G), 147896 human chromosome 11, or a complementary Strand thereof, (rs476551, C or G), 150043 (rs1079 1861, A or G), 152853 wherein in the oligo- or polynucleotide contains a partial base US 9.255.264 B2 23 24 sequence of the base sequence of a haplotype block that is (rs10791855, G or A), 126741 (rs512421. A or G), 133917 determined by a linkage disequilibrium analysis for a SNP (rs2155201, C or T), 134786 (rs7925123, C or G), 142991 marker whose allele frequency is statistically significantly (rs2236651, T or C), 144254 (rs2236652, A or G), 147896 different between a group having a curly hair trait and a group (rs476551, C or G), 150043 (rs10791861, A or G), 152853 having a non-curly hair trait and consists of abase sequence (rs22.98466, C or T), 168931 (rs10791863, T or C), 172500 set forthin any one of SEQID NO:1 to NO:5, and wherein the (rs2155031, T or C), 175003 (rs2276036, T or C), 184535 partial base sequence consisting of a contiguous base (rs22.98468, A or G), 189853 (rs11227447, C or G), 194405 sequence containing one or more single nucleotide polymor (rs2282568, G or C), and 202111 (rs3814738, Tor G) in the phisms (SNPs) wherein the SNPs include an SNP whose base sequence set forth in SEQID NO:2: allele frequency is statistically significantly different between 10 a group having a curly hair trait and a group having a non (3) nucleotides represented by Nucleotide Numbers 5297 curly hair trait, and an SNPs linked to the SNP. (rs523583, A or C), 18280 (rs3741367, T or C), and 18933 The oligo- or polynucleotides, or complementary strands (rs3741368, G or A) in the base sequence set forth in SEQID thereof, defined by these base sequences contain one or more NO:3: a hair shape susceptibility SNP marker that is a single nucle 15 (4) nucleotides represented by Nucleotide Numbers 1 otide polymorphism (SNP) which is present in a haplotype (rs1789165. A or G) 8378 (rs10796828, G or T), 12624 block represented by a base sequence set forth in any one of (rs1789172, T or C), 20147 (rs1192921, G or C), 22309 SEQ ID NO: 1 to NO: 5, and whose allele frequency is (rs1192923, A or T), 24512 (rs1192924, T or C), and 26599 statistically significantly different between a group having a (rs1789168, T or C) in the base sequence set forth in SEQID curly hair trait and a group having a non-curly hair trait, oran NO:4; and SNP linked to the SNP. When these oligo- or polynucleotides, (5) nucleotides represented by Nucleotide Numbers 17000 or complementary strands thereof, are detected, the genetic (rs2664, T or C), 18895 (rs793.4055, T or G), 26143 predisposition of hair shape in a test Subject can be examined (rs17363723, G or A), 26545 (rs11234174, A or G), 27090 and/or determined. Therefore, these oligo- or polynucle (rs10792781, CorT), 27751 (rs7107678, GorA), and 30274 otides, or complementary strand thereof can be defined and 25 (rs7106362, T or C) in the base sequence set forth in SEQID used as markers for determining the genetic predisposition of NO:5. hair shape possessed by an individual. Among the nucleotides described above, the nucleotide The length (nucleotide length) of these oligo- or polynucle represented by Nucleotide Number 7633 (rs2276299. A or T) otides, or complementary Strands, is desirably a length which in the base sequence set forth in SEQ ID NO:1; the nucle is specifically recognized in human genome, and there are no 30 otides represented by Nucleotide Numbers 189853 particular limitations on the limit. The length is usually equal (rs11227447, C or G) and 1944.05 (rs2282568, G or C) in the to or more than 10-mers and equal to or fewer than 1000 base sequence set forth in SEQ ID NO:2: the nucleotides mers, preferably equal to or more than 20-mers and equal to represented by Nucleotide Numbers 18280 (rs3741367, Tor or fewer than 500-mers, and more preferably equal to or more C) and 18933 (rs3741368, G or A) in the base sequence set than 20-mers and equal to or fewer than 100-mers. Therefore, 35 forth in SEQID NO:3: the nucleotide represented by Nucle if necessary, the length can be set to, for example, 11 nucle otide Number 1 (rs1789165. A or G) in the base sequence set otides containing a hair shape susceptibility SNP marker forth in SEQ ID NO:4; and the nucleotide represented by present in a haplotype block represented by a base sequence Nucleotide Number 17000 (rs2664, T or C) in the base set forth in SEQID NO:1 to NO:5 (preferably, 5 nucleotides sequence set forth in SEQID NO:5 are preferred. each on the 5' side and the 3' side of the hair shape suscepti 40 It is desirable that the hair shape susceptibility SNP marker bility SNP marker), 21 nucleotides (preferably including 10 be located at the center or near the center of the hair shape nucleotides each on the 5' side and the 3' side of the hair shape determining marker of the present invention (for example, susceptibility SNP marker), 101 nucleotides (preferably within 100 nucleotides, preferably 50 nucleotides, more pref including 50 nucleotides each on the 5' side and the 3' side of erably 30 nucleotides, even more preferably 10 nucleotides, the hair shape susceptibility SNP marker), 601 nucleotides 45 and still more preferably 5 nucleotides, from the center), but (preferably including 300 nucleotides each on the 5' side and it is not necessarily required. Furthermore, when two or more the 3' side of the hair shape susceptibility SNP marker), or the hair shape susceptibility SNP markers are included in the hair like. shape determining marker of the present invention, all of the Examples of the hair shape susceptibility SNP marker used hair shape susceptibility SNP markers may be located at the in the present invention, which should be included in the hair 50 center or near the center of the hair shape determining marker shape determining marker of the present invention, include of the present invention; one of the hair shape susceptibility the following: SNP markers is located at the center or near the center, while (1) nucleotides represented by Nucleotide Numbers 1 (db the others may be located at any positions; or all of the hair SNP Database ID: rs10792367, G or C), 7633 (rs2276299, A shape susceptibility SNP markers may not be located at the or T), and 9315 (rs41491.82. G or C) in the base sequence set 55 center or near the center. forth in SEQID NO:1; Specific examples of the hair shape determining marker of (2) nucleotides represented by Nucleotide Numbers 1 the present invention in which the hair shape susceptibility (rs11227403, C or T), 16722 (rs11607393, A or C), 19992 SNP marker is located at the center include, for example, in (rs3825067, T or C), 21051 (rs11227411, T or C), 21927 the case where a SNP is contained in the nucleotide repre (rs10896081, T or A), 25269 (rs11227413, A or G), 27032 60 sented by Nucleotide Number 1 (dbSNP Database (rs11227415, C or T), 35997 (rs3862386, C or G), 49537 ID:rs 10792367, Gior C) in the base sequence set forth in SEQ (rs9645684, A or G), 55405 (rs10896085, T or A), 69180 ID NO:1, a 11-mer polynucleotide consisting of from 5 nucle (rs918299, T or C), 84627 (rs7943911, A or G), 86.185 otides upstream of SEQID NO:1 to Nucleotide Number 6, a (rs2177054, A or C), 90221 (rs10750778, C or T), 91247 21-mer polynucleotide consisting of from 10 nucleotides (rs659 1207, A or T), 92398 (rs10896091, C or T), 98150 65 upstream of SEQID NO:1 to Nucleotide Number 11, a 101 (rs7946917, G or A), 100779 (rs10896094, T or C), 101730 mer polynucleotide consisting of from 50 nucleotides (rs7941431, A or G), 102920 (rs2293121, G or T), 105310 upstream of SEQID NO: 1 to Nucleotide Number 51, and a US 9.255.264 B2 25 26 601-mer polynucleotide having a base sequence consisting of In the step (b), detected from the genomic DNA obtained in from 300 nucleotides upstream of SEQ ID NO:1 to Nucle the step (a) is an SNP which is a polymorphism present in a otide Number 11. haplotype block in the 11q12.2 to 11 q13.2 region (D11S4191 and D11S987) of human chromosome 11 and that is deter 4 METHOD FOR DETERMINING GENETIC mined by a linkage disequilibrium analysis on a single nucle SUSCEPTIBILITY TO HAIR SHAPE otide polymorphism (SNP), whose allele frequency is statis tically different between a group having a curly hair trait and The present invention also provides a method for determin a group having a non-curly hair trait, and the allele frequency ing the genetic Susceptibility (genetic predisposition) of a test of which SNP is higher in any curly hair people group than in Subject to hair shape. The method for determining the genetic 10 susceptibility to hair shape of the present invention includes any non-curly hair people group, or a SNP that is linked to the the following steps (a) and (b), and there are no particular SNP. The base sequences set forth in SEQID NO:1 to NO:5 limitations on the limit: include the 12,590-bp base sequence set forth in SEQ ID (a) a step of preparing a genomic DNA derived from a test NO:1, the 202,111-bp base sequence set forth in SEQ ID Subject; and 15 NO:2, the 18,933-bp base sequence set forthin SEQID NO:3, (b) a step of detecting, from the genomic DNA, a single the 27,375-bp base sequence set forth in SEQID NO:4, and nucleotide polymorphism (SNP) whose allele frequency is the 35,979-bp base sequence set forth in SEQID NO:5, in the statistically significantly different between a group having a genomic region of human chromosome 11. curly hair trait and a group having a non-curly hair trait, and The method for determination of the present invention being present in a haplotype block in the 11q12.2 to 11 q13.2 preferably further includes the following step (c): region (D11S4191 and D11S987) of human chromosome 11 (c) a step of determining, if the allele frequency of the that is determined by a linkage disequilibrium analysis on a detected SNP is statistically significantly higher in the curly single nucleotide polymorphism (SNP) marker whose allele hair people group than in the non-curly hair people group, that frequency is statistically significantly different between a the test Subject has a genetic predisposition to curly hair, and group having a curly hair trait and a group having a non-curly 25 if the allele frequency of the detected SNP is statistically hair trait, and that consists of a base sequence set forth in any significantly higher in any non-curly hair people group than in one of SEQID NO:1 to NO:5, and a single nucleotide poly the curly hair people group, that the test Subject does not have morphism (SNP) linked to the SNP. a genetic predisposition to curly hair. The step (a) (extraction of a genomic DNA) and the step (b) An example of the step (c) may be a step of identifying, for (detection of SNPs) can be carried out using a known method 30 any one or more nucleotides of the nucleotide numbers as (for example, Birren Bruce et al., Genome Analysis, Vol. 4/A indicated in the following table that are present in the base Laboratory Manual Mapping Genomes, Cold Spring Harbor sequences set forth in SEQID NO:1 to NO:5 in the genomic Laboratory, NY, 1999). DNA derived from a test subject, whether the nucleotide is In the step (a), the genomic DNA derived from a test nucleotide (i) or nucleotide (ii); and determining, when the Subject can be obtained from a material such as all cells 35 nucleotide is nucleotide (i), that the test Subject has a predis (including cultured cells; however, reproductive cells are position to curly hair, and when the nucleotide is nucleotide excluded), tissues (including cultured tissues), organs, or (ii), that the test Subject does not have a predisposition to curly body fluids (for example, blood, saliva, lymph fluid, respira hair. tory tract mucosa, semen, Sweat, urine, and the like), which have been isolated from the test Subject, clinical specimens 40 TABLE 3 therefrom, and the like. The material is preferably leukocytes Nucleotide (i) Nucleotide (ii) or monocytes separated from peripheral blood, and is more Nucleotide (having (No Suitably leukocytes. These materials can be isolated accord SEQID NO. Number predisposition) predisposition) ing to those methods usually used in clinical tests. 1 1 C G For example, in the case of using leukocytes as the mate 45 7633 T A. rial, first, leukocytes are separated from the peripheral blood 9315 C G isolated from a test Subject, according to an ordinary method. 2 1 T C 16722 C A. Subsequently, Proteinase K and sodium dodecyl sulfate 19992 C T (SDS) are added to the leukocytes thus obtained to degrade 21051 C T and denature proteins, and then phenol/chloroform extraction 50 21927 A. T is carried out to thereby obtain genomic DNA (including 2S269 G A. 27032 T C RNA). The RNA can be eliminated with an RNase as neces 35997 G C sary. Meanwhile, the extraction of genomic DNA is not lim 49537 G A. ited to the method described above, and can be carried out 55405 A. T using a method well-known in the art (for example, Joseph 55 6918O C T 84627 G A. Sambrook et al., Molecular Cloning: A Laboratory Manual (3 86.185 C A. Vol. set), Cold Spring Harbor Laboratory, NY, 2001) or using 90221 T C a commercially available DNA extraction kit or the like. 91247 T A. Furthermore, if necessary, the DNA containing the 11q12.2 to 92398 T C 981SO A. G 11 q13.2 region of human chromosome 11, or a DNA contain 60 100779 C T ingahaplotype block represented by a base sequence set forth 101730 G A. in any one of SEQID NO: 1 to NO: 5 in the genomic region 102920 T G 105310 A. G of human chromosome 11, may be isolated. The isolation of 126,741 G A. the DNA can be carried out by PCR using a primer which 133917 T C hybridizes with the 11q12.2 to 11q. 13.2 region or with the 65 134786 G C corresponding haplotype block and using the genomic DNA 142991 C T as a template, or the like. US 9.255.264 B2 27 28 TABLE 3-continued curly hair, or when the nucleotide is T, the test subject does not have a predisposition to curly hair; Nucleotide (i) Nucleotide (ii) Nucleotide (having (No (7) in the base sequence set forth in SEQ ID NO:2, it is SEQID NO. Number predisposition) predisposition) identified whether the nucleotide represented by Nucleotide Number 21051 is T or C, and it is determined, when the 144254 A. 147896 C nucleotide is C, that the test Subject has a predisposition to A. curly hair, or when the nucleotide is T, the test subject does not 152853 C have a predisposition to curly hair; 168931 (8) in the base sequence set forth in SEQ ID NO:2, it is 172500 10 175003 identified whether the nucleotide represented by Nucleotide 184535 Number 21927 is T or A, and it is determined, when the 189853 1944OS nucleotide is A, that the test Subject has a predisposition to 202111 curly hair, or when the nucleotide is T, the test subject does not 3 5297 15 have a predisposition to curly hair; 1828O 18933 (9) in the base sequence set forth in SEQ ID NO:2, it is 4 1 identified whether the nucleotide represented by Nucleotide 8378 Number 25269 is A or G, and it is determined, when the 12624 nucleotide is G, that the test Subject has a predisposition to 20147 22.309 curly hair, or when the nucleotide is A, the test subject does 24512 not have a predisposition to curly hair; 26599 (10) in the base sequence set forth in SEQID NO:2, it is 5 17OOO 18895 identified whether the nucleotide represented by Nucleotide 26143 Number 27032 is C or T, and it is determined, when the 25 nucleotide is T. that the test Subject has a predisposition to 27090 curly hair, or when the nucleotide is C, the test subject does 27751 not have a predisposition to curly hair; 30274 (11) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide More specifically, the method of the present invention for 30 Number 35997 is C or G, and it is determined, when the determining genetic Susceptibility of a test Subject to hair nucleotide is G, that the test Subject has a predisposition to shape includes any one step of the following (1) to (56). curly hair, or when the nucleotide is C, the test subject does (1) In the base sequence set forth in SEQ ID NO:1, it is not have a predisposition to curly hair; identified whether the nucleotide represented by Nucleotide (12) in the base sequence set forth in SEQID NO:2, it is Number 1 is G or C, and it is determined, when the nucleotide 35 identified whether the nucleotide represented by Nucleotide is C, that the test Subject has a predisposition to curly hair, or Number 49537 is A or G, and it is determined, when the when the nucleotide is G, the test subject does not have a nucleotide is G, that the test Subject has a predisposition to predisposition to curly hair; curly hair, or when the nucleotide is A, the test subject does (2) in the base sequence set forth in SEQ ID NO:1, it is not have a predisposition to curly hair; 40 (13) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 7633 is A or T, and it is determined, when the nucle Number 55405 is T or A, and it is determined, when the otide is T. that the test subject has a predisposition to curly nucleotide is A, that the test Subject has a predisposition to hair, or when the nucleotide is A, the test subject does not have curly hair, or when the nucleotide is T, the test subject does not a predisposition to curly hair, 45 have a predisposition to curly hair; (3) in the base sequence set forth in SEQ ID NO:1, it is (14) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 9315 is G or C, and it is determined, when the Number 69180 is T or C, and it is determined, when the nucleotide is C, that the test Subject has a predisposition to nucleotide is C, that the test Subject has a predisposition to curly hair, or when the nucleotide is G, the test subject does 50 curly hair, or when the nucleotide is T, the test subject does not not have a predisposition to curly hair; have a predisposition to curly hair; (4) in the base sequence set forth in SEQ ID NO:2, it is (15) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 1 is C or T, and it is determined, when the nucleotide Number 84627 is A or G, and it is determined, when the is T. that the test Subject has a predisposition to curly hair, or 55 nucleotide is G, that the test Subject has a predisposition to when the nucleotide is C, the test subject does not have a curly hair, or when the nucleotide is A, the test subject does predisposition to curly hair; not have a predisposition to curly hair; (5) in the base sequence set forth in SEQ ID NO:2, it is (16) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 16722 is A or C, and it is determined, when the 60 Number 86.185 is A or C, and it is determined, when the nucleotide is C, that the test Subject has a predisposition to nucleotide is C, that the test Subject has a predisposition to curly hair, or when the nucleotide is A, the test subject does curly hair, or when the nucleotide is A, the test subject does not have a predisposition to curly hair; not have a predisposition to curly hair; (6) in the base sequence set forth in SEQ ID NO:2, it is (17) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide 65 identified whether the nucleotide represented by Nucleotide Number 19992 is T or C, and it is determined, when the Number 90221 is C or T, and it is determined, when the nucleotide is C, that the test Subject has a predisposition to nucleotide is T. that the test Subject has a predisposition to US 9.255.264 B2 29 30 curly hair, or when the nucleotide is C, the test subject does curly hair, or when the nucleotide is T, the test subject does not not have a predisposition to curly hair; have a predisposition to curly hair; (18) in the base sequence set forth in SEQID NO:2, it is (29) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 91247 is A or T, and it is determined, when the 5 Number 144254 is A or G, and it is determined, when the nucleotide is T. that the test Subject has a predisposition to nucleotide is G, that the test Subject has a predisposition to curly hair, or when the nucleotide is A, the test subject does curly hair, or when the nucleotide is A, the test subject does not have a predisposition to curly hair; not have a predisposition to curly hair; (19) in the base sequence set forth in SEQID NO:2, it is (30) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide 10 identified whether the nucleotide represented by Nucleotide Number 92398 is C or T, and it is determined, when the Number 147896 is C or G, and it is determined, when the nucleotide is T. that the test Subject has a predisposition to nucleotide is G, that the test Subject has a predisposition to curly hair, or when the nucleotide is C, the test subject does curly hair, or when the nucleotide is C, the test subject does not have a predisposition to curly hair; 15 not have a predisposition to curly hair; (20) in the base sequence set forth in SEQID NO:2, it is (31) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 98150 is G or A, and it is determined, when the Number 150043 is A or G, and it is determined, when the nucleotide is A, that the test Subject has a predisposition to nucleotide is G, that the test Subject has a predisposition to curly hair, or when the nucleotide is G, the test subject does curly hair, or when the nucleotide is A, the test subject does not have a predisposition to curly hair; not have a predisposition to curly hair; (21) in the base sequence set forth in SEQID NO:2, it is (32) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 100779 is T or C, and it is determined, when the Number 152853 is C or T, and it is determined, when the nucleotide is C, that the test Subject has a predisposition to 25 nucleotide is T. that the test Subject has a predisposition to curly hair, or when the nucleotide is T, the test subject does not curly hair, or when the nucleotide is C, the test subject does have a predisposition to curly hair, not have a predisposition to curly hair; (22) in the base sequence set forth in SEQID NO:2, it is (33) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 101730 is A or G, and it is determined, when the 30 Number 168931 is T or C, and it is determined, when the nucleotide is G, that the test Subject has a predisposition to nucleotide is C, that the test Subject has a predisposition to curly hair, or when the nucleotide is A, the test subject does curly hair, or when the nucleotide is T, the test subject does not not have a predisposition to curly hair; have a predisposition to curly hair; (23) in the base sequence set forth in SEQID NO:2, it is (34) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide 35 identified whether the nucleotide represented by Nucleotide Number 102920 is G or T, and it is determined, when the Number 172500 is T or C, and it is determined, when the nucleotide is T. that the test Subject has a predisposition to nucleotide is C, that the test Subject has a predisposition to curly hair, or when the nucleotide is G, the test subject does curly hair, or when the nucleotide is T, the test subject does not not have a predisposition to curly hair; have a predisposition to curly hair; (24) in the base sequence set forth in SEQID NO:2, it is 40 (35) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 105310 is G or A, and it is determined, when the Number 175003 is T or C, and it is determined, when the nucleotide is A, that the test Subject has a predisposition to nucleotide is C, that the test Subject has a predisposition to curly hair, or when the nucleotide is G, the test subject does curly hair, or when the nucleotide is T, the test subject does not not have a predisposition to curly hair; 45 have a predisposition to curly hair; (25) in the base sequence set forth in SEQID NO:2, it is (36) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 126741 is A or G, and it is determined, when the Number 184535 is A or G, and it is determined, when the nucleotide is G, that the test Subject has a predisposition to nucleotide is G, that the test Subject has a predisposition to curly hair, or when the nucleotide is A, the test subject does 50 curly hair, or when the nucleotide is A, the test subject does not have a predisposition to curly hair; not have a predisposition to curly hair; (26) in the base sequence set forth in SEQID NO:2, it is (37) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 133917 is C or T, and it is determined, when the Number 189853 is C or G, and it is determined, when the nucleotide is T. that the test Subject has a predisposition to 55 nucleotide is G, that the test Subject has a predisposition to curly hair, or when the nucleotide is C, the test subject does curly hair, or when the nucleotide is C, the test subject does not have a predisposition to curly hair; not have a predisposition to curly hair; (27) in the base sequence set forth in SEQID NO:2, it is (38) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 134786 is C or G, and it is determined, when the 60 Number 194405 is G or C, and it is determined, when the nucleotide is G, that the test Subject has a predisposition to nucleotide is C, that the test Subject has a predisposition to curly hair, or when the nucleotide is C, the test subject does curly hair, or when the nucleotide is G, the test subject does not have a predisposition to curly hair; not have a predisposition to curly hair; (28) in the base sequence set forth in SEQID NO:2, it is (39) in the base sequence set forth in SEQID NO:2, it is identified whether the nucleotide represented by Nucleotide 65 identified whether the nucleotide represented by Nucleotide Number 142991 is T or C, and it is determined, when the Number 202111 is T or G, and it is determined, when the nucleotide is C, that the test Subject has a predisposition to nucleotide is G, that the test Subject has a predisposition to US 9.255.264 B2 31 32 curly hair, or when the nucleotide is T, the test subject does not curly hair, or when the nucleotide is T, the test subject does not have a predisposition to curly hair, have a predisposition to curly hair; (40) in the base sequence set forth in SEQID NO:3, it is (51) in the base sequence set forth in SEQID NO:5, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 5297 is A or C, and it is determined, when the Number 18895 is T or G, and it is determined, when the nucleotide is C, that the test Subject has a predisposition to nucleotide is G, that the test Subject has a predisposition to curly hair, or when the nucleotide is A, the test subject does curly hair, or when the nucleotide is T, the test subject does not not have a predisposition to curly hair; have a predisposition to curly hair; (41) in the base sequence set forth in SEQID NO:3, it is (52) in the base sequence set forth in SEQID NO:5, it is 10 identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 26143 is G or A, and it is determined, when the Number 18280 is T or C, and it is determined, when the nucleotide is A, that the test Subject has a predisposition to nucleotide is C, that the test Subject has a predisposition to curly hair, or when the nucleotide is G, the test subject does curly hair, or when the nucleotide is T, the test subject does not not have a predisposition to curly hair; have a predisposition to curly hair, 15 (53) in the base sequence set forth in SEQID NO:5, it is (42) in the base sequence set forth in SEQID NO:3, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 26545 is A or G, and it is determined, when the Number 18933 is G or A, and it is determined, when the nucleotide is G, that the test Subject has a predisposition to nucleotide is A, that the test Subject has a predisposition to curly hair, or when the nucleotide is A, the test subject does curly hair, or when the nucleotide is G, the test subject does not have a predisposition to curly hair; not have a predisposition to curly hair; (54) in the base sequence set forth in SEQID NO:5, it is (43) in the base sequence set forth in SEQID NO:4, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 27090 is C or T, and it is determined, when the Number 1 is A or G, and it is determined, when the nucleotide nucleotide is T. that the test Subject has a predisposition to is G, that the test Subject has a predisposition to curly hair, or 25 curly hair, or when the nucleotide is C, the test subject does when the nucleotide is A, the test subject does not have a not have a predisposition to curly hair; predisposition to curly hair; (55) in the base sequence set forth in SEQID NO:5, it is (44) in the base sequence set forth in SEQID NO:4, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide Number 27751 is G or A, and it is determined, when the Number 8378 is G or T, and it is determined, when the 30 nucleotide is A, that the test Subject has a predisposition to nucleotide is T. that the test Subject has a predisposition to curly hair, or when the nucleotide is G, the test subject does curly hair, or when the nucleotide is G, the test subject does not have a predisposition to curly hair; or not have a predisposition to curly hair; (56) in the base sequence set forth in SEQID NO:5, it is (45) in the base sequence set forth in SEQID NO:4, it is identified whether the nucleotide represented by Nucleotide identified whether the nucleotide represented by Nucleotide 35 Number 30274 is T or C, and it is determined, when the Number 12624 is T or C, and it is determined, when the nucleotide is C, that the test Subject has a predisposition to nucleotide is C, that the test Subject has a predisposition to curly hair, or when the nucleotide is T, the test subject does not curly hair, or when the nucleotide is T, the test subject does not have a predisposition to curly hair. have a predisposition to curly hair, In addition, the SNP detected in the method of the present (46) in the base sequence set forth in SEQID NO:4, it is 40 invention for determining the genetic susceptibility (genetic identified whether the nucleotide represented by Nucleotide predisposition) to hair shape may be any one of the SNPs Number 20147 is G or C, and it is determined, when the described above, or may be two or more thereof. Preferably, nucleotide is C, that the test Subject has a predisposition to two or more SNPs are detected, and thereby, the type or the curly hair, or when the nucleotide is G, the test subject does presence or absence of the genetic predisposition of the test not have a predisposition to curly hair; 45 Subject to the hair shape, which is a general polygenic trait, (47) in the base sequence set forth in SEQID NO:4, it is can be made clear, while a gene which serves as a main factor identified whether the nucleotide represented by Nucleotide determining the hair shape of the test subject can be retrieved Number 22309 is A or T, and it is determined, when the with higher accuracy. nucleotide is T. that the test Subject has a predisposition to The detection of the SNPs can be carried out by directly curly hair, or when the nucleotide is A, the test subject does 50 determining the base sequence of the 11q12.2 to 11 q13.2 not have a predisposition to curly hair; region of human chromosome 11 further isolated from a (48) in the base sequence set forth in SEQID NO:4, it is sample containing the genomic DNA, or the base sequence of identified whether the nucleotide represented by Nucleotide the haplotype block represented by the base sequences set Number 24512 is T or C, and it is determined, when the forth in SEQ ID NO:1 to NO:5 in the genomic regions of nucleotide is C, that the test Subject has a predisposition to 55 human chromosome 11. Alternatively, as a method for detect curly hair, or when the nucleotide is T, the test subject does not ing a polymorphism, in addition to the method of directly have a predisposition to curly hair, determining the gene sequence of the region as described (49) in the base sequence set forth in SEQID NO:4, it is above, there are available a method of determining, when the identified whether the nucleotide represented by Nucleotide polymorphism sequence is a restriction enzyme recognition Number 26599 is T or C, and it is determined, when the 60 site, the genotype by using the difference in the restriction nucleotide is C, that the test Subject has a predisposition to enzyme cleavage pattern (hereinafter, called RFLP); and curly hair, or when the nucleotide is T, the test subject does not methods based on hybridization using a polymorphism-spe have a predisposition to curly hair, cific probe (for example, a method of determining the type of (50) in the base sequence set forth in SEQ ID NO:5, it is polymorphism by attaching particular probes on a chip, a identified whether the nucleotide represented by Nucleotide 65 glass slide or a nylon film and detecting the difference in the Number 17000 is T or C, and it is determined, when the intensity of hybridization with respect to those probes, or a nucleotide is C, that the test Subject has a predisposition to method of determining the genotype by detecting the effi US 9.255.264 B2 33 34 ciency of hybridization of a specific probe as the amount of also be used in combination. Hereinafter, as representative the probe decomposed by a polymerase during amplification methods, the TaqMan-PCR method and the invader method of the two strands of a template; a method of detecting the that are used in the Examples described below will be temperature difference in the fusion of two strands by tracing explained in more detail. the temperature change of fluorescence emitted by a certain (1) TaqMan-PCR Method type of two-stranded specific fluorescent dye, and thereby The TaqMan-PCR method is a method of using a fluores determining the polymorphism; a method of attaching cent-labeled, allele-specific oligonucleotide (TaqMan complementary sequences to the two ends of a polymorphic probe), and PCR by a Taq DNA polymerase. As the TaqMan site-specific oligo-probe, and specifying the genotype by uti probe, an oligonucleotide containing a contiguous base lizing the difference between the case where the probe makes 10 sequence of about 15 to about 30 nucleotides, which is a a secondary structure within the molecules of the probe itself partial base sequence of a haplotype block represented by any due to temperature, and the case where the probe hybridizes one of SEQID NO:1 to NO:5 in the genomic region of human with the target region; and the like). Further examples include chromosome 11, and contains one or more polymorphic sites methods of carrying out a nucleotide extension reaction by a described above (for example, a nucleic acid probe contained polymerase from a template-specific primer, and determining 15 in the reagent for hair shape determination of the present a nucleotide that is accepted to the polymorphic site at that invention that will be described below), is used. The probe is time (a method of using dideoxynucleotides, including fluo labeled with a fluorescent dye such as FAM or VIC at the rescently labeling each of them, and detecting the fluores 5'-terminal, and with a quencher (quenching Substance) Such cence of each, and a method of detecting the accepted as TAMPA at the 3'-terminal, respectively, and in the state as dideoxynucleotides by mass spectrometry); a method of rec received, since the quencher absorbs the fluorescent energy, ognizing the presence or absence of a complementary base fluorescence is not detected. It is preferable to produce probes pair or a non-complementary base pair at a mutation site by for both alleles, and to label the probes with fluorescent dyes means of an enzyme, Subsequent to a template-specific having different fluorescence wavelengths for batch detection primer; and the like. (for example, FAM for one allele and VIC for the other). Now, conventionally well-known, representative methods 25 Furthermore, the 3'-terminal is phosphorylated so that a PCP for detecting genetic polymorphisms will be listed below, but extension reaction from the Taqman probe does not occur. the present invention is not at all intended to be limited to When a PCR is carried out using a primer which is designed these: (a) a RFLP (restriction enzyme-cleaved fragment to amplify a partial sequence of the genomic DNA containing length polymorphism) method; (b) a PCR-SSCP method a region that hybridizes with the TaqMan probe, as well as a (analysis of single-stranded DNA higher structure polymor 30 Taq DNApolymerase, the Taqman probe hybridizes with the phism, Biotechniques, 16, p. 296-297, 1994, and Biotech template DNA, and at the same time, an extension reaction niques, 21, p. 510 to 514, 1996); (c) an ASO hybridization from the PCR primer occurs. However, when the extension method (Clin. Chin. Acta., 189, p. 153-157, 1990); (d) a direct reaction proceeds, the hybridized Taqman probe is cleaved sequencing method (Biotechniques, 11, p. 246-249, 1991); due to the 5' nuclease activation of the Taq DNA polymerase, (e) an ARMS method (Nuc. Acids Res., 19, p. 3561-3567, 35 and the fluorescent dye is released and is no longer affected by 1991, and Nuc. Acids Res., 20, p. 4831-4837, 1992): (f) a the quencher, so that fluorescence is detected. With the ampli denaturant concentration gradient gel electrophoresis fication of the template, the fluorescence intensity increases (DGGE) method (Biotechniques, 27, p. 1016-1018, 1999); exponentially. For example, in the detection of a polymor (g) an RNaseA cleavage method (DNA Cell Biol. 14, p. phism in the nucleotide represented by Nucleotide Number 1 87-94, 1995): (h) a chemical cleavage method (Biotech 40 (rs10792367, Gior C) in the base sequence set forth in SEQID niques, 21, p. 216-218, 1996): (i) a DOL method (Genome NO:1, when an allele-specific oligonucleotide containing the Res., 8, p. 549-556, 1998): (i) a Taq Man-PCR method (Genet. nucleotide (having a length of about 15 to about 30 nucle Anal., 14, p. 143-149, 1999, and J. Clin. Microbiol. 34, p. otides; the Callele is labeled with FAM, and the Tallele is 2933-2936, 1996); (k) an invader method (Science, 5109, p. labeled with VIC, respectively, at the 5'-terminals, and the 778-783, 1993, J. Bio. Chem., 30, p. 21387-21394, 1999, and 45 3'-terminals are both labeled with TAMPA) is used as the Nat. Biotechnol., 17, p. 292-296, 1999); (1) a MALDI-TOF/ TaqMan probe, if the genotype of the test subject is CC or TT, MS method (Genome Res., 7, p. 378-388, 1997, and Eur. J. high fluorescence intensity of FAM or VIC is recognized in Clin. Chem. Clin. Biochem.,35, p. 545-548, 1997); (m)a TDI the respective cases, while the other fluorescence is almost method (Proc. Natl. Acad. Sci. USA, 94, p. 10756-10761, unrecognizable. On the other hand, if the genotype of the test 1997); (n) a molecular beacon method (Nat. Biotechnol. 16, 50 subject is CT, fluorescence of both FAM and VIC is detected. p. 49-53, 1998); (O) a dynamic allele specific hybridization (2) Invader Method (DASH) method (Nat. Biotechnol., 17, p. 87-88, 1999); (p) a In the invader method, unlike the TaqMan-PCR method, padlock probe method (Nat. Genet. 3, p. 225-232, 1998); (q) the allele-specific oligonucleotide (allele probe) itself is not a DNA chip or DNA microarray (Nakamura, Yusuke, et al., labeled, and the oligonucleotide has a sequence having no “SNP Idenshi Takei no Senryaku (Strategy for SNP Gene 55 complementarity to the template DNA on the 5' side of the Polymorphism), Nakayama Shoten Co., Ltd., p. 128-135, nucleotides at the polymorphic site (flap) and has a comple 2000); and (R) an ECA method (Anal. Chem., 72, p. 1334 mentary sequence specific to the template on the 3' side. In the 1341, 2000). invader method, use is made of an oligonucleotide having a Those described above are representative methods for gene complementary sequence specific to the 3' side of the poly polymorphism detection; however, the method of the present 60 morphic site of the template (invader probe; the nucleotides invention for determining the genetic susceptibility (genetic corresponding to the polymorphic site, which is the 5'-termi predisposition) to hair shape is not limited to these, and any nal of the probe, are arbitrary), and a FRET (Fluorescence other gene polymorphism detection methods that are already Resonance Energy Transfer) probe characterized in that the 5' known or will be developed in the future can be broadly used. side has a sequence capable of adopting a hairpin structure, Furthermore, in regard to the gene polymorphism detection of 65 and the sequence contiguous from the nucleotides forming the present invention, these methods for gene polymorphism pairs with the nucleotides of the 5'-terminal to the 3' side when detection may be used singly, or two or more methods can a hairpin structure is formed, is a sequence complementary to US 9.255.264 B2 35 36 the flap of the allele probe. The 5'-terminal of the FRET probe extremely useful as a method for the examination and/or is fluorescent labeled (for example, FAM, VIC, or the like), determination for the fundamental regulation of hair shape. and a quencher (for example, TAMRA, or the like) is bonded in the vicinity thereof, so that in the state as received (hairpin 5. REAGENT FOR DETERMINATION OF structure), fluorescence is not detected. When the template 5 GENETIC SUSCEPTIBILITY (GENETIC genomic DNA is allowed to react with the allele probe and the PREDISPOSITION) TO HAIR SHAPE AND KIT invader probe, upon the complementary binding of the three INCLUDING THE REAGENT entities, the 3'-terminal of the invader probe penetrates into the polymorphic site. When the single-stranded portion of the The present invention also provides a reagent to be used in 10 the determination method of the present invention, and a kit allele probe (that is, the flap portion on the 5' side from the including the reagent. That is, the reagent for determination of nucleotides of the polymorphic site) is cut using an enzyme the present invention and the kit including the reagent include which recognizes the structure of this polymorphic site a nucleic acid probe and/or a primer capable of detecting one (Cleavase), the flap complementarily binds with the FRET or more SNPs selected from the group consisting of an SNP in probe, and the polymorphic site of the flappenetrates into the 15 the 11q12.2 to 11q13.2 region (D11S4191 and D11S987) of hairpin structure of the FRET probe. When Cleavase recog human chromosome 11, which is determined by a linkage nizes and cleaves this structure, the fluorescent dye used to disequilibrium analysis on a single polynucleotide polymor label the terminal of the FRET probe is released and is no phism (SNP) marker whose allele frequency is statistically longer affected by the quencher, and thus fluorescence is significantly different between a group having a curly hair detected. An allele probe whose nucleotides of the polymor trait and a group having a non-curly hair trait, and is present phic site do not match with the template is not cleaved by in a haplotype block having a 12.590-bp base sequence set Cleavase, since an allele probe which is not cleaved can also forth in SEQID NO:1, a 202,111-bp base sequence set forth hybridize with the FRET probe, fluorescence is similarly in SEQID NO:2, a 18.933-bp base sequence set forth in SEQ detected. However, because the reaction efficiency is differ ID NO:3, a 27.375-bp base sequence set forth in SEQ ID ent, in the allele probe whose nucleotides of the polymorphic 25 NO:4, or a 35,979-bp base sequence set forth in SEQ ID site match the template, the fluorescence intensity is mark NO:5, and which has a higher allele frequency in an arbitrary edly stronger than that of the allele probe which does not curly hair people group than in an arbitrary non-curly hair match. Usually, it is preferable to have the template DNA people group, and an SNP linked to the SNP. amplified by PCR using a primer capable of amplifying the According to an embodiment, the nucleic acid probe used region containing the portions where the allele probe and the 30 in the reagent for determination of the present invention and invader probe hybridize, before the template DNA is allowed the kit including the reagent, is a nucleic acid which specifi to react with the three kinds of probes and Cleavase. cally hybridizes with the region of a genomic DNA contain The hair shape of a person can be freely changed by a ing the nucleotides of the SNP site to be detected in the permanent treatment, a styling agent treatment, brushing or method for examination and/or determination of the present the like, and also can change in an acquired manner, through 35 invention, and is, for example, a probe which specifically changes in aging, metabolism, and the like. For this reason, it hybridizes with the hair shape determining marker sequence is difficult to correctly determine or classify the intrinsic of the present invention. The nucleic acid probe is not par natural hair shape of a person based only on the phenotype. ticularly limited in the length (length of nucleotides in the Furthermore, since the hair shape can be considered as a portion that hybridizes with the genomic DNA), as long as the general trait of complicated polygenicity, it can be speculated 40 nucleic acid probe is specific to a target site to be hybridized that for individual persons, the gene which serves as a main and can easily detect polymorphisms. For example, the length causative factor for determining the hair shape among the hair is about 10 nucleotides or more, preferably about 15 nucle shape Susceptibility genes of the present invention described otides or more, more preferably about 15 to about 600 nucle above, may vary indifferent individuals. Therefore, when the otides, even more preferably about 15 to about 200 nucle genetic predisposition to hair shape is examined and/or deter 45 otides, and still more preferably about 15 to about 50 mined, a method for regulating the hair shape appropriate for nucleotides. Meanwhile, the phrase “specifically hybridizes the individuals can be provided. with a target site (sequence) means that cross-hybridization Furthermore, according to the method, the susceptibility to with another DNA does not occur significantly under stan an acquired change in the hair shape of a test Subject, that is, dard hybridization conditions, preferably under stringent the risk of hair shape change, can be determined. The risk of 50 hybridization conditions (for example, conditions described hair shape change can be mechanically determined using the in Joseph Sambrook et al., Molecular Cloning: A Laboratory polymorphisms described above as the reference (index), Manual (3 Vol. set), Cold Spring Harbor Laboratory, NY. without requiring the judgment of a person having expertise 2001). Suitably, the nucleic acid probe preferably has abase Such as a doctor. Accordingly, the method of the present sequence complementary to the base sequence of a region invention can also be used as a method for detecting the risk 55 containing nucleotides of the polymorphic site to be detected; of hair shape change. however, if such specific hybridization is possible, the nucleic Through the method of the present invention for determin acid probe does not need to be completely complementary. ing the genetic Susceptibility (genetic predisposition) of a test The nucleic acid probe may contain an additional sequence Subject to hair shape, the type or the presence or absence of appropriate for the detection of polymorphism (a sequence the genetic predisposition of the test Subject to hair shape, 60 which is not complementary to the genomic DNA). For which is a general polygenic trait, can be made clear, and a example, the allele probe used in the invader method has an gene which serves as the main causative factor that deter additional sequence called flap, at the 5'-terminal of the nucle mines the hair shape of the test Subject can be searched among otides of the polymorphic site. Furthermore, the probe may the hair shape Susceptibility genes of the present invention. also be labeled with an appropriate labeling agent, for Furthermore, appropriate measures for promoting the regu 65 example, a radioisotope (for example, "I, I, H, and ''C), lation of hair shape in the test subject can be devised based on an enzyme (for example, B-galactosidase, B-glucosidase, the results of the search. Therefore, the present invention is alkaliphosphatase, peroxidase, malate dehydrogenase, or the US 9.255.264 B2 37 38 like), a fluorescent Substance (for example, fluorescamine, of nucleic acid primers, which is a combination of a nucleic fluorescein isothiocyanate, or the like), or a luminescent Sub acid containing a base sequence having about 10 to about 50 stance (for example, luminol, a luminol derivative, luciferin, nucleotides, preferably about 15 to about 50 nucleotides, and lucigenin, or the like). Alternatively, the probe may also be more preferably about 15 to about 30 nucleotides, that is a further bonded, in the vicinity of a fluorescent substance (for partial base sequence of a haplotype block represented by a example, FAM, VIC, or the like), with a quencher (quenching base sequence set forth in any one of SEQID NO:1 to NO:5 substance) which absorbs the fluorescent energy emitted by in the genomic region of human chromosome 11, and specifi the fluorescent substance. In such an embodiment, the fluo cally hybridizes with a portion of the complementary strand rescent Substance and the quencher are separated at the time sequence on the 5' side relative to the nucleotides of the of the detection reaction, and fluorescence is detected. 10 polymorphic site to be detected, and a nucleic acid containing The nucleic acid probe can also be used after being immo a base sequence having about 10 to about 50 nucleotides, bilized on an arbitrary solid phase. For this reason, the reagent preferably about 15 to about 50 nucleotides, and more pref of the present invention and the kit including the reagent can erably about 15 to about 30 nucleotides, that is the partial base be provided as an immobilized probe in which the probe is sequence and specifically hybridizes with a portion of the immobilized on an arbitrary Solid Support (for example, a 15 complementary strand sequence on the 3' side relative to the gene chip, a cDNA microarray, an oligo-DNA array, a mem nucleotides of the polymorphic site, the fragment of the brane filter, or the like, on which a probe is immobilized). nucleic acid to be amplified by the combination of nucleic Suitably, the immobilized probe is provided as a DNA chip acids having a length of about 50 to about 1000 nucleotides, for hair shape Susceptibility gene detection. preferably about 50 to about 500 nucleotides, and more pref The Solid Support used in immobilization is not particularly erably about 50 to about 200 nucleotides. limited as long as nucleic acid can be immobilized thereon, The primer may also contain an additional sequence appro and examples include a glass plate, a nylon membrane, micro priate for the detection of polymorphism (a sequence that is beads, a silicon chip, a capillary, other supports, or the like. not complementary to the genomic DNA), for example, a The immobilization of a nucleic acid on a Solid Support may linker sequence. Further, the primer may also be labeled with be carried out by a method of mounting a previously synthe 25 an appropriate labeling agent, for example, a radioisotope sized nucleic acid on a solid phase, or by a method of synthe (for example, "I, I, H, or 'C), an enzyme (for example, sizing a target nucleic acid on a solid phase. The immobili B-galactosidase, B-glucosidase, alkali phosphatase, peroxi zation method is, for example, in the case of a DNA dase, or malate dehydrogenase), a fluorescent Substance (for microarray, well known in the art according to the type of the example, fluorescamine, or fluorescein isothiocyanate), a immobilization probe, e.g., a commercially available spotter 30 luminescent Substance (for example, luminol, a luminol (manufactured by Amersham Biosciences Corp.), or the like derivative, luciferin, lucigenin, or the like), or the like. (for example, in situ synthesis of oligonucleotides by photo Preferably, the nucleic acid probe and/or primer used in the lithographic technology (Affymetrix, Inc.) or inkjet technol reagent for determination of the present invention and the kit ogy (Rosetta Inpharmatics, Inc.), and the like). including the reagent include the hair shape Susceptibility The nucleic acid primer used in the reagent for determina 35 SNP marker of the present invention, that is, the nucleotides tion of the present invention and the kit including the reagent, shown below: may be any nucleic acid primeras long as it is designed to be (1) in the base sequence set forth in SEQID NO:1, nucle capable of specifically hybridizing with the region of a otides represented by Nucleotide Numbers 1 (dbSNP Data genomic DNA containing the nucleotides of the SNP site to base ID:rs 10792367, G or C), 7633 (rs2276299, A or T), and be detected in the method for examination and/or determina 40 9315 (rs4149182, G or C): tion of the present invention, and specifically amplifying the (2) in the base sequence set forth in SEQID NO:2, nucle nucleic acid sequence. For example, the primer is a primer otides represented by Nucleotide Numbers 1 (rs11227403, C which specifically hybridizes with the nucleic acid sequence or T), 16722 (rs11607393, A or C), 19992 (rs3825067, T or of the hair shape determining marker of the present invention C), 21051 (rs11227411, T or C), 21927 (rs10896081, T or A), and amplifies the hair shape determining marker. Here, the 45 25269 (rs11227413, A or G), 27032 (rs11227415, C or T), phrase “specifically hybridizes with a target site (sequence) 35997 (rs3862386, C or G), 49537 (rs9645684, A or G), means that cross-hybridization with another DNA does not 554.05 (rs10896085, TorA), 69180 (rs918299, Tor C), 84627 occur significantly under the standard hybridization condi (rs7943911, A or G), 86.185 (rs2177054, A or C), 90221 tions, preferably under stringent hybridization conditions (for (rs10750778, C or T), 91247 (rs6591207, A or T), 92398 example, the conditions described in Joseph Sambrook et al., 50 (rs10896091, C or T), 98150 (rs7946917, G or A), 100779 Molecular Cloning: A Laboratory Manual (3 Vol. set), Cold (rs10896094, T or C), 101730 (rs7941431, A or G), 102920 Spring Harbor Laboratory, NY, 2001). (rs2293121, G or T), 105310 (rs10791855, G or A), 126741 The method for amplifying the nucleic acid sequence using (rs512421. A or G), 133917 (rs2155201, C or T), 134786 a primer is not particularly limited as long as it is a method (rs7925123, C or G), 142991 (rs2236651, T or C), 144254 ordinarily used in the art. For example, generally, a PCR 55 (rs2236652, A or G), 147896 (rs476551, C or G), 150043 method is broadly used, but examples include RCA (Rolling (rs10791861, A or G), 152853 (rs22.98466, C or T), 168931 Circle Amplification; Proc. Natl. Acad. Sci., Vol. 92, 4641 (rs10791863, T or C), 172500 (rs2155031, T or C), 175003 4645 (1995)), ICAN (Isothermal and Chimeric primer-initi (rs2276036, T or C), 184535 (rs22.98468, A or G), 189853 ated Amplification of Nucleic acids), LAMP (Loop-Mediated (rs11227447, C or G), 194405 (rs2282568, G or C), and Isothermal Amplification of DNA; Bio Industry, vol. 18, No. 60 202111 (rs3814738, T or G): 2 (2001)), NASBA (Nucleic acid Sequence-based Amplifica (3) in the base sequence set forth in SEQID NO:3, nucle tion method; Nature, 350, 91-(1991)), TMA (Transcription otides represented by Nucleotide Numbers 5297 (rs523583, Mediated Amplification method; J. Clin. Microbiol. Vol. 31, A or C), 18280 (rs3741367, T or C), and 18933 (rs3741368, 3270-(1993), and the like). The number and type of the G or A); nucleic acid primer required for amplification can vary 65 (4) in the base sequence set forth in SEQID NO:4, nucle depending on the amplification method. For example, in the otides represented by Nucleotide Numbers 1 (rs1789165. A case of using a PCR method, the required primer may be a pair or G), 8378 (rs10796828, GorT), 12624 (rs1789172, Tor C), US 9.255.264 B2 39 40 20147 (rs1192921, G or C), 22309 (rs1192923, A or T), 6. USE OF HAIR SHAPE SUSCEPTIBILITY 24512 (rs1192924, T or C), and 26599 (rs1789168, T or C): GENE OR PROTEIN ENCODING THE GENE and (5) in the base sequence set forth in SEQID NO:5, nucle In regard to the hair shape Susceptibility gene identified by otides represented by Nucleotide Numbers 17000 (rs2664, T 5 the procedure described above or an expression product or C), 18895 (rs793.4055, T or G), 26143 (rs17363723, Gor thereof, the expression or activity changes in association with A), 26545 (rs11234174, Aor G), 27090 (rs10792781, CorT), the hair shape. Therefore, the hair shape susceptibility gene 27751 (rs7107678, G or A), and 30274 (rs7106362, T or C). and an expression product thereof can be used as a marker for More preferably, the nucleic acid probe and/or primer used the type of hair shape for detecting and/or determining the in the reagent for determination of the present invention and 10 type of hair shape of a test subject. Alternatively, when the the kit including the reagent, contains a nucleotide repre amount of expression of the hair shape Susceptibility gene or sented by Nucleotide Number 7633 (rs2276299, AorT) in the an expression product thereof is measured and evaluated, the base sequence set forth in SEQID NO:1; nucleotides repre evaluation or selection of a regulating agent for the hair shape sented by Nucleotide Numbers 189853 (rs11227447, C or G) of a person can be carried out. Furthermore, alternatively, and 194405 (rs2282568, Gior C) in the base sequence set forth 15 when the amount of expression of the hair shape Susceptibil in SEQ ID NO:2: nucleotides represented by Nucleotide ity gene or an expression product thereof is controlled, the Numbers 18280 (rs3741367, T or C) and 18933 (rs3741368, hair shape of a person can be regulated. G or A) in the base sequence set forth in SEQID NO: 3; a According to the present invention, the person who can nucleotide represented by Nucleotide Number 1 (rs1789 165, serve as an object in need of the detection and/or determina A or G) in the base sequence set forth in SEQID NO:4; and tion of the type of hair shape or the regulation of hair shape, a nucleotide represented by Nucleotide Number 17000 is not particularly limited to a specific human race or group, (rs2664, T or C) in the base sequence set forth in SEQ ID but Asian race is preferred, while Japanese people are more NO:5. preferred. As the nucleic acid probe having the nucleotides of the The hair shape Susceptibility gene and an expression prod polymorphic sites described above, a nucleic acid having the 25 uct thereofthat are used as the hair shape determining marker nucleotides of any one of the alleles for various polymorphic may be a gene which overlaps with the haplotype block sites can be used, or two nucleic acids having the nucleotides having a base sequence set forth in any one of SEQID NO:1 each respectively corresponding to each of the alleles can also to NO:5 or an expression product thereof. However, preferred be used, depending on the method for detecting polymor examples include SLC22A8 gene, PACS1 gene, KLC2 gene, phism used. Meanwhile, in regard to the invader probe used in 30 RAB1B gene, CNIH2 gene, YIF1A gene, MGC33486 gene, the invader method, the nucleotides of the polymorphic site CD248 gene, ORAOV1 gene, KRTAP5-8 gene, KRTAP5-9 (that is, the nucleotides at the 3'-terminal) may be any arbi gene and KRTAP5-10 gene, and expression products thereof, trary nucleotides. and among these, CNIH2 gene. YIF1A gene, ORAOV1 gene The nucleic acid probe and/or primer used in the reagent and KRTAP5-9 gene, and expression products thereof, are for determination of the present invention and the kit includ 35 more preferred. ing the reagent may be a DNA or an RNA, and may be CNIH2 gene is a gene containing a polynucleotide set forth single-stranded or double-stranded. In the case of being in SEQID NO:34, and CNIH2 protein encoded by the gene double-stranded, the nucleic acid probe and/or primer may be has an amino acid sequence set forth in SEQ ID NO:35. any one of a double-stranded DNA, a double-stranded RNA, CNIH2 gene is reported to be participating in the transport of and a DNA/RNA hybrid. The nucleic acid probe and/or 40 EGF family molecules, which are epidermal cell growth fac primer can be produced, based on the information of the base tors, from the endoplasmic reticulum to the Golgi apparatus sequence, according to an ordinary method using, for (Castro CP et al., J. Cell. Sci., 120 (Pt 14), p. 2454-66, 2007). example, a commercially available nucleotide synthesizer. The gene can be accessed at the NCBI gene database under The nucleic acid probe and/or primer described above can GeneID: 254263. The gene can be acquired by a known be respectively separately (or if possible, in a mixed State) 45 technique for gene manipulation. CNIH2 protein can be dissolved in water or an appropriate buffer solution (for obtained by expressing a gene containing a polynucleotide set example, TE buffer, or the like) to an appropriate concentra forth in SEQID NO:34, or can also be produced by a general tion (for example, 1 to 50 uM, or the like at 2 to 20x concen chemical synthesis method, according to the amino acid tration), and can be stored at about -20°C. The reagent for sequence information set forth in SEQID NO:35. determination of the present invention and the kit including 50 As shown in the Examples that will be described below, the reagent may further include, as constituents, other com gene expression in the hair root areas of Japanese curly hair ponents necessary for carrying out the method, for example, people and Japanese non-curly hair people was analyzed, and a buffer for hybridization reaction, an enzyme for nucleic acid it was found that as compared with the non-curly hair group, amplification reaction, a buffer and other necessary reagents, the amount of expression of CNIH2 gene is significantly a reagent for labeling, a reagent for label detection, and appa 55 lower in the curly hair group. Further, when a Substance ratuses needed for those reactions or procedure, depending on having a hair straightening action, such as morning glory, is the method for detecting polymorphism used. For example, administered, curly hair is alleviated, and the amount of when the reagent and the kit including the reagent are for expression of CNIH2 gene is increased. polymorphism detection according to a TaqMan-PCR YIF1A gene is a gene containing a polynucleotide set forth method, the reagent and the kit including the reagent can 60 in SEQID NO:36, and YIF1A protein encoded by the gene further include a 10xPCR reaction buffer solution, a 10x has an amino acid sequence set forth in SEQ ID NO:37. aqueous solution of MgCl2, a 10x aqueous solution of YIF1A gene is reported to be a gene that encodes a five-span dNTPs, a Taq DNA polymerase (5 U/LL) and the like. transmembrane protein present in the endoplasmic reticulum The reagent for determination of the present invention and or the Golgi apparatus (Yoshida Y. et al., Exp. Cell. Res. the kit including the reagent can be used for the examination 65 314(19), p. 3427-43, 2008). The gene can be accessed at the and/or determination of the genetic susceptibility (genetic NCBI gene database under GeneID: 10897. The gene can be predisposition) to hair shape. acquired by a known technique for gene manipulation. YIF1A US 9.255.264 B2 41 42 protein can be obtained by expressing a gene containing a the base sequences of ACNIH2 gene.YIF1A gene, ORAOV1 polynucleotide set forth in SEQ ID NO:36, or can also be gene or KRTAP5-9 gene; and more preferably a polynucle produced by a general chemical synthesis method according otide consisting of the base sequences set forth in SEQ ID to the amino acid sequence set forth in SEQID NO:37. NO:34, SEQ ID NO:36, SEQ ID NO:38 or SEQID NO:40, As shown in the Examples that will be described below, polynucleotides having base sequences complementary to gene expression in the hair root areas of Japanese curly hair these, and partial polynucleotides thereof. people and Japanese non-curly hair people was analyzed, and Furthermore, the marker for the type of hair shape of the it was found that as compared with the non-curly hair group, present invention can contain a strain consisting of a base the amount of expression of YIF1A gene is significantly sequence which is in a further complementary relation with higher in the curly hair group. Further, when a Substance 10 respect to the base sequence of the polynucleotide consisting having a hair straightening action, such as round cardamom, of complementary base sequence or a partial polynucleotide is administered, curly hair is improved, and the amount of thereof described above. expression of YIF1A gene is decreased. The polynucleotides described above and complementary ORAOV1 gene is a gene containing a polynucleotide set strands thereof may be respectively used as the marker of the forth in SEQIDNO:38, and ORAOV1 protein encoded by the 15 present invention in a single-stranded form, or may also be gene has an amino acid sequence set forth in SEQID NO:39. used as the marker of the present invention in a double It has been hitherto suggested that ORAOV1 gene is associ stranded form. ated with oral squamous cell carcinoma (Jiang L. et al., Int. J. Examples of the partial polynucleotide include a partial Cancer, 123(8), p. 1779-86, 2008). The gene can be accessed polynucleotide of the polynucleotide consisting of the base at the NCBI gene database under GeneID: 220064. The gene sequence of the hair shape Susceptibility gene of the present can be acquired by a known technique for gene manipulation. invention or a base sequence complementary to this, in which ORAOV1 protein can be obtained by expressing a gene con the partial polynucleotide has, for example, a length of con taining a polynucleotide set forth in SEQID NO:38, or can tiguous 15 nucleotides or more. The length of the partial also be produced by a general chemical synthesis method polynucleotide can be appropriately set in accordance with according to the amino acid sequence set forth in SEQ ID 25 the use. NO:39. (2) Primer for Amplifying Marker for Type of Hair Shape, and As shown in the Examples that will be described below, Probe for Detecting the Marker gene expression in the hair root areas of Japanese curly hair A partial polynucleotide of the polynucleotide consisting people and Japanese non-curly hair people was analyzed, and of the base sequence of the hair shape Susceptibility gene of it was found that as compared with the non-curly hair group, 30 the present invention or abase sequence complementary to the amount of expression of ORAOV1 gene is significantly this, can serve as a primer for amplifying the marker for the lower in the curly hair group. Further, when a substance type of hair shape. Preferably, the primer amplifies a poly having a hair straightening action, such as round cardamom, nucleotide consisting of a base sequence set forth in SEQID is administered, curly hair is improved, and the amount of NO:34, SEQID NO:36, SEQID NO:38 or SEQID NO:40, or expression of ORAOV1 gene is increased. 35 a base sequence complementary to this, or a partial poly KRTAP5-9 gene is a gene containing a polynucleotide set nucleotide of Such a polynucleotide. forth in SEQID NO:40, and KRTAP5-9 protein encoded by Furthermore, a polynucleotide consisting of the base the gene has an amino acid sequence set forth in SEQ ID sequence of the hair shape Susceptibility gene of the present NO:41. KRTAP5-9 gene is reported to be a gene that encodes invention or a base sequence complementary to this, or a a hair keratin-binding protein that is expressed in the cuticle 40 partial polynucleotide thereof, can serve as a probe for detect of hair (Rogers M A et al., Int. Rev. Cytol. 251, p. 209-63, ing the marker for the type ofhair shape. Preferably, the probe 2006). The gene can be accessed at the NCBI gene database detects a polynucleotide having a base sequence set forth in under GeneID: 3846. The gene can be acquired by a known SEQID NO:34, SEQID NO:36, SEQID NO:38, or SEQID technique for gene manipulation. KRTAP5-9 protein can be NO:40, or a base sequence complementary to this, or a partial obtained by expressing a gene containing a polynucleotide set 45 polynucleotide of Such a polynucleotide. forth in SEQID NO:40, or can also be produced by a general That is, a primer for specifically recognizing and amplify chemical synthesis method according to the amino acid ing an RNA produced as a result of the expression of CNIH2 sequence set forth in SEQID NO:41. gene, YIF1A gene, ORAOV1 gene or KRTAP5-9 gene, or a As shown in the Examples that will be described below, polynucleotide derived therefrom, or a probe for specifically gene expression in the hair root areas of Japanese curly hair 50 detecting the RNA or the polynucleotide derived therefrom, is people and Japanese non-curly hair people was analyzed, and included the primer or probe described above. it was found that as compared with the non-curly hair group, Specifically, the polynucleotide or partial polynucleotide the amount of expression of KRTAP5-9 gene is significantly can be used as a primer or a probe according to an ordinary lower in the curly hair group. method, in the methods known to specifically detect a par (1) Polynucleotide Marker for Detecting and/or Determining 55 ticular gene, such as a Northern Blotting method, an RT-PCR Type of Hair Shape method, and an in situ hybridization method. According to the present invention, the marker for detect In the case of using the polynucleotide or partial polynucle ing and/or determining the type of hair shape (marker for the otide as a primer, the nucleotide length thereof is usually 15 to type of hair shape) may be a polynucleotide having the base 100 nucleotides, preferably 15 to 50 nucleotides, and more sequence of the hair shape Susceptibility gene of the present 60 preferably 15 to 35 nucleotides. invention, or a partial polynucleotide thereof. Examples of Furthermore, in the case of using the polynucleotide or the marker for the type of hair shape of the present invention partial polynucleotide as a detection probe, one having a include a polynucleotide consisting of the base sequences of nucleotide length of usually 15 nucleotides or more, prefer SLC22A8 gene, PACS1 gene, KLC2 gene, RAB1B gene, ably 15 to 1000 nucleotides, and more preferably 100 to 1000 CNIH2 gene, YIF1A gene, MGC33486 gene, CD248 gene, 65 nucleotides, may be used. ORAOV1 gene, KRTAP5-8 gene, KRTAP5-9 gene, or Here, the term "specifically recognizes' means that, as in KRTAP5-10 gene; preferably a polynucleotide consisting of the case where, for example, in a Northern Blotting method, US 9.255.264 B2 43 44 a polynucleotide consisting of a base sequence set forth in Meanwhile, an indicator that determines the substitution, SEQID NO:34, SEQID NO:36, SEQID NO:38 or SEQ ID insertion or deletion of amino acid residues can be found by NO:40, or a base sequence complementary to this, or a partial using a computer program well known to those having ordi polynucleotide thereof can be specifically detected, and as in nary skill in the art, for example, DNA Star software program. the case where, for example, in an RT-PCR method, the For example, the number of variations is typically 10% or less polynucleotide is specifically produced, the detected sub of the total number of amino acids, preferably 5% or less of stance or the product can be considered as a polynucleotide the total number of amino acids, and more preferably 1% or consisting of a base sequence set forth in SEQ ID NO:34, less of the total number of amino acids. Furthermore, from the SEQID NO:36, SEQID NO:38 or SEQID NO:40, or a base viewpoint of maintaining the structure of protein, the amino sequence complementary to this, or a partial polynucleotide 10 acid to be substituted is preferably an amino acid having thereof. properties that are similar to those of amino acids before The partial polynucleotide of a polynucleotide consisting Substitution interms of the polarity, charge, solubility, hydro of a base sequence set forth in SEQ ID NO:34, SEQ ID phobicity, hydrophilicity, amphiphilicity and the like of the NO:36, SEQID NO:38 or SEQID NO:40, or a base sequence amino acid. complementary to this, can be designed based on the base 15 sequence of CNIH2 gene, YIF1A gene, ORAOV1 gene or The partial polypeptide may be a polypeptide consisting of KRTAP5-9 gene as set forth in the sequence numbers at least 5 contiguous amino acids, and preferably 10 to 100 described above, for example, through the software program amino acids, in an amino acid sequence encoded by the hair of Primer 3 or Vector NTI. The candidate sequence of the shape Susceptibility gene of the present invention (for primer or probe thus obtainable, or a sequence containing the example, an amino acid sequence set forth in SEQID NO:35, sequence in a portion, can be designed as a primer or a probe. SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:41), and (3) Polypeptide Marker for Detecting and/or Determining having a biological function and/or immunological activity Type of Hair Shape equivalent to those of an expression product of the hair shape Like the hair shape Susceptibility genes listed above, Susceptibility gene of the present invention (for example, expression products of these genes (proteins encoded by the 25 CNIH2, YIF1A, ORAOV1 or KRTAP5-9). hair shape Susceptibility genes, or polypeptides derived there The polypeptide encoded by the hair shape susceptibility from, or partial polypeptides thereof) can also serve as the gene of the present invention can be obtained by operations of marker (polypeptide) for the type of hair shape. DNA cloning, establishment of various plasmids, transfec Examples of the expression products include SLC22A8 tion of the plasmid to a host, culture of the transformant, and protein, PACS1 protein, KLC2 protein, RAB1B protein, 30 collection of protein from the culture, based on the base CNIH2 protein, YIF1A protein, MGC33486 protein, CD248 sequence information of the hair shape Susceptibility gene. protein, ORAOV1 protein, KRTAP5-8 protein, KRTAP5-9 These operations can be carried out according to known protein and KRTAP5-10 protein (or also referred to as methods, for example, the methods described in Molecular SLC22A8, PACS1, KLC2, RABID, CNIH2, YIF1A, Cloning, T. Maniatis et al., CSH Laboratory (1983); DNA MGC33486, CD248, ORAOV1, KRTAP5-8, KRTAP5-9 and 35 Cloning, D M. Glover, IRL PRESS (1985); and the like. KRTAP5-10), which are proteins encoded by SLC22A8 gene, Specifically, the polypeptide can be obtained by producing PACS1 gene, KLC2 gene, RAB1B gene, CNIH2 gene, a recombinant DNA (e.g., expression vector) through which a YIF1A gene, MGC33486 gene, CD248 gene, ORAOV1 gene encoding CNIH2, YIF1A, ORAOV1 or KRTAP5-9 can gene, KRTAP5-8 gene, KRTAP5-9 gene and KRTAP5-10 be expressed in a desired host cell, introducing this into a host gene, respectively; polypeptides derived from these proteins; 40 cell to thereby transform the recombinant DNA, culturing the and partial polypeptides thereof. Preferred examples include transformant, and collecting the target protein from the cul CNIH2, YIF1A, ORAOV1 and KRTAP5-9, polypeptides ture thus obtainable. derived from these, and partial polypeptides thereof. Furthermore, the polypeptide encoded by the hair shape More preferably, the expression products are proteins Susceptibility gene of the present invention can also be pro encoded by polynucleotides consisting of base sequences set 45 duced by a general chemical synthesis method in accordance forth in SEQID NO:34, SEQID NO:36, SEQID NO:38, and with an amino acid sequence encoded by the hair shape Sus SEQ ID NO:40, and even more preferably, proteins having ceptibility gene. amino acid sequences set forth in SEQ ID NO:35, SEQ ID (4) Antibody Specifically Recognizing Marker (Polypeptide) NO:37, SEQID NO:38 and SEQID NO:41. for Type of Hair Shape Furthermore, the expression products also include proteins 50 An antibody which specifically recognizes a polypeptide which have amino acid sequences resulting from deletions, consisting of an amino acid sequence encoded by the hair Substitutions or additions of one or several amino acids in the shape Susceptibility gene of the present invention or a partial amino acid sequences set forth in SEQ ID NO:35, SEQ ID polypeptide thereof, may be an antibody for detecting the NO:37, SEQ ID NO: 38 or SEQ ID NO:41, and having marker (polypeptide) for the type of hair shape described biological functions equivalent to and/or having equivalent 55 above. immunological activity to those of proteins consisting of the As will be described below, when such an antibody is used, amino acid sequences set forth in SEQID NO:35, SEQ ID the presence or absence of the expression of the marker NO:37, SEq ID NO:38, and SEQID NO:41 (homologues of (polypeptide) for the type of hair shape (for example, CNIH2, CNIH2, YIF1A, ORAOV1, or KRTAP5-9). YIF1A, ORAOV1, KRTAP5-9, or a polypeptide derived Here, examples of proteins which have equivalent biologi 60 therefrom, or a partial polypeptide thereof) in a tissue of a test cal functions include proteins that are equivalent to CNIH2, subject, and the level of the expression of the marker can be YIF1A, ORAOV1 or KRTAP5-9 in terms of the biochemical detected. Specifically, when a portion of the hair root area of or pharmacological functions. Further, examples of proteins a test subject or the like is collected by a biopsy method or the having equivalent immunological activity include proteins like, a protein is produced therefrom according to an ordinary that have an ability to induce a specific immune reaction in an 65 method, and the antibody of the present invention is used appropriate animal or cells thereof, and to bind specifically to according to an ordinary method in, for example, a known the antibodies to CNIH2, YIF1A, ORAOV1 or KRTAP5-9. detection method such as a Western Blotting method or an US 9.255.264 B2 45 46 ELISA method, the marker (polypeptide) for the type of hair tial polynucleotide thereof, or the amount of expression of a shape present in the tissue can be detected. protein derived from the gene (for example, CNIH2, YIF1A, The antibody for the detection of the type of hair shape may ORAOV1, or KRTAP5-9), a homologue thereof, or a partial be a polyclonal antibody or a monoclonal antibody, which are polypeptide thereof. both directed to the marker (polypeptide) for the type of hair 5 Furthermore, the method for detection/determination of shape as an immunizing antigen. the present invention is also used, for example, in the case These antibodies can be produced according to known where a pharmaceutical product, a cosmetic product or the methods (Current protocols in Molecular Biology, edited by like for alleviating curly hair is administered to a curly hair Ausubel et al., (1987) published by John Wiley and Sons, person, so as to determine the presence or absence or the Section 11.12-11.13). Specifically, a polyclonal antibody can 10 degree of an alleviation of the curly hair. be obtained by immunizing a non-human animal Such as a 1) Biological Sample rabbit with a polypeptide consisting of an amino acid Examples of the biological sample used herein include sequence encoded by the hair shape Susceptibility gene of the epithelial tissue or epithelial cells of a test subject, for present invention (for example, CNIH2,YIF1A, ORAOV1 or example, a tissue containing cells that are capable of express KRTAP5-9), which has been expressed in Escherichia coli or 15 ing the hair shape Susceptibility gene of the present invention the like and purified by ordinary methods, or with a partial (for example, CNIH2 gene, YIF1A gene, ORAOV1 gene, or polypeptide of the polypeptide above synthesized according KRTAP5-9 gene), such as the hair root area or skin; an RNA to an ordinary method, and collecting the polyclonal antibody produced from this tissue; a polynucleotide further produced from the blood serum of the immunized animal according to from the RNA; and a protein produced from the tissue an ordinary method. described above. These RNA, polynucleotide and protein can On the other hand, a monoclonal antibody can be obtained be prepared, for example, by collecting a portion of the hair from a hybridoma cell prepared by immunizing a non-human root area of a test subject by a biopsy method or the like, and animal Such as a mouse with the polypeptide expressed in then according to ordinary methods. Escherichia coli or the like and purified according to ordinary 2) Detection and/or Measurement of Marker methods as described above, or a partial polypeptide thereof, 25 The detection and measurement of a marker may vary and Subjecting spleen cells obtained from the animal and depending on the type of the biological sample used as the myeloma cells to cell fusion (Current protocols in Molecular object of measurement, and specifically, the detection and Biology, edited by Ausubel et al., (1987), published by John measurement are carried out as follows. Wiley and Sons, Section 11.4-11.11). (i) Case of Using RNA as Biological Sample of Measure The partial polypeptide used herein is an oligopeptide hav 30 ment ing a partial amino acid sequence of a polypeptide consisting In the case of using an RNA as a biological sample, the of an amino acid sequence encoded by the hair shape suscep detection and measurement is carried out by detecting and tibility gene of the present invention (for example, CNIH2, measuring the expression level of a marker (polynucleotide) YIF1A, ORAOV1 or KRTAP5-9). It is not necessary for the for the type of hair shape of the present invention in the RNA, partial polypeptide to have a functional biological activity, 35 for example, CNIH2 gene, YIF1A gene, ORAOV1 gene, but it is preferable that the partial polypeptide have the same KRTAP5-9 gene, or a partial polynucleotide thereof. immunogenic characteristics as those of proteins consisting Here, specifically, the measurement of the amount of of the amino acid sequences described above. For example, expression of the marker can be carried out by carrying out a there may be mentioned an oligopeptide consisting of at least known method such as a Northern Blotting method, an RT 8 contiguous amino acids, preferably 15 amino acids, and 40 PCR method, a DNA chip analysis method, or an in situ more preferably 20 amino acids, in the amino acid sequences hybridization analysis method, using a primer for amplifying described above, which oligopeptide has immunogenic char a polynucleotide that can serve as the marker of the present acteristics equivalent to those of proteins consisting of the invention described above, or a probe for detecting the poly amino acid sequences described above, and preferably nucleotide. CNIH2, YIF1A, ORAOV1 or KRTAP5-9. 45 In the case of using a Northern Blotting method, when the The production of an antibody to such a partial polypeptide probe of the present invention is used, the presence or absence can be carried out by increasing the immunological response of the expression of the marker (for example, CNIH2 gene, using various adjuvants depending on the host. Although YIF1A gene, ORAOV1 gene, KRTAP5-9 gene, or a partial there are no limitations, examples of Such adjuvants include polynucleotide thereof) in the RNA, and the level of the Freund's adjuvant; mineral gels such as aluminum hydrox 50 expression can be detected and measured. ide; Surface-active Substances such as lysolecithin, pluronic Specifically, there may be mentioned a method in which, polyol, polyanions, peptides, oil emulsifying agents, keyhole first, the probe DNA is labeled with a radioisotope (PP, or limpet hemocyanin, and dinitrophenol; and human adjuvants the like; RI), a fluorescent substance or the like; subsequently, such as bacillus Calmette-Guerin (BCG) and corynebacte the labeled disease marker thus obtainable is hybridized with rium parvum. 55 an RNA derived from a biological tissue of a test subject that (5) Detection and/or Determination of Type of Hair Shape has been transferred onto a nylon membrane or the like Detection/determination of the type of hair shape involves according to an ordinary method; and then the double strand collecting a portion of hair root tissue or the like of a test of the labeled disease marker (DNA) and the RNA thus Subject by a biopsy method or the like, and detecting and/or formed is detected and measured by measuring the signal determining the type of hair shape by using the marker for the 60 originating from the labeled material (RI, a fluorescent sub type of hair shape of the present invention contained in the stance or the like) of the labeled disease marker with a radia tissue as an indicator. For example, in the method described tion detector (BAS-1800 II, manufactured by Fujifilm Hold above, the type of hair shape is detected and/or determined by ings Corp.), a fluorescence detector or the like. measuring the expression level (amount of expression) of the Furthermore, a method using an AlkPhos DirectTM Label hair shape Susceptibility gene of the present invention (for 65 ling and Detection System (manufactured by Amersham example, CNIH2 gene, YIF1A gene, ORAOV1 gene, or Pharamcia Biotech, Inc.) can also be available, in which the KRTAP5-9 gene), a complementary strand thereof, or a par method includes labeling a probe DNA according to the pro US 9.255.264 B2 47 48 tocol of AlkPhos DirectTM, hybridizing the probe DNA with been bound to the antibody, for example, CNIH2, YIF1A, an RNA derived from a biological tissue of a test subject, and ORAOV1, KRTAP5-9, or a partial polypeptide thereof, and then detecting and measuring the signal originating from the measuring the amount (level) of the marker. labeled material of the probe DNA with a multibioimager Here, the measurement of the amount of protein binding STORM860 (manufactured by Amersham Pharmacia Bio can be carried out by using a known method such as a Western tech, Inc.). Blotting method. In the case of using an RT-PCR method, the presence or The Western Blotting method can be carried out by using absence of the expression of the marker in the RNA, and the the antibody of the present invention as a primary antibody, level of the expression can be detected and measured using Subsequently; labeling the primary antibody using, as a sec the primer of the present invention. Specifically, first, a cDNA 10 ondary antibody, an antibody which binds to the primary is prepared from an RNA derived from a biological tissue of antibody labeled with a radioisotope such as I, a fluores a test Subject according to an ordinary method, and by using cent Substance, an enzyme such as horse radish peroxidase this cDNA as a template, a pair of primers (a forward strand (HRP), or the like; and determining the signals originating which binds to the cDNA (minus strand) and a reverse strand from these labeled substances with a radiation meter, a fluo which binds to the plus strand) prepared from the marker 15 rescence detector or the like. Furthermore, after using the polynucleotide of the present invention is hybridized with the antibody of the present invention as the primary antibody, the cDNA, so that the region of the target marker can be ampli primary antibody is detected using an ECL Plus Western fied. Thereafter, a PCR method is carried out according to an Blotting Detection System (manufactured by Amersham ordinary method, and thus the amplified double-stranded Pharmacia Biotech, Inc.) according to the protocol, and mea DNA thus obtained is detected. surement can be made using a multibioimager STORM 860 For the detection of the amplified double-stranded DNA, a (manufactured by Amersham Pharmacia Biotech, Inc.). method of detecting a labeled double-stranded DNA pro 3) Determination of Type of Hair Shape duced by carrying out the PCR using primers which have The determination of the type of hair shape can be carried been labeled in advance with RI, a fluorescent substance or out by comparing the level of the marker of the present inven the like; a method of transferring the produced double 25 tion (for example, the level of gene expression of CNIH2 stranded DNA onto a nylon membrane or the like according to gene.YIF1A gene, ORAOV1 gene or KRTAP5-9 gene, or the an ordinary method, hybridizing this double-stranded DNA amount of CNIH2, YIF1A, ORAOV1 or KRTAP5-9) in a by using a labeled disease marker as a probe, and detecting the biological sample of a test Subject, which has been measured hybridization product; and the like can be used. The labeled as described above, with the corresponding level of a non double-stranded DNA product thus produced can be mea 30 curly hairperson, and determining the difference between the sured with an Agilent 2100 Bioanalyzer (manufactured by two levels. Yokogawa Analytical Systems, Inc.) or the like. Furthermore, The comparison of the level of expression of the marker an RT-PCR reaction solution is prepared using SYBR (regis polynucleotide or polypeptide between the biological sample tered trademark) Green RT-PCR Reagents (manufactured by of a test Subject and the biological sample of a non-curly hair Applied Biosystems, Inc.) according to the protocol, the reac 35 person can be carried out by carrying out the measurements tion solution is allowed to react with ABI PRIME (registered directed to the biological sample of a test subject and the trademark). 7700 Sequence Detection System (manufactured biological sample of a non-curly hair person in parallel. Fur by Applied BioSystems), and the reaction product may be thermore, even if the measurements are not carried out in detected. The detection and measurement of the level of parallel, the average value or a statistical median value of the expression of the marker (polynucleotide) for the type of hair 40 level of gene expression of the marker polynucleotide shape of the present invention in the RNA of a test subject (CNIH2 gene, YIF1A gene, ORAOV1 gene, KRTAP5-9 using such an RT-PCR method, will be described in gene, a partial polynucleotide thereof, or the like) or the level Examples. of expression of the marker polypeptide (CNIH2, YIF1A, In the case of using a DNA chip analysis, a DNA chip ORAOV1, KRTAP5-9, a partial polypeptide thereof, or the bonded with the DNA probe (single-stranded or double 45 like), which has been determined in advance in the tissues of Stranded) of the present invention is provided, and this is plural (at least 2, preferably 3 or more, and more preferably 5 hybridized with a cFNA prepared from an RNA derived from or more) non-curly hairpersons under the same measurement a biological tissue of a test Subject according to a conventional conditions, can be used for the comparison with the test method, the two strands of the DNA and cRNA thus formed subjects, as the measured value for the test subject with the are bound with a labeled probe prepared from the marker 50 level of expression of the marker polynucleotide or polypep polynucleotide of the present invention, and thereby, the pres tide of a non-curly hair person. ence or absence of the expression of the marker of the present The determination of the type of hair shape of a test subject invention and the level of the expression can be detected and can be carried out by using, as an index, the extent of increase measured. or decrease (for example, higher or lower by two times or Furthermore, a DNA chip capable of detecting and mea 55 more, and preferably three times or more) in the case of suring the level of expression of the marker of the present comparing the gene expression level of the marker polynucle invention can also be used as the DNA chip. As the DNA chip, otide (CNIH2 gene, YIF1A gene, ORAOV1 gene, KRTAP5-9 for example, GeneChip (registered trademark) Human gene, a partial polynucleotide thereof, or the like) or the Genome U133 plus 2 manufactured by Affymetrix, Inc. may expression level of the marker polypeptide (CNIH2, YIF1A, be used. 60 ORAOV1, KRTAP5-9, a partial polypeptide thereof, or the (ii) Case of Using Protein as Biological Sample of Object like) in the tissue of the test subject, with the levels of a of Measurement non-curly hair person. When a protein is used as an object of measurement, the For example, if the expression level of CNIH2 gene or measurement is carried out by bringing the antibody of the CNIH2 protein of the test subject is lower than such a level of present invention into contact with a biological sample, 65 a non-curly hair person, the test Subject can be considered as detecting the marker (polypeptide) for the type of hair shape a curly hair person, or is suspected to have the onset of curly of the present invention in the biological sample, which has hair in the future. US 9.255.264 B2 49 50 Furthermore, for example, if the expression level of YIF1A intending to promote waving, the expression level of CNIH2 gene or YIF1A protein of the test subject is lower than such a gene, ORAOV1 gene or KRTAP5-9 gene may be brought to a level of a non-curly hair person, the test Subject can be con value lower than the mRNA expression level of the gene in a sidered as a curly hairperson, or is suspected to have the onset non-curly hair person, and for example, it is desirable to of curly hair in the future. 5 decrease the expression level to a value of about 3 to 10 times For example, if the expression level of ORAOV1 gene or lower or less. ORAOV1 protein of the test subject is lower than such a level Furthermore, for example, in the case of Suppressing curly of a non-curly hair person, the test Subject can be considered hair or kinky hair, the expression level of YIF1A gene in the as a curly hairperson, or is Suspected to have the onset of curly human hair root area may be brought to a value equal to or hair in the future. 10 lower than the mRNA expression level of the gene in a non For example, if the expression level of KRTAP5-9 gene or curly hair person, and for example, it is desirable to decrease KRTAP5-9 protein of the test subject is lower than such a the expression level to a value of about 3 to 10 times lower or level of a non-curly hair person, the test Subject can be con less. On the other hand, in the case of intending to promote sidered as a curly hairperson, or is suspected to have the onset waving, the expression level of YIF1A gene may be brought of curly hair in the future. 15 to a value higher than the mRNA expression level of the gene 7. Method for Regulating Hair Shape in a non-curly hair person, and for example, it is desirable to When the nucleotides located at the hair shape susceptibil increase the expression level to a value of about 3 to 10 times ity SNP marker of the present invention are modified, the hair higher or more. shape of individuals can be regulated. The Suppression, induction or promotion of the expression That is, the present invention also provides a method for of a hair shape Susceptibility gene in the human hair root area regulating the hair shape of an individual. According to an can be carried out according to an ordinary method. For embodiment, the method may be a non-therapeutic method example, in the Suppression of gene, a method based on an for regulating hair shape for cosmetic purposes, and can be antisense nucleotide, for example, a technique based on a carried out by a beautician or a barber. Meanwhile, according method of inhibiting the translation from mRNA, or the like, to the present specification, the term “non-therapeutic' is a 25 may be used, and in the induction or promotion, a technique concept which does not encompass medical acts, that is, acts of expressing a hair shape Susceptibility gene through gene of remedy to human body through treatment. transduction by means of a viral vector or the like may be The method can be achieved by modifying the nucleotides used, or the like. Furthermore, in the suppression of the located at the hair shape susceptibility SNP markers of the expression of a protein encoded by a hair shape Susceptibility present invention listed above. The specific technique is not 30 gene can be basically realized by a technique of Suppressing particularly limited as long as it is a method capable of the expression of the gene, and in the induction or promotion achieving the purpose described above, and conventionally of the expression of the protein, a technique of expressing the known methods and techniques that will be developed in the gene at a high level, as well as a technique of direct intracu future can all be used; however, for example, a method of taneous injection of a human recombinant protein of the utilizing genetic recombination may be used. 35 protein, or the like may be used. Alternatively, the method for regulating hair shape of the The genetransduction utilizing an antisense nucleotide can present invention is carried out by controlling the expression be carried out in the same manner as in the methods ordinarily of the hair shape Susceptibility gene of the present invention used in gene therapy. For example, gene transduction can be in the hair root area of a person in need of regulation of hair carried out by a method of directly administering an antisense shape (for example, Suppression of curly hair or kinky hair, or 40 oligonucleotide or a chemical modification product thereof waving of scalp hair). into the body of a test Subject and thereby suppressing the For example, in a person who is concerned about having expression of the hair shape Susceptibility gene of the present curly hair or kinky hair, curly hair or kinky hair can be invention, or a method of introducing an antisense RNA to a Suppressed by inducing or promoting the expression of a hair target cell of a patient and thereby suppressing the expression shape Susceptibility gene whose expression contributes to the 45 of the hair shape Susceptibility gene of the present invention phenotype of straight hair, for example, CNIH2 gene, in the cell. ORAOV1 gene, or KRTAP5-9 gene. Alternatively, curly hair Here, the term “antisense nucleotide' encompasses an or kinky hair can be suppressed by inhibiting the expression antisense oligonucleotide, an antisense RNA, an antisense of a hair shape Susceptibility gene whose expression contrib DNA and the like, which all correspond to a portion of at least utes to the phenotype of curly hair or kinky hair, for example, 50 8 nucleotides or more in a hair shape Susceptibility gene of the YIF1A gene. On the other hand, in a person who wishes for present invention. Examples of the chemical modification waving of the Scalp hair, waving can be expressed or pro products thereof include derivatives which are capable of moted by inducing or promoting the expression of a hair increasing the transferability into cells or stability in the cells, shape Susceptibility gene whose expression contributes to the Such as phosphorothioates, phosphorodithioates, alkyl phos phenotype of curly hair or kinky hair, for example, YIF1A 55 photriesters, alkylphosphonates, and alkyl phosphoamidates gene. Alternatively, waving can be expressed or promoted by ('Antisense RNA and DNA”, published by WILEY-LISS, inhibiting the expression of a hair shape Susceptibility gene 1992, pp. 1-50; J. Med. Chem. 36, 1923-1937 (1993)). whose expression contributes the phenotype of straight hair, The antisense nucleotide or a chemical modification prod for example, CNIH2 gene, ORAOV1 gene or KRTAP5-9 uct thereof can Suppress the expression of a hair shape Sus gene. 60 ceptibility gene, that is, the expression of a protein encoded For example, in the case of suppressing curly hair or kinky by a hair shape Susceptibility gene, by binding to a sense hair, the expression level of CNIH2 gene, ORAOV1 gene, or strand mRNA in a cell, and can thereby control the function KRTAP5-9 gene in the human hair root area may be brought (activity) of the protein. to a value equal to or higher than the mRNA expression level In the method of directly administering an antisense oligo of the gene in a non-curly hair person, and for example, it is 65 nucleotide or a chemical modification product thereof into a desirable to increase the expression level to a value of about 3 living body, an antisense oligonucleotide or a chemical modi to 10 times higher or more. On the other hand, in the case of fication product thereof used therein may have a length of US 9.255.264 B2 51 52 preferably 5 to 200 nucleotides, more preferably 8 to 25 which about 0.0001 to 100 mg, and preferably about 0.001 to nucleotides, and most preferably 12 to 25 nucleotides. Upon 10 mg, is administered once in several days to several months the administration, the antisense oligonucleotide or a chemi to an adult as a test Subject. cal modification product thereof can be formulated into a In the case of a retrovirus vector containing an antisense preparation using a stabilizer, a buffer Solution, a solvent and 5 nucleotide, the amount can be selected in the range of an the like that are ordinarily used. amount which gives a retrovirus titer of about 1x10 pfu to In the method of introducing an antisense RNA into a target 1x101 pfu per day per kg of the patient’s body weight. In the cell of a test subject, the antisense RNA used therein may have case of a cell having an antisense nucleotide introduced a length of preferably 100 nucleotides or more, more prefer therein, an amount of about 1x10" cells/body to 1x10" cells/ 10 body may be administered. ably 300 nucleotides or more, and even more preferably 500 8. Method for Evaluation or Selection of Hair Shape Regu nucleotides or more. Furthermore, this method encompasses lating Agent an in Vivo method of introducing an antisense gene into the The present invention also provides a method for evaluat cells of a living body, and an ex vivo method of first introduc ing or selecting a hair shape regulating agent (screening ing an antisense gene into the cells that have been extracted 15 method). out of body, and returning the cells into the body (see Nikkei The screening method may be carried out by, for example, Science, April 1994, pp. 20-45; Gekkan Yakuji (Pharmaceu steps such as described below: ticals Monthly) 36(1), 23-48 (1994); Jikken Igaku (Experi (a) a step of administering a test Substance into a cell mental Medicine) Special Issue, 12(15) (1994), whole page: containing the hair shape Susceptibility gene of the present and the like). Among these, an in vivo method is preferred, invention; and and examples thereof include a viral transduction method (a (b) a step of selecting, among the administered test Sub method of using a recombinant virus) and a non-viral trans stances, a Substance which converts a nucleotide polymor duction method (see the various documents described above). phism of the hair shape susceptibility SNP marker of the As the method of using a recombinant virus, for example, present invention present on the hair shape Susceptibility gene methods of inserting an antisense nucleotide of MITK gene 25 or the vicinity thereof, for example, on the haplotype block into the genome of a virus such as retrovirus, adenovirus, containing the gene, to another polymorphism, as a hair shape adeno-associated virus, herpes virus, vaccinia virus, polio regulating agent. virus, or Sindbis virus, and introducing the product into the The cell used in the step (a) (step of administering a test living body, may be used. Among these methods, methods of Substance) may be any cell which can be introduced a haplo 30 type block in the genomic region of human chromosome 11 using retrovirus, adenovirus, adeno-associated virus and the represented by a base sequence set forth in any one of SEQID like are particularly preferred. As the non-viral transduction NO: 1 to NO: 5, or a gene which at least overlaps with the method, a liposome method, a lipofectin method and the like haplotype block, that is, the hair shape Susceptibility gene of may be used, and particularly, a liposome method is pre the present invention, and can retain the gene stably, and there ferred. As other non-viral transduction methods, for example, 35 are no particular limitations on the origin of the cell (for a microinjection method, a calcium phosphate method, an example, the cell is not limited to a prokaryotic cell or a electroporation method and the like may also be used. eukaryotic cell, oran insect cell or an animal cell, or the like). A preparation composition for gene transduction contains, Meanwhile, genetransduction, cell culture and the like can be as active ingredients, the antisense nucleotide described carried out by arbitrarily using any methods conventionally above or a chemical modification product thereof, recombi 40 known in the art (for example, Joseph Sambrook et al., nant viruses containing these, infected cells to which these Molecular Cloning: A Laboratory Manual (3 Vol. Set), Cold viruses have been introduced, and the like. Spring Harbor Laboratory, NY, 2001; The Japanese Tissue The administration of the composition to a test Subject can Culture Association, Ed., “Technology of Tissue Culture, 3rd be carried by, for example, intravenous, intraarterial, Subcu Edition, Fundamentals and Applications'. Asakura Shoten, taneous, or intramuscular administration in an appropriate 45 1996; and the like). The cell can be effectively utilized as a dosage form such as an injection, and can be introduced by screening tool in the method for evaluating or selecting a directly administering the composition through the skin of a Substance effective for regulating the hair shape (Screening patient. In the case of employing an in vivo method, the method). composition for gene transduction can be formulated into a There are no particular limitations on the test Substance dosage form such as an injection containing an antisense 50 that is administered. Examples include single compounds nucleotide of a hair shape Susceptibility gene, as well as a Such as a natural compound, an organic compound, an inor form in which, for example, a viral vector containing an ganic compound, a protein and a peptide; and arbitrary com antisense nucleotide of a hair shape Susceptibility gene that is pounds or compositions such as a compound library, expres embedded in a liposome or a membrane-fused liposome sion products of a gene library, a cell extract, a cell culture (Sendai virus (HVJ)-liposome, or the like). These liposome 55 Supernatant, products of a fermentation microorganism, a dosage forms include a Suspending agent, a freezing agent, a marine extract, and a vegetable extract. centrifuge concentration freezing agent, and the like. Further In regard to the step (b) (step of selecting a hair shape more, the composition for gene transduction can also be regulating agent), the presence or absence of the conversion formulated into a form of a culture fluid of cells infected with of a nucleotide polymorphism and the type of the nucleotide a virus to which a vector containing the antisense nucleotide 60 after conversion are detected. The method for detecting the of a hair shape Susceptibility gene has been introduced. The presence or absence of the conversion of a nucleotide poly amount of administration of the active ingredient in these morphism and the type of the converted nucleotide may be a various preparation forms can be appropriately adjusted on method of directly measuring the type of nucleotides, or a the basis of the severity of the disease intended to treat, the age method capable of indirectly evaluating the change of nucle and body weight of the patient, and the like. Usually, in the 65 otides. Examples of the method of directly measuring nucle case of an antisense nucleotide for a hair shape Susceptibility otides include methods that are well known to those having gene, the amount of administration may be an amount by ordinary skill in the art, such as PCR-SSCP, PCR-RLFP US 9.255.264 B2 53 54 PCR-SSO, PCR-ASP, a direct sequencing method, SNaP Furthermore, cell culture can be carried out by, for shot, dHPLC, a Sniper method, and a MALDI-TOF/MS example, inserting cells into a 24-well plate to which a culture method. Examples of the method of indirectly evaluating fluid has been added, and culturing the cells usually for 1 to 7 nucleotides includes methods of measuring a function, activ days, and preferably 1 to 3 days, in a gas phase of air con ity, the amount of a specific mRNA, or the amount of a 5 taining CO at a temperature of 37° C. protein, which may be produced/increased, or lost/decreased The measurement (quantification) of the expression of the as a result of the conversion of the target nucleotides. gene can be carried out according to the method described in The substance selected by the method can be used as a hair connection with the detection/measurement of a marker for shape regulating agent effective for the regulation of hair the type of hair shape described above ((5)-2)-(i)). That is, the shape, and can also be used for the preparation of a pharma 10 measurement can be carried out by performing a known ceutical product, a quasi-drug, a cosmetic material, a health method such as a Northern Blotting method, an RT-PCR food, or the like, which all contain the agent. When the method, a DNA chip analysis method, or an in situ hybrid selected Substance is further Subjected to other pharmacologi ization analysis method, using a primer for amplifying a cal tests, clinical tests and toxicology tests as necessary, a hair polynucleotide that can serve as the marker of the present shape regulating agent that is more effective and safe to 15 invention, or a probe for detecting the polynucleotide. human beings can be obtained. Furthermore, the measurement (quantification) of the Alternatively, the screening method described above can expression of the protein can be carried out according to the be carried out by using, for example, the expression of a hair method described in connection with the detection/measure shape Susceptibility gene of the present invention or a protein ment of a marker for the type of hair shape described above encoded by the gene in a tissue or cell capable of expressing ((5)-2)-(ii)). That is, the measurement can be achieved the gene or protein, as an indicator. according to a known method Such as a Western Blotting Specifically, the screening method can be carried out by the method, using an antibody which recognizes the marker following steps (a) to (d): (polypeptide) for the type of hair shape of the present inven (a) a step for contacting a test Substance with a tissue or cell tion. capable of expressing the hair shape Susceptibility gene of the 25 2) The measurement of the expression level of the hair present invention or a protein encoded by the gene; shape Susceptibility gene of the present invention can also be (b) a step of measuring the amount of expression of the carried out by introducing into a cell line a fusion gene in gene or the protein in the tissue or cell; which a reporter gene Such as, for example, luciferase gene, is (c) a step of comparing the amount of expression measured linked to a gene region controlling the expression of the gene in step (b) with the amount of expression of the gene or the 30 (regulatory region), and measuring the amount or activity of protein in a control tissue or cell which has not been contacted a protein derived from the reporter gene. with the test substance; and That is, the method for evaluating or selecting a hair shape (d) a step of selecting, based on the results of step (c), a test regulating agent according to the present invention can be Substance which decreases or increases the amount of expres carried out by the following steps of (a) to (c): sion of the gene or the protein, as a hair shape regulating 35 (a) a step of introducing a fusion gene of the regulatory agent. region of a hair shape Susceptibility gene of the present inven Here, as the tissue or cell capable of expressing the hair tion and a reporter gene, into a cell capable of expressing the shape Susceptibility gene of the present or a protein encoded hair shape Susceptibility gene of the present invention, and by the gene, the type of the tissue or cell does not matter as culturing the cell in the presence and in the absence of a test long as the tissue or cell which expresses the gene or the 40 Substance; protein. However, examples include a tissue or a cell of a (b) a step of measuring the amount of expression of an mammal, for example, the skin tissue, hair root area tissue expression product of the reporter gene in the cell culture (hair follicle tissue), epidermal keratinocytes, hair root area cultured in the presence of the test Substance, and comparing derived cells, an established epithelial cell line, and the like, the amount with the amount of expression of an expression all collected from a human being. The cell also includes a 45 product of the reporter gene in the cell culture cultured in the transformant which has been transformed with the hair shape absence of the test Substance; and Susceptibility gene of the present invention (an expression (c) a step of selecting, based on the comparison results vector having the gene). obtained in step (b), a test Substance which increases or The contact between the tissue or cell and a test substance decreases the amount of expression of the reporter gene can be carried out by, for example, adding the test Substance 50 expression product, as a hair shape regulating agent. inadvance to a culture fluid to a predetermined concentration, As the reporter gene, a structural gene of an enzyme which and then placing the tissue or cell in the culture fluid, or by catalyzes a light emission reaction or a color reaction is pre adding the test substance to a culture fluid in which the tissue ferred. Specifically, examples include the luciferase gene or cell is placed, to a predetermined concentration. described above, secreted alkali phosphatase gene, chloram Examples of the culture fluid include DMEM medium, 55 phenichol acetyltransferase gene, B-glucuronidase gene, MCDB medium, Willams' E medium, RPMI1640 medium, B-galactosidase gene, aequorin gene, and the like. DMEM/HamF12 (1:1) medium, various commercially avail Furthermore, as the regulatory region of the hair shape able media for epithelial cells, and the like, and appropriately susceptibility gene, for example, about 1 kb to about 10 kb, agar or gelatin may also be added. Furthermore, if necessary, and preferably about 2 kb, upstream of the transcription ini an antibiotic Substance, an amino acid, blood serum, a growth 60 tiation site of the gene can be used, and for example, the factor, a biological extract, and the like may also be added. regions having base sequences set forth in SEQID NO: 42 to Tissue culture can be carried out by, for example, inserting NO: 45 in CNIH2 gene, YIF1A gene, ORAOV1 gene or a collected hair root area tissue (hair follicle tissue) into a KRTAP5-9 gene, respectively, may be used. 24-well plate to which a culture fluid has been added, and A Substance which decreases the amount of expression of culturing the tissue usually for 10 to 30 days, and preferably 65 the hair shape Susceptibility gene may be a Substance which 1 to 21 days, in a gas phase of air containing CO at a tem Suppresses the expression of or promotes the degradation of a perature of 37° C. mRNA complementary to the polynucleotide constituting the US 9.255.264 B2 55 56 gene, and a Substance which decreases the amount of expres (c) a step of selecting, based on the comparison results of sion of a protein encoded by the hair shape Susceptibility gene the step (b), a test Substance which increases or decrease the may be a Substance which Suppresses the expression of the function or activity of the protein. hair shape Susceptibility gene or a protein thereof, or pro As the aqueous solution containing a protein encoded by motes the degradation of the gene or a protein thereof, and the hair shape Susceptibility gene, examples include an aque consequently decreases the amount of expression of the pro ous solution of CNIH2, YIF1A, ORAOV1 or KRTAP5-9, as tein. well as a tissue cell lysate, a nucleus extract, and cell culture Supernatant, which contain such a protein, and the like. The A Substance which increases the amount of expression of cell used herein may be a cell which expresses the hair shape the hair shape Susceptibility gene of the present invention Susceptibility gene of the present invention (for example, may be a substance which promotes the expression of or 10 CNIH2 gene, YIF1A gene, ORAOV1 gene, or KRTAP5-9 Suppresses the degradation of a mRNA complementary to the gene), and has a protein encoded by Such a gene as an expres polynucleotide constituting the gene, and a Substance which sion product. Specifically, a tissue or cell of a mammal, for increases the amount of expression of a protein encoded by example, the skin tissue, hair root area tissue (hair follicle the hair shape Susceptibility gene may be a Substance which tissue), epidermal keratinocytes, hair root area-derived cells, promotes the expression of the hair shape Susceptibility gene 15 an established epithelial cell line, and the like, all collected or a protein thereof, or Suppresses the degradation of the gene from a human being, can be used. The cell also includes a ora protein thereof, and consequently increases the amount of transformant which has been transformed with the hair shape expression of the protein. Susceptibility gene of the present invention (or an expression A Substance which increases the amount of expression of vector having the gene). Examples of host cells used in the the hair shape Susceptibility gene or a protein encoded by the transformation include well known cells such as Hela cell, gene, serves as a reducing or promoting agent for curly hair or COS cell, HEK293 cell, MDCK cell, CHO cell, and HL60 kinky hair. For example, a Substance which increases the cell. Furthermore, a cell fraction means one of various frac amount of expression of CNIH2 gene, YIF1A gene, tions derived from the cells described above, and includes, for ORAOV1 gene or KRTAP5-9 gene, or a protein encoded example, a cell membrane fraction, a cell cytoplasm fraction, thereby, can serve as an agent capable of reducing or improv 25 a cell nucleus fraction, and the like. ing curly hair or kinky hair, while a Substance which The activity of a protein encoded by the hair susceptibility gene of the present invention can be measured, for example, decreases the expression of such a gene or protein can serve as in the case of measuring the acetylcholine receptor activity or an agent capable of promoting curly hair or kinky hair, or a the phosphatidylserine binding ability, by known methods waving promoting agent. Furthermore, for example, a Sub Such as a binding assay, a co-immunoprecipitation method, a stance which increases the amount of expression of IVL gene 30 pulldown assay, a two-hybrid method (Y2H), a fluorescence or a protein encoded thereby, can serve as a promoting agent polarization method, and a time-resolved fluorescence reso for curly hair or kinky hair, or a waving promoting agent, nance energy transfer (TR-FRET) method (for example, while a Substance which decreases the expression of the gene Hiromitsu Nakauchi, Ed., “Immunological Protocol, or protein can serve as a reducing or improving agent for curly Yodosha Co., Ltd., 2004; Tadaomi Takenawa, Ed., “Optimal hair or kinky hair. Such a hair shape regulating agent can 35 Methods Clarifying Protein Interaction, Biotechnology function as a pharmaceutical product, a cosmetic product or Journal, Vol. 5, No. 6, Yodosha Co., Ltd., 2005). That is, the the like for an amelioration of curly hair or kinky hair, or for activity can be measured by immobilizing a protein encoded the promotion of waving of scalp hair, when administered to by a hair shape Susceptibility gene on a membrane or a plate a human being. using an aqueous solution containing the protein, and detect 3) Furthermore, the method for evaluating or selecting the 40 ing the amount of radioisotope-labeled acetylcholine orphos hair shape regulating agent of the present invention can be phatidylserine binding to the protein. A substance which Sup carried out by using the function (activity) of a protein presses (decreases) the function (activity) of the protein may encoded by the hair shape Susceptibility gene of the present be a substance which decreases the acetylcholine receptor invention as an indicator. activity or the phosphatidylserine binding ability, while a Examples of the function or activity of the protein include 45 Substance which enhances (increases) the function (activity) the acetylcholine receptor activity (Nguyen VT et al., J. Biol. of the protein may be a Substance which increases the acetyl Chem..., 275(38), p. 294.66-76, 2000), and phosphatidylserine choline receptor activity or the phosphatidylserine binding binding ability (Goebeler V et al., FEBS Lett. 546(2-3), p. ability. For example, a Substance which enhances the function 359-64, 2003). The amount of the protein and the function or (activity) of CNIH2, YIF1A, ORAOV1 or KRTAP5-9 can activity thereof have a certain correlation. Therefore, when 50 serve as an agent forameliorating curly hair or kinky hair, and the measurement of the function or activity of the protein a substance which Suppresses the function (activity) of such a described above is measured instead of the measurement of protein can serve as a waving promoting agent. the amount of the protein, an evaluation or selection of a hair shape regulating agent can be carried out. EXAMPLES Specifically, the evaluation or selection is carried out by the 55 following steps (a), (b) and (c). Hereinafter, the present invention will be described by way (a) a step for contacting a test Substance with an aqueous of Examples. Solution, tissue cells, or a cell fraction prepared from the tissue cells containing a protein encoded by the hair shape Example 1 Susceptibility gene of the present invention; 60 (b) a step of measuring the function or activity of the Definition of Hair Shape and Collection of Curly protein in the aqueous solution, tissue cells or cell fraction Hair Family Lines that has been contacted with the test Substance, and compar ing the function or activity with the function or activity of the In the present Example, an affected sib-pair linkage analy protein in a control aqueous Solution, control cells or control 65 sis and a case-control association analysis were carried out on cell fraction, which has not been contacted with the test a Japanese group, in order to identify the hair shape Suscep Substance; and tibility gene. US 9.255.264 B2 57 58 In general, hair shape varies with the human race, and the On the other hand, the phenotype is the hair shape is a people of the Asian race relatively more frequently have quantitative trait which can be continuously changed in a straight hair, while the people of the African race mainly have group, and it has been not established to which extent should kinky hair (or curled hair). A large proportion of the people of be determined as the curly hair trait or as the straight hair trait. the Indo-European race have a trait of wavy hair (wave hair) 5 In the present invention, among the classifications based on which is intermediate of the two. Since a Japanese group is a the actual states of hair shape, kinky hair, and curly hair or straight hair-dominant group, people having a curly hair trait strongly wavy hair are defined as the curly hair traits, and as the hair shape were defined as the affected (case), while the wavy hair, almost straight hair or slightly wavy hair, and straight hair trait was defined as the control (control). In a straight hair are defined as the Straight hair (non-curly hair) genetic analysis such as a linkage analysis, it is necessary to 10 traits. handle the object traits quantitatively to a certain extent, and AS Such, the phenotypes of hair shape could be accurately thus, for example, a method of binarizing the traits in Such a classified, but in regard to the collection of the objects of manner that curly hair=1 and straight hair-0, or a method of genetic analysis, the following problem to be solved emerged. measuring the degree of curly hair by a certain method, and 15 quantifying the degree were considered. However, in the cur That is, problems arise when the hair at the time point of rent situation, due to a variety of hair shapes of human being, collection is markedly short and it is impossible to evaluate the method for measurement or classification has not suffi the shape, and when the original hair shape has changed by ciently established. Thus, first, an accurate classification of permanent treatment, hair dyeing, and chemical treatments the phenotypes of hair shape was carried out. The hair shape by various styling agents. For this reason, all candidates who is defined by the overall feature of the hair and the degree of could become the objects of a genetic analysis were each curl (curl radius). Furthermore, factors defining the hair shape requested to Submit a photograph of the candidate himself include not only the curl characteristics of a single hair, but herself that was taken at a time when the phenotype of the hair also the synchrony of curl with the groups of hair in the shape could be discriminated (for example, childhood). That Surroundings. Thus, the phenotypes of hair shape were clas 25 is, it is a photograph of a hair state which is not a markedly sified as indicated in Table 4, based on the actual states of hair shape in various human races. This classification is applicable short hair and has not been subjected to a chemical treatment to various racial groups, including Japanese groups. Further of hair. At the same time, all of the candidates were requested more, FIG. 1 presents images of the phenotypes of hair shape. to submit several hair strands. The submitted hair strands 30 were subjected to a detailed shape evaluation of torsion or TABLE 4 kink of the hair, crimp, curl characteristics, and the like under water immersion conditions by which the effect of chemical Classification of phenotypes of hair shape treatment is lost. The objects of a genetic analysis were deter Type of hair 35 mined based on the evaluation of hair shape from the submit Feature Curl radius shape ted photographs of the candidates themselves, and the evalu Type 1 Hair which exhibits 9.5 cm or Straight hair ation of the shape of the submitted hair, and finally based on one curl in overall larger over an investigation of hair shape through interviews. even if the length of the entire the hair changes, or hair, or 3 cm 40 As such, it took about two years to collect curly hair family has one curl only at or larger only lines of 68 families with 283 members among 3000 or more the hair tips at the hair tip candidates applied from all over Japan. The specific details Smaller than Almost 9.5 cm over the straight hair, include 41 groups of two siblings, 22 groups of three siblings, entire hair, or slightly 4 groups of four siblings, and one group of five siblings, and or smaller wavy hair 45 100 pairs were defined as the final affected sib-pairs (brothers than 3 cm only or sisters having the curly hair trait). Since it was predicted at the hair tip Type 2 Hair which has 9.5 cm or Almost that this number of sib-pairs was sufficient to characterize the several repeated larger over straight hair, genetic locus in consideration of the strength of the genetic curls along the the entire or slightly factor and the risk in the siblings, it was decided to carry out length of the hair hair wavy hair 50 an affected sib-pair linkage analysis. with an inherent curl Equal to or Wavy hair radius, and has a curl larger of 3 cm In regard to the collection of specimens from the objects of period synchronizing and Smaller the genetic analysis, specimens were collected only when an with the hair in the than 9.5 cm approval was granted in advance by the ethics committee, Surroundings over the entire hair 55 Subsequently the person in charge of the implementation of Smaller than 3 cm Curly hair, or informed consent explained the contents of the study to the in the strongly wavy objects using a written explanation, and written consent was entire hair hair obtained. Type 3 Hair in which Kinky hair individual hairs have A doctor or a nurse collected about 20 mL of blood from finely repeated 60 each of the objects of the genetic analysis. The genomic DNA curls, and the curl was extracted from the blood specimen using PUREGENE period does not Genomic DNA Purification Kit (manufactured by Gentra synchronize with the Systems, Inc.) according to the manual. The genomic DNA hair in the Surroundings was dissolved in 2 mL of a DNA Hydration Solution, the 65 concentration was measured, and the Solution was stored at 4° C. The average yield of the genomic DNA was 576.2 g/20 ml of blood. US 9.255.264 B2 59 60 Example 2 significant linkage criteria as shown in the following Table 5. according to simulation results. Affected Sib-Pair Linkage Analysis on Entire Genome TABLE 5 In the present Example, an affected sib-pair linkage analy Suggestive Linkage P< 7.4 x 10' (Criteria for obtaining one LOD > 2.2 sis covering the entire genome was carried out for the first false positive linkage result over the entire genome) time on the Japanese curly hair family lines. To briefly Significant Linkage P< 2.2 x 10 describe the principle of this method, since siblings that are 10 (Criteria for obtaining 0.05 LOD > 3.6 false positive linkage results affected have inherited from their parents an allele causative over the entire genome) of a disease, the siblings necessarily share the allele. On the High Significant Linkage P< 3.0 x 107 (Criteria for obtaining 0.01 LOD > S.4 other hand, the number of alleles shared by brothers is 1 (a false positive linkage results value based on the null hypothesis). When many cases of 15 over the entire genome) allele sharing could be observed from the number of alleles based on the null hypothesis by examining the number of As a result of the Screening of whole chromosome, link alleles shared by many affected sib-pairs, it was determined ages were recognized on chromosome 1 and chromosome 11. that linkage was recognized. The results are respectively presented in FIG.2 and FIG.3. As The affected sib-pairlinkage analysis was carried out using shown in FIG.2, in chromosome 1, a maximum LOD score of a linkage mapping set (ABI PRISM Linkage Mapping Set 3.49 was obtained in the 1q21 to 1d23.1 region (near MD 10 v2.5) manufactured by Applied Biosystems, Inc. D1 S498), and a maximum LOD score of 3.13 was obtained in (ABI). This is a set of 400 fluorescent primers for typing in 25 the 1 q32 to 1d41 region (D1S249-D1S213). As shown in FIG. total, intended to amplify microsatellites, which are short 3, in chromosome 11, a maximum LOD score of 2.78 was repeating sequences rich in polymorphisms that are evenly obtained in the 11812 to 11q13.5 region (D11S905 to scattered in the genome, and the kit covers human chromo D11S937). The values thus obtained satisfied the criteria of Some at an average interval of 9.2 cm. 30 Suggestive Linkage defined by Lander and Kruglyak. There The genomic DNA prepared in Example 1 was used as a fore, the curly hair trait locus could be specified on chromo template, and PCR (GeneAmp PCR System 9700G, manu some 1 and chromosome 11, and it was strongly suggested factured by ABI) was carried out using a linkage mapping set. that hair shape Susceptibility genes exist in these regions. Detection of the amplification product (fragment) was carried 35 out using an ABI PRISM 3100 Genetic Analyzer (manufac Example 3 tured by ABI). The fluorescent primer set for typing includes Detailed Mapping in Candidate Regions primers labeled with three types of fluorescent dyes such as 6-FAM (blue), VIC (green) and NED (yellow), and therefore, Subsequently, chromosome 11 that where linkages was even with fragments of the same size, three types of colors can 40 recognized in Example 2 was Subjected to an affected sib-pair be separately discriminated. Accordingly, large amounts of linkage analysis (detailed mapping) by further using micro samples could be rapidly processed. satellite markers, for the purpose of narrowing the linkage The typing of the fragments was carried out by means of regions. GenotyperSoftware v3.7 (manufactured by ABI) and GeneS 45 The microsatellites used as a marker for the detailed map can Software (manufactured by ABI). ping were searched using Comprehensive human genetic A statistical test of the linkage was carried out using Gene maps of the Mammalian Genotyping Service (http://research hunter v2.1 r5 Software (Kruglyak, L. et al., Am. J. Hum. marshfieldclinic.org/genetics/GeneticResearch/compMap Genet., 58(6), 1347-1363, 1996), which is a non-parametric 50 S.asp). M which were present in the genome at an interval of analysis. Determination of the region where linkage is recog 1 to 2 cM and had high heterozygosity were selected. Fur nized was carried out according to the guidelines of Lander thermore, the fluorescent primers for typing, which were and Kruglyak (Nat. Genet., 11(3), 241-247, 1995) as intended to amplify the microsatellites, were designed based described below, based on the criteria for obtaining false 55 on the Genome Database Project (GDB) (http://www.gd positive linkage. b.org/). Here, although the GDB has terminated the operation, A linkage analysis came to be actively carried out over the currently retrieval and design can be carried out through the entire genome through the guidelines of Lander and Kruglyak NCBI (http://www.ncbi.nlm.nih.gov/). Fluorescent primers (polygenic diseases), but in a linkage analysis of individual 60 for typing manufactured by ABI were used, and for some of genes, the determination of whether the gene function can be the fluorescent primers for typing, those included in a linkage a cause of a disease, is also needed. However, in an analysis mapping set (ABI PRISM Linkage Mapping Set-HD 5 v2.5, over the entire genome, since the gene function is not taken manufactured by ABI) were used. The microsatellites used as into consideration at that stage, determination criteria 65 the markers for detailed mapping, and the fluorescent primers (threshold values) that are purely meaningful in terms of for typing are presented in Table 6 (see SEQ ID NO:6 to mathematical genetics are required. Thus, they have provided NO:33). US 9.255.264 B2 61 62 TABLE 6 Microsatellites used as markers for detailed mappinc, and fluorescent primers for typind Amplifi cation Loca- GenBank product tion Acces Heterozy- (fragment) ABI Microsatellite (cM) Sion go sity size Label Forward primer Reverse primer

MD10 AFM25429 D11S935 45.94 Z17148 O.73 196-208 6 - FAM

HD5 AFMa2.18xg 9 D11S4102 47.61 Z52543 O.76 142-174 6 - FAM AFM362toe D11S136O 50.88 Z24 611 O. 61 1 O3-117 6- FAM AGTGGTGTGCCGACAATCCAAATCAGGGCTTTCT (SEO ID NO : 6) (SEO ID NO : 7)

MD10 AFM105x1O D11S9 OS 51.95 Z16575 O.72 2O8 - 228 WIC ATA1BOf D11S1993 54. O9 GO8834 O.77 224 - 245 WIC GGACAGATGCTTCCAG. AGATTATGCATGTGTAAA AAAA GAGCC (SEQ ID NO: 8) (SEQ ID NO: 9) AFM255ye1 D11S986 56.76 Z21491 O.79 137-169 NED GAAGGACTCGGCTCCA GTAAGAGGATGGTAGGAG G GG (SEQ ID NO: 10) (SEQ ID NO: 11) AFM2.11xe1 D11S1313 58.4 O Z23 608 O.85 184-204 NED CTAAGCATGANGCCAA AGTTTGACATTAGGGAAT GTTA TTTGA (SEQ ID NO: 12) (SEQ ID NO: 13)

MD10 AFM338WC1 D11S41.91 6O. O9 Z51451 O.87 111-135 WIC AFM1652 c3 D11S1765 61.78 Z51. Of 6 O.79 234-252 6- FAM CAGAAATGCCACCCAGTTCCGGAGTTTGCACAAT AGAG CT (SEQ ID NO: 14) (SEQ ID NO: 15) AFMa356yg5 D11S4O76 62.62 Z53 015 O.77 151-163 NED CATGAATGCTCTTGTC AACCCCCTGGAAAATAGA CC CT (SEQ ID NO: 16) (SEQ ID NO: 17) AFMO39xg3 D11S1883 65. O5 Z50899 O.73 250-266 NED TTCAGTAACAGGAGAC TGGTTTCGGATCTCTTCT AAAAGG CA (SEQ ID NO: 18) (SEQ ID NO: 19)

MD10 AFMa131ye5 D11S987 67.48 Z21492 O 82 82-118 6 - FAM AFMa272yb5 D11S4113 68. O1 Z52723 O 8O 218-262 NED ACCTCACGGTGTAATC CTTGAAGCCCATCTTTGC CC (SEQ ID NO: 21) (SEQ ID NO: 2O) AFM289yag D11S1337 68.55 Z24 O8O O. 59 279-295 6- FAM AFMbO32zg5 D11S4136 71.60 Z53163 O 8O 18O-2O2 WIC GAATCGCTTGAACCCA. CCAGGTGGTCTTAACGG G (SEQ ID NO: 24) (SEQ ID NO: 25)

MD10 AFM212xe3 D11S1314 73 64 Z23617 O.76 2 O9-227 WIC AFMcO2Oyd5 D11S4184 75.3 O Z54O28 O 68 263-277 WIC CCCAGCCTTACATATT GCTGATGAGCAGAGGTA CC G (SEQ ID NO: 26) (SEQ ID NO: 27)

HD5 AFMa103.2f 9 D11S42Of 76.13 ZS2O3 O O. 89 254 - 288 6 - FAM AFM199yh10 D11S4128 77.78 Z51124 O.83 148-168 WIC AAGTTGCAGTGAGCCGTTCCAGCCCATTAACCT (SEQ ID NO: 28) (SEQ ID NO: 29)

MD10 AFM25 625 D11S937 79.98 Z1715.9 O. 88 23 O-264 6 - FAM AFMb334yc1 D11S4166 81.26 Z53689 O. 67 110-130 NED GGAAGGCACCATGATA GTGAAGTCTGGGATTTC CTTG AGC (SEQ ID NO: 30) (SEQ ID NO: 31) AFMb343yf5 D11S4172 82.57 Z53759 O 68 141-153 WIC CCAGCTCAAATGCTCATTATCAGCAACATGAAA TCAG ATGGAC (SEQ ID NO: 32) (SEQ ID NO: 33)

MD10 AFMO63yg1 D11S901 85.48 Z16505 O. 81 160-176 6 - FAM

The results obtained by carrying out an affected sib-pair 55 Example 4 linkage analysis (detailed mapping) on chromosome 11 in the same manner as in Example 2, are presented in FIG. 4. As Case-Control Association Analysis shown in FIG.4, a maximum LOD score of 2.81 was obtained d d hairsh bill f h in the 11q12.2 to 11q13.2 region (D11S4191 and D11S987). 60 In order to identifyfy a hairhairshap shape susceptibilitypt1b1lity ggene from the The values thus obtained were considered to satisfy the cri 11q12.2 to 11q13.2 region (D11S4191 and D11S987) on teria of Significant Linkage and Suggestive Linkage, respec chromosome 11, where strong linkage was recognized in ivelv, defined b d d lvak described i Example 3 above, a comparison of the allele frequency for the tively, defined by Lander an Kruglya as SC1)C 1 single nucleotide polymorphism (SNP) markers present in Example 2. Therefore, the curly hairtrait loci on chromosome 65 the region was made by a case-control association analysis. 11 could be narrowed, and it was strongly suggested that hair Since it is necessary that the cases (affected: those having shape Susceptibility genes exist in these regions. the curly hair trait) and the controls (control: those having the US 9.255.264 B2 63 64 straight hair trait) consist of people of the same race as the In SNP:rs 11227447 (single nucleotide polymorphism rep race for whom the hair shape Susceptibility gene is identified, resented by Nucleotide Number 189853 in the base sequence in the present invention, non-family related Japanese people set forth in SEQID NO: 2), the proportion of homozygous having the curly hair trait and non-family related Japanese C-allele carriers was higher in the people having the straight people having the straight hairtrait were employed as objects. hair trait as compared with the people having the curly hair Objects were collected in the same manner according to the trait (p=0.061), and even by the allele type, a significant criteria described in Example 1, and genomic DNA was difference was observed between the people having the obtained from each of 43 non-family related Japanese people straight hair trait and the people having the curly hair trait having the curly hair trait and 51 non-family related Japanese (p=0.055) (Table 7-4). people having the straight hair trait. 10 With reference to the dbSNP database (http://www.ncbi.n- In SNP: rs2282568 (single nucleotide polymorphism rep lm.nih.gov/SNP?) and the JSNP database (http://snp.ims.u- resented by Nucleotide Number 194405 in the base sequence tokyo.ac.jp/index ja.html), SNPs which represented certain set forth in SEQID NO: 2), the proportion of homozygous regions in the region to be analyzed, and had a gene frequency G-allele carriers was higher in the people having the straight of the minor allele of 10% or higher in a panel of Japanese 15 hair trait as compared with the people having the curly hair people, were selected as SNPs to be typed. Thus, 38 SNPs trait (p=0.061), and even by the allele type, a significant were selected from the region to be analyzed. difference was observed between the people having the The typing of SNPs was carried out according to a TaqMan straight hair trait and the people having the curly hair trait PCR method, using TaqMan SNP Genotyping Assays (manu (p=0.055) (Table 7-5). factured by ABI, formerly known as Assays-on-Demand or In SNP: rs3741367 (single nucleotide polymorphism rep Assays-by-Design). Furthermore, the apparatuses of Applied resented by Nucleotide Number 18280 in the base sequence Biosystems 7900HT Fast Real-time PCR System (manufac set forth in SEQ ID NO:3), the proportion of homozygous tured by ABI) and Applied Biosystems 7500 Real-time PCR T-allele carriers was higher in the people having the straight System (manufactured by ABI) were used. The method was hair trait as compared with the people having the curly hair carried out according to the respective manuals attached to 25 trait (p=0.051), and even by the allele type, a significant the apparatuses. difference was observed between the people having the The typing data thus obtained were totalized for each of the straight hair trait and the people having the curly hair trait cases and the controls, and a significant difference test was (p=0.063) (Table 7-6). carried out through a X test by four methods involving the In SNP: rs1789 165 (single nucleotide polymorphism rep genotype, allele type, dominant model and recessive model. 30 resented by Nucleotide Number 1 in the base sequence set That is, if any genetic variation is causative of changes in the forth in SEQID NO:4), the proportion of homozygous A-al hair shape, differences in the allele frequency and the like are lele carriers was higher in the people having the straight hair expected between the cases and the controls. Furthermore, in trait as compared with the people having the curly hair trait the present Example, since the association analysis was car (p=0.062) (Table 7-7). ried out on a relatively small number of objects, the signifi 35 These seven SNPs all satisfied the Hardy-Weinberg equi cance level was set at p-0.05. Further, in some part, the librium. Therefore, these seven SNPs were considered to be significance level was set to be loose (p<0.07) in order to hair shape susceptibility SNPs, and their relations with hair increase the power of the test. shape were confirmed. As a result, it was found that there is a statistically signifi cant (p<0.05) difference between the cases and the controls, 40 TABLE 7-1 for the two SNPs shown below. In SNP:rs3741368 (single nucleotide polymorphism rep Association analysis on SNP: rs3741368 resented by Nucleotide Number 18933 in the base sequence set forth in SEQ ID NO:3), the proportion of homozygous Allele type Genotype G-allele carriers was significantly higher in the people having 45 SNP: rs3741368 G A. GG GA AA the straight hair trait as compared with the people having the Curly hair trait 68.4% 31.6% 44.7% 47.4% 7.9% curly hair trait, and even by the allele type, a significant Straight hair trait 82.4% 17.6% 68.6% 27.5% 3.9% difference was observed between the people having the (control) straight hair trait and the people having the curly hair trait (Table 7-1). 50 p value Allele type O.O39 In SNP:rs2664 (single nucleotide polymorphism repre (x test) Genotype O.O76 sented by Nucleotide Number 17000 in the base sequence set GG vs GA, AA O.O24 forth in SEQID NO:5), the proportion of homozygous T-al lele carriers was significantly higher in the people having the straight hair trait as compared with the people having the 55 TABLE 7-2 curly hair trait (Table 7-2). Furthermore, it was found that even the five SNPs shown Association analysis on SNPrs2664 below exhibit a difference between the cases and the controls. Allele type Genotype In SNP:rs2276299 (single nucleotide polymorphism rep resented by Nucleotide Number 7633 in the base sequence set 60 SNP:rs2664 T C TT TC CC forth in SEQID NO:1), the proportion of homozygous T-al Curly hair trait 33.3% 66.7% 4.8% 57.1%. 38.1% lele carriers was higher in the people having the curly hairtrait Straight hair trait 41.0% 59.0% 20.0% 42.0%. 38.0% as compared with the people having the straight hair trait (control) p value Allele type O.285 (p=0.056), and even by the allele type, a significant difference (x test) Genotype 0.077 was observed between the people having the straight hair trait 65 TT vs TC, CC O.O31 and the people having the curly hair trait (p=0.058) (Table 7-3). US 9.255.264 B2 65 66 TABLE 7-3 TABLE 7-7-continued Association analysis on SNP:rs2276299 ASSociation analysis on SNPTS1789 165 Allele type Genotype Allele type Genotype SNP:rs178916S G A. GG GA AA SNP:S2276299 A. T AA AT TT p value Allele type O.138 Curly hair trait 61.6% 38.4% 41.9% 39.5%. 18.6% (X test) Genotype O.O88 Straight hair trait 74.5% 25.5% 54.9% 39.2% 5.9% GG, GA vs AA O.062 (control) 10 p value Allele type O.OS8 (X test) Genotype O.133 Example 5 AA, AT vs TT O.OS6 Haplotype Analysis 15 As a result of the analyses in Example 4, seven hair shape TABLE 7-4 susceptibility SNPs were found. Further, a haplotype analysis was carried out in order to found a correlation between hair Association analysis on SNPrs11227.447 shape and polymorphisms that are present in the Surrounding Allele type - Genotype regions of the SNPs, particularly those that have not been typed, and to identify hair shape Susceptibility genes. SNP:S11227.447 C G CC CG GG In the analysis, the linkage disequilibrium coefficient D' Curly hair trait 17.4% 82.6% O.0% 34.9%. 65.1% (pair-wise LD coefficient) based on the EM algorithm was Straight hair trait 29.4% 70.6% 7.8% 43.1%. 49.0% calculated using Haploview 4.1 Software (Barrett, J C, et al., (control) Bioinformatics, 21(2), 263-265, 2005), and the analysis was p value Allele type 0.055 25 carried out. A linkage disequilibrium analysis was carried out (X test) Genotype O.O89 on the SNPs found above and the SNPs present in the sur CC vs CG, GG O.061 rounding regions, using the HapMap PHASE data of the International HapMap Project Database (HapMap Data Rel 21/PhaseII July 06, on NCBI Build 35 assembly, dbSNP TABLE 7-5 30 b125). Meanwhile, the analysis panel consisted of JPT+CHB (Japanese people in Tokyo, Japan, and Chinese people of Han Association analysis on SNPTS2282508 race in Beijing, China). The method for inferring the haplotype block used the Allele type Genotype confidence interval (Gabriel, SB, et al., Science, 296 (5576), SNP: rs2282S68 C G CC CC GG 35 p. 2225-2229, 2002). That is, it can be considered that the haplotype blocks to be determined are mostly in the genome Curly hair trait 82.6% 17.4% 65.1% 34.9% 0.0% Straight hair trait 70.6% 29.4% 49.0% 43.1% 7.8% range where historical recombination has not been recog (control) nized, and strong linkage disequilibrium exists within the p value Allele type 0.055 regions. Usually, when the upper limit of the 95% confidence (X test) Genotype O.O89 40 interval of the linkage disequilibrium coefficient D' is lower CC, CG vs GG O.061 than 0.9, the region is considered as a region having an evi dence of historical recombination. On the other hand, when the upper limit of the 95% confidence interval of D' is higher TABLE 7-6 than 0.98 and the lower limit is higher than 0.7, the region can 45 be considered as a region where strong linkage disequilib ASSociation analysis on SNPTS3741367 rium exists. As a result, haplotype blocks of the following items (1) to Allele type Genotype (5) containing the seven hair shape susceptibility SNPs SNP: rs3741367 T C TT TC CC shown below were found. 50 (1) A 12,590-bp haplotype block ranging from SNP: Curly hair trait 70.9% 29.1% 48.8% 44.2% 7.0% Straight hair trait 82.4% 17.6% 68.6% 27.5% 3.9% rs 10792367 to SNP:rs 11231299 and containing SNP: (control) rs2276299, and represented by the base sequence set forth in p value Allele type O.036 SEQ ID NO:1 (FIG. 5). This haplotype block was a region (x test) Genotype O.149 containing SLC22A8 gene. From this result, SLC22A8 gene TT vs TC, CC O.OS1 55 was identified as a hair shape Susceptibility gene. (2) A 202,111-bp haplotype block ranging from SNP: rs 11227403 to SNP:rs3814738 containing SNP:rs 11227447, TABLE 7-7 and SNP:rs2282568, and represented by the base sequence set forth in SEQID NO:2 (FIG. 6). This haplotype block was Association analysis on SNPrs 1789 16s 60 a region containing PACS1 gene, KLC2 gene, RAB1B gene, Allele type Genotype CNIH2 gene, YIF1A gene, and MGC33486 gene. From this result, PACS1 gene, KLC2 gene, RAB1B gene, CNIH2 gene, SNP: rs178916S G A. GG GA AA YIF1A gene, and MGC33486 gene were identified as hair Curly hair trait 21.1% 78.9% O.0% 42.1% S7.9% shape Susceptibility genes. Straight hair trait 12.7% 87.3% 2.0% 21.6% 76.5% 65 (3) A 18, 933-bp haplotype block ranging from SNP: (control) rs531784 to SNP:rs3741368 containing SNP:rs3741367 and SNP:rs3741368, and represented by the base sequence set US 9.255.264 B2 67 68 forth in SEQID NO:3 (FIG. 7). This haplotype block was a (2) 202,111-bp haplotype block represented by the base region containing CD248 gene. From this result, CD248 gene sequence set forth in SEQ ID NO: 2: There were fourteen was identified as a hair shape Susceptibility gene. principal haplotypes in this haplotype block (Table 9-1 to (4) A 27.375-bp haplotype block ranging from SNP: Table 9-3). As SNP loci that are linked to a hair shape sus rs1789 165 to SNP:rs 1789170 containing SNP:rs 1789 165, and represented by the base sequence set forth in SEQ ID ceptibility SNP marker, SNP:rs 11227447 and SNP: NO:4 (FIG. 8). This haplotype block was a region containing rs2282568, which is additional 34 hair shape susceptibility ORAOV1 gene. From this result, ORAOV1 gene was identi SNP markers shown below were identified. fied as a hair shape Susceptibility gene. SNP:rs 11227403 (single nucleotide polymorphism repre (5) A 35,979-bp haplotype block ranging from SNP: 10 sented by Nucleotide Number 1 in the base sequence set forth rs7395845 to SNP:rs9651754 containing SNP:rs2664, and in SEQID NO:2), SNPrs11607393 (single nucleotide poly represented by the base sequence set forth in SEQID NO:5 morphism represented by Nucleotide Number 16722), SNP: (FIG. 9). This haplotype block was a region containing rs3825067 (single nucleotide polymorphism represented by KRTAP5-8 gene, KRTAP5-9 gene, and KRTAP5-10 gene. 15 Nucleotide Number 19992), SNP:rs11227411 (single nucle From this result, KRTAP5-8 gene, KRTAP5-9 gene, and otide polymorphism represented by Nucleotide Number KRTAP5-10 gene were identified as hair shape susceptibility 21051), SNP:rs 10896081 (single nucleotide polymorphism genes. represented by Nucleotide Number 21927), SNP:rs 11227413 (single nucleotide polymorphism represented by Nucleotide Example 6 Number 25269), SNP:rs 11227415 (single nucleotide poly morphism represented by Nucleotide Number 27032), SNP: Identification of Hair Shape Susceptibility SNP rs3862386 (single nucleotide polymorphism represented by Marker Nucleotide Number 35997), SNPrs9645684 (single nucle otide polymorphism represented by Nucleotide Number While haplotype blocks were found in the haplotype analy 25 49537), SNP:rs 10896085 (single nucleotide polymorphism sis in Example 5, a haplotype was extracted from each of the represented by Nucleotide Number 55405), SNP: rs918299 haplotype blocks using the same Haploview 4.1 Software (single nucleotide polymorphism represented by Nucleotide (Barrett, JC et al., Bioinformatics, 21 (2), 263-265, 2005). By Number 69180), SNP: rs7943911 (single nucleotide poly comparing the respective nucleotide combinations of the morphism represented by Nucleotide Number 84627), SNP: extracted haplotypes, that is, the SNP marker groups, SNP 30 rs2177054 (single nucleotide polymorphism represented by loci that were linked to the hair shape susceptibility SNP Nucleotide Number 86.185), SNP:rs10750778 (single nucle marker loci were identified. The SNP loci thus identified can otide polymorphism represented by Nucleotide Number be identified as additional hair shape susceptibility SNP 90221), SNP: rs659 1207 (single nucleotide polymorphism markers. represented by Nucleotide Number 91247), SNP:rs 10896091 As a result, additional hair shape susceptibility SNP mark 35 (single nucleotide polymorphism represented by Nucleotide ers shown below were respectively found in the haplotype Number 92398), SNP: rs7946917 (single nucleotide poly blocks of (1) to (5) shown in Example 4. morphism represented by Nucleotide Number 98.150), SNP: (1) 12,590-bp haplotype block represented by the base rs 10896094 (single nucleotide polymorphism represented by sequence set forth in SEQID NO:1: There were six principal 40 Nucleotide Number 100779), SNPrs7941431 (single nucle haplotypes in this haplotype block (Table 8). As the SNP loci otide polymorphism represented by Nucleotide Number that are linked to a hair shape susceptibility SNP marker, 101730), SNP:rs2293121 (single nucleotide polymorphism SNP:rs2276299, additional two hair shape susceptibility SNP represented by Nucleotide Number 102920), SNP: markers shown below were identified. rs 10791855 (single nucleotide polymorphism represented by SNP:rs 107.92367 (single nucleotide polymorphism repre 45 Nucleotide Number 105310), SNP:rs512421 (single nucle sented by Nucleotide Number 1 in the base sequence set forth otide polymorphism represented by Nucleotide Number in SEQ ID NO:1), and SNP:rs4149182 (single nucleotide 126741), SNP: rs2155201 (single nucleotide polymorphism polymorphism represented by Nucleotide Number 9315). represented by Nucleotide Number 133917), SNP:rs7925123 (single nucleotide polymorphism represented by Nucleotide TABLE 8 50 Number 134786), SNP:rs2236651 (single nucleotide poly Nucleotide morphism represented by Nucleotide Number 142991), SNP: number in rs223.6652 (single nucleotide polymorphism represented by base Nucleotide Number 144254), SNP:rs476551 (single nucle Sequence Hair shape set forth in Haplotype susceptibility otide polymorphism represented by Nucleotide Number 55 147896), SNP:rs10791861 (single nucleotide polymorphism SNP marker SEQ ID NO: 1 1 2 3 4 5 6 SNP represented by Nucleotide Number 150043), SNP:rs22.98466 rs10792367 1 C C G G. G. G. O (single nucleotide polymorphism represented by Nucleotide rS2187384 23.63 C C T C C C Number 152853), SNP:rs10791863 (single nucleotide poly rs953894 3624 C C T C T T morphism represented by Nucleotide Number 168931), SNP: rS1004836 3670 T T T T T C 60 rS11568491 4746 rs2155031 (single nucleotide polymorphism represented by rS2276299 7633 T A A A A. A O Nucleotide Number 172500), SNPrs2276036 (single nucle (Example 4) otide polymorphism represented by Nucleotide Number rs379.3961 7872 rS41491.82 93.15 C C G C G G O 175003), SNP:rs22.98468 (single nucleotide polymorphism rS11231299 12590 G. G. A. G. G. G. 65 represented by Nucleotide Number 184535), and SNP: rs3814738 (single nucleotide polymorphism represented by Nucleotide Number 202111).

US 9.255.264 B2 71 72 -continued

Nucleotide number in base Sequence Set forth in SEQ Haplotype Hair shape SNP marker ID NO: 2 1 2 3 4 S 6 7 8 9 10 1 1 12 13 14 susceptibility SNP rS10896.104 434.42 C C C T T T C T C C T T T rS2236652 44254 G. A. G. G. G. G. G. G. G. G. G. G. G. O rs476SS1 47896 G. C. G. G. G. G. G. G. G. G. G. G. G. O rS10791861 SOO43 G. A. G. G. G. G. G. G. G. G. G. G. G. O rS22.98466 52853 T C T T T T T T T T T T T O rS21551.98 55873 C T C C C C T C T C C C C rs10791863 68931 C T C C C C C C C C C C C O rS21SSO31 72500 C T C C C C C C C C C C C O rS474005 74874 C C C T T T C T C C T T T rS2276036 75003 C T C C C C C C C C C C C O rs3814739 77552 C T T T T T T T T C T T T rSS24859 82652 G. G. G. G. A. G. G. G. G. G. G. A. G. rS1151540 83380 A. A. A C C C A C A A C C C rS22.98468 84535 G. A. G. G. G. G. G. G. G. G. G. G. G. O rS11227.447 89853 G. C. G. G. G. G. G. G. G. G. G. G. G. O (Example 4) rS2282568 944OS C G C C C C C C C C C C G O (Example 4) rs556595 99655 T T G G G G T G G T G. G. G. rs3814738 202111 G T G. G. G. G. G. G. G. G. G. G. G. O

2 5 (3) 18,933-bp haplotype block represented by the base sequence set forth in SEQID NO:4), SNP:rs1192924 (single sequence set forth in SEQID NO:3: There were six principal nucleotide polymorphism represented by Nucleotide Num haplotypes in this haplotype block (Table 10). As a SNP locus ber 24512 in the base sequence set forth in SEQ ID NO:4), that is linked to hair shape susceptibility SNP markers, SNP: and SNP:rs 1789168 (single nucleotide polymorphism repre rs3741367 and SNP:rs3741368, additional one hair shape 30 sented by Nucleotide Number 26599 in the base sequence set susceptibility SNP marker shown below was identified. forth in SEQID NO:4). SNP:rs523583 (single nucleotide polymorphism repre sented by Nucleotide Number 5297 in the base sequence set TABLE 11 forth in SEQID NO:3). 35 Nucleotide number in TABLE 10 base sequence set Hair shape Nucleotide forth in SEQ Haplotype Susceptibility number in base 40 SNP marker ID NO: 4 1 2 3 4 SNP sequence set Hair shape forth in SEQ Haplotype Susceptibility rs178916S 1 A. G A. G O (Example 4) rs17891-67 4276 G A. G G SNP marker ID NO:3 1 2 3 4 S 6 SNP rS17891 64 7195 G C G G rs10796828 8378 G T G T O rS531,784 1 C T T T T C rs1789172 12624 T C T C O 45 rs47931.5 142 C G. G. G. G. C rS12284226 14644 rs493O3S1 1815 A. A. G. G. G. A rS6606651 16324 rs493O352 2144 G G T T T G rS12278346 16388 rSS23.583 5297 A. A C A A. A O rs4441044 18395 A. G A. A. rS1625595 1328O T T C C T C rS1210223 19530 C G G C rs3741367 1828O T T C T T T O (Example 4) rS1192921 2014.7 G C G C O rs3741368 18933 G G A G G G O (Example 4) 50 rS1192923 22.309 A. T A. T O rS1192924 24,512 T C T C O rs17891.68 26599 T C T C O (4) 27.375-bp haplotype block represented by the base rs178917O 27375 G A. G G sequence set forth in SEQID NO:4: There were four principal haplotypes in this haplotype block (Table 11). As SNP loci 55 (5) 35,979-bp haplotype block represented by base that are linked to a hair shape susceptibility SNP marker sequence set forth in SEQID NO:5: There were six principal SNP:rs1789 165, additional six hair shape susceptibility SNP haplotypes in this haplotype block (Table 12). As SNP loci markers shown below were identified. that are linked to a hair shape susceptibility SNP marker SNP:rs 10796828 (single nucleotide polymorphism repre SNP:rs2664, additional six hair shape susceptibility SNP sented by Nucleotide Number 8378 in the base sequence set 60 markers shown below were identified. forth in SEQ ID NO:4), SNP:rs 1789172 (single nucleotide SNP:rs793.4055 (single nucleotide polymorphism repre polymorphism represented by Nucleotide Number 12624 in sented by Nucleotide Number 18895 in the base sequence set the base sequence set forthin SEQID NO:4), SNP:rs 1192921 forth in SEQID NO:5), SNP:rs17363723 (single nucleotide (single nucleotide polymorphism represented by Nucleotide polymorphism represented by Nucleotide Number 26143 in Number 20147 in the base sequence set forth in SEQ ID 65 the base sequence set forth in SEQ ID NO:5), SNP: NO:4), SNP:rs 1192923 (single nucleotide polymorphism rs 11234174 (single nucleotide polymorphism represented by represented by Nucleotide Number 22309 in the base Nucleotide Number 26545 in the base sequence set forth in US 9.255.264 B2 73 74 SEQ ID NO:5), SNP:rs 10792781 (single nucleotide poly Example 7 morphism represented by Nucleotide Number 27090 in the base sequence set forth in SEQ ID NO:5), SNP:rs7107678 Analysis of Gene Expression in Scalp Hair Roots in (single nucleotide polymorphism represented by Nucleotide Curly Hair People and Straight Hair People Number 27751 in the base sequence set forth in SEQ ID NO:5), and SNP:rs7106362 (single nucleotide polymor Ten curly hair people and ten straight hair people were phism represented by Nucleotide Number 30274 in the base collected according to the classifications of Example 1, and an analysis was carried out on the expression of the hair shape sequence set forth in SEQID NO:5). Susceptibility gene in the scalp hair roots of each test Subject. 10 In regard to the collection of specimens from the test Subjects, Nucleotide an approval was granted in advance by the ethics committee, number in Subsequently the person in charge of the implementation of base sequence Hair shape informed consent explained the contents of the study to the set forth in Haplotype susceptibility objects using a written explanation, and written consent was 15 obtained. SNP marker SEQ ID NO:5 1 2 3 4 5 6 SNP About 60 scalp hair strands per person were pulled out Table 12-1 from all over the whole head of each test subject, and only those scalp hair root parts that were determined to be in the rsf395845 1 C A A A A. A growth period from the shape of the hair root part, were rS116.00364 329 T C C C C C rsf417OO 3851 G. A. A. A. A. A collected in a petri dish filled with ice-cooled PBS (manufac rS7926544 4100 A G. G. G. G. G. tured by Invitrogen, Inc.). Under a stereoscopic microscope rS11234O79 5311 G G T G G G and using forceps and a needle teeth, the outer hair root sheath rS11234.088 7947 G G T G G G and the inner hair rootsheath were removed from the hair root rS11234O92 8532 C C A A C C part as much as possible, and the hair root of the hair shaft rsf40512 8632 C T C C C T 25 only (hair shaft keratinized region) was separated and pre rs10736764 972O G. A. G. G. G. A rS10898276 9941 A G. G. G. A. G. pared. The hair shaft keratinized region was introduced in a rs1951558 O846 C T C C C T 1.5-mL tube containing 0.5 mL of an RNA extraction solu rsf33199 O978 C G C C C G tion, ISOGEN (manufactured by Nippon Gene Co., Ltd.), and rS11234102 1882 A C C C A C the tissue was sufficiently crushed with a mini codeless rS10898.28O 1898 C A C C C A 30 grinder and a homogenization pestle. 0.5 mL of ISOGEN and rs10792768 3485 T T A A T T rS10898.282 4329 A G. G. G. A. A 200ul of chloroform were added thereto, and the mixture was rS10751114 5755 G. A. A. A. G. G. sufficiently stirred in a vortex mixer and then was centrifuged rS76042O 6259 C C T C C C (15000 rpm, for 15 minutes) using a small-sized microcen rs10792769 6579 A A G G A A trifuge. Thus, about 500 uL of an aqueous phase containing rS2664 7000 C T C C C C O 35 RNA was collected. 50 uL of 3M sodium acetate and 1 uL of (Example 4) Ethachinmate (manufactured by Nippon Gene Co., Ltd.) rS2663 7053 A G. G. G. A. A rS2665 7105 T T A A T T were added to the collected solution, and the mixture was rs10792770 7605 T C C C T T sufficiently stirred. Furthermore, 1 mL of isopropanol was rsf35.8341 7835 G T T T G G added and stirred, and the mixture was centrifuged (15000 rs10792774 802O G G T T G G 40 rpm, for 20 minutes) with a small-sized microcentrifuge to rS11604725 84O7 T C C C T T precipitate total RNA. The supernatant was discarded, and rS10898.286 8762 C G. G. G. C C then 75% ethanol was added to the precipitate. The mixture rsf34OSS 8895 G T G. G. G. G. O rS41297.54 9446 C A A A C C was centrifuged again (15000 rpm, for 10 minutes) with a rs4129753 9708 G. A. A. A. G. G. Small-sized microcentrifuge. The Supernatant was discarded, rS79491.69 2013S T C C C T T 45 and the precipitate was dried in air and was dissolved in 20LL rs10792777 2O858 C T T T C C of Nuclease-free Water (manufactured by Invitrogen, Inc.). A rS10898.288 21495 A G. G. G. A. A portion of this was used to measure the RNA concentration rS10898.289 21527 T C C C T T using an absorption spectrometer (GeneQuant: manufactured rS10898.290 21678 C T T T C C rS11234149 21845 G T T T G G by Pharmacia AB, or Nono Drop: manufactured by Nanodrop rS11234150 21894 C C T T C C 50 Technologies, Inc.), or RiboGreen RNA Reagent and Kit rS10898.293 22901 T C C C T T (manufactured by Invitrogen, Inc.). cDNA was synthesized rs10792779 243OO G T T T G G from 1 lug of the total RNA thus obtained using QuantiTect rS11234164 2SO11 T C C T T T Reverse Transcription Kit (manufactured by Qiagen N.V.) rs17363672 2SO26 C G. G. C C C rs12790712 2S260 A G. G. G. A. A according to the attached protocol, and the cDNA was used in rs12792822 25276 G. A. A. A. G. G. 55 the quantification of the amount of gene expression by PCR. Table 12-2 The quantification of the amount of gene expression was carried out using TaqMan (registered trademark) Gene rs12798817 2S612 C T C T C C Expression Assays manufactured by Applied BioSystems, rs17363723 26143 A G A A A. A O Inc. (ABI). According to the attached protocol, the synthe rS11234174 26S45 G. A. G. G. G. G. O 60 sized cDNA, a primer & probe set specific to the gene to be rs10792781 27090 T C T T T T O rsf107678 27751 A G A A A. A O detected and quantified, a real-time PCR reagent and the like rS10898.297 28001 A. A. T A A. A (manufactured by ABI) were mixed, and fragments of the rsf106362 30274 C T C C C C O gene to be detected and quantified were amplified with rsf31369 35218 T C T C T T Applied Biosystems 7500 Real-Time PCRSystem (manufac rs9651754 35979 A T A T A A 65 tured by ABI). At this time, real-time PCR was carried out in the same manner using a known cDNA derived from a stan dard hair shaft keratinized region sample, and a calibration US 9.255.264 B2 75 76 curve was produced. Thus, standardization of the amount of After completion of the culture (Day 2), the medium was gene expression was carried out. Furthermore, standardiza removed by suction, the cells were washed two times with tion of the amount of expression of the gene to be detected and PBS (manufactured by Invitrogen, Inc.), and then 1 mL per quantified was carried out using GAPDH gene as an internal well of ISOGEN (manufactured by Nippon Gene Co., Ltd.) standard, and also employing KRT31 gene and KRT85 gene, was added to the cells. The cells were sufficiently lysed and which is recognized to be uniformly expressed in the sample mixed through pipetting, and the solution was collected in a hair shaft keratinized region, as internal standards. 1.5-mL tube. Total RNA was extracted by the same method as In order to detect and quantify the amount of expression of the method described in Example 7, and cDNA for use in the CNIH2 gene, Assay Number Hs00704421 s1 of TaqMan quantification of the amount of gene expression by PCR was Gene Expression Assays (manufactured by ABI) was used as 10 obtained. The quantification of the amount of expression of a specific primer & probe set. the hair shape Susceptibility gene was also carried out by the In order to detect and quantify the amount of expression of method described in Example 7. YIF1A gene, Assay Number Hs00610969 g1 of TaqMan In regard to the determination criteria for a Substance that Gene Expression Assays (manufactured by ABI) was used as regulates the amount of expression of a gene, for example, if a specific primer & probe set. 15 the amount of gene expression is higher by 10%, preferably In order to detect and quantify the amount of expression of 30%, and more preferably 50% or more, as compared with the ORAOV1 gene, Assay Number Hs004.11598 m1 of TaqMan control, the amount of expression is then said to be signifi Gene Expression Assays (manufactured by ABI) was used as cantly high, and the test Substance can be selected as an a specific primer & probe set. expression promoting agent for the hair shape Susceptibility In order to detect and quantify the amount of expression of gene. Furthermore, for example, if the amount of gene KRTAP5-91 gene, Assay Number Hs00534357 s1 of Taq expression is lower by 10%, preferably 30%, and more pref Man Gene Expression Assays (manufactured by ABI) was erably 50% or more, as compared with the control, the used as a specific primer & probe set. amount of expression is then said to be significantly low, and The amounts of expression of the hair shape susceptibility the test Substance can be selected as an expression Suppres genes in the scalp hair roots of the curly hair group and the 25 sant for the hair shape Susceptibility gene. straight hair group are presented in FIG. 10A to FIG. 10D. Approximately 700 kinds of plant extracts were evaluated From the results shown in FIG. 10, decreases in the amount of by the screening system described above, and a search was expression of CNIH2 gene, ORAOV1 gene and KRTAP5-9 made for Substances that regulate the amount of expression of gene were observed and an increase in the amount of expres the hair shape Susceptibility gene. As a result, expression sion of YIF1A gene was observed in the curly hair group, as 30 promoting agents and expressing agents for the genes were compared with the straight hairgroup. Therefore, it was made respectively found as indicated in Table 13. clear that CNIH2 gene, YIF1A gene, ORAOV1 gene and KRTAP5-9 gene are hair shape susceptibility genes serving as TABLE 13 indicators for the evaluation of hair shape, and the measure ment of the amounts of expression of these genes in the hair 35 Substances that regulate the amounts of expression of the root area is valuable. hair shape susceptibility genes Example 8 Name of plant extract Amount of CNIH2 gene expression Screening of Substance Regulating Amount of 40 Expression of Hair Shape Susceptibility Gene (relative to control as 1) Expression Aristolochia 3.08 Normal human neonatal foreskin epidermal keratinocytes promoting manshuiriensis Kom. (stem agent extract) (KK-4009, manufactured by Kurabo Industries, Ltd.) were Asclepias cuirassavica 2.31 used in the screening. Normal human neonatal foreskin epi 45 (root extract) dermal keratinocytes in a frozen state were melted, and then Ipomoea purpurea 1.81 the cells were seeded in a 75-cm flask or a 25-cm flaskata (morning glory) (seed extract density of 2500 cells/cm. The cells were cultured in a serum Expression Raphantis sativits O.48 free medium for human keratinocyte culture (Defined Kera Suppressing (seed extract) tinocyte-SFM, manufactured by Invitrogen, Inc.) containing 50 agent Aster tatarictis (root O.33 extract) added supplements, under the conditions of 37° C. and a CO Agastache rigosa (whole O.20 concentration of 5%. The cells were subcultured at the time plant extract) point at which the cells reached a sub-confluent state, and the Amount of YIF1A gene cells were seeded in a 6-well plate at a cell density of 2500 expression cells/cm. At the time point at which the cells had reached a 55 (relative to control as 1) Sub-confluent state (Day 0), the medium was exchanged to a Expression Hydnocarpus 2.80 serum-free medium for human keratinocyte culture contain promoting anthelmintica (seed ing no Supplements, and the cells on Day 1 were used as the agent extract) cells for screening. Rosa rugosa (flower 2.36 extract) To the medium (serum-free medium for human kerati 60 Sassafras albidum (bark 1.92 nocyte culture containing no Supplements) for the cells for extract)) screening prepared as described above, a plant extract was Expression Anomain cardamomum O.70 added to a final concentration of 0.1% or 1%, and the cells Suppressing (round cardamom) (seed extract) were cultured for 24 hours under the conditions of 37° C. and agent Forsythia suspensa O.S2 (fruit extract) a CO concentration of 5%. Furthermore, as control, 50% 65 Ligustrain robustain (leaf O.45 ethanol (control) was similarly added to a final concentration extract) of 0.1% or 1%, and the cells were cultured. US 9.255.264 B2 77 78 TABLE 13-continued Example 9 Substances that regulate the amounts of expression of the Evaluation of Form of Hair Follicle Through Culture hair shape susceptibility genes of Human Hair Follicle Organ Name of plant extract 5 As a method for evaluating the hair shape and the form of Amount of ORAOV1 gene expression the hair follicle, an investigation was conducted on an evalu ation method based on the culture of the human hair follicle (relative to control as 1) organ. The scalp tissues of the temporal region or the occipital Expression Benthamidia florida 2.66 10 region of men and women in the age of 30's to 80’s, which had promoting (bark extract) agent Solidago virgatirea 186 been excised by cosmetic plastic Surgery and became unnec (whole plant extract) essary, were obtained and used in the experiment. Mean Amonum cardamomum 1.41 while, in regard to the collection of specimens, an approval (round cardamom) (seed extract) was granted in advance by the ethics committee, Subse Expression Hibiscus rosa-sinensis O.S3 15 Suppressing (flower extract) quently the Surgeon explained the contents of the study to the agent Thamnoia vermicularis O.39 objects using a written explanation, and written consent was (thallus extract) obtained. Steilera chanaeiasme O.25 The human scalp tissue thus obtained was recovered in a (root extract) petri dish filled with Williams' E medium (manufactured by Sigma-Aldrich Company) containing 1% of antibiotic/anti fungal agents (manufactured by Invitrogen, Inc.). The hair follicles were aseptically isolated one by one under a stereo Reference Example scopic microscope and using forceps and a scalpel or a needle teeth. The isolated hair follicles were separated from the Relations Between Hair Shape and Form of Hair 25 epidermal tissue at the position of the lower part of the seba Follicle ceous gland, and any extra connective tissue, adipocytes and the like attached to the lower part of the hair follicle, were removed as much as possible. The isolated hair follicles thus In general, the hair shape varies with the human races, and prepared were transferred, one hair follicle per well, onto a the people of the Asian race relatively more frequently have 30 24-well plate to which Williams’ E medium (manufactured straight hair, while the people of the African race mainly have by Sigma-Aldrich Company) containing 400 uL of 10 ug/mL kinky hair (or curled hair). A large proportion of the people of insulin (manufactured by Invitrogen, Inc.), 40 ng/mL of the Indo-European race have a trait of wavy hair (wave hair) hydrocortisone (manufactured by Sigma-Aldrich Company), which is intermediate of the two. As a feature related to such 2 mM L-glutamine (manufactured by Invitrogen, Inc.), and variation of hair shape, the form of the hair follicle at the hair 35 1% antibiotic/antifungal agents (manufactured by Invitrogen, root part may be mentioned. That is, if the form of the hair Inc.) had been added, and culture was initiated. The culture follicle is curved, the hair is curved, and if the form of the hair was carried out in the manner of suspension culture, under the follicle is straight, the hair is straight (Thibaut, S. at al., Br. J. conditions of 37° C. and a CO concentration of 5%. There Dermatol., 152(4), p. 632-638, 2005). after, the medium was exchanged at an interval of 2 to 3 days, 40 and at the same time, photographs of the hair follicles were In order to investigate the relations between the hair shape taken. and the form of the hair follicle in more detail, tissue speci The photographs of the change in the form of the hair mens of hair follicle were produced from the human scalp follicle during culturing days are presented in FIG. 12. The tissues of various races, and the form of the hair follicle was hair shaft in the hair follicle grew with the progress of the observed. Meanwhile, in regard to the collection of speci- as culture, and thereby elongated. Furthermore, along with the mens from the test Subjects, an approval was granted in progress of the culture, it was observed that the hair follicle advance by the ethics committee, Subsequently the person in was straight (straight hair) after one day from the initiation of charge of the implementation of informed consent explained culture (Day 1), but the hair follicle (hair shaft) was gradually the contents of the study to the objects using a written expla curved with the culturing days. nation, and written consent was obtained. The collected hair so In order to quantify the degree of curvature of the hair follicles were frozen after being embedded in Tissue-Tek follicle (hair shaft), the ratio of end-to-end distance was cal OCT Compound (manufactured by Miles Laboratories, Inc.), culated. The ratio of end-to-end distance is one of the indices which is an embedding medium for frozen tissue section representing the degree of curl, and can be determined by the preparation, and frozen section specimens were produced following calculation (Hrdy, D., Am. J. Phys. Anthropol. according to a standard method. Subsequently, the specimens ss 39(1), p. 7-17, 1973). were subjected to HE staining, and were observed with a Straight length between the ends of the object (hair, hair microscope. follicle)/curve length along the axis of the object (hair or hair FIG. 11 presents images of the hair follicle tissue of various follicle) human races. As can be seen from the results shown in FIG. That is, according to the formula shown above, the ratio of 11, the hair follicle of an Asian person having straight hair 60 end-to-end distance represents a value between 0 and 1. So was straight, while the hair follicle of a Caucasian person that a straight object gives a value close to 1, and an object having wavy hair was bent only at the lowermost part of the with a large degree of curvature gives a value close to Zero (0). hair root. Furthermore, in the case of an Afro-American hav The photographs of the hair follicles shown in FIG. 12 were ing curled hair, it was found that the entire hair follicle tissue analyzed using an image analyzing Software (Nexus was curved. Therefore, it could be confirmed that the hair 65 NewOube Ver, 4.23, manufactured by IMAX Systems, Inc.), shape and the form of the hair follicle were closely related to and the length of the hair follicle (hair shaft) and the ratio of each other. end-to-end distance were determined (Table 14). US 9.255.264 B2 79 80 As a result, it could be confirmed that the hair follicle (hair Example 10 shaft) elongated with the culturing days, and at the same time, the hair follicle was gradually being curved. Therefore, it was Evaluation of an Agent of Regulating the Expression found that when this evaluation system is used, search for an of Hair Shape Susceptibility Gene Regulating Agent agent for curling of hair, or a curly hair ameliorating agent 5 Based on Human Hair Follicle Organ Culture (hair straightening agent) can be conducted. That is, a test For the purpose of Verifying the effect of an agent of regu Substance is added to the evaluation system of human hair lating the expression of hair shape Susceptibility gene on the follicle organ culture, the hair follicle organ is cultured, and form of the hair follicle, an evaluation was conducted using the ratio of end-to-end distance of the hair follicle (hair shaft) the evaluation system of human hair follicle organ culture. which has elongated to a certain length is measured. When the " The human hair follicle was prepared according to hair follicle is cultured in the presence of a test substance, if Example 9. The isolated hair follicles were divided into two the ratio of end-to-end distance becomes Smaller as compared groups, with 12 hair strands in each group, so that there was with a control cultured without adding the test substance, the no fluctuation in the size. One of the groups was suspension test substance can be selected as a hair curling agent. When is cultured for 15 days in a medium fororgan culture (400 LL) to the hair follicle- is cultured in the presence of a test substance, which a morning glory extract, which is an expression pro if the ratio of end-to-end dist b 1 moting agent for CNIH2 gene as described in Table 13, was II uneratio oI end-to-ena distance becomes larger as com- added at a final concentration of 0.2%. The other group was pared with a control cultured without adding the test sub- Suspension cultured for 15 days in a medium for organ culture stance, the test Substance can be selected as a curly hair (400 uL) to which 50% EtOH (a final concentration of 0.831) ameliorating agent (hair straightening agent). 20 was added, as a control. According to the same procedure, a group added with an round cardamom extract (final concen TABLE 1.4 tration 0.2%), which is a YIF1A gene9. expressionp suppressantpp and an expression promoting agent for ORAOV1 gene as Changes in the length of hair follicle (hair shaft) and the ratio described- - - 1n- Table 3, and a control group (50 O% EtOH, final fend d di in the hair follicle during culturi as concentration 0.83%) were prepared (n=12 for each group). of end-to-end distance in the hair follicle during culturing After the initiation of culture, the medium was exchanged at an interval of 2 to 3 days, and at the same time, photographs Culturing days Length of hair follicle Ratio of the hair follicles were taken. From the images of hair (day) (mm) of end-to-end distance follicles thus taken, the degree of elongation and the degree of curvature (ratio of end-to-end distance) of the hair follicles 1 3.465 1.OOS were respectively measured. 3 4.419 1.OO2 At the time point at which the length of the hair follicle 6 sing 0.99, (hair shaft) elongated by 1.5 mm or more as compared with the length at the initiation of culture, the ratio of end-to-end 8 6.748 O.988 distance of the hair follicle (hair shaft) was measured. As a 10 7.571 0.973 35 result, it was found that the morning glory extract and the 12 8.131 O.958 round cardamom extract significantly increase the ratio of 14 8.758 O.901 end-to-end distance, which indicates the degree of curvature 16 9.433 O.82S of the hair follicle (hair shaft), as compared with the 50% EtOH-added control (FIG. 13). From these results, it could be 18 9.720 O.818 40 seen that an agent of regulating the expression of hair shape Susceptibility gene expression can be selected as a curly hair ameliorating agent (hair straightening agent) for the hair.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 45

<21 Os SEQ ID NO 1 &211s LENGTH: 1259 O &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs SEQUENCE: 1 Ctttggittac aaggagcagc ccatcaagtt agct taalaca gaaaggggala tittatttgga 60

gaatt Caggg at atttaata galacc.ccggg gtaaaaag.cg catcCagggc tigatgaggaa 12O cc.gagacct g gaatt catta agaac cagtg gaagttcgcct caccagctct ttittatctgg 18O

gcc catgtgg to tcttgttc. tc.tttittctic tigtgtgtctg cct tattot c ttgctgcaac 24 O tggctttctic togctictatot goatctgggc cagoctagoc to atgctaac ct gcct tcc.c 3 OO

agggcaagga caaagagatg gataagaac C. tcttaagat C to aaatcct a gcc.caggaga 360 gag tatgtga taaatgagat ttggatctgg agtgccCtgt ggtctagttg gt caccacca 42O

gagatggcag attatggaac tgttcagttg gcagatt CC9 gggatgcaga to cittagaaa 48O

US 9.255.264 B2 93 94 - Continued aagat cagat agttgtagat atgcggcgtt atttctgagg gct ctgttct gttcCattga 1920 tctatat citc tdtttgg tac catgctgttt cqgttactgt agc cittatag tatagitttga 198O agtic aggtag cqtgatgcct C cagotttgt t cttittggct taggattgac ttggtgatgc 2O4. O ggg.cccttitt ttggttc.cat atgaactitta aagtagttitt titcca attct gtgaagaaag 21OO t cattggtag Cttgatgggg atggcattga atctataaat taccttgggc agtatggc.ca 216 O ttitt cacgat attgattctt cot acccatg agcatggaat gttcttctat ttgtttgtat 222 O cct cittitt at tt cattgagc agtggitttgt agttctic citt gaagaggtoc titcacgt.ccc 228O gtgtaagttggatticcitagg tataaagagt caaga cc cat Cagtgtgctg. tatt caggaa 234 O acccatctica C9tgcagaga cacacatagg Ctcaaaataa aaggatggag galagatctac 24 OO Caagcaaatg gaaaacaaaa aaaggcaggg gttgcaatcc tagt ct ctga taaaacagac 246 O tittaalaccala caaagatcaa aagagacaaa gaaggc.catt acataatggit aaagggat.ca 252O attcaacaag aagagctaac tat cotaaat atatatgcac ccaatacagg agcacccaga 2580 tt cataaag.c aagttcc tdag tdaccitacaa agagacittag act cocacac aataataatg 264 O ggagactitta acaccc cact gtcaa.catta gacagat caa caagatagaa agittaacaag 27 OO gatacc cagg aattgaactic accitctgcac caag.cgg acc taataga cat citacagaact 276 O citccaccc.ca aat caacaga atata cattt ttitt cagcac cacaccacac ctatt coaaa 282O attgaccaca tagttggaag taaagct citc ct cagoaaat gtaaaagat c agacattata 288O acaaactgtc. tct cagacca cattgcaatc aaact agaac toaggattaa gaatctoact 294 O Caaaac Cact Caactacatg gaalactgaac aacct gctCC tigaatgact a Ctggg tacat 3 OOO aacaaaatga aggcagaaat aaagatgttc tittgaaacca acgagaacaa agacacaiaca 3 O 6 O taccagaatc. tctgggacgc attcaaag.ca gtgtgtagag ggaaattitat agcactaaat 312 O gcc cacaaga gaaagcaggg aagat coaaa attgacaccc talacat caca attaaaagaa 318O

Ctagaaaagc aagagcaaac acattcaaaa got agcagaa ggcaagaaat alactaaaatc 324 O agagcagaac talaggaaat agaga cacaa aaaac ccttic aaaaattaat gaatcCagga 33 OO gctggitttitt taaaggat.c aacaaaattig at aga.ccgct agcaagacta ataaagaaaa 3360 aaagagagaa gaatcaaata gacgcaataa aaaatgataa aggggatatic accaccgatc 342O ccacagaaat acaaact acc atcagagaat act acaaaca cct citacgca aataaac tag 3480 aaaatctaga agaaatggat aaatticct cq acacatacac cct cocaaga ctaaaccagg 354 O aagaagttga atctotgaat agaccaataa caggctctgaaattgttggca ataat caata 36OO gcttaccaac caaaaagagt ccagtaccag atggatt cac agctgaattic taccagaggit 366 O acaaggagga actggtacca ttcCttctga aactatt coa at Caacagala aaggagggaa 372 O t cct coctaa ct catttitat gaggc.cagca to atcctgat accaaag.ccg ggcagagaca 378 O caac caaaaa agagaattitt agaccaatat cottgatgaa catcgatgca aaaatcc to a 384 O ataaaatact ggcaaacca atc.ca.gcago a catccaaaa gctitatic cac catgat caag 3900 tgggctt cat coctdggatg caaggctggit toaatataca caaat caata aatgtaatcc 396 O agcatataaa cagaac caaa gacaaaaacc acatgattat citcaatagat gcagaaaagg 4 O2O c ctittgacaa aattcaacaa ccctt catgc taaaaact ct caataaatta gg tattgatg 4 O8O ggacgitat ct caaaataata agagctat ct atgacaaacc cacagccaat at catactga 414 O atgggcaaaa actggaag catt CCCtttga aaactgg cat aagacaggga tigCCCtctict 42OO

Caccactic ct attcaa.cata gtgttggaag ttctggc.cag ggcaattagg Caggaga agg 426 O