Genome Editing of Mesenchymal Stem/Stromal Cells (Mscs) by CRISPR/Cas9 Technology for Azurin-Based Anticancer Therapies

Genome editing of Mesenchymal Stem/Stromal Cells (MSCs) by CRISPR/Cas9 technology for azurin-based anticancer therapies

Andreia Filipa Dias Almeida

Dissertation to obtain the Master of Science Degree in

Biomedical Engineering

Supervisors:

Doctor Evguenia Bekman

Doctor Nuno Filipe Santos Bernardes

Examination Committee

Chairperson: Professor Cláudia Alexandra Martins Lobato da Silva

Supervisor: Doctor Evguenia Bekman

Member of the Committee: Professor Leonilde de Fátima Morais Moreira

November 2017

It is not the strongest of the species that survive, nor the most intelligent, but the one more responsive to change. Charles Darwin

If we knew what it was we were doing, it would not be called research, would it? Albert Einstein

The most incomprehensible thing about the world is that it is at all comprehensible. Albert Einstein

The harder you work the luckier you get. Gary Player

Acknowledgments First of all, I thank my parents and my brother for all the support, values, patience, confidence and encouragement that allowed me to achieve the end of this stage. Without them, nothing would be possible. I thank my family and my old friends who were always present and believed in me. I thank my housemate friends for all the shared moments and for never letting me give up. I thank the friends that lab gave me for all assistance and support during this work. I am sincerely grateful to my supervisors Doctor Nuno Bernardes and Doctor Evguenia Bekman for the all support, unmeasurable advices, motivation, a lot of patience, and all the knowledge that helped me overcome the immense difficulties that happened during this work. They were the literal guides of this path. I thank Professor Arsénio Fialho and Professor Isabel Sá-Correia, Professor Joaquim Cabral and Professor Cláudia Lobato da Silva, and Professor Maria do Carmo Fonseca for allowing me to attend the laboratories of BSRG, TagusPark, and iMM, respectively.

Thank you all who somehow contributed to making this thesis possible.

iii

Abstract The conventional systemic therapies applied in cancer treatments cause several side effects in patients. Therefore, more specific targeted therapies are in need to a more safe and precise treatment. MSCs present the ability to be vehicles for drug delivery to the tumour sites due to their unique immunomodulation and migration potential towards tumours. Azurin is a bacterial protein produced by Pseudomonas aeruginosa that has been strongly explored considering its antitumoral activity. Thus, the strategy of the present work includes the genetic edition of MSCs to establish these as potential carriers of azurin into tumoral sites. The initial steps of this strategy were performed in this work, namely the design and test of four gRNAs to produce DSBs in a genomic safe harbour, the first intron of PPP1R12C gene, and the design of a donor template that will allow the incorporation of the azurin encoding sequence into this locus via CRISPR/Cas9 mechanism through homology repair. The guides were designed using bioinformatics tools and chosen considering the lower number and site of off-targets in exonic regions and the higher score between all. The efficiency in HEK293T cells was assessed with the GeneArt™ Genomic Cleavage Detection Kit (Invitrogen™). Of the guides tested, two were successful in producing the desired cuts with efficiencies of 2.72 and 3.00. Concerning to the construction of donor template, all parts were obtained, being that the next steps are the ligations between them to produce a donor template capable of repairing the DSB in future experiments using MSCs.

Keywords: Mesenchymal Stem/Stromal Cells; Azurin; Anticancer therapies; Genome editing; CRISPR/Cas9 mechanism; Homology direct-Repair.

Resumo As terapias sistémicas convencionais aplicadas em oncologia causam diversos efeitos secundários. Por isso são necessárias terapias localizadas mais específicas de forma a permitir um tratamento mais seguro e preciso. As Células Estaminais do Mesênquima (CEMs) apresentam características que lhes permitem serem veículos de entrega de fármacos dirigidos aos locais tumorais, devido ao seu potencial imunomodulatório e de migração em direção aos tumores. A azurina é uma proteína bacteriana produzida por Pseudomonas aeruginosa que tem sido explorada como agente antitumoral. A estratégia deste trabalho visa a edição genética das CEMs a fim destas transportarem a azurina para o microambiente tumoral. Os passos iniciais desta estratégia foram realizados neste trabalho, nomeadamente o desenho e o teste de quatro gRNAs, para produzirem cortes na cadeia dupla de DNA num local genómico seguro, o primeiro intrão do gene PPP1R12C, e o desenho de um template dador para a incorporação de uma sequência codificante da azurina através do mecanismo CRISPR/Cas9, por homologia. O desenho das guides foi feito com recurso a ferramentas bioinformáticas, considerando o menor número e a localização de off-targets em regiões exónicas e os scores mais elevados. A taxa de eficiência de clivagem foi avaliada em células HEK293T recorrendo a kits comerciais. Das guides testadas, em duas verificou-se corte com eficiências de 2.72 e 3.00. Relativamente à construção do template dador, foram amplificadas todas as partes, sendo que os próximos passos são as ligações entre elas para originar o template que permita fazer a reparação dos cortes em futuras experiências em CEMs.

Palavras-chave: Células Estaminais do Mesênquima; Azurina; Terapias anticancerígenas; Edição do genoma; Mecanismo CRISPR/Cas9; Reparação por Homologia direta.

Table of Contents

Acknowledgments ...... iii Abstract ...... iv Resumo...... v Table of Contents ...... vi List of Tables ...... viii List of Figures ...... ix List of Abbreviations ...... xii 1. Introduction ...... 1 1.1 Cancer ...... 1 1.2 Mesenchymal Stem/Stromal Cells (MSCs) ...... 1 1.2.1 MSCs and Cancer ...... 2 1.3 Azurin ...... 3 1.3.1 Azurin and Cancer ...... 3 1.4 Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) ...... 4 1.4.1 Alternatives to CRISPR ...... 10 1.4.2 CRISPR: applications and challenges for gene-based therapies ...... 11 1.4.2.1 Therapeutic applications of genome editing using stem cells ...... 14 2. Motivation and Workflow ...... 18 3. Materials and Methods ...... 19 3.1 Cell Culture ...... 19 3.2 Western Blot ...... 19 3.3 DNA purification ...... 20 3.3.1 Genomic DNA ...... 20 3.3.2 Plasmid DNA ...... 20 3.3.3 PCR products ...... 20 3.4 Guide design, cloning and testing ...... 20 3.4.1 Guide Design ...... 20 3.4.2 Guide Cloning ...... 21 3.4.3 Cleavage efficiency test of the guides ...... 22 3.4.3.1 HEK293T cells ...... 22 3.4.3.2 MSCs ...... 23 3.5 Cloning into pBluescript II KS plasmid (pKS) ...... 24 3.6 PCR Amplification ...... 24 3.6.1 Fragments Amplification by PCR ...... 24 3.6.2 PCR ligation ...... 27 4. Results ...... 29 4.1 Selection of an appropriate MSCs donor for genome editing for anticancer proposes ...... 29

4.2 Cas9 Guide construction and test ...... 33 4.2.1 Bioinformatic Design ...... 34 4.2.2 Cloning of double-strand guide oligonucleotides into pX459 vector ...... 35 4.2.3 Cas9 Cleavage efficiency test ...... 35 HEK293T cells ...... 35 MSCs ...... 37 4.3 Donor Template ...... 39 4.3.1 Construction of the parts of donor template ...... 39 4.3.2 PCR Ligations ...... 43 5. Discussion...... 47 6. Conclusion ...... 50 7. Current Challenges and Future Perspectives ...... 50 References ...... 51 Appendix ...... 58 1. Antibodies ...... 58 2. Donor template sequence ...... 58 3. Agarose gel electrophoresis of PCR products correspondent to hAzurin I, hAzurin, hAzurin II, and eGFP+SV40polyA ...... 59 4. pCAG-SpCas9-GFP-U6-gRNA plasmid ...... 60

vii

List of Tables

Table 1 Comparison of different programmable nucleases [55]. ZFN - zinc finger nuclease; TALEN - transcription activator-like effector nuclease; CRISPR - clustered regularly interspaced short palindromic repeats...... 11 Table 2 Guide sequences with BbsI linkers for cloning into px459 plasmid...... 21 Table 3 Primers used in Guides’ Cleavage efficiency test...... 22 Table 4 PCR conditions to verify the amplification of the regions of interest...... 23 Table 5 Primers used to amplify the fragments of donor template...... 25 Table 6 Size of the amplified fragments to donor construction...... 25 Table 7 PCR conditions to amplify the promoter sequence of IL6 gene with NZYLong DNA Polymerase...... 25 Table 8 PCR conditions to amplify the promoter sequence of IL6 gene, hAzurin and eGFP+SV40polyA with Phusion High-Fidelity DNA Polymerase...... 26 Table 9 PCR conditions to amplify the Homology Arms with KAPA2G Fast HotStart ReadyMix PCR Kit...... 27 Table 10 Primers used to amplify the ligations between fragments of donor template (see Table 5). . 27 Table 11 Primers used to amplify the ligation between Ligation II and 3’HA (see Table 5)...... 28 Table 12 PCR conditions to amplify the ligation between Ligation II and 3’HA with Xpert HighFidelity DNA Polymerase...... 28 Table 13 Cas9 guides used in this work with respective sequence and PAM...... 34 Table 14 Number of exonic off-targets sites and score value for four guides tested in this work, obtained from three different bioinformatics tools (WGE, CRISPOR, and CRISPR Design)...... 34 Table 15 Exonic off-target genes for the four guides tested in this work, obtained from three different bioinformatics tools (WGE, CRISPOR, and CRISPR Design) verified in NCBI (https://www.ncbi.nlm.nih.gov/)...... 34 Table 16 MSCs sensibility to puromycin. Initial density at day 0 of 4000 cells/cm2. 25-50% of confluence at day 1. Green: cells presented a confluence equal to or greater than the initial; Yellow: some cells died; Orange: mostly cells died; Brown: almost all cells died; Red: all cells died...... 38 Table 17 Antibodies employed in this work...... 58 Table 18 Primers used to amplify the hAzurin I and hAzurin II fragments...... 60

viii

List of Figures Figure 1 3D structure of Azurin from Pseudomonas aeruginosa. PDB ID:1jzg ...... 3 Figure 2 CRISPR/Cas9 mechanism acting to produce a DSB on the target DNA. Homology region between tracrRNA and crRNA in pink (not to scale)...... 6 Figure 3 Scheme of workflow to obtain the final donor template constituted by homology arms (5’HA and 3’HA) flanking human IL6-promoter, humanized Azurin (hAzurin) gene and P2A - eGFP+SV40polyA sequence...... 18 Figure 4 Scheme of proposed workflow to obtain the donor template incorporated into the genome of MSCs...... 18 Figure 5 Western Blot analysis for detection of azurin in CM of tested MSCs. Ctrl 1: cells without microporation; Ctrl 2: cells microporated without plasmid; pVAX-Azurin: cells microporated with pVAX- engineered Azurin plasmid; pVAX-GFP: cells microporated with pVAX-GFP plasmid (Thermo Fisher Scientific, courtesy of Profs Miguel Prazeres and Gabriel Monteiro, iBB/IST). The marker used was the NZYColour Protein Marker II (NZYTech)...... 29 Figure 6 Western Blot analysis of expression of Azurin and GFP in cell lysates of tested MSCs. Ctrl 1: cells without microporation; Ctrl 2: cells microporated without plasmid; pVAX-Azurin: cells microporated with pVAX-engineered Azurin plasmid; pVAX-GFP: cells microporated with pVAX-GFP plasmid. Controls: Actin (A); GAPDH(B); Test: Azurin (C); GFP(D). The marker used was the NZYColour Protein Marker II (NZYTech)...... 29 Figure 7 Western Blot analysis of influence of conditioned medium of non-microporated MSCs (CM) on production of proteins in total form present in the tumour environment of MCF-7 cells: GAPDH (A); PI3K (B); Akt (C). The marker used was the NZYColour Protein Marker II (NZYTech)...... 30 Figure 8 Western Blot analysis of influence of conditioned medium of non-microporated MSCs (CM) on production of proteins in phosphorylated form present in the tumour environment of MCF-7 cells: GAPDH (A); PI3K (B); Akt (C). The marker used was the NZYColour Protein Marker II (NZYTech). .. 31 Figure 9 Western Blot analysis of influence of conditioned media of MSCs microporated without plasmid (CM) or with pVAX-engineered Azurin plasmid (Az) on production of proteins in total form present in the tumour environment of HT-29 cells: GAPDH (A); PI3K (B); Akt (C). The marker used was the NZYColour Protein Marker II (NZYTech)...... 31 Figure 10 Western Blot analysis of influence of conditioned media of MSCs microporated without plasmid (CM) or with pVAX-engineered Azurin plasmid (Az) on production of proteins in phosphorylated form present in the tumour environment of HT-29 cells: GAPDH (A); PI3K (B); Akt (C). The marker used was the NZYColour Protein Marker II (NZYTech)...... 32 Figure 11 Western Blot analysis of influence of conditioned media of MSCs microporated without plasmid (CM) or with pVAX-engineered Azurin plasmid (Az) on production of proteins in total form present in the tumour environment of A549 cells: GAPDH (A); PI3K (B); Akt (C). The marker used was the NZYColour Protein Marker II (NZYTech)...... 32 Figure 12 Western Blot analysis of influence of conditioned media of MSCs microporated without plasmid (CM) or with pVAX-engineered Azurin plasmid (Az) on production of proteins in phosphorylated form present in the tumour environment of A549 cells: GAPDH (A); PI3K (B); Akt (C). The marker used was the NZYColour Protein Marker II (NZYTech)...... 32 Figure 13 Western Blot analysis of influence of conditioned media of MSCs microporated without plasmid (CM) or with pVAX-engineered Azurin plasmid (Az) on production of proteins present in the tumour environment of A549 cells: GAPDH (A); Src (B); pSrc (phospo Src) (C). The marker used was the NZYColour Protein Marker II (NZYTech)...... 33

Figure 14 Plasmid pX459 used to clone the guides. Map Image for pSpCas9(BB)-2A-Puro (PX459) V2.0 [103]...... 35 Figure 15 Agarose gel electrophoresis of PCR products amplified with primers correspondent to each guide. Guide 1: Corte1.Fw, Corte1.Rev; Guide 2: Corte2.Fw, Corte2.Rev; Guide 3: Corte3.Fw, Corte3.Rev; Guide 4: Corte4.Fw, Corte4.Rev (see Table 3 on section 3.4.3.1). G1 - Guide 1; G2 - Guide 2; G3 - Guide 3; G4 - Guide 4; uPCR – uncut PCR; Mk – 1Kb Plus DNA Ladder (Invitrogen™)...... 36 Figure 16 (A) Agarose gel electrophoresis of PCR products digested with Detection enzyme to determine cleavage efficiency of the tested guides. Efficiency ratios are the following: Guide 1: non- cutter; Guide 2: 2.72; Guide 3: 3.00; Guide 4: impossible to observe the second band (ratio of [cut/noncut] measured by ImageJ software). G1 - Guide 1; G2 - Guide 2; G3 - Guide 3; G4 - Guide 4; uPCR – uncut PCR; cPCR – cut PCR; Mk – 1Kb Plus DNA Ladder (Invitrogen™). (B) The nucleotide sequence of cleavage region of Guide 3 in the reverse strand of the intron 1 in PPP1R12C gene. The homology arms are highlighted in red. The guide is in bold and the sequence correspondent to PAM is underlined...... 37 Figure 17 Plasmid pBluescript II KS used to clone the fragments of the interest...... 39 Figure 18 (A) Agarose gel electrophoresis of PCR product amplified from genomic DNA of HEK293Tcells with primers 5HAIL6.G3 Fw and AzIL6 Rev, correspondent to IL6-promoter (see Table 5 on section 3.6.1). (B) Agarose gel electrophoresis of the re-amplified PCR product referred before with Phusion HF DNA Polymerase. Mk - 1Kb Plus DNA Ladder (Invitrogen™). 1-2-3-4: 55ºC-58ºC- 60ºC-62ºC of annealing temperature...... 40 Figure 19 Agarose gel electrophoresis to verify by vector digestion the insertion of the IL6-promoter fragment into the pKS vector. Mk – 1Kb Plus DNA Ladder (Invitrogen™)...... 41 Figure 20 Agarose gel electrophoresis to verify by vector digestion the insertion of the IL6-promoter fragment, after re-amplification with Phusion HF DNA Polymerase, treatment with PNK and purification with NZYGelpure kit, into the pKS vector. Mk – 1Kb Plus DNA Ladder (Invitrogen™)...... 41 Figure 21 Agarose gel electrophoresis of PCR products amplified from pVAX-engineered Azurin and pEGFP-N1 plasmids DNA, with primers IL6Az Fw and P2AAz Rev, and P2AGFP Fw and 3HApolyA.G3 Rev, for hAzurin and eGFP+SV40polyA amplification, respectively. (See Table 5 on section 3.6.1). Mk – 1Kb Plus DNA Ladder (Invitrogen™). (See complete figure on section 3 in appendix). 1-2-3-4: 54ºC-56ºC-58ºC-60ºC of annealing temperature...... 42 Figure 22 (A) Agarose gel electrophoresis of PCR products amplified from genomic DNA of HEK293Tcells, with primers 5HA.G3 Fw and IL65HA.G3 Rev, and polyA3HA.G3 Fw and 3HA.G3 Rev, for 5’Homology Arm and 3’Homology Arm amplification, respectively. (see Table 5 on section 3.6.1). (B) Agarose gel electrophoresis of PCR products correspondent to 5’Homology Arm and 3’Homology Arm amplification after purification with NZYGelpure kit. Mk – 1Kb Plus DNA Ladder (Invitrogen™). 1- 2-3: 60ºC-62ºC-64ºC of annealing temperature...... 43 Figure 23 (A) Agarose gel electrophoresis of PCR product amplified from IL6-promoter and hAzurin DNA fragments with primers 5HAIL6.G3 Fw and P2AAz Rev, correspondent to Ligation I: IL6- promoter + hAzurin (see Table 10 on section 3.6.2). (B) Agarose gel electrophoresis of PCR product referred before after purification with NZYGelpure kit. Mk – 1Kb Plus DNA Ladder (Invitrogen™). .... 44 Figure 24 (A) Agarose gel electrophoresis of PCR product amplified from hAzurin and eGFP+SV40polyA DNA fragments with primers IL6Az Fw and 3HApolyA.G3 Rev, correspondent to Ligation II: hAzurin + eGFP+SV40polyA (see Table 10 on section 3.6.2). (B) Agarose gel electrophoresis of PCR product referred before after purification with NZYGelpure kit. Mk – 1Kb Plus DNA Ladder (Invitrogen™). The remaining bands correspond to Ligation I amplification...... 45

Figure 25 Agarose gel electrophoresis to verify by vector digestion the insertion of the Ligation II fragment, after purification with NZYGelpure kit, into the pKS vector. Mk – 1Kb Plus DNA Ladder (Invitrogen™)...... 45 Figure 26 (A) Agarose gel electrophoresis of PCR product amplified from Ligation II and 3’Homology Arm DNA fragments with primers IL6Az Fw and 3HA.G3 Rev, correspondent to Ligation II + 3’HA (see Table 11 on section 3.6.2). (B) Agarose gel electrophoresis of PCR product referred before after purification with NZYGelpure kit. Mk – 1Kb Plus DNA Ladder (Invitrogen™)...... 46 Figure 27 Agarose gel electrophoresis of PCR products amplified from pVAX-engineered Azurin and pEGFP-N1 plasmids DNA, with primers IL6Az Fw and P2AAz Rev, and P2AGFP Fw and 3HApolyA.G3 Rev, for hAzurin and eGFP+SV40polyA amplification, respectively (highlighted bands). (See Table 5 on section 3.6.1). The remaining bands correspond to amplification of the portion of the hAzurin fragment until to restriction site of AflII enzyme (hAzurin I) and from that site (hAzurin II), with primers IL6Az Fw and AzAflII Rev, and AzAflII Fw and P2AAz Rev (see Table 18). Mk – 1Kb Plus DNA Ladder (Invitrogen™). 1-2-3-4: 54ºC-56ºC-58ºC-60ºC of annealing temperature...... 59 Figure 28 Full Sequence Map for pCAG-SpCas9-GFP-U6-gRNA...... 60

List of Abbreviations

AAV - Adeno-associated virus MSCs - Mesenchymal Stem/Stromal Cells AP - Alkaline Phosphatase MW - Molecular Weight ATP - Adenosine triphosphate mRNA - messenger RNA BSA - Bovine Serum Albumin NHEJ - Non-homologous end joining DMEM - Dulbecco’s Modified Eagle Medium nt - nucleotides DSBs - Double-strand breaks PAM - proto-spacer adjacent motif dNTPs - Deoxynucleotides PBS - Phosphate-buffered saline dsDNA - double-stranded DNA PNK - Polynucleotide Kinase ECAC - European Collection of Authenticated PPP1R12C - Protein phosphatase 1 regulatory Cell Cultures subunit 12C ECL - Enhanced chemiluminescence Rev - Reverse EDTA - Ethylenediamine tetraacetic acid RNP - Ribonucleoprotein EtBr - Ethidium Bromide SDS - Sodium Dodecyl Sulphate FBS - Fetal Bovine Serum ssDNA - single-stranded DNA FD - Fast Digest TBE - Tris/Borate/EDTA Fw - Forward TE - Tris-EDTA HA - Homology Arm Units: HDR - Homology-direct Repair bp - base pair HEK - Human Embryonic Kidney Da - Dalton HF - High Fidelity FDU - FastDigest Unit HSCs - Hematopoietic Stem Cells g - g-force hMSCs - Human Mesenchymal Stem Cells IU/ml - International Unit per Millilitre IL - Interleukin rpm - Revolution per Minute iBB - Institute for Bioengineering and U - Enzyme Unit Biosciences V - Volt iPSCs - induced Pluripotent Stem Cells w/v % - Weight/Volume Percentage LB - Luria-Bertani Concentration MHC - Major Histocompatibility Complex ºC - Degree Celsius

xii

1. Introduction

1.1 Cancer About 16% of people die from cancer, nearly 1 in 6 global deaths. The most common types of cancer that kill men are lung, liver, stomach, colorectal, and prostate cancers. Concerning to women, the most prevalent are breast, lung, colorectal, cervical, and stomach cancers. Furthermore, there is lack of data that disables cancer policies in low- and middle-income countries [1]. The risk for this type of disease can be reduced by avoiding tobacco, limiting the amount of alcoholic drinks, reducing the UV ray exposure, maintaining a healthy life concerning to food and exercise, and search for regular medical care. Substances such as those mentioned previously are examples of carcinogens, that are directly responsible for damaging DNA, promoting or supporting cancer. Cancer is a result of mutations that interfere with oncogene and tumour suppressor gene function, leading to uncontrollable cell growth, where an oncogene is a gene encoding a protein that promotes cell division whereas a tumour suppressor gene is one that reports to cells when not to divide [2]. The diagnosis and the therapy of cancer are the greatest challenges for physicians that work in clinical oncology and molecular medicine. On the other hand, practicing clinicians, who treat patients that suffer from this disease, are facing the challenge to achieve the maximum of therapeutic efficacy and minimum of side effects. The available systemic therapies cause side effects in treated patients, from nausea to damaged tissues, as well as in cancer survivors, namely iatrogenic consequences like genomic mutations and their consequences. Thus, personalized and targeted therapies are necessary and urgent [3].

1.2 Mesenchymal Stem/Stromal Cells (MSCs) MSCs are present in several tissues such as bone marrow, liver, skin, dental pulp, adipose tissue, brain, and skeletal muscle [3]. MSCs are self-renewing and multipotent adult stem cells of mesodermal origin with an important ability to differentiate into several cell types like osteoblasts, chondrocytes and adipocytes. These cells are also involved in processes like immunosuppression and have capacity to migrate towards sites of inflammation and tumours, which is referred to as tropism or homing capacity. Thus, MSCs, due to this last important feature, can be used as vehicles to deliver drugs and anti-tumour agents to tumour sites [4]. Interactions of chemokines and chemokine receptors mediate this migration of MSCs to the impaired sites [5]. The fate of MSC is regulated in part by tissue mechanical properties namely the tissue and matrix stiffness that is able to drive expression of genes involved in differentiation of MSCs. In other words, soft matrices such as the brain drive MSCs to differentiate into a neurogenic lineage, while stiffer matrices such as the muscles and bone drive these cells to differentiate into myogenic and osteogenic lineages. The range of stiffness that is recognized by MSCs includes values found in normal tissues as well as those found in invasive cancers and metastases that are 10- to 15- fold higher [6].

The extraction of MSCs from adults and consequent purification are not very difficult because of their ability to adhere to plastic or glass in laboratory conditions [7]. Their expansion in vitro is also not complex, and considering their tropism ability referred above, MSCs present striking characteristics that allow the delivery of vectors including therapeutic agents as secreted proteins produced from exogenous genes that might be expressed in these cells [5]. The low immunogenic state of these cells is another important feature. This happens due to low expression of MHC class I molecules and lack of MHC class II molecules and costimulatory molecules like CD40, CD80, and CD86, essential for immune cell stimulation, what origins a weak allogenic immune response when MSCs are administered to a non-identical recipient [3]. MSCs present several immunomodulatory properties that affect both the innate and adaptive immune systems. Relative to the adaptive immune system, it was verified that MSCs have direct immunosuppressive properties by inhibiting the activation and proliferation of effector T cells via cell- to-cell contact and the production of several soluble suppressive factors such as IFN-γ, IL-10, IL1-β, TGF-β, IL-11 and IL-12 [8]. Considering the low-specificity of the conventional therapies like surgery, radiotherapy and chemotherapy and the underlying side effects, alternative therapeutic strategies are required and have been investigated targeting the increase of the specificity and, consequently, the safety and the success of the treatment.

1.2.1 MSCs and Cancer Taking into account the homing mechanisms for tumour tropism of the MSCs that involve a variety of adhesion molecules and tumour-derived cytokines, chemokines, and growth factors, this type of stem cells has become an attractive vector for localized delivery of therapeutic agents for cancer treatment [6]. It is thought that there is a cross-talk between MSCs and cancer cells since MSCs express functional epidermal growth factor receptor (EGFR) whereas cancer cells secrete EGFR-ligands like transforming growth factor- (TGF-). The presence of this growth factor leads to an up-regulated expression by MSCs of a wide array of genes, including VEGFA, IL6, EREG, HB-EGF, LIF, NGF, NRG1, CCL19, CCL2, CCL25, and CXCL3, all of which with ability to contribute to tumour progression [9]. Therefore, the promoters of these up-regulated genes can be used to direct the expression of genes of interest, namely therapeutic or anticancer genes. The underlying mechanisms to the effect of MSCs on tumour growth remain unclear. However, many studies with genetically engineered MSCs have verified the inhibition of the tumour growth in several cancer types, namely lung cancer, melanoma, glioma, liver cancer and breast cancer [4]. Considering the tight correlation between the tissue stiffness and the MSC differentiation referred above, it is thought that this last process allows the utilization of promoters regulating genes involved in this process to trigger the expression of downstream genes of interest like therapeutic genes, being these promoters able to perceive the change in the tissue stiffness. Despite the heterogeneous origin of cancers, the matrix stiffness is similar in most cases, so this property may present a huge opportunity to enhance the specificity and the efficiency of cancer targeting techniques [6].

According to the described above and considering all features of MSCs mentioned in section 1.2, the use of these cells in the development of new anticancer therapeutic strategies is a way that is worth considered given the therapeutic potential of MSCs. Current strategies explore the tropism of MSCs towards tumours as a tool to deliver suicide genes to several types of tumours including those of brain, head and neck, ovary, breast, lung, pancreas, colon, blood, and skin. This type of therapy is more efficient and has fewer side effects than chemotherapy or radiotherapy due to the selective eradication of cancer cells. Moreover, the use of gene therapy aims to block specific pathways, enzymes or growth factors that participate in the carcinogenesis, tumour growth and cell proliferation. However, it is important to be aware that the main risk for therapeutic use of MSCs is their possible cancerous transformation. As such, ‘primum non nocere’ should be the primary consideration when it is necessary to design any therapeutic strategy [3]. The genetic modification of MSCs for therapeutic purpose can be achieved using viral or non- viral vectors. The main advantage of the non-viral methods is the safety, however the most frequent lack of integration into host genome may constitute a huge disadvantage because long term expression is necessary for clinical applications [4]. All the above features of MSCs make these cells an ideal vehicle for efficient delivery of therapeutics to the target site [6].

1.3 Azurin Azurin is a cupredoxin type of electron transfer low molecular weight redox protein from the opportunistic pathogenic bacteria Pseudomonas aeruginosa [10]. This protein is formed by 128 amino acids with about 14 kDa of molecular weight (see Figure 1). Structural homology is highly conserved between the diverse existent forms of azurin. These present a characteristic single-domain signature with a compact structurally rigid β-sandwich core, immunoglobulin fold, and an essentially neutral hydrophobic patch surrounding the copper site [11, 12]. Considering that the azurin structurally resembles immunoglobulins, this protein is non-immunogenic and thus cannot be easily eliminated by the immune system.

Figure 1 3D structure of Azurin from Pseudomonas aeruginosa. PDB ID:1jzg

1.3.1 Azurin and Cancer It is reported that azurin selectively induces the apoptosis in several human cancer cell types, entering effectively in cancer cells but not in normal cells, showing lower cytotoxicity concerning to the

latter. The cytotoxicity is based on the internalization of the protein, which creates a complex with the tumour suppressor protein p53 and stabilizes it, inducing apoptosis or cell cycle arrest in the G1 [10]. This internalization occurs by endocytosis, and it has been suggested that it may disrupt caveolae and selectively remove receptors from the cell membrane that may be crucial for cancer progression [13]. Additionally, azurin can induce the inhibition of angiogenesis as well as the inhibition of cell signalling pathways involved in the process of drug-resistance development. Therefore, azurin is able to target multiple steps in the cancer progression pathway [14]. The interaction between azurin and p53 occurs on hydrophobic patch of the azurin [15]. The formed complex includes four azurin molecules per one p53 molecule [16]. The azurin has a preferential entry into the cancer cells than in normal cells, which has been associated with a fragment of 28 amino acids between residues 50 and 77 of azurin [16]. p28 is a 28-amino acid peptide fragment of the azurin that specifically binds to p53 triggering its post-translational stabilization. This subsequently increases its intracellular concentration inhibiting the binding of ubiquitin ligases and preventing proteasomal degradation of the tumour suppressor protein, and thus resulting in an enhancement of the anti-proliferative activity of p28. p28 has a specific and stable interaction with the DBD (DNA-binding domain) of p53, being DBD a very important domain not only because it is the domain necessary for the binding of the tumour suppressor to DNA [15] but also because it is involved in ubiquitination pathway responsible for the proteasomal degradation of p53, as described above [17]. Moreover, p28 is a peptide with two different phase I clinical trials already finished with positive indications [18, 19]. Azurin has another important property concerning to its ability to recognize and bind to certain cellular receptors, like receptor tyrosine kinases present at the cell surface, since it is structurally similar to the respective ligands, inhibiting by competitive binding the cellular signalling processes that result in the proliferation, migration, invasion and angiogenesis of several types of human tumours [16]. Azurin also has the property of a natural scaffold protein as a non-antibody recognition protein that demonstrates immunoglobulin-like binding characteristics, so this protein may have the ability to bind various unrelated mammalian proteins relevant for cancer, becoming a potentially important protein for therapeutic purposes [16]. In addition to what is stated above, the broad range of antitumor properties of the azurin also include its ability to induce alteration of morphological features of the cancer cells, such as lipid rafts that may be disrupted by azurin, causing the decrease in resistance to the other anticancer drugs. These morphological changes also include an increase in cell mass, height, volume and elasticity, resulting in the inversion of carcinogenic phenotype towards a more “epithelial-like” and less invasive one [20].

1.4 Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Genome editing with programmable nucleases has been strongly explored, opening new avenues for several applications from basic research in disease processes via cellular and animal models to clinical therapy. It is believed that in near future therapies will rely on precise genome editing to provide therapeutic approaches for currently untreatable diseases.

Clustered regularly interspaced short palindromic repeats (CRISPR) make part of the prokaryotic adaptive immune system, being a distinctive feature of the genomes of most Bacteria and Archaea and involved in resistance to bacteriophages [21]. When viruses invade bacteria and release their own DNA into these cells, the immune system of bacteria makes a copy of one DNA strand of the invading virus, and consequently inserts it into a portion of genome of bacteria that is named by CRISPR array. Thus, the DNA of the virus is stored in the spacers between two palindromic repeats in the CRISPR array. Then, bacteria transcribe a portion of CRISPR array to make a pre-crRNA strand that includes multiple complementary spacers and palindromic repeats. After that, this pre-crRNA is turned into crRNA through a process in which a tracrRNA binds to one of the palindromic repeats of the pre-crRNA and the ribonuclease III cuts the tracrRNA generating a separated pre-crRNA that is matured and named by crRNA [22]. Thus, CRISPR arrays contain multiple copies of a short repeat sequence (25-40 nucleotides) separated by variable sequences with similar size (spacers) derived from invaders of viral or plasmid origin. CRISPR/Cas system includes the Cas genes present near CRISPR locus encoding Cas nucleases that associate with crRNAs and use them as guides to recognize and to cleave invading nucleic acids [23]. There are six CRISPR systems that work according to different mechanisms in order to ensure DNA recognition and cleavage. These systems are grouped in two classes: Class 1 (types I, III, and IV) with multisubunit effector complexes, and Class 2 (types II, V, and VI) with single protein effectors [24]. Class 2 systems have been considered for genome engineering owing to their simplicity, and only type II, derived from Streptococcus pyogenes [25], has been utilized for RNA-guided engineered nucleases as described below. The effector single protein of type II is Cas9, a large multidomain nuclease which size depends on the species, varying from ~950 to over 1,600 amino acids [24]. This endonuclease acts in sync with two guide RNAs: CRISPR RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA) [25, 26]. The tracrRNA contains complementary regions for both the crRNA and Cas9 endonuclease, acting as a link between the variable crRNAs and Cas9. Moreover, in order to simplify the endogenous system for laboratorial use, the two guide RNAs (tracrRNA and crRNA) have been combined into a single chimeric RNA sequence, named by single guide RNA (sgRNA) [25], which directs the CRISPR- associated protein Cas9 to introduce a sequence-specific DNA cleavage by double-strand breaks (DSBs) in the target DNA. This acquired Cas9-DNA recognition requires both base-pairing complementarity between the crRNA and the target DNA and a short-conserved sequence named by proto-spacer adjacent motif (PAM), located on the opposite site to that of the RNA-DNA hybridization in the DNA target. After the recognition, the DNA cleavage is completed by two Cas9 domains: the HNH (McrA-like fold [24]) nuclease domain and the RuvC-like (RNase H fold [24]) domain. At the sites complementary to the crRNA-guide sequence, the first domain is responsible by cleavage of the complementary strand, while the second domain cleaves the non-complementary strand [27]. Hence, Cas9 protein can be easily re-targeted to new DNA sequences by changing just a small portion of the sequence of its correspondent RNA guide that base-pairs with target DNA, as

described above. Moreover, this protein can generate several DSBs within the same genome expressing multiple guide RNAs [28, 25]. The efficiency of genome editing in eukaryotic cells varies depending on the chromatin structure and epigenetic state of the target locus [29]. Thus, the system constituted by bacterial CRISPR repeats associated with protein Cas9 (CRISPR/Cas9) consists in a complex of a sgRNA with Cas9 nuclease from Streptococcus pyogenes (SpCas9), which recognizes a variable 20-nucleotide target sequence adjacent to a 5’-NGG-3’ PAM and introduces a DSB in the target DNA three base pairs upstream of the PAM sequence [30]. (see Figure 2).

Figure 2 CRISPR/Cas9 mechanism acting to produce a DSB on the target DNA. Homology region between tracrRNA and crRNA in pink (not to scale).

This induced DSB is a potentially lethal event for the cell and, therefore needs to be repaired by the DNA repair machinery [31], via one of two main mechanisms: the non-homologous end joining (NHEJ) and the homology-direct repair (HDR) pathways [32]. The mechanism of NHEJ repair consists in the joining of the free DNA ends through a homology-independent and mechanistically flexible process, which often generates random small insertions or deletions (indels) [25, 32]. These resultant indels can cause frameshift mutations [33] that generate the production of non-functional proteins or degradation of mRNA by nonsense-mediated decay [34]. Thereby, the ability of CRISPR/Cas9 system to induce DSBs subsequently repaired through NHEJ pathway has been explored for rapid generation of loss-of-function alleles in protein- coding genes [32]. Moreover, the NHEJ may be used to restore the reading frame of a dysfunctional gene in order to treat a disease [35]. This mechanism is predominant in DNA repair during G1, S and G2 phases of the cell cycle [36]. NHEJ has two subpathways, classical (cNHEJ) initiated by the Ku complex and alternative (altNHEJ) initiated by poly ADP-ribose polymerase 1, each of them with distinct mutational consequences. The cNHEJ suppresses the formation of chromosome translocations, however sometimes induces sequence alterations at the junction regions. In turn, the altNHEJ works when the cNHEJ is not activated, beyond that it is related with a higher probability of chromosome translocations and the induction of larger sequence alterations at junction break-points. Thus, altNHEJ

can be responsible for the elimination from the genome of highly cytotoxic DNA DSBs, but at the cost of increasing the rate of translocations [37]. Current experiments show that the knock-out of DNA ligase IV (LIG4) by using Cas9/sgRNAs generates a significant increase in rate of HDR-based knock in of target genes, which correlated with a parallel decrease of NHEJ activity. These data indicate that the homology-independent repair of Cas9-induced DSBs is largely mediated by the conventional DNA ligase IV-dependent NHEJ pathway [32]. The HDR pathway of DNA damage repair consists in an accurate strand-exchange process based on existing homologous DNA templates [32], which contain homology to sequences flanking the DSB named by homology arms [31]. These donor DNA templates are usually a single-(ssDNA) or double-stranded DNA (dsDNA). HDR mediates small insertions or substitutions at a higher rate than large insertions [34]. Moreover, it is known that viral vectors with ssDNA may generate higher HDR rates than dsDNA or plasmid DNA [38]. This system of recombination allows a great mutation precision and the ability to generate knock-in cancer models [25]. This mechanism may happen if a donor DNA template that contains the desired edit is available when the DSB is generated since the cellular HDR machinery will use this donor DNA to repair the existent DSB incorporating the insert into the targeted locus [31]. The length of the homology arm has a crucial role in increasing HDR rate since the efficiency of recombination increases as the length of homology arms increases [39]. Some studies suggest that the minimum homology arm length required for HDR is 125bp for human cells, however this length might vary depending on the locus of the gene of interest [40]. On the other hand, other studies state that the large insertions require longer (>500nt) homology arms [31]. Another study shows also that significant levels of genome editing can be achieved without homology arms, indicating the NHEJ- mediated knock-in [41]. More recent studies show that the synthesis-dependent strand annealing (SDSA) model reflects simple predictions for optimal donor design to repair of Cas9-induced DSBs in human cells, reporting that only ~35 nucleotides of homology with the targeted locus are required to introduce inserts ranging from 1 to 1000 nucleotides via SDSA. In this mechanism, the DSB is first resected to produce 3’ overhangs on both sides of the DSB, which invade the linear donor and are extended by DNA synthesis copying the donor sequences. The bridge on the DSB is completed when the synthesized strands are removed from the donor to anneal back to each other at the locus. The linear donor with these short homology arms can be chemically synthesized as single- or dsDNA fragments without any cloning, simplifying the overall process [31]. HDR happens mainly during S and G2 phases when DNA replication is completed and sister chromatids are available to serve as repair templates [36], being largely restricted to cells that are actively dividing, what limits the treatments that require precise genome modifications to mitotic cells [34]. Thus, there is a competition between HDR and NHEJ mechanisms in S and G2 phases, what downregulates the first system [36]. The HDR mechanism allows the replacement of endogenous genome segments by plasmid sequences, enabling the insertion of targeted DNA into the genome as well as the precise genetic modification in living cells. DNA cleavage introduced by CRISPR/Cas9 promotes HDR mechanism at

nearby regions, enhancing the efficiency of gene targeting. Most studies have employed HDR-based strategies, showing that the rate of targeted integration in these strategies is low. This can be justified by the fact that in human cells HDR pathway is intrinsically inefficient, whereas the NHEJ repair pathway is predominant, which results in few target clones among a large number of random integrations. Thus, random DNA integration via NHEJ to generate transgenic animals and cell lines has been widely used, since the frequency of this mechanism is about 1000-fold higher than HDR- mediated DNA insertion [32]. It is thought that chemical or genetic inactivation of the NHEJ pathway components and chemical activation of HDR or manipulation of the cell cycle may increase the rate of HDR relative to rate of NHEJ [30], however such manipulations can be harmful to cells as well as hard to employ [36]. The optimization of the conditions of delivery, namely the timing of providing the donor template [42], the form and dose of this [38], and synchronization of the cell cycle [36] may facilitate occurrence of HDR. However, it is of note that these invasive manipulations may alter the cellular response to DNA damage at other non-target sites and drive to tumour formation. Therefore, the design of optimal DNA donor templates can increase HDR frequencies at the same time that leaves cell cycle regulation intact. One study from June 2017 showed that HDR efficiency is higher with linearized plasmid than with PCR product owing to protection of the backbone sequence from degradation of the template sequence, which do not happen with the latter. Thus, it is thought that in mammalian cells a plasmid donor with at least 1-2kbp of total homology is used to generate large sequence changes, whereas ssDNAs are more efficient for small sequence changes. Recently, enhanced HDR frequency has been reported by using asymmetric ssDNA donor templates showing that optimizing the donor template at the 5’ and 3’ homology regions flanking the DSB site may contribute to increase the HDR rate without any chemical or genetic intervention. Moreover, the position of the RNA guide target sequence has been analysed showing that DSB repair activity increased when the site was positioned on the transcriptionally active strand [39]. The maximum activity of the Cas9 protein is required for efficient genome editing being dependent of the sequences surrounding the target site and other factors, so it is necessary to search for the optimal guide RNA sequence before any steps in order to optimizing gene repair activities [39]. Some studies have reported human codon-optimized FokI-dCas9 nuclease as an alternative to Cas9, verifying that this fusion protein presents a higher specificity than the latter with off-target events reduced to undetectable levels [43]. An application of this second-generation nuclease is the xenotransplantation, namely the engineering of the porcine cells to secrete immunomodulatory molecules to provide ‘local’ graft-specific immune protection, aiming to decrease or eliminate the necessity of chronic systemic immunosuppression [44]. An alternative DSB repair pathway is the microhomology-mediated end-joining (MMEJ) [45]. This mechanism requires short homologous sequences (5-25bp) as homology arms for DSB repair, and with independent machinery from HDR generates an accurate gene knock-in with a more simply constructed donor vector. MMEJ is mainly active during M-early S phases that are when HDR is inactive. Moreover, some studies have suggested the dominance of the MMEJ in repair of DSBs in relation to other pathways. MMEJ results mainly in short deletions of the intervening sequence, so the

use of this method for gene knock-in is not frequent. However, there is a system named by Precise Integration into Target Chromosome (PITCh) system, where MMEJ pathway is used for gene knock- in. The PITCh system generates DSBs in the donor vector (PITCh vector) and the genomic DNA, what origins the insertion of the donor sequence into the genome by MMEJ. This process includes microhomologous DNA ends on the PITCh vector generated by the programmable nucleases [33]. The CRISPR/Cas9 system has been improved to induce specific DSBs in the genomes of several species, enhancing genome engineering through the targeting of specific genomic locations guided by sgRNA. High efficiency is an important advantage of this technology over other traditional gene-targeting strategies [37]. However, the off-target cleavage owing to low target specificity is an important limitation of this system that should be kept in mind, since the sgRNA can bind DNA sequences other than the intended targets, directing Cas9 mediated DSBs to unwanted locations. A promising solution for this involves the modification of Cas9 inactivating one of its two endonuclease sites in order to generate a Cas9 nickase, which in turn will produce single strand breaks (SSBs) in lieu of DSBs. The endogenous SSB repair systems are more accurate than DSB repair so off-target from SSBs can be easily and accurately repaired, enhancing editing specificity while maintaining on- target efficiency [25]. It is reported that exponentially growing mammalian cells require one hour to repair 90% of the DSBs caused by ionizing radiation but may take fifteen hours to repair 90% of Cas9 lesions, which means that the long lifetime of the Cas9-DNA complex may be a limiting factor in genome editing. This observation is consistent with the model that defends that Cas9 stably binds to substrate DNA, hiding the underlying DSB and consequently avoiding the recognition by genome surveillance factors [30]. As an alternative, the designed sgRNA can be co-introduced with either active Cas9 endonuclease or Cas9 mRNA into the nucleus of a cell [25]. The utilization of purified recombinant Cas9 protein complexed with an in vitro transcribed sgRNA, i.e. Cas9 RNPs, is associated with an increase of genome-editing efficiency and a low rate of off-targets effects beyond it avoiding the need for in vivo transcription and translation [37]. These advantages are consequences of a high activity shortly after protein transfection, followed by a rapid degradation [36]. Then, the main factors associated with the good performance of this approach are the better control of the process in vitro, the protection of the Cas9-complexed guide RNA from cellular degradation, and the avoidance of cellular toxicity related with transfection with foreign DNA [37], beyond the reported superior electroporation of RNP relatively to that of DNA [46]. It is worth noting that concerning to electroporation of Cas9 mRNA and sgRNA, it has been reported a modest gene editing level, which can be justified by the instability of unmodified sgRNA. Thus, other approach may be used, namely partially chemically modified sgRNAs that significantly increases the editing efficiency via co-delivery with either Cas9 mRNA or protein [47]. Moreover, other RNA-guided endonucleases like Cpf1 are emerging as a powerful genome- editing tool. This endonuclease from Francisella novicida belongs to type V of class 2 CRISPR system. Cpf1 CRISPR arrays are processed into mature crRNAs (42-44nt [48]) without an additional tracrRNA by Cpf1, cleaving a target dsDNA with a short T-rich PAM motif on the 5’end of the non- target strand, in contrast to the Cas9 that cleaves a target dsDNA containing G-rich PAM motif located

on the 3’end of the non-target strand. Furthermore, Cpf1 generates a staggered dsDNA break resulting in five-nucleotide 5’-overhangs distal to the PAM site [48] instead of the blunt end cut introduced by Cas9 [49].

1.4.1 Alternatives to CRISPR Zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) appeared before the CRISPR/Cas9 system being used to introduce site-specific DNA DSBs with high accuracy and efficiency. These strategies have been developed to introduce a broad range of genomic modifications, such as targeted mutation, insertion, deletion or gene knock-out in several types of cells and organisms. However, the CRISPR/Cas9 stands out due to its major simplicity, as referred above [32]. A key advantage of this mechanism is its high efficiency that renders common selection procedures unnecessary [37]. ZFNs and TALENs act following similar principles but there is a difference between them, mainly in their binding-domains. In the first, the binding domain is constituted by three-nucleotide recognition modules (zinc-finger domain) [50], whereas in the second, its binding domain is formed by one-nucleotide recognition module (TALE) [51]. In addition, these nucleases have separate DNA- binding domains and nonspecific cleavage domain from the FokI endonuclease. A major disadvantage of the ZFNs is the requirement of complicated protein engineering for the zinc-finger domain [52]. The TALENs also require multistep cloning for assembling the TALEs [53]. The use of meganucleases is another genome editing tool. They act as restriction enzymes, however are configured to target DNA sequences which length varies between 14bp and 40bp. Therefore, taking into account various shortcomings, like their low specificity in recognition of the DNA and the need to fuse the recognition and cleavage domains, this type of nucleases has had a very limited use [54]. Meganucleases and ZFNs have reportedly low success rates in inducing site-specific DNA breaks, contrary to what happens with TALENs and CRISPR [52]. In turn, CRISPR can simultaneously target multiple loci in the genome with high efficiency and without significantly increasing the required dose [28]. These three alternatives to CRISPR/Cas9 rely on sequence recognition via protein-DNA interactions, whereas in the CRISPR/Cas9 the recognition is via a short RNA guide molecule that base-pairs with the target DNA and directs the Cas9 to the correct genome location [34]. Table 1 summarizes the key differences between the main three nucleases referred above.

ZFN TALEN CRISPR

DNA-binding moiety Protein Protein RNA

Target site size [bp] 18-36 30-40 22

Nuclease FokI FokI Cas

Cytotoxicity Variable to high Low Low

Design availability More complex Complex Simple

Ease of multiplexing Low Low High

All these genome editing systems may be valuable tools for biomedical research, drug discovery and development, as well as gene therapy. In other words, these technologies contribute to the synthetic biology, i.e., the application of engineering principles to biology [56]. Nevertheless, it is important to keep in mind that the specificity of genome editing systems may be affected by their dosage and expression patterns, as well as the number, type and stage of target cells. Moreover, it is necessary to know the level of efficiency of genomic modification required to achieve significant clinical benefit, since the treatment of highly penetrant monogenic diseases is more straightforward than that of complex multigenic diseases, and each monogenic disease may require different levels of efficiency of editing [57, 58].

1.4.2 CRISPR: applications and challenges for gene-based therapies An approach strongly considered in gene therapy is the targeted insertion into a locus named by “safe harbour”. This is a predefined locus unrelated to the disease-causing gene being a safe site to introduce genetic material. The safe harbour locus is the one that is able to support sufficient and stable gene expression in the modified cells, beyond that it also needs to be safe, not interfering with normal cell function and gene regulation [54]. A promising safe harbour is the AAVS1 locus that is the most common integration site for AAV, a type of virus without a known associated pathology. This locus is located on chromosome 19 within intron 1 of the PPP1R12C gene [54, 59]. AAVS1 locus has been a reliable workhorse in genome editing of human cell line, similarly to the mouse ROSA26 locus, providing a safe haven for transgene expression without overt phenotype. Thus, as disruption of PPP1R12C is not related with any known disease, the AAVS1 locus is considered a safe harbour for transgene targeting [60]. A big challenge is the delivery of CRISPR/Cas9 to the targeted cells since, depending on the mode of delivery and the duration of nuclease expression, both off-targets and immune responses can arise. The most common delivery system are the viral vectors as AAV, that were already clinically approved, being an attractive candidate for in vivo use considering their low degree of immune stimulation, well-characterized serotypes, and ability to target various tissues [61]. However, one hurdle for utilization of the AAV is its small packaging capacity (~ 4.7kbp [62]). Taking into account that

the homology arms required for efficient HDR have usually a minimum of 2 x 0.4kbp, it leaves ~3.9kbp for promoter, polyadenylation signal and transgene. Furthermore, post-transcriptional regulatory elements and the use of multicistronic cassettes may also be required [63]. Another limitation is the possibility of constitutive nuclease expression underlying to viral vectors that may result in cell toxicity and genomic instability [64]. Moreover, the expression levels of AAV may decrease over time due to the turnover of the infected cells [65]. One study from July 2017 showed that two AAV donors can be designed to originate sequential homologous recombination using a transgene split between these two donors that can be fused during recombination. Thus, CRISPR and two AAV donors can mediate the integration of large transgene cassettes [63]. Concerning to delivery via non-viral system, some methods like the chemical transfection using for example liposomes, mechanical deformation [66], and electroporation have been considered [67]. Another techniques that must be taken into account are the hydrodynamic injection and lipid and other lipid-like constructions, such as lipid nanoparticles that have shown great promise as delivery agents in several species, including humans [62]. Negatively charged DNA and other nucleic acids can be electrostatically complexed to cationic materials, like lipofectamine, in order to generate nanoparticles that can be endocytosed by cells [67]. For example, the sgRNA can be cloned into Cas9-expressing plasmids like px459, whereas the HDR template can be constructed into plasmid vector. The targeted genome editing can occur using the Lipofectamine 2000 to deliver these plasmids [68]. The mRNA and proteins introduced by these methods will be present in cells only transiently, so a decrease of the frequency of the off-target effects and lower cell toxicity relative to viral methods are expected [67]. The non-viral delivery may allow more precise control of the duration of dosing because it avoids the transcription process. Moreover, concerns of long-term expression of programmable nuclease are reduced since protein and mRNA are rapidly degraded without integration into the genome. Additionally, repeated injections of non-viral nanoparticles may be performed considering the potential lower adaptive immune response [62]. Nevertheless, the possible off-targets effects of CRISPR/Cas9 approach may in fact do more harm than good, conveying importance to the prediction of off-targets using bioinformatics tools. Therefore, it is necessary to check all safety concerns for CRISPR/Cas9 use in humans, what has not been done yet [25]. The main challenge to use non-viral methods is the delivery of Cas9, sgRNA and repair template simultaneously in vivo, namely the delivery of DNA into the nucleus with high efficiency and low toxicity [62]. Nevertheless, some studies advocate that the application of combined non-viral and viral delivery-based therapeutic genome editing has a great potential for a range of diseases since sgRNA and donor template may be constructed into a viral vector for a continued expression, and transient Cas9 can be delivered via a non-viral vector and multi-administered for an effective DNA cleavage [62]. According to some studies, a Cas9 all-in-one expression plasmid that drives similar sgRNA expression levels from two different RNA polymerase III promoters, co-expressing two sgRNAs, and a simultaneously regulated expression of Cas9 and GFP proteins by a 2A self-cleaving peptide may be applied in order to maximize the concurrent cellular delivery of CRISPR components. Targeted

integration or large deletions can be also achieved applying the combination of CRISPR/Cas9 system with ssODNs (single-stranded oligodeoxynucleotides) templates containing homology arms flanking the genomic modification site. Moreover, targeted gene disruption can be increased by co-transfection with DNA end-processing enzymes involved in the cNHEJ and altNHEJ repair mechanisms [37]. The components of the CRISPR/Cas9 system, including guide RNA, Cas9 and a donor DNA template in the case of HDR, are hydrophilic biomacromolecules that must overcome several barriers to be delivered into target cells, being able to reach the genome of these cells. The main barriers to delivery are firstly the extracellular barriers like phagocytosis by macrophages or other phagocytes, degradation by enzymatic or hydrolytic means, and a potential induction of an immune response and the generation of cytokines. After that, if biomacromolecules can avoid excretion, localize to the proper organ and extravasate out of the bloodstream, they must be endocytosed by the target cell, where these must escape the endosome and localize to the cytoplasm, if their form is mRNA, or nucleus, if their form is DNA, sgRNA or nuclease protein, in order to effectively edit the target gene [69]. In some cases, components of genome editing system can be delivered ex vivo by extracting primary cells, like HSCs, from patients, gene editing these cells and transplanting then the modified cells back into the patient. This type of transfection enables the use of physical methods, which are not suitable for systemic application. For instance, ex vivo electroporation of plasmid DNA or mRNA into HSCs can provide high transfection efficiency [70]. On the other hand, genome editing employed in vivo has additional delivery challenges, like the potential induction of long-term transgene expression with only a single-injection when viral delivery systems are applied and generate unknown consequent effects [71]. An alternative are the RNA modification therapies as RNAi and ASOs (Antisense Oligonucleotides) that silence the mRNA transcribed from disease genes. An ASO-based product has received approval for use in patients with homozygous familial hypercholesterolemia, as well as other RNA modification therapies are in advanced stages of development (see Ionis Pharmaceuticals’ pipe- line). However, despite this progress and therapeutic promise of these technologies, there are some limitations. RNAi and ASOs can induce knockdown of any target protein, but delivery barriers limit their application to a subset of organs and tissue types. Moreover, incomplete suppression of disease proteins, off-target effects and other safety concerns are also strong challenges [72]. Companies like CRISPR Therapeutics, Intellia Therapeutics and Editas Medicine works to translate CRISPR/Cas9 technologies to human therapeutics. The first evaluates both in vivo and ex vivo treatments using CRISPR/Cas9 system with potential targets for ex vivo treatment like hemoglobinopathies, immunodeficiencies and immune therapies, whereas concerning to the in vivo treatment, it may be explored for diseases located in the liver, lung, eye, and other organs (see the CRISPR Therapeutics website). The second company uses for example existing delivery technology as lipid nanoparticles for the in vivo treatment of liver diseases as hepatitis B virus (see the Intellia Therapeutics website). In turn, the third company is following gene editing in the eye through AAV- mediated local delivery, among other projects (see the Editas Medicine website). It is important to consider, aiming the clinical translation of genome editing technologies, the immune response to the corrected genes, since if a target gene has not been properly expressed in

tissues owing to gene deficiency, the proteins produced by the correct copy may induce an adaptive immune response, so further investigation is necessary concerning the targeted tolerance [73]. Institutions in China (West China Hospital) [74] and the United States [75] are planning to perform clinical trials for cancer therapy using CRISPR/Cas9 system for efficient genome editing in vitro, however scientists need to develop approaches to delivery CRISPR/Cas9 components into target organs in vivo [34]. The reprograming of the polymorphic MHC locus via CRISPR/Cas9 technology could enable the creation of matched donors for allogeneic cellular transplantation. The replacement of MHC alleles may be more beneficial for improving donor-recipient matching since full immunological functionality is maintained [76]. CRISPR/Cas9 system has emerged as a tool with enormous potential for helping in the generation of in vitro and in vivo cancer models, besides that through its combination with human embryonic or adult stem cells will likely prove invaluable for studying the molecular and cellular origin of human disease [37]. Another application for CRISPR is the agriculture where this mechanism may be used to edit the genome of crops and plants in order to generate phenotypes that provide resistance to bacteria, so less pesticide might be used, which may help to save money for farmers and to lower the impact of overuse pesticides [77].

1.4.2.1 Therapeutic applications of genome editing using stem cells Currently, there are several examples of genome editing applications using stem cells, some of which will be referred below. The first example is the cystic fibrosis (CF), which is a recessive inherited disease associated with multiorgan damage that compromises epithelial and inflammatory cell function [78], where several approaches have already been used. In a first example, the HDR pathway was used to correct the gene of interest, transmembrane conductance regulator (CFTR) gene. The delivery was made by plasmid and the used cells were the iPSCs of patient. In this case, the three types of systems were used, namely ZFN [79], TALEN [80], and CRISPR [81]. In the first approach, the CFTR correction resulted in restored expression of the mature CFTR glycoprotein and restoration of CFTR chloride channel function in iPSC-derived epithelial cells [79]. Concerning to the approach using TALENs, clonal populations of corrected CF-iPSCs were isolated and expanded [80]. About the third approach, the mutation was precisely corrected using CRISPR to target corrective sequences to the endogenous CFTR genomic locus in combination with a completely excisable selection system which significantly improved the efficiency of this correction [81]. As second approach, the HDR was used to correct the mutated locus in cultured intestinal stem cells of patients. Here, the delivery method was also a plasmid and the used system was the CRISPR/Cas9 resulting in the expression of the corrected and fully functional allele. Therefore, this study provided the proof of concept for gene correction by homologous recombination in primary adult stem cells derived from patients with a single-gene hereditary defect [82]. Concerning to this disease another method was applied where small/short DNA fragments and sequence-specific TALENs were used to correct the target mutation present in cell- derived patient-iPSCs. The delivery method was once again a plasmid [78].

Another example is the haemophilia A, a common genetic bleeding disorder caused by various mutations in the blood coagulation factor VIII encoded by F8 gene, commonly chromosomal inversions. An approach used to cure this disease consisted in a correction of the inversion based on the NHEJ pathway using plasmid-delivered TALENs in iPSCs, where the disease model and successive correction were achieved [83]. Other applied method with the same purpose employed the CRISPR/Cas9 system to correct the inversion with patient iPSCs. Here, the delivery method was also a plasmid, but in this case encoding the Cas9 protein and the sgRNA, and the pathway that mediated the strategy was also the NHEJ. The inversion-corrected iPSCs without detectable off-target mutations were isolated based on whole-genome sequencing or targeted deep sequencing [84]. Another application of genome editing using stem cells is the sickle-cell anemia, which is the most common human genetic disease caused by a single mutation in human β-globin (HBB) gene [85]. In this case, the correction of the target gene was mediated by HDR, and the delivery method and used cells were once more a plasmid and patient iPSCs, respectively. In the first approach, the applied system was based on ZFNs [86]. On the other hand, TALENs were also employed to correct the target gene [85]. More recently, a study demonstrated that the CRISPR/Cas9 system using a specific guide RNA and Cas9 was much more efficient in targeting and correcting the gene of interest than ZFNs and TALENs, also by HDR [87]. Concerning to this disease other type of therapies were still applied, namely the site-specific correction of the sickle mutation in hematopoietic stem cells of the patient that would originate the permanent production of normal red blood cells, using ZFNs and a homologous donor template [88]. β-thalassemia is other example where genome editing has been applied to correct the mutation of the gene of interest via HDR using iPSCs of the patient via CRISPR/Cas9 combined with the piggyBac transposon. The wild-type gene was restored and no off-target effects were detected with this approach. This disease is one of the most common genetic diseases worldwide that is caused by mutations also in HBB gene [89]. Other approaches employed included ZFNs [90] and TALENs [85]. In the first, using comparative genomic hybridization and whole-exome sequencing, the results revealed substantial but different genomic variations that occurred at factor-induced somatic cell reprogramming and zinc finger nuclease-aided gene targeting steps [90]. Concerning to the second approach, the engineered TALENs were highly specific and generated minimal off-target effects. These combined with piggyBac transposon originated corrected patient-derived hiPSCs with full pluripotency and a normal karyotype [85]. Another study applied ZFNs in the genome editing of primary fibroblasts and iPSCs generated from a mouse model for radiosensitive severe combined immunodeficiency (RS-SCID), a rare disorder characterized by cellular sensitivity to radiation and the absence of lymphocytes due to impaired DNA- dependent protein kinase (DNA-PK) activity, encoded by PRKDC gene. The HDR-mediated edition rescued the kinase activity overcoming the radiosensitivity and enabling T-cell maturation [91]. X-linked severe combined immunodeficiency (SCID-X1), a genetic disease that leaves newborns at high risk of serious infection with a predicted lifespan of less than one year in the absence of a matched bone marrow donor, was another focus of therapy by genome editing. This disease is caused by mutations in the gene encoding the Interleukin-2 receptor gamma chain (IL-2Rγ)

which leads to a lack of functional lymphocytes. The applied approach was based on utilization of patient iPSCs and TALENs to generate gene corrected iPSCs lines also via HDR [92]. Genetic correction of patient-derived iPSCs by TALENs or CRISPR/Cas9 was also applied as gene therapy of Duchene muscular dystrophy (DMD), which is a severe muscle-degenerative disease caused by a mutation in the dystrophin gene. The approach that restored the full-length dystrophin protein in differentiated skeletal muscle cells was the exon knock-in [93]. HIV is other important focus of gene therapy. The apparent elimination of HIV-1 in a patient treated with an allogeneic stem cell transplant homozygous for a naturally occurring CCR5 deletion mutation is in accordance with the concept that a single dose of HIV-resistant hematopoietic stem cells can provide disease protection, however the frequency of this type of natural donors is low [94]. CCR5 is the major co-receptor used by HIV-1 and individuals homozygous for 32bp deletion in this co- receptor are resistant to HIV-1 infection. Thus, engineered ZFNs were used to disrupt the CCR5 gene in human hematopoietic stem/progenitor cells via NHEJ pathway leading to efficient disruption of the gene due to the introduction of indels at the break site, without constraint of the long-term expression of a foreign transgene [95]. However, some virus strains use CXCR4 co-receptor in place of or in addition to CCR5, so in order to resolve this problem a method using ZFNs that, when introduced into human T cells, disrupt the gene CXCR4 by cleavage and NHEJ may be applied [96]. In one other approach to this disease iPSCs homozygous for the naturally occurring CCR5 deletion were generated through genome editing of wild-type iPSCs using TALENs or CRIPSR/Cas9, exactly mimicking the natural mutation. The frequency of homologous recombination with CRISPR/Cas9 was four times greater than with TALENs. The monocytes and macrophages differentiated in vitro from these mutated iPSCs presented resistance to HIV infection [97]. Considering that most cancers, including lymphomas, leukaemia, and several solid tumours, are associated with genomic rearrangements such as chromosomal translocations, the CRISPR/Cas9 system should be taken into account as a valuable tool to generate in vitro models to study these diseases. A method like the CRISPR/Cas9 is able to induce desired chromosomal translocation which may be essential to study the oncogenic role of chromosome translocations and to develop new therapies for these diseases as well as it can be adaptable for other genomic rearrangements such as deletions or insertions that are also often associated with cancer. These translocations can either generate a fusion between two genes within intronic sequences resulting in the expression of a novel fusion protein that presents oncogenic potential or, in alternative, bring a silent protooncogene near an active enhancer or promoter element, contributing to the increase of its expression. A specific example of such application is the combination of the CRISPR/Cas9 with HDR in order to select hMSCs that harbour the oncogenic translocation EWSR1-WT1 resulting in expression of the EWSR1-WT1 fusion protein found in the aggressive desmoplastic small round cell tumour which is a rare sarcoma [98]. Another example is the t(11;22)(q24;q12) chromosomal translocation involving EWSR1 and FLI1 loci that is a hallmark of Ewing sarcoma believed to occur in hMSCs. The resultant fusion gene induced in hMSCs was not compatible with hMSC viability/homeostasis so edited cells were progressively lost in culture. Thus, taking into account that the Ewing sarcoma is composed by poorly differentiated cells of

unknown origin, the model was tested in human iPSCs revealing the maintenance of this translocation [37]. In another approach, human iPSCs were transformed with a non-viral vector carrying a gene of interest, in this case, the IL24 transgene which demonstrates a significant anti-tumour activity. The mechanism used to transform the cells was by TALENickases, which are TALENs that generate single-strand breaks. Then, the iPSCs were differentiated into MSCs that showed high expression of IL24, and efficiently differentiated into osteoblasts, chondrocytes and adipocytes. The overexpression of IL24 selectively inhibited the growth of melanoma cells and induced apoptosis [4].

Taking into account the above information, the CRISPR/Cas9 method may be a strong potential “bench-to-bedside” tool. Moreover, considering the properties of azurin as an anticancer protein and the ability of the MSCs to be vehicles for drug delivery to the tumour sites as described above, a strategy that includes genetically modifying MSCs to carry azurin to the target site may be a promising approach that should be carefully accessed as an anticancer therapy. The initial steps of this strategy, namely the designing and testing of gRNAs to produce DSBs in a genomic safe harbour, and the design of a donor template that leads to the incorporation of the azurin gene that encodes this protein into this locus via CRISPR/Cas9 is the scope of this master thesis.

2. Motivation and Workflow Since cancer is still one of the main causes of death in the world and the side effects caused by systemic therapies and the related non-specificity are both recurrent, huge challenges remain in the fight against this disease. The genetic engineering of stem cells as vectors for delivery of therapeutic transgenes is rising as a more specific alternative to systemic therapies in the oncologic field. This type of strategy allows the precise delivery of therapeutic proteins into the cancer cells, leaving the normal cells unaffected. The proposal of this work is the employment of CRISPR/Cas9 system to stably insert a codon- optimized form of azurin into a genomic safe harbour within the genome of MSCs in order to these cells secret this anticancer protein in the vicinity of cancer cells without recurring to viral transfections methods.

The main objectives of this work are: ✓ The test of guides in HEK293T cells and MSCs; ✓ The construction of donor template (see Figure 3).

Figure 3 Scheme of workflow to obtain the final donor template constituted by homology arms (5’HA and 3’HA) flanking human IL6-promoter, humanized Azurin (hAzurin) gene and P2A - eGFP+SV40polyA sequence. This donor template will be incorporated into the genome of MSCs by HDR via CRISPR/Cas9 technology (see Figure 4).

Figure 4 Scheme of proposed workflow to obtain the donor template incorporated into the genome of MSCs.

3. Materials and Methods

3.1 Cell Culture

All cell lines were grown in a humidified atmosphere at 37ºC with 5% CO2 (Binder CO2 incubator C150). Cell lines A549 (lung), HT-29 (colon), MCF-7 (breast) and HEK293T (isolated cells from human embryonic kidneys, transformed with large T antigen) were obtained from ECACC and cultured in T-flasks with DMEM medium (GIBCO™) supplemented with 10% of heat-inactivated FBS (GIBCO™), 100 IU/ml penicillin, and 100mg/ml streptomycin (PenStrep, GIBCO™), referred to as D. For their maintenance, cells were passaged 3 times per week by chemical detaching with Trypsin 0.05%. Concerning to Human Bone Marrow-derived MSCs, these were obtained from adult volunteer donors, after informed consent, at Instituto Português de Oncologia de Lisboa, Francisco Gentil and provided to us by the stock of the Stem Cell Bioengineering and Regenerative Medicine Lab from iBB. Cells were cultured in StemPro® MSC SFM XenoFree medium (GIBCO™) (XF medium). For their maintenance, cells were passaged 3 times per week depending on their development by chemical detaching with Tryple. The donor tested was the M83A15.

3.2 Western Blot MCF-7, HT-29 and A549 cells were plated (5x105cells/well) in 6-well plastic plates. For cell lysis, cells were washed twice with 1ml of PBS and then incubated with 100μL of catenin lysis buffer (1% Triton X-100, 1% Nonidet-P40 in PBS) supplemented with 1:7 proteases inhibitor (Roche Diagnostics GmbH, Germany) and 1:100 phosphatases inhibitor (Cocktail 3, Sigma Aldrich) for 10 min at 4°C. After that, lysed cells were scrapped and vortexed three times, during 10s each time, centrifuged at 15400xg (B.Braun Sigma-Aldrich 2K15), 4°C for 10 min and quantified by Bradford method (BioRad Protein Assay). 20μg (for total form of proteins) or 30μg (for phosphorylated form of proteins) of total protein per sample were prepared, denatured at 95°C for 5 min and placed on the ice to avoid the formation of complexes. Regarding the supernatant of transfected MSCs, a sample of 20μL was mixed with 5μL of loading buffer, to verify the presence of Azurin in such conditioned media. Before loading to the gel, samples were denaturated at 100ºC for 5 min. Total protein samples were separated by electrophoresis in 15% polyacrylamide gel and electrotransferred to a nitrocellulose membrane (RTA Transfer Kit, BioRad) following the manufacturer’s instructions of the Trans-Blot Turbo Transfer System (BioRad). The non-specific binding sites were blocked with 5% (w/v %) not-fat dry milk in PBS-Tween20 (0.5%) or 5% BSA (phosphorylated proteins) in 1x PBS during 1h by shaking at room temperature and, after that, the membrane was incubated also by shaking at 4ºC, overnight with correspondent primary antibody. In the next day, the membrane was washed with PBS-Tween20 (0.5%) and probed with the respective secondary antibody, conjugated with horseradish peroxidase, at room temperature by shaking again for another 1h. The membrane was revealed adding ECL substrates (Pierce) and capture the chemiluminescence by Fusion Solo (Vilber Lourmat) equipment. All protein levels were normalized by the correspondent GAPDH level. All used antibodies are detailed in appendix (Table 17 in section 1).

3.3 DNA purification

3.3.1 Genomic DNA Total DNA from HEK293T cells was isolated with DNeasy® Blood & Tissue Kit (Qiagen), according to which the cultured cells were lysed with proteinase K and buffer AL, containing a chaotropic salt, at 56ºC for 10min. After the addition of ethanol, the sample was loaded onto the DNeasy Mini spin column, centrifuged at 6.000xg (VWR) for 1min and washed in two steps to purify DNA. Purified DNA was eluted in 100µl of water and quantified by NanoDrop TM 2000 (ThermoFisher ND-2000) [99].

3.3.2 Plasmid DNA Plasmid DNA was extracted using NZYMiniprep Kit (NZYTech) according to manufacturer’s instructions. Briefly, bacteria were pelleted and resuspended in buffer A1 containing RNase A. Cells were lysed by addition of buffer A2 containing NaOH and SDS. After neutralization by addition of buffer A3, cleared lysate was obtained by centrifugation at 18.000xg for 7 min. Plasmid DNA was selectively adsorbed on the silica gel-based NZYTech plasmid spin column while impurities like salts and proteins were washed away in a wash step. Purified DNA was eluted in 30µl of elution buffer and quantified by NanoDrop TM 2000 (ThermoFisher ND-2000) [100].

3.3.3 PCR products 1 PCR products were precipitated with ⁄10 of the volume of sodium acetate, 3M pH 5.2, and 2.5 volumes of 100% ethanol, vortexed and stored at -20ºC overnight. All samples were centrifuged at 18.000xg (Microfuge® 18 Centrifuge, Beckman Coulter™) for 30min. The supernatant was removed and the pellets were washed with 70% ethanol (500µl), centrifuged for 10min and the pellet was dissolved in 15µl of TE. Samples were separated by electrophoresis in 1.5% agarose gel (75V) and the bands of interest were excised from the gel with a scalpel. NZYGelpure kit (NZYTech) was used to purify DNA from agarose in agreement with the manufacturer’s instructions. Briefly, each gel slice was melted in 3 volumes (v/w) of binding buffer at 55-60ºC and loaded onto a mini-column with silica-gel based membrane. DNA was eluted in 30µl of elution buffer and quantified by NanoDrop TM 2000 (ThermoFisher ND-2000). For PCR clean-up, which is referred when applied, the PCR product was directly purified by addition of binding buffer and loaded onto a mini-column, following a protocol similar to described previously [101] .

3.4 Guide design, cloning and testing

3.4.1 Guide Design The 20 nucleotides followed by a NGG corresponding to the guide RNA (gRNA) sequence were designed with the help of three online CRISPR Design Tools (Wellcome Trust Sanger Institute (WTSI) Genome Editing, CRISPOR [102], and CRISPR Design from Zhang Lab, MIT) based on the highest score and the lowest number of predicted off-targets in exonic regions. The genome location selected to target was the first intron of PPP1R12C gene known as AAVS1 locus. The pairs of oligonucleotides corresponding to both strands of each guide sequence were synthetized by Sigma-Aldrich©.

3.4.2 Guide Cloning The oligonucleotides were resuspended in Tris.HCl pH8 10mM to a final concentration of 1mM by incubation for 15min at room temperature with shaking. The oligonucleotides were diluted to 100µM with ultrapure water, and phosphorylated and annealed in a reaction containing 10µM of both sense and antisense oligonucleotides (see Table 2), 1x T4 DNA Ligase Buffer (ThermoFisher), 1mM of ATP, 10U of PNK (ThermoFisher), and ultrapure water to a final volume of 10µl, incubated for 30-40min at 37ºC and for 5 min at 95ºC. Then, the reactions were cooled down on the bench (~2,5h) to the room temperature, allowing the efficient annealing of the oligonucleotide pairs.

Table 2 Guide sequences with BbsI linkers for cloning into px459 plasmid.

Guide sense strand antisense strand

1 caccgCGAATTGGAGCCGCTTCAAC aaacGTTGAAGCGGCTCCAATTCGc

2 caccgCCAGCGAGTGAAGACGGCAT aaacATGCCGTCTTCACTCGCTGGc

3 caccgCAATCCTATTATAGCCGAAT aaacATTCGGCTATAATAGGATTGc

4 caccgCGGCCAGCGGTTTGGTAACG aaacCGTTACCAAACCGCTGGCCGc

Prior to the ligation step, all annealed oligonucleotides were diluted 1:250 with ultrapure water. The mixes for ligation step were prepared in 0.5ml microcentrifuge tubes containing in a final volume of 10µl: 50ng of vector px459 [pSpCas9(BB)-2A-Puro (PX459, Addgene plasmid # 62988) [103]] previously digested with BbsI restriction enzyme; 1µl of oligo duplex (1:250); 1x T4 DNA Ligase Buffer (ThermoFisher); 0.5mM of ATP; and 5U of T4 DNA Ligase (ThermoFisher). As a control, 50ng of vector px459 were ligated without an insert in the same conditions. All tubes were incubated overnight at 8ºC. Competent E.coli DH5 bacteria were used to transform with ½ of ligation products on the next day: 5µl of each ligation were incubated on ice with 100µl of competent bacteria in 2ml microcentrifuge tubes during 15-30min; after 1min30s of heat shock at 42ºC cells were cooled down on ice for 1-2min. 900µl of LB medium were added to tubes, and these were left to recover for 1h at 37ºC with shaking (220rpm). Bacteria were pelleted by brief centrifugation, supernatant was discarded, and the pellet resuspended in the remaining liquid and plated onto LB agar plates with 100µg/ml of ampicillin. Cells were incubated overnight at 37ºC and isolated colonies were picked in 3ml of ampicillin-containing LB medium and grown overnight at 37ºC and 220rpm. Plasmid DNA was extracted using NZYMiniprep Kit as described in 3.3.2. Sanger sequencing was performed at GATC Biotech. After the sequence confirmation, the correct cells were stored in 15% glycerol at -80ºC.

3.4.3 Cleavage efficiency test of the guides The test was made with HEK293T cells and MSCs.

3.4.3.1 HEK293T cells Approximately, 130000 HEK293T cells/well were plated in a final volume of 1ml in a 24-well plate and incubated until reaching 70-80% of confluence. After that, cells were transfected using Lipofectamine® 2000 Transfection Reagent (Invitrogen™). The px459 plasmids with the guides (gRNA plasmids) and the control empty px459 plasmid were diluted to final concentration of 200ng/μl and ~500ng were transfected per well. Firstly, 50μl of Opti-MEM™ medium (GIBCO™) were mixed by pipetting “up and down”, with 2μl of Lipofectamine® 2000 (A), or with 3μl of diluted plasmid (B) and incubated for 5min at room temperature, before mixing both A and B, in dropwise manner and incubating for more 15min at room temperature. The final 100μl were added to the cells dropwise to the correspondent well containing 1ml of medium and further mixed by pipetting “up and down”. The selection of transfected cells with puromycin started 24 hours after transfection by replacing the medium in each well with medium containing puromycin (2μg/ml) with exception of the control well that has only cells. This selection was performed during 48h, so after 24h the medium containing puromycin was renewed. After selection, cells were collected from all wells except the well with no transfected cells to which medium containing puromycin had been added since all cells were dead, as expected. Cells were washed with PBS and collected with trypsin, pelleted by centrifugation and stored at -80ºC for further analysis. This protocol was performed with the assistance of Doctor Sandra Martins from iMM. The cleavage efficiency of the guides was tested with GeneArt™ Genomic Cleavage Detection Kit (Invitrogen™) [104], following the manufacturer’s instructions. Firstly, a mix with cell lysis buffer (50μl) and protein degrader (2μl) per each cell pellet was prepared. The respective cell pellet was resuspended in 52μl in 0.2ml microcentrifuge tubes, vortexed and incubated in thermocycler first for 15min at 68ºC and then for 10min at 95ºC. Meanwhile, 1:1 (Fw/Rev) mix of each pair of primers (see Table 3) that amplify the region where Cas9 cuts was prepared.

Table 3 Primers used in Guides’ Cleavage efficiency test.

Name Sequence 5’ to 3’ Type Tm [ºC] %GC Reaction

Corte1.Fw TTCCCCGTTGCCAGTCTCGAT Forward 66 57 Guide test

Corte1.Rev AGAGAGACGGCAGCGTTAGA Reverse 62 55 Guide test

Corte2.Fw CAGGTTCCGTCTTCCTCCAC Forward 64 60 Guide test

Corte2.Rev AAGAGGATGGAGAGGTGGCT Reverse 62 55 Guide test

Corte3.Fw GGCAAGGGCTCTGTCTACAG Forward 64 60 Guide test

Corte3.Rev CAGGACCTCACACTGTCACC Reverse 64 60 Guide test

Corte4.Fw GCTCTTTACCAGCCTGTCCA Forward 62 55 Guide test

Corte4.Rev ACAATGAAGGAGGTGCTGGG Reverse 62 55 Guide test

The mixes for PCR reactions to verify the amplification of the regions of interest were performed in a final volume of 25μl, adding each pair of primers (0.5μl of 10μM Fw/Rev mix) and 12.5μl of Amplitaq Gold® 360 Master Mix. 2μl of each cell lysate were added to 24μl of respective mix, while for the PCR control kit 1μl of control template & primers was added also to 12.5μl of Amplitaq Gold® 360 Master Mix to a final volume of 25μl. A control tube with 2μl of water instead of lysate was used for each pair of primers. The conditions used in the thermocycler are presented in Table 4. After these reactions, 2μl of PCR product mixed with 10μl of water and 2μl of 6x loading dye were loaded on 2% agarose gel (EtBr, 0.5xTBE) in order to verify the amplification of PCR product of interest.

Table 4 PCR conditions to verify the amplification of the regions of interest.

Stage Temperature Time Cycles Initial denaturation 95ºC 10min 1x Denaturation 95ºC 30s

Annealing 61ºC 30s 40x Extension 72ºC 30s Final extension 72ºC 7min 1x

The next step was the cleavage assay using a thermal cycler program to randomly anneal the PCR fragments with and without indels to form heterogeneous DNA duplexes. First of all, 3μl of PCR product were added to 1μl of 10x Detection Reaction Buffer in a final volume of 9μl, while for PCR control provided in the kit only 1μl of PCR product was added to similar mix. Duplicate re-annealing reactions were made with a negative enzyme control for each sample in order to distinguish the background bands from the expected cleavage product. The conditions used in thermocycler were: a first step at 95ºC for 5min; a second step with a temperature drop between 95ºC-85ºC at -2ºC/s; and a third step with a temperature drop between 85ºC-25ºC at -0.1ºC/s. After denaturation and re- annealing, 1μl of Detection Enzyme was added to all test samples whereas 1μl of water was added to all negative control samples, mixed by pipetting and incubated at 37ºC for 1h. 2μl of 6x loading dye were added to each sample, and loaded on 2% agarose gel (EtBr, 0.5xTBE) in order to verify the cleavage efficiency of the chosen guides by observing the respective cleavage products.

3.4.3.2 MSCs The microporation protocol was performed twice using in the first time ~38000 cells/cm2 and ~7400 cells/cm2 in the second time. The microporation protocol was based on previous publications from the group [105]. The cells were transferred to 1.5ml microcentrifuge tube and centrifuged at 1250rpm for 7min. After that, the supernatant was discarded, the pellet was resuspended in Resuspension Buffer R, which is provided by the microporator manufacturer and kept on ice. 10μg of plasmid DNA - px459 with Guide 3 cloned or px459 without guide - were added to the microcentrifuge tube in a total volume of 120μl. A microcentrifuge tube with cells alone was used as control. 100μl of each mix, with cells and DNA or cells only (control), were carefully aspirated into the Neon® Pipette avoiding the emergence of air bubbles.

The Neon® Transfection (Invitrogen™) was made following the manufacturer’s instructions [106], with the following microporation protocol: 1000mV, 40ms, 1 Pulse. Immediately after the electric pulse, cells were transferred from the Neon® Pipette to 900μl of restoring medium, the Opti-MEM™ medium (GIBCO™), to increase the cell viability after transfection. The microporated cells were incubated at room temperature for 5min and plated in 6-well plates previously coated with CELLstart™ substrate and StemPro® MSC SFM XF medium (GIBCO™) in a final volume of 2ml per well. Cells were incubated at 37ºC and 5% CO2 during 48h. After this time, the selection with puromycin was initiated with either 0.5, 1 or 2.5μg/ml. Medium was changed every day for at least 2 days, after which medium was replaced by StemPro® MSC SFM XF medium (2ml/well) in all wells. 50% (1ml/well) of the medium was changed every two days until cell harvest.

3.5 Cloning into pBluescript II KS plasmid (pKS) 20µg of pKS (Stratagene) DNA were hydrolysed with 150U of EcoRV enzyme (ThermoFisher) in a final volume of 200µl of 1x Red Buffer (ThermoFisher) for 1h at 37ºC. After that, 5U of Fast AP (ThermoFisher) were added for another 1h at 37ºC. The DNA was precipitated with ethanol overnight and run on agarose gel and purified as described in section 3.3.3. Prior to ligation step, PCR fragments were phosphorylated and blunted in a reaction containing 20µl of DNA fragment, 1x T4 DNA Ligase Buffer (ThermoFisher), 0.5mM of dNTPs, 0.5mM of ATP, 1.5µl of T4 DNA polymerase (5U/µl) or Klenow polymerase (10U/µl) (ThermoFisher), and 15U of PNK (ThermoFisher) in a final volume of 30 µl. This mix was incubated at 37ºC for 1h and 15min at 75ºC. Ligation was carried out in a final volume of 10µl of 1x T4 DNA Ligase Buffer (ThermoFisher) containing 50ng of linearized and dephosphorylated pKS vector, 0.5mM of ATP, 5U of T4 DNA Ligase (ThermoFisher) and 6.5µl of purified DNA fragment at 8ºC overnight. Control ligation containing vector alone was made in parallel. Competent E.coli DH5 bacteria were transformed with ½ of ligation products on the next day as described in 3.4.2. Plasmid DNA was extracted using NZYMiniprep Kit (NZYTech) according to manufacturer’s instructions described in 3.3.2. To identify the clones with correctly inserted DNA fragments, plasmid DNA was hydrolysed by restriction enzymes HindIII FD (ThermoFisher) and EcoRI FD (ThermoFisher) in a following reaction: 3µl of plasmid DNA and 0.5FDU of each enzyme in 20µl of 1x Buffer FD (ThermoFisher). The mix was incubated for 1h at 37ºC and analysed on 1.2% agarose gel. The positive clones were Sanger sequenced at GATC Biotech and, after the confirmation, stored in 15% glycerol at -80ºC.

3.6 PCR Amplification

3.6.1 Fragments Amplification by PCR PCR reactions were made to amplify the IL6-promoter and homology arms, hAzurin, and eGFP+SV40polyA genes using as templates genomic DNA of HEK293T cells, pVAX-engineered Azurin plasmid DNA (custom synthesized by NZYTech) and pEGFP-N1 plasmid DNA (Clontech), respectively.

Table 5 Primers used to amplify the fragments of donor template.

Name Sequence 5’ to 3’ Type Tm [ºC] %GC Fragment

5HA.G3 Fw GGCTCAAGTGATCTCCCATCT Forward 64 52 5’HA

IL65HA.G3 Rev GTCTCTTGCAGGAGGATCCGGGAGGGTGACTGGCTTTT Reverse 60 | 60 58 | 58 5’HA

5HAIL6.G3 Fw AAAAGCCAGTCACCCTCCCGGATCCTCCTGCAAGAGAC Forward 60 | 60 58 | 58 IL6-prom

AzIL6 Rev CCCCTTTTCATAGCATCCATAGCTGGGCTCCTGGAGGG Reverse 58 | 62 45 | 72 IL6-prom

IL6Az Fw CCCTCCAGGAGCCCAGCTATGGATGCTATGAAAAGGGG Forward 62 | 58 72 | 45 hAzurin

TCGCCAGCCTGCTTCAGCAGGCTGAAGTTAGTAGCCTTCAAG P2AAz Rev Reverse 60 | 60 67 | 50 hAzurin GTCAGGGTTCCTT GCTGAAGCAGGCTGGCGACGTGGAGGAGAACCCTGGACCTA eGFP+ P2AGFP Fw Forward 60 | 58 67 | 61 TGGTGAGCAAGGGCGAG SV40polyA

3HApolyA.G3 eGFP+ ACCTGGCTGTGTCATTTCTTTAAGATACATTGATGAGTTTGGA Reverse 58 | 60 45 | 30 Rev SV40polyA

polyA3HA.G3 Fw TCCAAACTCATCAATGTATCTTAAAGAAATGACACAGCCAGGT Forward 60 | 58 30 | 45 3’HA

3HA.G3 Rev TATGGTCTCGCTCTGTCACC Reverse 62 55 3’HA

Table 6 Size of the amplified fragments to donor construction.

Fragment Size [bp]

5’ Homology Arm 459

IL6-promoter 1280

hAzurin 506

eGFP+SV40polyA 1024

3’ Homology Arm 461

The promoter sequence of IL6 gene [107] was amplified with 2.5U of NZYLong DNA Polymerase (NZYTech) in a final volume of 25µl containing: 1x Reaction Buffer (NZYTech), 0.4mM of dNTPs, 0.4µM of each primer, forward and reverse, and 15ng of correspondent DNA. The conditions used in the thermocycler are presented in Table 7. This PCR product was purified according to section 3.3.3 and consequently reamplified with Phusion, as described below.

Table 7 PCR conditions to amplify the promoter sequence of IL6 gene with NZYLong DNA Polymerase.

Stage Temperature Time Cycles Initial denaturation 95ºC 2min 1x Denaturation 95ºC 30s

Annealing 55ºC-58ºC-60ºC-62ºC 45s 30x Extension 68ºC 1.30min Final extension 68ºC 5min 1x

The PCR reactions were performed in a final volume of 25µl of 1x Phusion HF Buffer (ThermoFisher) containing: 0.5U of Phusion High-Fidelity DNA Polymerase (ThermoFisher), 0.4mM of dNTPs, 0.5µM of each primer, forward and reverse, and 1µl of correspondent DNA. The conditions used in the thermocycler are indicated in Table 8. The promoter sequence of IL6 gene was purified and cloned into pKS vector as described in section 3.5.

Table 8 PCR conditions to amplify the promoter sequence of IL6 gene, hAzurin and eGFP+SV40polyA with Phusion High-Fidelity DNA Polymerase.

Stage Temperature Time Cycles Initial denaturation 98ºC 2min 1x Denaturation 98ºC 10s 55ºC-58ºC-60ºC-62ºC (IL6-promoter) Annealing 54ºC-56ºC-58ºC-60ºC 45s (hAzurin and 30x eGFP+SV40polyA)

1.30min (IL6-promoter) Extension 72ºC 1min (hAzurin and eGFP+SV40polyA) Final extension 72ºC 5min 1x

The promoter sequence of IL6 gene in one of the resulting clones was re-amplified with Phusion High-Fidelity DNA Polymerase according to protocol presented in Table 8 but with thirty-five cycles instead thirty cycles including five initial cycles with an annealing temperature of 54ºC and thirty consequent cycles with an annealing temperature of 62ºC. The resultant PCR product was treated with PNK (ThermoFisher) for 1h at 37ºC, as described in section 3.5, diluted 1:2 and purified following the PCR clean-up protocol referred in section 3.3.3. The purified DNA was cloned into pKS vector. The promoter sequence in one of the resulting clones was re-amplified with Phusion High- Fidelity DNA Polymerase following the protocol presented in Table 8 but with an annealing temperature of 60ºC. The resultant PCR product was purified following the PCR clean-up protocol, digested with DpnI restriction enzyme (New England Biolabs) adding 0.5µl of enzyme and 0.5µg of DNA in a final volume of 25µl of 1x NEBuffer (New England Biolabs) by incubation for 15min at 37ºC, and purified by gel extraction.

The homology arms were amplified with KAPA2G Fast HotStart ReadyMix PCR Kit (KAPABIOSYSTEMS) in a final volume of 25µl containing: 1x KAPA2G Fast HotStart ReadyMix, 0.5µM of each primer, forward and reverse, and 15ng of correspondent DNA. The conditions used in the thermocycler are presented in Table 9. These PCR products were purified being that the PCR

clean-up protocol was applied in the 5’HA purification while the gel extraction and subsequent purification were applied to 3’HA.

Table 9 PCR conditions to amplify the Homology Arms with KAPA2G Fast HotStart ReadyMix PCR Kit.

Stage Temperature Time Cycles Initial denaturation 95ºC 3min 1x Denaturation 95ºC 15s

Annealing 60ºC-62ºC-64ºC 15s 35x

Extension 72ºC 1s

Final extension 72ºC 1min 1x

3.6.2 PCR ligation The strategy for the construction of the donor vector was based on PCR ligation. Primers used are presented in Table 10.

Table 10 Primers used to amplify the ligations between fragments of donor template (see Table 5).

Fragment PCR fragment DNA 1 DNA 2 Primers size I: IL6-prom + IL6- hAzurin 5HAIL6.G3 Fw – P2AAz Rev 1748 hAzurin prom II: hAzurin + eGFP+SV40 hAzurin IL6Az Fw – 3HApolyA.G3 Rev 1512 eGFP+SV40polyA polyA

The Ligation I was amplified in a final volume of 25µl containing 9ng and 18ng of IL6-promoter and hAzurin DNA, respectively, following the protocol correspondent to Phusion High-Fidelity DNA Polymerase (ThermoFisher). The conditions used in the thermocycler are presented in Table 8 but with a gradient temperature in annealing step of 60ºC-62ºC-64ºC and an extension time of 2.30min. The resultant PCR product was purified.

The Ligation II was amplified in a final volume of 25µl containing 1µl of each correspondent DNA diluted 1:10, following the protocol correspondent to NZYLong DNA polymerase (NZYTech). The conditions used in the thermocycler are indicated in Table 7 but with thirty-five cycles instead thirty cycles where the annealing temperature was 60ºC and the extension time was 2min. This PCR product was purified and cloned into the pKS vector. The Ligation II was re-amplified from one of the clones obtained with Phusion High-Fidelity DNA Polymerase (ThermoFisher) in a final volume of 25µl containing 15ng of correspondent DNA. The conditions used in the thermocycler are presented in Table 8 but with an annealing temperature of 60ºC and an extension time of 2min. The resultant PCR product was purified following the PCR clean- up protocol.

The Ligation II + 3’HA was performed using the primers presented in Table 11.

Table 11 Primers used to amplify the ligation between Ligation II and 3’HA (see Table 5).

PCR Fragment DNA 1 DNA 2 Primers fragment size

II+3’HA Ligation II 3’HA IL6Az Fw – 3HA.G3 Rev 1930

The Ligation II+3’HA was performed in a final volume of 25µl of 1x PCR Buffer (GRiSP) containing 1U of Xpert HighFidelity DNA Polymerase (GRiSP), 0.8µM of each primer, forward and reverse, and 15ng of each correspondent DNA. The conditions used in the thermocycler are presented in Table 12. The resultant PCR product was purified.

Table 12 PCR conditions to amplify the ligation between Ligation II and 3’HA with Xpert HighFidelity DNA Polymerase.

Stage Temperature Time Cycles Initial denaturation 95ºC 1min 1x Denaturation 95ºC 15s

Annealing 60ºC 15s 35x

Extension 72ºC 1.30min

Final extension 72ºC 3min 1x

4. Results

4.1 Selection of an appropriate MSCs donor for genome editing for anticancer purpose The M83A15 donor was tested in order to select an appropriate donor of MSCs for the test of guides in section 3.4.3.2, and consequently for the therapeutic purpose of this work. As discussed before, MSCs may have a controversial role in cancer development or treatment; therefore, we decided to test the effects of its conditioned medium on some signalling pathways associated to tumour progression. In addition, two Western Blot analysis were performed to verify the presence of azurin with 14kDa of molecular weight in conditioned medium (CM) (see Figure 5) and cell lysates (Figure 6) of MSCs isolated from M83A15 donor transfected with pVAX-engineered Azurin to ensure the ability of these cells to express and secrete azurin to the extracellular media. pVAX-GFP was used in parallel as a control of the transfection parameters.

Azurin (14kDa) MW

kDa Ctrl 1 Ctrl 2 pVAX-Azurin pVAX-GFP

75 - 63 - 48 - 35 - 25 - 20 - 17 - 11 -

Figure 5 Western Blot analysis for detection of azurin in CM of tested MSCs. Ctrl 1: cells without microporation; Ctrl 2: cells microporated without plasmid; pVAX-Azurin: cells microporated with pVAX-engineered Azurin plasmid; pVAX-GFP: cells microporated with pVAX-GFP plasmid (Thermo Fisher Scientific, courtesy of Profs Miguel Prazeres and Gabriel Monteiro, iBB/IST). The marker used was the NZYColour Protein Marker II (NZYTech).

Figure 6 Western Blot analysis of expression of Azurin and GFP in cell lysates of tested MSCs. Ctrl 1: cells without microporation; Ctrl 2: cells microporated without plasmid; pVAX-Azurin: cells microporated with pVAX- engineered Azurin plasmid; pVAX-GFP: cells microporated with pVAX-GFP plasmid. Controls: Actin (A); GAPDH(B); Test: Azurin (C); GFP(D). The marker used was the NZYColour Protein Marker II (NZYTech).

Another set of Western Blot analysis were carried out to verify the influence of conditioned media of MSCs and azurin-producing MSCs, isolated from M83A15 donor, on MCF-7 cells (see Figure 7 and Figure 8), and on HT-29 and A549 cells (see Figure 9-Figure 13), concerning the protein expression of important signalling pathways associated to cell proliferation, such as PI3K/Akt or Src. Importantly, azurin has been shown to inhibit cell proliferation through these pathways which was also tested. Such information may provide important insights regarding the behaviour of cancer cells in the presence of the conditioned medium of this particular donor.

Cells were plated in 6-well plastic plates and were placed overnight at 37ºC and 5% CO2 to adhere. On the next day, cells were treated with three different conditions. In the case of MCF-7 cells: control 50%D/50%XF; test 50%D/50%CM; and test 100%CM where CM is the conditioned medium of MSCs that were not microporated. On the other hand, with HT-29 and A549 cells: control 50%D/50%XF; test 50%D/50%CM; and test 50%D/50%Az where CM and Az are the conditioned media of MSCs that were microporated without plasmid or with pVAX-engineered Azurin plasmid (NZYTech), respectively. After 24h, cells were lysed and protein expression was analysed by Western-Blot as described in the section 3.2.

A GAPDH (37kDa) B PI3K (60kDa) C Akt (60kDa) MW MW MW D/XF D/CM CM D/XF D/CM CM kDa D/XF D/CM CM kDa kDa 48 - 35 - 25 - 75 - 20 - 63 - 17 - 48 - 11 - 35 - 25 - 75 - 20 - 63 - 17 - 48 - 11 - 35 -

Figure 7 Western Blot analysis of influence of conditioned medium of non-microporated MSCs (CM) on production of proteins in total form present in the tumour environment of MCF-7 cells: GAPDH (A); PI3K (B); Akt (C). The marker used was the NZYColour Protein Marker II (NZYTech).

A GAPDH (37kDa) B pPI3K (60kDa) C pAkt (60kDa) MW MW MW kDa D/XF D/CM CM D/XF D/CM CM D/XF D/CM CM kDa kDa 48 - 35 - 25 - 20 - 17 - 11 - 75 - 75 - 63 - 63 - 48 - 48 - 35 - 35 -

Figure 8 Western Blot analysis of influence of conditioned medium of non-microporated MSCs (CM) on production of proteins in phosphorylated form present in the tumour environment of MCF-7 cells: GAPDH (A); PI3K (B); Akt (C). The marker used was the NZYColour Protein Marker II (NZYTech).

As it is possible to see in the previous Figures, in particular for the phosphorylated forms of the proteins, when cells were exposed only to Conditioned Medium, there is a decrease in the levels of these proteins, which at least is an indication that the enrichment with the proteins secreted by the mesenchymal stem cells is not causing an activation of these pathways, that are associated to proliferation.

Next, we looked at the effects in different cancer cell lines caused by the presence of azurin produced by MSCs.

A GAPDH (37kDa) B PI3K (60kDa) C Akt (60kDa) MW MW MW kDa D/XF D/CM D/Az kDa D/XF D/CM D/Az kDa D/XF D/CM D/Az

75 - 63 - 48 - 75 - 35 - 63 - 25 - 48 - 75 - 20 - 35 - 63 - 48 - 17 - 25 - 11 - 20 - 35 -

Figure 9 Western Blot analysis of influence of conditioned media of MSCs microporated without plasmid (CM) or with pVAX-engineered Azurin plasmid (Az) on production of proteins in total form present in the tumour environment of HT-29 cells: GAPDH (A); PI3K (B); Akt (C). The marker used was the NZYColour Protein Marker II (NZYTech).

A GAPDH (37kDa) B pPI3K (60kDa) C pAkt (60kDa) MW D/XF D/CM D/Az MW D/XF D/CM D/Az MW D/XF D/CM D/Az kDa kDa kDa

75 - 63 - 48 - 35 - 25 - 75 - 20 - 75 - 63 - 17 - 63 - 48 - 11 - 48 - 35 - 35 - Figure 10 Western Blot analysis of influence of conditioned media of MSCs microporated without plasmid (CM) or with pVAX-engineered Azurin plasmid (Az) on production of proteins in phosphorylated form present in the tumour environment of HT-29 cells: GAPDH (A); PI3K (B); Akt (C). The marker used was the NZYColour Protein Marker II (NZYTech).

A GAPDH (37kDa) B PI3K (60kDa) C Akt (60kDa) MW MW MW D/XF D/CM D/Az D/XF D/CM D/Az kDa D/XF D/CM D/Az kDa kDa

75 - 63 - 75 - 63 - 48 - 48 - 35 - 35 - 25 - 75 - 25 - 20 - 63 - 20 - 17 - 48 - 11 - 35 - Figure 11 Western Blot analysis of influence of conditioned media of MSCs microporated without plasmid (CM) or with pVAX-engineered Azurin plasmid (Az) on production of proteins in total form present in the tumour environment of A549 cells: GAPDH (A); PI3K (B); Akt (C). The marker used was the NZYColour Protein Marker II (NZYTech).

A GAPDH (37kDa) B pPI3K (60kDa) C pAkt (60kDa) MW MW D/XF D/CM D/Az D/XF D/CM D/Az MW D/XF D/CM D/Az kDa kDa kDa

75 - 75 - 63 - 63 - 48 - 48 - 35 - 35 - 25 - 25 - 20 - 75 - 20 - 17 - 63 - 48 -

Figure 12 Western Blot analysis of influence of conditioned media of MSCs microporated without plasmid (CM) or with pVAX-engineered Azurin plasmid (Az) on production of proteins in phosphorylated form present in the tumour environment of A549 cells: GAPDH (A); PI3K (B); Akt (C). The marker used was the NZYColour Protein Marker II (NZYTech).

A GAPDH (37kDa) B Src (60kDa) C pSrc (60kDa) MW MW MW D/XF D/CM D/Az kDa D/XF D/CM D/Az D/XF D/CM D/Az kDa kDa 75 - 63 - 48 - 75 - 35 - 63 - 25 - 48 - 20 - 75 - 35 - 63 - 17 - 25 - 48 - 11 - 20 - 35 -

Figure 13 Western Blot analysis of influence of conditioned media of MSCs microporated without plasmid (CM) or with pVAX-engineered Azurin plasmid (Az) on production of proteins present in the tumour environment of A549 cells: GAPDH (A); Src (B); pSrc (phospo Src) (C). The marker used was the NZYColour Protein Marker II (NZYTech).

Despite the results seem to be dependent on the cell line tested, the Western Blot analysis of the phosphorylated forms showed that, when conditioned medium of the non-microporated cells was applied, apparently an increase of the cell proliferation occurred in cells treated with D/CM relative to that treated with D/XF whereas the cells treated with only CM apparently showed an inhibition of the proliferation. In the total forms, in turn, an inhibition of cell proliferation was verified in cells treated with CM. On the other hand, when conditioned media of the microporated cells without plasmid or with pVAX-engineered Azurin plasmid were applied, the A549 cells treated with the plasmid that expresses Azurin presented a slight inhibition in Akt total form, PI3K total and phosphorylated forms, and Src phosphorylated form. These are still preliminary results that need to be validated in different donors, however at least for some cell lines, the expression of azurin by MSCs seems to cause the same effects already verified when the protein is added to the cells after its expression in an E.coli system and posterior purification [13, 20, 108].

4.2 Cas9 Guide construction and test As stated before, we chose the referred AAVS1 genomic safe harbour to precisely introduce the gene coding for azurin in a stable manner within the genome of human Mesenchymal Stem cells using CRISPR/Cas9 technology. This region is located in the first intron of the PPP1R12C gene [54, 59]. The selection of the appropriate Cas9 guide sequence followed the steps described next. First, the bioinformatic design of four different guides, corresponding to four different regions of the first intron of PPP1R12C gene, based on two main features (which are dependent on the algorithm of each bioinformatic tool used) namely the overall score and the number of exonic off-targets. The identification of possible off-targets located in coding sequences of other genes allows the verification of which gene can be possibly disrupted, creating a possible mutation into a protein or interruption of gene expression, whereas the probability of this happening in intronic regions is lower. Secondly, the cloning of the selected guides that were previously synthetized by Sigma-Aldrich© into guide RNA and Cas9-expressing vector pX459 (Addgene plasmid # 62988); and lastly the test of the cleavage

efficiency of each guide using the GeneArt™ Genomic Cleavage Detection Kit (Invitrogen™) in target cells.

4.2.1 Bioinformatic Design The three different tools used to design the guides’ sequence were: Wellcome Trust Sanger Institute (WTSI) Genome Editing; CRISPOR [102]; and CRISPR Design from Zhang Lab, MIT. The obtained guides are presented in Table 13.

Table 13 Cas9 guides used in this work with respective sequence and PAM.

Guide 1 Guide 2 Guide 3 Guide 4

(Reverse strand) (Forward strand) (Forward strand) (Forward strand)

Sequence1 CGAATTGGAGCCGCTTCAAC CCAGCGAGTGAAGACGGCAT CAATCCTATTATAGCCGAAT CGGCCAGCGGTTTGGTAACG 5’-3’

PAM2 TGG GGG GGG AGG

1 A – Adenine, T – Thymine, C – Cytosine, G - Guanine; 2 proto-spacer adjacent motif. The score and number of exonic off-targets of each guide obtained from each bioinformatic tool referred above are presented in Table 14, and the respective localization of each indicated exonic off-target is presented in Table 15.

Table 14 Number of exonic off-targets sites and score value for four guides tested in this work, obtained from three different bioinformatics tools (WGE, CRISPOR, and CRISPR Design).

Tools Guide 1 Guide 2 Guide 3 Guide 4 Number of No data WGE1 0 0 1 Exonic available. off-target CRISPOR 0 1 0 1 sites CRISPR Design 2 7 0 3 CRISPOR 94 92 96 97 Score CRISPR Design 94 89 92 95 1 Wellcome Trust Sanger Institute (WTSI) Genome Editing.

Table 15 Exonic off-target genes for the four guides tested in this work, obtained from three different bioinformatics tools (WGE, CRISPOR, and CRISPR Design) verified in NCBI (https://www.ncbi.nlm.nih.gov/).

Tools Guide 1 Guide 2 Guide 3 Guide 4 WGE1 - - - FBLN7 CRISPOR - CASP16 - FBLN7 EDEM3 Exonic MYBPC2 off-target SBK1 LRRC4C LOC148696 sites CRISPR Design SMAD6 DIO2-AS1 - ECI1 CLN3 FBLN7 DBNDD1 LMO4 1 Wellcome Trust Sanger Institute (WTSI) Genome Editing.

4.2.2 Cloning of double-strand guide oligonucleotides into pX459 vector The next step was the cloning of the selected guides into the pX459 vector (see Figure 14) with a codon-optimized SpCas9 for expression in human cells and the single guide RNA under the control of U6 promoter. The presence of two asymmetric sites for the BbsI restriction enzyme in pX459 allows the double-strand guide DNA to be cloned into the vector before the sgRNA scaffold. This vector also includes a selection marker of resistance to puromycin antibiotic.

Figure 14 Plasmid pX459 used to clone the guides. Map Image for pSpCas9(BB)-2A-Puro (PX459) V2.0 [103].

The correct insertion of guide sequences into the pX459 vector was verified by Sanger sequencing at GATC Biotech.

4.2.3 Cas9 Cleavage efficiency test The cleavage efficiency of each selected Cas9 guide was tested in order to choose the guide with the best cleavage efficiency prior the design of the homology arms for the introduction of azurin cassette. This test was performed in HEK293T cells and also attempted in human bone-marrow derived MSCs. HEK293T are widely used for the development of genome-editing approaches as well as the study of DNA repair mechanisms in general [39], and the MSCs were used because they make part of therapeutic strategy proposed in this work. The efficiency of the guides was determined with the GeneArt™ Genomic Cleavage Detection Kit (Invitrogen™) [104].

HEK293T cells In this test, the cells were first transfected with pX459 containing each of the guides with Lipofectamine2000 as per standard protocols, upon which, successfully transfected cells are selected with the addition of puromycin to the cell culture media. The puromycin concentration used to select the HEK293T cells was 2µg/ml [109] with 48 hours of exposition. The test uses genomic DNA from

positive transfected cells to amplify by PCR loci where the gene-specific double-strand breaks occur (see Figure 15).

Figure 15 Agarose gel electrophoresis of PCR products amplified with primers correspondent to each guide. Guide 1: Corte1.Fw, Corte1.Rev; Guide 2: Corte2.Fw, Corte2.Rev; Guide 3: Corte3.Fw, Corte3.Rev; Guide 4: Corte4.Fw, Corte4.Rev (see Table 3 on section 3.4.3.1). G1 - Guide 1; G2 - Guide 2; G3 - Guide 3; G4 - Guide 4; uPCR – uncut PCR; Mk – 1Kb Plus DNA Ladder (Invitrogen™).

The resultant PCR product is denatured and re-annealed, generating mismatches as strands with an indel re-anneal to strands with no indels or a different indel. These mismatches are then detected and cleaved by the Detection Enzyme of the kit and the resultant bands are revealed by agarose gel electrophoresis (see Figure 16) and analysed by ImageJ to obtain a value for rate of efficiency for each guide.

Figure 16 (A) Agarose gel electrophoresis of PCR products digested with Detection enzyme to determine cleavage efficiency of the tested guides. Efficiency ratios are the following: Guide 1: non-cutter; Guide 2: 2.72; Guide 3: 3.00; Guide 4: impossible to observe the second band (ratio of [cut/noncut] measured by ImageJ software). G1 - Guide 1; G2 - Guide 2; G3 - Guide 3; G4 - Guide 4; uPCR – uncut PCR; cPCR – cut PCR; Mk – 1Kb Plus DNA Ladder (Invitrogen™). (B) The nucleotide sequence of cleavage region of Guide 3 in the reverse strand of the intron 1 in PPP1R12C gene. The homology arms are highlighted in red. The guide is in bold and the sequence correspondent to PAM is underlined.

The observation of the Figure 16 and the presented ratios for each guide allows to conclude that Guide 3 is the best one, since the intensity of the sum of the bands correspondent to cut fragments is three fold higher than the intensity of the band correspondent to uncut fragments, meaning that the efficiency of this guide is higher, that is in the agreement with the bioinformatic analysis referred previously on section 4.2.1. Furthermore, it is possible to conclude from Table 14 that the best guide considering the score value and number of exonic off-target sites is the Guide 3, since its score is 96 (CRISPOR tool) or 92 (CRISPR Design tool) and number of exonic off-target sites is 0 in both tools.

MSCs Taking into account the success rate verified with HEK293T cells, only Guide 3 was tested in MSCs. Two attempts to test the Guide 3 in MSCs were performed. Firstly, the sensibility to puromycin of human bone-marrow derived MSCs was assessed (see Table 16).

Table 16 MSCs sensibility to puromycin. Initial density at day 0 of 4000 cells/cm2. 25-50% of confluence at day 1. Green: cells presented a confluence equal to or greater than the initial; Yellow: some cells died; Orange: mostly cells died; Brown: almost all cells died; Red: all cells died.

Concentration Day 1 Day 2 Day 3 [µg/ml] 0 0.5

1 2 2.5 3 4 6

The first attempt to test the Guide 3 in MSCs was carried out with a cell density of ~38000 cells/cm2 and a concentration of 2.5μg/ml [110, 111] of puromycin to select the cells. 24h after the microporation, the cells presented a satisfactory morphology and confluence, being that in the conditions where the DNA was microporated to the cells, the number of cells was lower than in control conditions (microporation with no addition of plasmid DNA), suggesting a successful microporation protocol. Thus, at 48h after microporation, selection with puromycin was initiated. After 24h of selection with puromycin there were still some live cells in control, therefore the medium containing puromycin was changed. At the beginning of the second day, the medium containing puromycin was changed again in order to improve the selection. By the end of this day, the cells were mostly dead in the control condition so the medium was replaced by StemPro® MSC SFM XF without puromycin to allow the expansion of the cells that survived. However, after three days of recovery the cell density remained unchanged. 50% (1ml/well) of the medium was changed every two days in order to maintain the essential factors for the cell recovery, however the cells eventually died.

Due to the lack of success of the first attempt, the second attempt to test the Guide 3 in MSCs was realized with a lower cellular density (of ~7400cells/cm2) and lower concentrations of puromycin (1μg/ml [112] and 0.5μg/ml [113]). 24h after the microporation, the cells presented a satisfactory morphology, being that in the conditions where cells were microporated with plasmid DNA the number of cells was also lower. After 48h the cell density increased, so the selection with puromycin was initiated. At the concentration of 1μg/ml of puromycin, cells were maintained for 48h, and after 24h the medium containing puromycin was changed. By the end of the second day, the majority of cells in control condition were dead so the medium was replaced by StemPro® MSC SFM XF medium. The level of confluence in other conditions was very low. At the concentration of 0.5μg/ml of puromycin, the selection was performed during 72h since after 48h there were still some alive cells in control conditions. The medium containing puromycin was renewed every 24h. By the end of the third day, the cells in control conditions were dead so the

medium was replaced by StemPro® MSC SFM XF medium. The level of confluence in other conditions was higher than in the previous attempt. 50% (1ml/well) of the medium was changed every two days in order to maintain the essential factors to the cell recovery. However, after one week of a modest increase in confluence the cells ceased to grow, without reaching confluence levels necessary to realize the cleavage efficiency test. Therefore, it was not possible to obtain in the time course of this thesis a conclusive test of the cleavage efficiency of Guide 3 in bone-marrow derived human mesenchymal stem cells.

4.3 Donor Template The construction of the donor template to be used for HDR of DSB was performed in several steps. First of all, each part of the final construct was amplified from an appropriate DNA template. After that, the attempts to perform the ligations between the parts were realized following the workflow described in section 2 (see Figure 3). The sequence of donor template is presented in section 2 of appendix. All cloned DNA fragments of the donor template referred below were cloned into pBluescript II KS vector presented in Figure 17.

Figure 17 Plasmid pBluescript II KS used to clone the fragments of the interest.

4.3.1 Construction of the parts of donor template

IL6-promoter

The promoter of the IL6-gene was amplified by PCR using genomic DNA of HEK293T cells as a template [107]. Several attempts of PCR amplification and cloning were performed to obtain PCR product without mutations introduced during amplification process, and the best resulting DNA obtained has two nucleotide mismatches in its sequence (see Figure 18 (A)) for which the verification

by Sanger sequencing was not totally conclusive. Therefore, 1µl of this PCR product was re-amplified with Phusion HF DNA Polymerase (see Figure 18 (B)) in order to correct the possible errors. The resultant PCR product of this re-amplification was cloned into the pBluescript II KS (pKS) vector and the insertion of the promoter fragment was verified by hydrolysis of the vector with enzymes HindIII and EcoRI as referred in section 3.5. (see Figure 19). Two clones were verified by Sanger sequencing and one of these (highlighted in Figure 19) presented only one mismatch in region where the reverse primer anneals. The fragment correspondent to the IL6-promoter sequence in this clone was re-amplified with the Phusion HF DNA Polymerase and cloned into pKS vector (see Figure 20). The results of the sequencing showed that the mismatch of the initial template remained in the three clones. One possible conclusion is that this can be due to a mismatch in the DNA sequence of the template that can differ from that in the databases to which the sequenced DNA is compared to. It would be important to amplify by PCR the same region from different DNA template sources, e.g, different cell lines to verify if they contain the same mismatch. Considering that the referred DNA was from a plasmid and was cloned into bacteria, i.e. it was methylated, this was digested with DpnI enzyme, after re-amplification with Phusion HF DNA Polymerase and purification with NZYGelpure kit from one of these three clones, to degrade the template from bacteria and preserve the PCR product, which probably was corrected because the primers used in re-amplification had the corrected sequence. The resultant product of digestion with DpnI was purified with NZYGelpure kit.

IL6- promoter 1280 bp IL6- A 1 2 3 4 promoter 1280 bp Mk B 1 2 3 4 Mk bp bp

2000 - 2000 - 1650 - 1000 - 1000 - 850 - 650 - 650 - 300 - 400 - 200 - 300 - 100 - 200 - 100 -

Figure 18 (A) Agarose gel electrophoresis of PCR product amplified from genomic DNA of HEK293Tcells with primers 5HAIL6.G3 Fw and AzIL6 Rev, correspondent to IL6-promoter (see Table 5 on section 3.6.1). (B) Agarose gel electrophoresis of the re-amplified PCR product referred before with Phusion HF DNA Polymerase. Mk - 1Kb Plus DNA Ladder (Invitrogen™). 1-2-3-4: 55ºC-58ºC-60ºC-62ºC of annealing temperature.

pKS IL6- vector promoter 2961 bp 1280 bp Mk

2000 - 1650 - 1000 - 650 - 400 - 300 - 200 - 100 -

Figure 19 Agarose gel electrophoresis to verify by vector digestion the insertion of the IL6-promoter fragment into the pKS vector. Mk – 1Kb Plus DNA Ladder (Invitrogen™).

pKS IL6- vector promoter 2961 bp 1280 bp

2000 - 1650 -

1000 - 650 - 400 - 300 - 200 - 100 -

Figure 20 Agarose gel electrophoresis to verify by vector digestion the insertion of the IL6-promoter fragment, after re-amplification with Phusion HF DNA Polymerase, treatment with PNK and purification with NZYGelpure kit, into the pKS vector. Mk – 1Kb Plus DNA Ladder (Invitrogen™).

hAzurin eGFP+SV40polyA

The hAzurin and eGFP+SV40polyA were amplified from pVAX-engineered Azurin and pEGFP-N1 plasmids DNA, respectively (see Figure 21).

Figure 21 Agarose gel electrophoresis of PCR products amplified from pVAX-engineered Azurin and pEGFP-N1 plasmids DNA, with primers IL6Az Fw and P2AAz Rev, and P2AGFP Fw and 3HApolyA.G3 Rev, for hAzurin and eGFP+SV40polyA amplification, respectively. (See Table 5 on section 3.6.1). Mk – 1Kb Plus DNA Ladder (Invitrogen™). (See complete figure on section 3 in appendix). 1-2-3-4: 54ºC-56ºC-58ºC-60ºC of annealing temperature.

5’HA 3’HA

The homology arms were designed based on the genomic location of the DSB introduced by the Guide 3 (see Figure 16 (B)) and amplified from genomic DNA of HEK293T cells (see Figure 22 (A)). Both were purified with NZYGelpure kit (see Figure 22 (B)). However, taking into account the specificity of the amplification just a PCR clean-up was applied to 5’HA whereas a gel extraction and subsequent purification were applied to 3’HA.

A 5’HA 3’HA 459 bp 461 bp 5’HA 3’HA 1 2 3 1 2 3 B 459 bp 461 bp Mk Mk bp bp 2000 - 1650 - 2000 - 1000 - 1650 - 650 - 1000 - 500 - 850 - 400 - 650 - 300 - 500 - 200 - 400 - 100 - 300 - 200 - 100 -

Figure 22 (A) Agarose gel electrophoresis of PCR products amplified from genomic DNA of HEK293Tcells, with primers 5HA.G3 Fw and IL65HA.G3 Rev, and polyA3HA.G3 Fw and 3HA.G3 Rev, for 5’Homology Arm and 3’Homology Arm amplification, respectively. (see Table 5 on section 3.6.1). (B) Agarose gel electrophoresis of PCR products correspondent to 5’Homology Arm and 3’Homology Arm amplification after purification with NZYGelpure kit. Mk – 1Kb Plus DNA Ladder (Invitrogen™). 1-2-3: 60ºC-62ºC-64ºC of annealing temperature.

4.3.2 PCR Ligations

Ligation I: IL6-promoter hAzurin

The Ligation I is constituted by IL6-promoter and hAzurin fragments referred above, in section 4.3.1. This Ligation was obtained by PCR using primers with complementary linkers to the sequences to be ligated, generating a 20-nt overlap between the two sequences as described in section 3.6 (see Figure 23 (A)). The resultant PCR product corresponding to the expected MW (1748bp) was purified with NZYGelpure kit (see Figure 23 (B)).

Ligation I A B Ligation I 1748 bp x 1748 bp Mk Mk bp bp

2000 - 2000 - 1650 - 1650 - 1000 - 1000 - 650 - 650 - 500 - 500 - 400 - 400 - 300 - 300 - 200 - 200 - 100 - 100 -

Figure 23 (A) Agarose gel electrophoresis of PCR product amplified from IL6-promoter and hAzurin DNA fragments with primers 5HAIL6.G3 Fw and P2AAz Rev, correspondent to Ligation I: IL6-promoter + hAzurin (see Table 10 on section 3.6.2). (B) Agarose gel electrophoresis of PCR product referred before after purification with NZYGelpure kit. Mk – 1Kb Plus DNA Ladder (Invitrogen™).

Ligation II: hAzurin eGFP+SV40polyA

P2A

The Ligation II is constituted by hAzurin and eGFP+SV40polyA fragments referred above, in section 4.3.1, and P2A sequence was included in overlapping primers. This last sequence allows a bicistronic expression which means that both GFP and azurin will be co-expressed but translated as independent proteins rather than a fusion protein. This Ligation was obtained by PCR as described in section 3.6 (see highlighted in Figure 24 (A)). The resultant PCR product was purified with NZYGelpure kit (see highlighted in Figure 24 (B)). The purified PCR product was cloned into pKS vector and the insertion of the fragment referred previously was verified by digestion of the vector (see Figure 25). Two clones (highlighted in Figure 25) were verified by Sanger sequencing. The results of the sequencing confirmed the insertion of the correct Ligation II sequence in the two clones. Ligation II was reamplified from one of these two clones and purified with NZYGelpure kit.

Ligation II A Ligation II 1512 bp B 1512 bp Mk Mk bp bp

2000 - 2000 - 1650 - 1650 - 1000 - 1000 - 650 - 500 - 650 - 400 - 300 - 400 - 200 - 300 - 100 - 200 - 100 -

Figure 24 (A) Agarose gel electrophoresis of PCR product amplified from hAzurin and eGFP+SV40polyA DNA fragments with primers IL6Az Fw and 3HApolyA.G3 Rev, correspondent to Ligation II: hAzurin + eGFP+SV40polyA (see Table 10 on section 3.6.2). (B) Agarose gel electrophoresis of PCR product referred before after purification with NZYGelpure kit. Mk – 1Kb Plus DNA Ladder (Invitrogen™). The remaining bands correspond to Ligation I amplification.

pKS vector Ligation II 2961 bp 1512 bp

2000 - 1650 -

1000 - 650 - 400 - 300 - 200 - 100 -

Ligation II + 3’HA:

hAzurin P2A eGFP+SV40polyA 3’HA

The Ligation II + 3’HA is constituted by Ligation II and 3’HA fragments referred before. This ligation was obtained by PCR as described in section 3.6 (see highlighted in Figure 26 (A)). The resultant PCR product was purified with NZYGelpure kit (see Figure 26 (B)).

A Ligation II+3’HA B Ligation II+3’HA 1930 bp 1930 bp Mk Mk bp bp

2000 - 1650 - 2000 - 1650 - 1000 - 650 - 1000 - 500 - 400 - 650 - 300 - 500 - 200 - 400 - 100 - 300 - 200 - 100 -

Figure 26 (A) Agarose gel electrophoresis of PCR product amplified from Ligation II and 3’Homology Arm DNA fragments with primers IL6Az Fw and 3HA.G3 Rev, correspondent to Ligation II + 3’HA (see Table 11 on section 3.6.2). (B) Agarose gel electrophoresis of PCR product referred before after purification with NZYGelpure kit. Mk – 1Kb Plus DNA Ladder (Invitrogen™).

Summary of results: For the construction of the final vector, it was necessary to amplify by PCR six DNA fragments, and ligate them by five PCR ligations. Of these, all individual fragments were obtained and sequence verified the hAzurin, P2A, and eGFP+SV40polyA DNA fragments. Due to the lack of time following steps were not yet done: • Ligation between Ligation I and 5’HA; • Sequencing verification of Ligation I + 5’HA and Ligation II + 3’HA for posterior ligation between them.

5. Discussion Taking into account the properties of the azurin as an anticancer protein and the tropism ability of the MSCs towards tumour sites described in sections 1.3.1 and 1.2.1, respectively, the formulated strategy of this work was to test the feasibility of stably incorporating a gene coding for azurin within the genome of MSCs. Due to the variability that may occur among different donors of bone marrow-derived MSCs, one particular donor was tested to validate its feasibility for the future applications desired (M83A15). Two main features were tested: i) the verification of the presence of azurin in the conditioned medium and in cell lysates of these cells as an indication of its capacity to express the codon-optimized gene of azurin; ii) the influence of the conditioned media of the non-microporated cells and microporated without plasmid or with pVAX-engineered Azurin plasmid on signalling pathways related to cancer cell proliferation. In the case of these, we tested mainly proteins which have already been demonstrated by us and others to be affected by azurin, such as pPI3K, pAkt and pSrc. The verification of the presence of azurin in conditioned medium and cell lysates of the cells was positive. Two bands with approximately 14kDa were detected with a custom-made anti-azurin western blot. The observation of these two bands just happens in eukaryotic cells, contrary to azurin expressed in E.coli strains, so a possible justification may be post-translational modifications like glycosylation, phosphorylation or acetylation, or even cleavage of the protein that needs to be further assessed in the future. Several tests were made to assess the influence of the conditioned media of the cells on production of the proteins present in tumoural environment. First, the conditioned medium of the non- microporated cells was tested in order to verify its influence in the levels of PI3K and Akt proteins in their total and phosphorylated forms. The conclusion of this test with phosphorylated forms was that apparently an increase in the levels of these proteins occurred in cells treated with D/CM relative to those treated with D/XF whereas the cells treated with only CM apparently showed a proliferation decrease in these levels, which may occur due to the enrichment of secreted molecules by MSCs. In the total forms, in turn, it was verified a decrease in the levels of these proteins in cells treated with CM, representing the huge controversy around the role of MSCs in cell proliferation in a tumoural environment. The levels of these proteins were assessed as an indication of possible effects in proliferation of cancer cells in response to these conditioned media, since the proteins are strongly associated to signalling pathways that control proliferation [108, 20]. A second test was made with conditioned media of the microporated cells without plasmid or with pVAX-engineered Azurin plasmid. The tested proteins were PI3K and Akt once more, and Scr protein. The conclusion of this test was that when cells were treated with the plasmid that expresses azurin a slight inhibition was verified in Akt total form, PI3K total and phosphorylated forms, and Src phosphorylated form with A549 cells. This may indicate that, similarly to the purified protein, the delivery via mesenchymal stem cells has the ability to attenuate oncogenic pro-proliferative pathways.

In this work, we chose the described genomic safe harbour AAVS1 locus in the intron 1 of PPP1R12C gene [54, 59], and the incorporation of the gene that encodes azurin into this locus via the CRISPR/Cas9 mechanism.

Thus, four guides correspondent to four different regions of the target genome location were firstly designed, using three bioinformatics tools including the Wellcome Trust Sanger Institute (WTSI) Genome Editing, CRISPOR, and CRISPR Design from Zhang Lab, MIT. Considering their score and the number and position of exonic off-targets of the four tested guide sequences, the best guide was the Guide 3 because of its good score and the zero exonic off-targets. After the design of the guides, these were tested in HEK293T cells showing that the Guide 3 was also the best considering its cleavage efficiency observed in the agarose gel. For this reason only Guide 3 was tested in second cell line. Regarding the cleavage efficiency test in the MSCs, two attempts were realized to test the Guide 3 in MSCs. The test with MSCs presented several troubles over time, starting with the puromycin selection of the cells since it originated a very slow recuperation. In the first attempt, higher cell density and puromycin concentration were applied taking into account the prediction of a large cell death due to the stress originated by microporation and puromycin selection. In other words, this attempt was to test if the utilization of a higher cell density could improve the efficiency of the transfection. However, according to the results obtained, it was possible to verify that the cell density may probably be an extra stress for cells, so the second attempt was realized in order to overcome this. In this second attempt, the applied cell density was still quite high but more physiological, i.e., it was closer to what they are normally adapted and where they grow better [114]. In the second approach, the tested concentrations of puromycin were also lower than the applied in first attempt since the cells recuperation was very slow, which originated a very low level of cell confluence at the end of the test. This low confluence may difficult the recovery of the cells since these apparently need the cell-to-cell contact to proliferate. Thus, a lower puromycin concentration to select the cells originated a slower selection that, in turn, allowed the maintenance of the cell support during this process. The passage of the cells to a 12-well plate, in order to put the cells closer, proved to be quite aggressive to a few cells since some cells did not even adhere, and did not recover. The deficient growth of the cells may be originated by the transfection of a larger plasmid than that used in protocol on which this part of work was based, thus an optimization of microporation parameters may be necessary. As such, current efforts are being taken to optimize the parameters of transfection. A major difficulty in the system used in this thesis was due to the lack of a fluorescence marker like GFP that could be used to quantify the percentage of transfected cells. A new plasmid pCAG-SpCas9-GFP-U6-gRNA (Addgene #79144), see Figure 28 on section 4 in appendix, will be used to obtain the parameters which may allow the higher transfection rates like the appropriate cell number, pulse voltage, pulse width and pulse number. Positively transfected cells may then be evaluated through flow cytometry. Afterwards, the plasmid already constructed in this thesis containing Guide 3 will be transfected using the optimized parameters to determine the cleavage efficiency of this guide in MSCs. An alternative to overcome these difficulties may also be the utilization of RNP complex with purified protein and synthetic guides, as described in section 1.4, that is a more laborious system but

is also a cleaner and more efficient, with a high activity shortly after protein transfection, followed by a rapid degradation and the avoidance of cellular toxicity related with DNA. The different efficiencies commonly presented by these two cell types reflect the difference in biology and genetic background between established cell lines and human primary stem cells [37].

The next step was the construction of the donor template that will be incorporated into genome by HDR via CRISPR/Cas9 mechanism. This template is constituted by two homology arms designed around the cleavage site for the Guide 3, the promoter sequence of IL6 gene, the hAzurin sequence (i.e. a codon optimized sequence of azurin gene from Pseudomonas aeruginosa, that also contains in its N-terminal a peptide sequence that confers it the ability to be secreted to the outside of the cells), and the eGFP+SV40polyA sequence, with a P2A sequence in between. The two homology arms were designed near the cleavage site for the Guide 3 to allow the homology between the donor template and the region that was cleaved by Cas9 in order to incorporate this template in this locus. These homology arms were amplified from HEK293T cells and their length is about 440bp each one. Although some studies suggest that large insertions may require longer homology arms namely with >500bp [31], it becomes hard to clone such a large insert. The promoter sequence from the IL6 gene [107] was amplified from HEK293T cells, being the choice between several promoters of the genes that are up-regulated by MSCs in presence of TGF- [9] as referred in section 1.2.1. In order to select this gene two main observations were taken into account: the higher fold induction (10.47 [9]) and the smaller region size (about 1200bp [115]). Therefore, considering the secretion of TGF- by cancer cells, the utilization of this promoter to direct the expression of genes of interest like hAzurin in the tumour microenvironment is logical taking into account potential contribution for the field of anticancer therapies. However, a recent study from September 2017 employed just a part of the promoter sequence used in the present work applying a similar strategy based on the utilization of MSCs and the up-regulation of the promoter sequence of IL6 gene in the cancer microenvironment [116]. This recent study may be considered in future steps of this work since it is easier to work with smaller DNA sequences. The hAzurin, in turn, was amplified from pVAX-engineered Azurin plasmid DNA, which was obtained by our group in a previous work. The eGFP+SV40polyA sequence was amplified from pEGFP-N1 plasmid DNA, where eGFP sequence is optimized for use in mammalian cells and SV40polyA promotes transcript stability and export to the cytoplasm. On the other hand, the P2A self-cleaving peptide allows the expression of two separate proteins from the same mRNA, in other words, a bicistronic expression, which means that when there is a GFP there is necessarily a hAzurin, as referred in section 4.3.2, allowing a better control in expression of hAzurin gene.

6. Conclusion To conclude, with this work the initial objectives were almost all achieved. The Cas9 guides were tested in HEK293T cells and MSCs, allowing the choice of one guide to be employed in CRISPR/Cas9 technology in order to cleave the selected safe harbour. However, the test in MSCs was not finished. Other steps that can be taken are the test of other donors of MSCs taking into account the large controversy concerning to the role of MSCs in the tumour microenvironment and the test of the influence of azurin expressed by MSCs in other tumour cell lines to validate more donors to be used in the therapeutic purpose of this work. Despite the fact that the cloning of the full construct was not possible during the time frame of this thesis, it was possible to determine the PCR conditions for the amplification of all components. It should be noted that several attempts to optimize the mentioned protocols in section 4.3 were realized until the referred results were obtained. Thus, the possible next steps to continue this work may start with the cloning of Ligation I and consequent ligation to 5’HA, and cloning of Ligation II+3’HA and selection of the clones with the correct insert, choosing the one with the band with correct size considering that this ligation after purification presented two bands (see Figure 26 (B)). After that, in order to ligate the two resultant fragments (5’HA+Ligation I and Ligation II+3’HA) a possible strategy is the hydrolysis of the both with AflII enzyme (see section 2 in appendix) that cuts in the end of hAzurin fragment and generates sticky ends that allow the ligation by complementarity (see Figure 3).

7. Current Challenges and Future Perspectives There are several challenges, some already mentioned in section 1 and others in section 5, in the way to achieve the final objective of the strategy proposed in this work, being that some alternatives to overcome or at least attenuate these difficulties are referred below. The large size of the insert correspondent to donor template can be reduced if a smaller portion of promoter is applied [116] instead the whole promoter used in this work, as already referred in section 5, which will facilitate the work since it may be easier to handle smaller DNA fragments. Concerning to the difficulties in selection of MSCs with puromycin during the test of guides after microporation, it is known that the presence of antibiotics like this can originate the donor integration into unspecific sites. Moreover, considering the proposed alternative in section 5 of the utilization of purified protein and synthetic guides, a way to select the cells after this type of transfection may be through single cell sorting. For the delivery of this RNP complex and the donor template a recent study from October 2017 proposed the usage of gold nanoparticles conjugated to DNA and complexed with cationic endosomal disruptive polymers as vehicle [117]. Another difficulty of this work was the PCR amplification of the homology arms from the selected locus, what means that the choice of other locus or other genomic safe harbour could be employed to overcome this barrier. The challenge concerning to big size of SpCas9 that sometimes interferes with its performance throughout the process that leads to cleavage of the DNA, namely its delivery, may be overcome with the utilization of an alternative protein as the Cas9 from Staphylococcus aureus

(SaCas9) that is ~1kbp shorter and can edit mammalian genome with efficiency like that of SpCas9. However, more studies are needed to understand the long-term impact of this Cas9 expression [118]. Other barriers such as delivery of the CRISPR/Cas9 components and other concerns related with the application of this mechanism are referred in section 1.4.2, where some alternatives are also presented.

References

[1] World Health Organization, “10 facts about cancer,” Updated February 2017.

[2] Peter Crosta, “Cancer: Facts, Causes, Symptoms and Research,” Medical News Today, Updated 24 Nov 2015.

[3] Mavroudi M, Zarogoulidis P, Porpodis K, Kioumis I, Lampaki S, Yarmus L, MAlecki R, Zarogoulidis K, and Malecki M, “Stem cells’ guided gene therapy of cancer: New frontier in personalized and targeted therapy,” Journal of Cancer Research and Therapy, p. 2: 22–33, 2014.

[4] Liu B, Chen F, Wu Y, Wang X, Feng M, Li Z, Zhou M, Wang Y, Wu L, Liu X, Liang D, “Enhanced tumor growth inhibition by mesenchymal stem cells derived from iPSCs with targeted integration of interleukin24 into rDNA loci,” Oncotarget, pp. 8:40791-40803, 2017.

[5] Marin-Bañasco C, Benabdellah K, Melero-Jerez C, Oliver B, Pinto-Medel MJ, Hurtado-Guerrero I, Castro F, Clemente D, Fernández O, Martin F, Leyva L, Suardíaz M, “Gene Therapy with Mesenchymal Stem Cells Expressing IFNßAmeliorates Neuroinflammation in Experimental Models of Multiple Sclerosis,” British Journal of Pharmacology, pp. 174:238-253, 2017.

[6] Liu L, Zhang SX, Liao W, Farhoodi HP, Wong CW, Chen CC, Ségaliny AI, Chacko JV, Nguyen LP, Lu M, Polovin G, Pone EJ, Downing TL, Lawson DA, Digman MA, Zhao W, “Mechanoresponsive stem cells to target cancer metastases through biophysical cues,” Science Translational Medicine, p. 9(400), 2017.

[7] Osteocord-bone from blood, “Extraction and Isolation of MSCs,” [Online]. Available: https://www.york.ac.uk/res/bonefromblood/background/ext-isol-MSCs.html. [Acedido em 10 October 2017].

[8] Klyushnenkova E, D. Mosca J, Zernetkina V, K. Majumdar M, J. Beggs K, W. Simonetti D, J. Deans R, R. McIntosh K, “T cells responses to allogeneic human mesenchymal stem cells: immunogenicity, tolerance, and suppression,” Journal of Biomedical Science, pp. 12:47-57, 2005.

[9] De Luca A, Roma C, Gallo M, Fenizia F, Bergatino F, Frezzetti D, Constantini S, and Normanno N, “RNA- seq analysis reveals significant effects of EGFR signalling on the secretome of mesenchymal stem cells,” Oncotarget, pp. 5:10518-10528, 2014.

[10] Choi JH, Lee MH, Cho YJ, Park BS, Kim S, Kim GC, “The Bacterial Protein Azurin Enhances Sensitivity of Oral Squamous Carcinoma Cells to Anticancer Drugs,” Yonsei Medical Journal, pp. 52:773-778, 2011.

[11] C. Jeuken LJ, Ubbink M, Bitter JH, van Vliet P, Meyer-Klaucke W, W. Canters G, “The structural role of the copper-coordinating and surface-exposed histidine residue in the blue copper protein azurin,” Journal of Molecular Biology, p. 299:737–755, 2000.

[12] Fialho AM, Salunkhe P, Manna S, Mahali S, Chakrabarty AM., “Glioblastoma multiforme: novel therapeutic approaches.,” ISRN Neurology, p. 2012:642345, 2012.

[13] Bernardes N, Ribeiro AS, Abreu S, Vieira AF, Carreto L, Santos M, Seruca R, Paredes J, Fialho AM, “High- throughput molecular profiling of a P-cadherin overexpressing breast cancer model reveals new targets for the anti-cancer bacterial protein azurin,” International Journal of Biochemistry and Cell Biology , p. 50:1–9, 2014.

[14] Kwan JM, Fialho AM, Kundu M, Thomas J, Hong CS, Das Gupta TK, Chakrabarty AM, “Bacterial proteins as potential drugs in the treatment of leukemia,” Leukemia Research, pp. 33:1392-1399, 2009.

[15] Bizzarri AR, Santini S, Coppari E, Bucciantini M, Di Agostino S, Yamada T, Beattie CW, Cannistraro S, “Interaction of an anticancer peptide fragment of azurin with p53 and its isolated domains studied by atomic

force spectroscopy,” International Journal of Nanomedicine, pp. 6:3011-3019, 2011.

[16] Bernardes N, Seruca R, Chakrabarty AM, Fialho AM, “Microbial-based therapy of cancer: Current progress and future prospects,” Bioengineered Bugs, pp. 1:178-190, 2010.

[17] Santini S, Bizzarri AR, Cannistraro S., “Modelling the interaction between the p53 DNA-binding domain and the p28 peptide fragment of Azurin,” Journal of Molecular Recognition, pp. 24:1043-1055, 2011.

[18] Warso MA, Richards JM, Mehta D, Christov K, Schaeffer C, Rae Bressler L, Yamada T, Majumdar D, Kennedy SA, Beattie CW, Das Gupta TK., “A first-in-class, first-in-human, phase I trial of p28, a non-HDM2- mediated peptide inhibitor of p53 ubiquitination in patients with advanced solid tumours.,” British Journal of Cancer, pp. 108:1061-1070, 2013.

[19] Lulla RR, Goldman S, Yamada T, Beattie CW, Bressler L, Pacini M, Pollack IF, Fisher PG, Packer RJ, Dunkel IJ, Dhall G, Wu S, Onar A, Boyett JM, Fouladi M., “Phase I trial of p28 (NSC745104), a non-HDM2- mediated peptide inhibitor of p53 ubiquitination in pediatric patients with recurrent or progressive central nervous system tumors: A Pediatric Brain Tumor Consortium Study.,” Neuro-Oncology, pp. 18:1319-1325, 2016.

[20] Bernardes N, Abreu S, Carvalho FA, Fernandes F, Santos NC, Fialho AM, “Modulation of membrane properties of lung cancer cells by azurin enhances the sensitivity to EGFR-targeted therapy and decreased b1 integrin-mediated adhesion,” Cell Cycle, p. 15: 1415–1424, 2016.

[21] Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero DA, Horvath P, “CRISPR provides acquired resistance against viruses in prokaryotes,” Science, pp. 315:1709-1712, 2007.

[22] Maggio I, Holkers M, Liu J, Janssen JM, Chen X, Gonçalves MA., “Adenoviral vector delivery of RNA- guided CRISPR/Cas9 nuclease complexes induces targeted mutagenesis in a diverse array of human cells,” Scientific Reports, p. 4:5105, 2014.

[23] Hale CR, Zhao P, Olson S, Duff MO, Graveley BR, Wells L, Terns RM, Terns MP, “RNA-guided RNA cleavage by a CRISPR RNA-Cas protein complex,” Cell, pp. 139:945-956, 2009.

[24] Shmakov S, Abudayyeh OO, Makarova KS, Wolf YI, Gootenberg JS, Semenova E, Minakhin L, Joung J, Konermann S, Severinov K, Zhang F, Koonin EV, “Discovery and functional characterization of diverse Class 2 CRISPR-Cas systems,” Molecular Cell, pp. 60:385-397, 2015.

[25] Albitar A, Rohani B, Will B, Yan A, Gallicano GI, “The Application of CRISPR/Cas Technology to Efficiently Model Complex Cancer Genomes in Stem Cells,” Journal of Cellular Biochemistry, 2017.

[26] Charpentier E, Doudna JA., “Biotechnology: Rewriting a genome.,” Nature, pp. 495:50-51, 2013.

[27] Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E, “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity,” Science, pp. 337:816-821, 2012.

[28] Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F, “Multiplex genome engineering using CRISPR/Cas systems,” Science, p. 339: 819–823., 2013.

[29] Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE, Church GM, “RNA-guided human genome engineering via Cas9,” Science, p. 339: 823–826, 2013.

[30] Richardson CD, Ray GJ, DeWitt MA, Curie GL, Corn JE, “Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA,” Nature Biotechnology, pp. 34:339-344, 2016.

[31] Paix A, Folkman A, Goldman DH, Kulaga H, Grzelak M, Rasoloson D, Paidemarry S, Green R, Reed R, Seydoux G, “Precision genome editing using synthesis-dependent repair of Cas9-induced DNA breaks,” bioRxiv , 2017.

[32] He X, Tan C, Wang F, Wang Y, Zhou R, Cui D, You W, Zhao H, Ren J, Feng B, “Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair,” Nucleic Acids Research , p. 44(9):e85, 2016.

[33] Sakuma T, Nakade S, Sakane Y, Suzuki KT, Yamamoto T, “MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems,” Nature Protocols, pp. 11:118-133, 2016.

[34] Cox DBT, Platt RJ, Zhang F, “Therapeutic genome editing: prospects and challenges,” Nature Medicine, p. 21:121–131, 2015.

[35] Long C, Amoasii L, Mireault AA, McAnally JR, Li H, Sanchez-Ortiz E, Bhattacharyya S, Shelton JM, Bassel- Duby R, Olson EN., “Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy,” Science, pp. 351:400-403, 2016.

[36] Lin S, Staahl BT, Alla RK, Doudna JA, “Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery,” eLIFE, p. 3:e04766, 2014.

[37] Torres-Ruiz R, Martinez-Lage M, Martin MC, Garcia A, Bueno C, Castaño J, Ramirez JC, Menendez P, Cigudosa JC, Rodriguez-Perales S, “Efficient Recreation of t(11;22) EWSR1-FLI1+ in Human Stem Cells Using CRISPR/Cas9,” Stem Cell Reports, p. 8: 1408–1420, 2017.

[38] Chen F, Pruett-Miller SM, Huang Y, Gjoka M, Duda K, Taunton J, Collingwood TN, Frodin M, Davis GD., “High-frequency genome editing using ssDNA oligonucleotides with zinc-finger nucleases.,” Nature Methods, pp. 8:753-755, 2011.

[39] Song F, Stieger K., “Optimizing the DNA Donor Template for Homology-Directed Repair of Double-Strand Breaks.,” Molecular Therapy — Nucleic Acids, pp. 7:53-60, 2017.

[40] Natsume T, Kiyomitsu T, Saga Y, Kanemaki MT., “Rapid Protein Depletion in Human Cells by Auxin- Inducible Degron Tagging with Short Homology Donors,” Cell Reports, pp. 15:210-218, 2016.

[41] Anguela XM, Sharma R, Doyon Y, Miller JC, Li H, Haurigot V, Rohde ME, Wong SY, Davidson RJ, Zhou S, Gregory PD, Holmes MC, High KA., “Robust ZFN-mediated genome editing in adult hemophilic mice.,” Blood, pp. 122:3283-3287, 2013.

[42] Wang J, Exline CM, DeClercq JJ, Llewellyn GN, Hayward SB, Li PW, Shivak DA, Surosky RT, Gregory PD, Holmes MC, Cannon PM., “Homology-driven genome editing in hematopoietic stem and progenitor cells using ZFN mRNA and AAV6 donors.,” Nature Biotechnology, pp. 33:1256-1263, 2015.

[43] Tsai SQ, Wyvekens N, Khayter C, Foden JA, Thapar V, Reyon D, Goodwin MJ, Aryee MJ, Joung JK., “Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing.,” Nature Biotechnology, pp. 32:569-576, 2014.

[44] Mark B. Nottle, Evelyn J. Salvaris, Nella Fisicaro, Stephen McIlfatrick, Ivan Vassiliev, Wayne J. Hawthorne, Philip J. O’Connell, Jamie L. Brady, Andrew M. Lew, Peter J. Cowan, “Targeted insertion of an anti-CD2 monoclonal antibody transgene into the GGTA1 locus in pigs using FokI-dCas9,” Scientific Reports, p. 7: 8383, 2017.

[45] Bae S, Kweon J, Kim HS, Kim JS, “Microhomology-based choice of Cas9 nuclease target sites,” Nature Methods, pp. 11:705-706, 2014.

[46] Schumann K, Lin S, Boyer E, Simeonov DR, Subramaniam M, Gate RE, Haliburton GE, Ye CJ, Bluestone JA, Doudna JA, Marson A., “Generation of knock-in primary human T cells using Cas9 ribonucleoproteins.,” Proceedings of the National Academy of Sciences of the United States of America, pp. 112:10437-10442, 2015.

[47] Hendel A, Bak RO, Clark JT, Kennedy AB, Ryan DE, Roy S, Steinfeld I, Lunstad BD, Kaiser RJ, Wilkens AB, Bacchetta R, Tsalenko A, Dellinger D, Bruhn L, Porteus MH., “Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells.,” Nature Biotechnology, pp. 33:985-989, 2015.

[48] Gao P, Yang H, Rajashankar KR, Huang Z, Patel DJ., “Type V CRISPR-Cas Cpf1 endonuclease employs a unique mechanism for crRNA-mediated target DNA recognition,” Cell Research, pp. 26:901-913, 2016.

[49] Stella S, Alcón P, Montoya G., “Structure of the Cpf1 endonuclease R-loop complex after target DNA cleavage,” Nature, pp. 546:559-563, 2017.

[50] Maeder ML, Thibodeau-Beganny S, Osiak A, et al., “Rapid "open-source" engineering of customized zinc- finger nucleases for highly efficient gene modification,” Molecular Cell, pp. 31:294-301, 2008.

[51] Christian M, Cermak T, Doyle EL, Schmidt C, Zhang F, Hummel A, Bogdanove AJ, Voytas DF, “Targeting DNA double-strand breaks with TAL effector nucleases,” Genetics, pp. 186:757-761, 2010.

[52] Bhakta MS, Henry IM, Ousterout DG, Das KT, Lockwood SH, Meckler JF, Wallen MC, Zykovich A, Yu Y, Leo H, Xu L, Gersbach CA, Segal DJ, “Highly active zinc-finger nucleases by extended modular assembly,” Genome Research, pp. 23:530-538, 2013.

[53] Zhao J, Sun W, Liang J, Jiang J, Wu Z, “A One-Step System for Convenient and Flexible Assembly of Transcription Activator-Like Effector Nucleases (TALENs),” Molecules and Cells, pp. 39:687-691, 2016.

[54] Silva G, Poirot L, Galetto R, Smith J, Montoya G, Duchateau P, Pâques F, “Meganucleases and other tools for targeted genome engineering: perspectives and challenges for gene therapy,” Current Gene Therapy, pp. 11:11-27., 2011.

[55] Kim EJ, Kang KH, Ju JH., “CRISPR-Cas9: a promising tool for gene editing on induced pluripotent stem cells.,” Korean Journal of Internal Medicine, pp. 32:42-61, 2017.

[56] Elowitz MB, Leibler S., “A synthetic oscillatory network of transcriptional regulators.,” Nature, pp. 403:335- 338, 2000.

[57] Li H, Haurigot V, Doyon Y, Li T, Wong SY, Bhagwat AS, Malani N, Anguela XM, Sharma R, Ivanciu L, Murphy SL, Finn JD, Khazi FR, Zhou S, Paschon DE, Rebar EJ, Bushman FD, Gregory PD, Holmes MC, High KA., “In vivo genome editing restores haemostasis in a mouse model of haemophilia.,” Nature, pp. 475:217-221, 2011.

[58] Mueller C, Tang Q, Gruntman A, Blomenkamp K, Teckman J, Song L, Zamore PD, Flotte TR., “Sustained miRNA-mediated knockdown of mutant AAT with simultaneous augmentation of wild-type AAT has minimal effect on global liver miRNA profiles.,” Molecular Therapy, pp. 20:590-600, 2012.

[59] Tiyaboonchai A, Mac H, Shamsedeen R, Mills JA, Kishore S, French DL, Gadue P., “Utilization of the AAVS1 safe harbor locus for hematopoietic specific transgene expression and gene knockdown in human ES cells.,” Stem Cell Research, pp. 12:630-637, 2014.

[60] Oceguera-Yanez F, Kim SI, Matsumoto T, Tan GW, Xiang L, Hatani T, Kondo T, Ikeya M, Yoshida Y, Inoue H, Woltjen K, “Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives,” Methods, pp. 101:43-55, 2016.

[61] Hastie E, Samulski RJ, “Adeno-associated virus at 50: a golden anniversary of discovery, research, and gene therapy success--a personal perspective,” Human Gene Therapy, pp. 26:257-265, 2015.

[62] Yin H, Song CQ, Dorkin JR, Zhu LJ, Li Y, Wu Q, Park A, Yang J, Suresh S, Bizhanova A, Gupta A, Bolukbasi MF, Walsh S, Bogorad RL, Gao G, Weng Z, Dong Y, Koteliansky V, Wolfe SA, Langer R, Xue W, Anderson DG, “Therapeutic genome editing by combined viral and non-viral delivery of CRISPR system components in vivo,” Nature Biotechnology, pp. 34:328-333, 2016.

[63] Bak RO, Porteus MH, “CRISPR-Mediated Integration of Large Gene Cassettes Using AAV Donor Vectors,” Cell Reports, pp. 20:750-756, 2017.

[64] Moore R, Spinhirne A, Lai MJ, Preisser S, Li Y, Kang T, Bleris L, “CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells.,” Nucleic Acids Research, pp. 43:1297-1303, 2015.

[65] Herzog RW, Davidoff AM, Markusic DM, Nathwani AC., “AAV vector biology in primates: finding the missing link?,” Molecular Therapy, pp. 19:1923-1924, 2011.

[66] Sharei A, Zoldan J, Adamo A, Sim WY, Cho N, Jackson E, Mao S, Schneider S, Han MJ, Lytton-Jean A, Basto PA, Jhunjhunwala S, Lee J, Heller DA, Kang JW, Hartoularos GC, Kim KS, Anderson DG, Langer R, Jensen KF., “A vector-free microfluidic platform for intracellular delivery.,” Proceedings of the National Academy of Sciences of the United States of America, pp. 110:2082-2087, 2013.

[67] Zuris JA, Thompson DB, Shu Y, Guilinger JP, Bessen JL, Hu JH, Maeder ML, Joung JK, Chen ZY, Liu DR, “Efficient Delivery of Genome-Editing Proteins In Vitro and In Vivo,” Nature Biotechnology, p. 33:73–80., 2015.

[68] Blinka S, Reimer MH Jr, Pulakanti K, Rao S., “Super-Enhancers at the Nanog Locus Differentially Regulate Neighboring Pluripotency-Associated Genes.,” Cell Reports, pp. 17:19-28, 2016.

[69] Yin H, Kauffman KJ, Anderson DG., “Delivery technologies for genome editing.,” Nature Reviews Drug Discovery, pp. 16:387-399, 2017.

[70] Genovese P, Schiroli G, Escobar G, Tomaso TD, Firrito C, Calabria A, Moi D, Mazzieri R, Bonini C, Holmes MC, Gregory PD, van der Burg M, Gentner B, Montini E, Lombardo A, Naldini L., “Targeted genome editing in human repopulating haematopoietic stem cells.,” Nature, pp. 510:235-240, 2014.

[71] Bankiewicz KS, Forsayeth J, Eberling JL, Sanchez-Pernaute R, Pivirotto P, Bringas J, Herscovitch P, Carson RE, Eckelman W, Reutter B, Cunningham J., “Long-term clinical improvement in MPTP-lesioned primates after gene therapy with AAV-hAADC.,” Molecular Therapy, pp. 14:564-570, 2006.

[72] Castanotto D, Rossi JJ., “The promises and pitfalls of RNA-interference-based therapeutics.,” Nature, pp. 457:426-433, 2009.

[73] Doerfler PA, Nayak S, Corti M, Morel L, Herzog RW, Byrne BJ., “Targeted approaches to induce immune tolerance for Pompe disease therapy.,” Molecular Therapy - Methods and Clinical Development, p. 3:15053, 2016.

[74] Cyranoski D., “Chinese scientists to pioneer first human CRISPR trial.,” Nature, pp. 535:476-477, 2016.

[75] Reardon S., “First CRISPR clinical trial gets green light from US panel.,” Nature doi:10.1038/nature.2016.20137, 2016.

[76] Kelton W, Waindok AC, Pesch T, Pogson M, Ford K, Parola C, Reddy ST, “Reprogramming MHC specificity by CRISPR-Cas9-assisted cassette exchange,” Scientific Reports, p. 7:45775, 2017.

[77] Shen S, Loh TJ, Shen H, Zheng X, Shen H., “CRISPR as a strong gene editing tool.,” BMB Reports, pp. 50:20-24, 2017.

[78] Suzuki S, Sargent RG, Illek B, Fischer H, Esmaeili-Shandiz A, Yezzi MJ, Lee A, Yang Y, Kim S, Renz P, Qi Z, Yu J, Muench MO, Beyer AI, Guimarães AO, Ye L, Chang J, Fine EJ, Cradick TJ, Bao G, Rahdar M, Porteus MH, Shuto T, Kai H, Kan YW, Gruenert DC, “TALENs Facilitate Single-step Seamless SDF Correction of F508del CFTR in Airway Epithelial Submucosal Gland Cell-derived CF-iPSCs,” Molecular Therapy-Nucleic Acids, p. 5:e273, 2016.

[79] Crane AM, Kramer P, Bui JH, Chung WJ, Li XS, Gonzalez-Garay ML, Hawkins F, Liao W, Mora D, Choi S, Wang J, Sun HC, Paschon DE, Guschin DY, Gregory PD, Kotton DN, Holmes MC, Sorscher EJ, Davis BR, “Targeted correction and restored function of the CFTR gene in cystic fibrosis induced pluripotent stem cell,” Stem Cell Reports, pp. 4:569-577, 2015.

[80] Sargent RG, Suzuki S, Gruenert DC, “Nuclease-mediated double-strand break (DSB) enhancement of small fragment homologous recombination (SFHR) gene modification in human-induced pluripotent stem cells (hiPSCs),” Methods in Molecular Biology , pp. 1114:279-290, 2014.

[81] Firth AL, Menon T, Parker GS, Qualls SJ, Lewis BM, Ke E, Dargitz CT, Wright R, Khanna A, Gage FH, Verma IM, “Functional Gene Correction for Cystic Fibrosis in Lung Epithelial Cells Generated from Patient iPSCs,” Cell Reports, pp. 12:1385-1390, 2015.

[82] Schwank G, Koo BK, Sasselli V, Dekkers JF, Heo I, Demircan T, Sasaki N, Boymans S, Cuppen E, van der Ent CK, Nieuwenhuis EE, Beekman JM, Clevers H, “Functional repair of CFTR by CRISPR/Cas9 in intestinal stem cell organoids of cystic fibrosis patients,” Cell Stem Cell, pp. 13:653-658, 2013.

[83] Park CY, Kim J, Kweon J, Son JS, Lee JS, Yoo JE, Cho SR, Kim JH, Kim JS, Kim DW., “Targeted inversion and reversion of the blood coagulation factor 8 gene in human iPS cells using TALENs,” Proceedings of the National Academy of Sciences of the United States of America, pp. 111:9253-9258, 2014.

[84] Park CY, Kim DH, Son JS, Sung JJ, Lee J, Bae S, Kim JH, Kim DW, Kim JS., “Functional Correction of Large Factor VIII Gene Chromosomal Inversions in Hemophilia A Patient-Derived iPSCs Using CRISPR- Cas9,” Cell Stem Cell, pp. 17:213-220, 2015.

[85] Sun N, Zhao H, “Seamless correction of the sickle cell disease mutation of the HBB gene in human induced pluripotent stem cells using TALENs,” Biotechnology and Bioengineering, pp. 111:1048-1053, 2014.

[86] Sebastiano V, Maeder ML, Angstman JF, Haddad B, Khayter C, Yeo DT, Goodwin MJ, Hawkins JS, Ramirez CL, Batista LF, Artandi SE, Wernig M, Joung JK, “In situ genetic correction of the sickle cell anemia mutation in human induced pluripotent stem cells using engineered zinc finger nucleases,” Stem Cells, pp. 29:1717-1726, 2011.

[87] Huang X, Wang Y, Yan W, Smith C, Ye Z, Wang J, Gao Y, Mendelsohn L, Cheng L, “Production of Gene- Corrected Adult Beta Globin Protein in Human Erythrocytes Differentiated from Patient iPSCs After Genome Editing of the Sickle Point Mutation,” Stem Cells, pp. 33:1470-1479, 2015.

[88] Hoban MD, Cost GJ, Mendel MC, Romero Z, Kaufman ML, Joglekar AV, Ho M, Lumaquin D, Gray D, Lill GR, Cooper AR, Urbinati F, Senadheera S, Zhu A, Liu PQ, Paschon DE, Zhang L, Rebar EJ, Wilber A, Wang X, Gregory PD, Holmes MC, Reik A, Hollis RP, Kohn DB, “Correction of the sickle cell disease mutation in human hematopoietic stem/progenitor cells,” Blood, pp. 125:2597-2604, 2015.

[89] Xie F, Ye L, Chang JC, Beyer AI, Wang J, Muench MO, Kan YW., “Seamless gene correction of β- thalassemia mutations in patient-specific iPSCs using CRISPR/Cas9 and piggyBac,” Genome Research, pp. 24:1526-1533, 2014.

[90] Ma N, Shan Y, Liao B, Kong G, Wang C, Huang K, Zhang H, Cai X, Chen S, Pei D, Chen N, Pan G., “Factor-induced Reprogramming and Zinc Finger Nuclease-aided Gene Targeting Cause Different Genome Instability in β-Thalassemia Induced Pluripotent Stem Cells (iPSCs),” Journal of Biological Chemistry, pp. 290:12079-12089, 2015.

[91] Rahman SH, Kuehle J, Reimann C, Mlambo T, Alzubi J, Maeder ML, Riedel H, Fisch P, Cantz T, Rudolph C, Mussolino C, Joung JK, Schambach A, Cathomen T, “Rescue of DNA-PK Signaling and T-Cell Differentiation by Targeted Genome Editing in a prkdc Deficient iPSC Disease Model,” PLOS Genetics , p. 11:e1005239, 2015.

[92] Menon T, Firth AL, Scripture-Adams DD, Galic Z, Qualls SJ, Gilmore WB, Ke E, Singer O, Anderson LS, Bornzin AR, Alexander IE, Zack JA, Verma IM, “Lymphoid regeneration from gene-corrected SCID-X1 subject-derived iPSCs,” Cell Stem Cell, pp. 16:367-372, 2015.

[93] Li HL, Fujimoto N, Sasakawa N, Shirai S, Ohkame T, Sakuma T, Tanaka M, Amano N, Watanabe A, Sakurai H, Yamamoto T, Yamanaka S, Hotta A, “Precise correction of the dystrophin gene in duchenne muscular dystrophy patient induced pluripotent stem cells by TALEN and CRISPR-Cas9,” Stem Cell Reports, pp. 4:143-154, 2015.

[94] Li L, Krymskaya L, Wang J, Henley J, Rao A, Cao LF, Tran CA, Torres-Coronado M, Gardner A, Gonzalez N, Kim K, Liu PQ, Hofer U, Lopez E, Gregory PD, Liu Q, Holmes MC, Cannon PM, Zaia JA, DiGiusto DL, “Genomic editing of the HIV-1 coreceptor CCR5 in adult hematopoietic stem and progenitor cells using zinc finger nucleases,” Molecular Therapy, pp. 21:1259-1269, 2013.

[95] Holt N, Wang J, Kim K, Friedman G, Wang X, Taupin V, Crooks GM, Kohn DB, Gregory PD, Holmes MC, Cannon PM, “Human hematopoietic stem/progenitor cells modified by zinc-finger nucleases targeted to CCR5 control HIV-1 in vivo,” Nature Biotechnology, pp. 28:839-847, 2010.

[96] Wilen CB, Wang J, Tilton JC, Miller JC, Kim KA, Rebar EJ, Sherrill-Mix SA, Patro SC, Secreto AJ, Jordan AP, Lee G, Kahn J, Aye PP, Bunnell BA, Lackner AA, Hoxie JA, Danet-Desnoyers GA, Bushman FD, Riley JL, Gregory PD, June CH, Holmes MC, Doms RW, “Engineering HIV-resistant human CD4+ T cells with CXCR4-specific zinc-finger nucleases,” PLOS Pathogens, p. 7:e1002020, 2011.

[97] Ye L, Wang J, Beyer AI, Teque F, Cradick TJ, Qi Z, Chang JC, Bao G, Muench MO, Yu J, Levy JA, Kan YW, “Seamless modification of wild-type induced pluripotent stem cells to the natural CCR5Δ32 mutation confers resistance to HIV infection,” Proceedings of the National Academy of Sciences of the United States of America, pp. 111:9591-9596, 2014.

[98] Vanoli F, Tomishima M, Feng W, Lamribet K, Babin L, Brunet E, Jasin M, “CRISPR-Cas9-guided oncogenic chromosomal translocations with conditional fusion protein expression in human mesenchymal cells,” Proceedings of the National Academy of Sciences of the United States of America, pp. 114:3696-3701, 2017.

[99] QIAGEN, DNeasy Blood & Tissue Kit, 2011.

[100] L. I. NZYTech, NZYMiniprep, Lisboa: Instituto Superior de Agronomia.

[101] L. I. NZYTech, NZYGelpure, Lisboa: Instituto Superior de Agronomia.

[102] Haeussler M, Schönig K, Eckert H, Eschstruth A, Mianné J, Renaud JB, Schneider-Maunoury S, Shkumatava A, Teboul L, Kent J, Joly JS, Concordet JP, “Evaluation of off-target and on-target scoring

algorithms and integration into the guide RNA selection tool CRISPOR,” Genome Biology, p. 17:148, 2016.

[103] Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F., “Genome engineering using the CRISPR-Cas9 system.,” Nat Protoc., nº doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. 10.1038/nprot.2013.143 PubMed 24157548, pp. 8(11):2281-308, 2013 Nov.

[104] Life Technologies Corporation, GeneArt® Genomic Cleavage Detection Kit, 2014.

[105] Madeira C, Ribeiro SC, Pinheiro IS, Martins SA, Andrade PZ, da Silva CL, Cabral JM., “Gene delivery to human bone marrow mesenchymal stem cells by microporation.,” Journal of Biotechnology, pp. 151:130- 136, 2011.

[106] Invitrogen, Neon® Transfection System, life techonologies.

[107] Yasukawa K, Hirano T, Watanabe Y, Muratani K, Matsuda T, Nakai S, Kishimoto T., “Structure and expression of human B cell stimulatory factor-2 (BSF-2/IL-6) gene.,” The EMBO Journal, pp. 6:2939-2945, 1987.

[108] Bernardes N, Ribeiro AS, Abreu S, Mota B, Matos RG, Arraiano CM, Seruca R, Paredes J, Fialho AM., “The bacterial protein azurin impairs invasion and FAK/Src signaling in P-cadherin-overexpressing breast cancer cell models.,” PLoS One, p. 8:e69023, 2013.

[109] Huang J, Dibble CC, Matsuzaki M, Manning BD., “The TSC1-TSC2 complex is required for proper activation of mTOR complex 2.,” Molecular and Cellular Biology, pp. 28:4104-4115, 2008.

[110] Ovchinnikov DA, Titmarsh DM, Fortuna PR, Hidalgo A, Alharbi S, Whitworth DJ, Cooper-White JJ, Wolvetang EJ., “Transgenic human ES and iPS reporter cell lines for identification and selection of pluripotent stem cells in vitro.,” Stem Cell Research, pp. 13:251-261, 2014.

[111] Drobinskaya I, Linn T, Saric T, Bretzel RG, Bohlen H, Hescheler J, Kolossov E., “Scalable selection of hepatocyte- and hepatocyte precursor-like cells from culture of differentiating transgenically modified murine embryonic stem cells.,” Stem Cells, pp. 26:2245-2256, 2008.

[112] Yang C, Przyborski S, Cooke MJ, Zhang X, Stewart R, Anyfantis G, Atkinson SP, Saretzki G, Armstrong L, Lako M., “A key role for telomerase reverse transcriptase unit in modulating human embryonic stem cell proliferation, cell cycle dynamics, and in vitro differentiation.,” Stem Cells, pp. 26:850-863, 2008.

[113] Paatero AO, Turakainen H, Happonen LJ, Olsson C, Palomäki T, Pajunen MI, Meng X, Otonkoski T, Tuuri T, Berry C, Malani N, Frilander MJ, Bushman FD, Savilahti H., “Bacteriophage Mu integration in yeast and mammalian genomes.,” Nucleic Acids Research , p. 36:e148, 2008.

[114] Kim DS, Lee MW, Lee TH, Sung KW, Koo HH, Yoo KH., “Cell culture density affects the stemness gene expression of adipose tissue-derived mesenchymal stem cells.,” Biomedical Reports, pp. 6:300-306, 2017.

[115] Wongchana W, Palaga T., “Direct regulation of interleukin-6 expression by Notch signaling in macrophages.,” Cellular & Molecular Immunology, pp. 9:155-162, 2012.

[116] Cafforio P, Viggiano L, Mannavola F, Pellè E, Caporusso C, Maiorano E, Felici C, Silvestris F., “pIL6-TRAIL- engineered umbilical cord mesenchymal/stromal stem cells are highly cytotoxic for myeloma cells both in vitro and in vivo.,” Stem Cell Research & Therapy, p. 8:206., 2017.

[117] Lee K, Conboy M, Park HM, Jiang F, Kim HJ, Dewitt MA, Mackley VA, Chang K, Rao A, Skinner C, Shobha T, Mehdipour M, Liu H, Huang WC, Lan F, Bray NL, Li S, Corn JE, Kataoka K, Doudna JA, Conboy I, Murthy N., “Nanoparticle delivery of Cas9 ribonucleoprotein and donor DNA in vivo induces homology- directed DNA repair.,” Nature Biomedical Engineering, pp. doi:10.1038/s41551-017-0137-2, 2017.

[118] Ran FA, Cong L, Yan WX, Scott DA, Gootenberg JS, Kriz AJ, Zetsche B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang F., “In vivo genome editing using Staphylococcus aureus Cas9.,” Nature, pp. 520:186-191, 2015.

Appendix

1. Antibodies Table 17 Antibodies employed in this work.

Secondary Antibody Proteins Primary Antibody (1:2000 PBS-Tween20) (Santa Cruz Biotechnology) Azurin (Santa Cruz 1:2000 Anti-goat Biotechnology) PI3K (Cell Signalling 1:1000 Anti-rabbit Total Technology) (milk-buffer) Akt (Cell Signalling 1:500 Anti-rabbit Technology) Src (Cell Signalling 1:1000 Anti-rabbit Technology) pPI3K (Cell Signalling 1:1000 Anti-rabbit Technology) Phosphorylated pAkt (Cell Signalling 1:1000 Anti-rabbit (BSA) Technology) pSrc (Cell Signalling 1:500 Anti-rabbit Technology) GAPDH (Santa Cruz 1:1000 Anti-mouse Biotechnology) GFP (Santa Cruz Control (milk-buffer) 1:1000 Anti-mouse Biotechnology) Actin (Santa Cruz 1:1000 Anti-goat Biotechnology)

2. Donor template sequence 5’Homology Arm IL6-Promoter hAzurin P2A eGFP+SV40polyA 3’Homology Arm restriction site of AflII enzyme GGCTCAAGTGATCTCCCATCTTGGCCTCCCAAAGTACTGGGATTACAGGCATGAGCCATGGTGCCTGGCTGGGAG TGACTTCTTCTTGGATACAGTATCCATTTGGGATCATGAAAAAGCTCAGGAAGTAGATAGTGGTGATGGTTGCAT AATATTGGAGGTATCCTAAATGCCACTGAATTGTGCACTTTAAAACAGGGAAGTTGGTAAATTTTATGTTGTTTA TTTTACCACCACCACCACAACAAAAGATAAAGAAAACACAACAGGTGGTCAACACCCACAAGCTATAGCTTTCTG ACCCCTGGGCAAGGGCTCTGTCTACAGATACAGACAGATCTCAGCAACATGTTGAACACAAGAAGCAAATTGCAG AAGGATGTGCAGCAGACATGCAGAGGGCGCTGACTGTGGTTGAATAAAAAGCCAGTCACCCTCCCGGATCCTCCT GCAAGAGACACCATCCTGAGGGAAGAGGGCTTCTGAACCAGCTTGACCCAATAAGAAATTCTTGGGTGCCGACGC GGAAGCAGATTCAGAGCCTAGAGCCGTGCCTGCGTCCGTAGTTTCCTTCTAGCTTCTTTTGATTTCAAATCAAGA CTTACAGGGAGAGGGAGCGATAAACACAAACTCTGCAAGATGCCACAAGGTCCTCCTTTGACATCCCCAACAAAG AGGTGAGTAGTATTCTCCCCCTTTCTGCCCTGAACCAAGTGGGCTTCAGTAATTTCAGGGCTCCAGGAGACCTGG GGCCCATGCAGGTGCCCCAGTGAAACAGTGGTGAAGAGACTCAGTGGCAATGGGGAGAGCACTGGCAGCACAAGG CAAACCTCTGGCACAGAGAGCAAAGTCCTCACTGGGAGGATTCCCAAGGGGTCACTTGGGAGAGGGCAGGGCAGC AGCCAACCTCCTCTAAGTGGGCTGAAGCAGGTGAAGAAAGTGGCAGAAGCCACGCGGTGGCAAAAAGGAGTCACA CACTCCACCTGGAGACGCCTTGAAGTAACTGCACGAAATTTGAGGATGGCCAGGCAGTTCTACAACAGCCGCTCA CAGGGAGAGCCAGAACACAGAAGAACTCAGATGACTGGTAGTATTACCTTCTTCATAATCCCAGGCTTGGGGGGC TGCGATGGAGTCAGAGGAAACTCAGTTCAGAACATCTTTGGTTTTTACAAATACAAATTAACTGGAACGCTAAAT TCTAGCCTGTTAATCTGGTCACTGAAAAAAAATTTTTTTTTTTTCAAAAAACATAGCTTTAGCTTATTTTTTTTC TCTTTGTAAAACTTCGTGCATGACTTCAGCTTTACTCTTTGTCAAGACATGCCAAAGTGCTGAGTCACTAATAAA AGAAAAAAAGAAAGTAAAGGAAGAGTGGTTCTGCTTCTTAGCGCTAGCCTCAATGACGACCTAAGCTGCACTTTT CCCCCTAGTTGTGTCTTGCCATGCTAAAGGACGTCACATTGCACAATCTTAATAAGGTTTCCAATCAGCCCCACC CGCTCTGGCCCCACCCTCACCCTCCAACAAAGATTTATCAAATGTGGGATTTTCCCATGAGTCTCAATATTAGAG TCTCAACCCCCAATAAATATAGGACTGGAGATGTCTGAGGCTCATTCTGCCCTCGAGCCCACCGGGAACGAAAGA

GAAGCTCTATCTCCCCTCCAGGAGCCCAGCTATGGATGCTATGAAAAGGGGCCTGTGTTGTGTGCTGCTGCTGTG CGGAGCTGTTTTCGTGTCCGCCAGGGCAGAGTGCTCAGTCGATATTCAAGGAAACGACCAAATGCAGTTCAACAC AAACGCCATAACCGTAGATAAGAGTTGCAAACAGTTCACAGTGAACCTGTCACATCCAGGGAATCTGCCAAAGAA CGTCATGGGACACAACTGGGTCCTCTCCACCGCCGCTGACATGCAGGGAGTCGTTACAGACGGCATGGCCTCTGG GTTGGATAAAGACTACCTCAAACCAGATGATTCACGGGTTATCGCTCACACCAAATTGATTGGGTCCGGAGAAAA GGATTCTGTGACATTCGACGTGAGCAAACTTAAGGAAGGGGAACAGTACATGTTCTTTTGCACCTTTCCAGGCCA TTCCGCCCTTATGAAAGGAACCCTGACCTTGAAGGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGCGACGTGGA GGAGAACCCTGGACCTATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGA CGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCT GAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCA GTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCA GGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCT GGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAA CTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCA CAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCT GCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGT CCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCGCGACTC TAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAAC CTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAAT AGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTA TCTTAAAGAAATGACACAGCCAGGTGTGGTGGCTCATGCCGGCTTTGGGAGGCCAAGGCAGGAGGATCCCTTGAG CCTGGGAATTTGAGGCTTCAGTGAGCCATAATTGCACCACTGTACTCCAGCCTGGGTGACAGTGTGAGGTCCTGT CTCAAAAAAAAAAAAAGGGTCAGATGCGGTGGCTCCTGCCTGTAATTTCAGCACTTTGGGAGGCCGAGGCGGGTG GATCATGAGGTCAGGAGTTCAAGACCAGCCTGGCCAACATGATGAAACCCCATCTCTATTAAAAATACAAAAGTT AGCTGGGTGTGGTGGCGTGTGCCTGTAATCCCAGCTACTCAAGAAGCTGAGGCAGGAGAACCGCTTGAACCTGGG AGGCAGAAGTTGCAGTGAGCCAAGATCATGCCACTGCACTCCAGCCTGGGTGACAGAGCGAGACCATA

3. Agarose gel electrophoresis of PCR products correspondent to hAzurin I, hAzurin, hAzurin II, and eGFP+SV40polyA

hAzurin I hAzurin hAzurin II eGFP+SV40polyA 416 bp 506 bp 136 bp 1024 bp 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 Mk bp

2000 - 1000 - 500 - 300 - 100 -

Figure 27 Agarose gel electrophoresis of PCR products amplified from pVAX-engineered Azurin and pEGFP-N1 plasmids DNA, with primers IL6Az Fw and P2AAz Rev, and P2AGFP Fw and 3HApolyA.G3 Rev, for hAzurin and eGFP+SV40polyA amplification, respectively (highlighted bands). (See Table 5 on section 3.6.1). The remaining bands correspond to amplification of the portion of the hAzurin fragment until to restriction site of AflII enzyme (hAzurin I) and from that site (hAzurin II), with primers IL6Az Fw and AzAflII Rev, and AzAflII Fw and P2AAz Rev (see Table 18). Mk – 1Kb Plus DNA Ladder (Invitrogen™). 1-2-3-4: 54ºC-56ºC-58ºC-60ºC of annealing temperature.

Table 18 Primers used to amplify the hAzurin I and hAzurin II fragments.

Name Sequence 5’ to 3’ Type Tm [ºC] %GC Fragment

IL6Az Fw CCCTCCAGGAGCCCAGCTATGGATGCTATGAAAAGGGG Forward 62 | 58 72 | 45 hAzurin I

AzAflII Rev AACATGTACTGTTCCCCTTC Reverse 58 45 hAzurin I

AzAflII Fw TGACATTCGACGTGAGCAAA Forward 58 45 hAzurin II

TCGCCAGCCTGCTTCAGCAGGCTGAAGTTAGTAGCCTTCAAG P2AAz Rev Reverse 60 | 60 67 | 50 hAzurin II GTCAGGGTTCCTT

4. pCAG-SpCas9-GFP-U6-gRNA plasmid

Figure 28 Full Sequence Map for pCAG-SpCas9-GFP-U6-gRNA.