US 20140230.090A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0230090 A1 AVNIEL et al. (43) Pub. Date: Aug. 14, 2014
(54) METHODS OF INTRODUCING DSRNATO Apr. 23, 2013, provisional application No. 61/814,890, PLANT SEEDS FOR MODULATING GENE filed on Apr. 23, 2013, provisional application No. EXPRESSION 61/908,865, filed on Nov. 26, 2013, provisional appli cation No. 61/908,855, filed on Nov. 26, 2013. (71) Applicant: A.B. Seeds Ltd., Lod (IL) Publication Classification (72) Inventors: Amir AVNIEL, Tel-Aviv (IL); Efrat Lidor-Nili, Nes Ziona (IL); Rudy Maor, (51) Int. Cl. Rechovot (IL); Ofir Meir, Doar-Na CI2N IS/II3 (2006.01) Emek Soreq (IL); Orly Noivirt-Brik, (52) U.S. Cl. Givataim (IL) CPC ...... CI2N 15/I 137 (2013.01); C12N 15/I 13 (2013.01) (21) Appl. No.: 14/143,836 USPC ...... 800/279: 800/302 (22) Filed: Dec. 30, 2013 (57) ABSTRACT A method of introducing an exogenous non-transcribable Related U.S. Application Data polynucleotide trigger, for example dsRNA, molecule into a (60) Provisional application No. 61/748,095, filed on Jan. seed is provided. The method comprises contacting the seed 1, 2013, provisional application No. 61/748,101, filed with the exogenous non-transcribable polynucleotide trigger, on Jan. 1, 2013, provisional application No. 61/748, for example dsRNA, molecule under conditions which allow 094, filed on Jan. 1, 2013, provisional application No. penetration of the exogenous non-transcribable polynucle 61/748,099, filed on Jan. 1, 2013, provisional applica otide trigger, for example dsRNA, molecule into the seed, tion No. 61/814,888, filed on Apr. 23, 2013, provi thereby introducing the exogenous non-transcribable poly sional application No. 61/814,892, filed on Apr. 23, nucleotide trigger, for example dsRNA, molecule into the 2013, provisional application No. 61/814,899, filed on seed. Patent Application Publication Aug. 14, 2014 Sheet 1 of 65 US 2014/0230.090 A1
TOHIN00 Patent Application Publication Aug. 14, 2014 Sheet 2 of 65 US 2014/0230.090 A1
&
S &
Patent Application Publication Aug. 14, 2014 Sheet 3 of 65 US 2014/0230.090 A1
FIG. 3A
FIG. 3B
FIG. 3C WTRICE SPDS-1 Patent Application Publication Aug. 14, 2014 Sheet 4 of 65 US 2014/0230.090 A1
TREATMENT OF NFY dsRNATOTOMATO SEEDS TARGET OF mir169 55 DAYS AFTER ORA SEEDTM TREATMENT
CONTROLPLANTS 12 a 10 a 8 ?hls 6 4 a 2 2 O X<10 10<=x<15 15<=x<20 20<=x<25 25C=x<30 30<=x<35 X>35 HEIGHT (cm)
NFYAmr169
?3. 5 g al
FIG. 4B Patent Application Publication Aug. 14, 2014 Sheet 5 of 65 US 2014/0230.090 A1
(NO)IHOBHSINVld 09GW07980£(NO)IHOBHSINVld
9
SNWild O' Patent Application Publication Aug. 14, 2014 Sheet 6 of 65 US 2014/0230.090 A1
C S (NO) LH813HSLNVld NVW
*———————————? (NO)IHOBHSINVld
07 98 09 SLNWildO% Patent Application Publication Aug. 14, 2014 Sheet 7 of 65 US 2014/0230.090 A1
TONOO ... CONOO ONOO (ONOO ONOO
co Co go Co go go NOSSd)(NW Patent Application Publication Aug. 14, 2014 Sheet 8 of 65 US 2014/0230.090 A1
NOISSX NWOWNW Patent Application Publication Aug . 14, 2014 Sheet 9 of 65 US 2014/0230.090 A1
81/“50/-|
SCE|ESTOHIN00 Patent Application Publication Aug. 14, 2014 Sheet 10 of 65 US 2014/0230.090 A1
Patent Application Publication Aug. 14, 2014 Sheet 14 of 65 US 2014/0230.090 A1
7ZVIÐV000WIWLOWOLOVIÐOVLVIVI, |||||||||||||||||||| Ç9;VIÐ00.00WIWLOWOLOVIÐOYILWWI, Z9||90700000LOLCOWI,0000 ||||||||||||||||||| GZ900V00000||0||00WI,0000 Patent Application Publication Aug. 14, 2014 Sheet 15 of 65 US 2014/0230090 A1
NADPHDS1 SCORE EXPECT IDENTITIES GAPS STRAND FRAME 42.8BITS(46) 0,021() 28/30(93%) 1/30(3%) PLUSIPLUS FEATURES: QUERY 2 TAATACGACTCACTATAGGGAGAACTTGGG 31 sec. 23 kicketkech-like su ANOTHER SEGMENT:
SCORE EXPECT IDENTITIES GAPS STRAND FRAME 374 BITS(40) 0.91 () 20/20(100%) 0120(0%) PLUSIPLUS FEATURES: QUERY 523 CCCTATAGTGAGTCGTATTA. 542 | | | | | | | | | | | | || || || || SBUCT 755 CCCTATAGTGAGTCGTATTA 774
NADPHDS2. SCORE EXPECT IDENTITIES GAPS STRAND FRAME 392 BITS(42) 0.26() 21/21 (100%) 0121(0%) PLUSIPLUS FEATURES: QUERY 189 GATGAAGAAGACAAAAAGAAA 209 | | | | | | | | | | | | | | | | | | | || SBUCT 42818 GATGAAGAAGACAAAAAGAAA 42838
FIG 10A
Patent Application Publication US 2014/0230.090 A1
90/,5D/-| ISO-??VII Patent Application Publication Aug. 14, 2014 Sheet 18 of 65 US 2014/0230.090 A1
N :
5.
WNWOWOO)WINOd Patent Application Publication Aug. 14, 2014 Sheet 19 of 65 US 2014/0230.090 A1
N 5.
:
CD u (U Ch. H CC N
(6) H913M Patent Application Publication Aug. 14, 2014 Sheet 20 of 65 US 2014/0230.090 A1
WNWOWOO)WINOd Patent Application Publication US 2014/0230.090 A1
CILL"5D]=|
WNWOWOOWINOd Patent Application Publication Aug. 14, 2014 Sheet 22 of 65 US 2014/0230.090 A1
i
Cd Cd Cd Cd Cd Cd Cd Cd N- do lo S cyd on r WNWOWOO)WINOd Patent Application Publication Aug. 14, 2014 Sheet 23 of 65 US 2014/0230.090 A1
Ø Ø ZINWTd
|||NWTd
070 (6) HOM Patent Application Publication Aug. 14, 2014 Sheet 24 of 65 US 2014/0230.090 A1
08 09 07 OZ WNWOWOO 99WINOd Patent Application Publication Aug. 14, 2014 Sheet 25 of 65 US 2014/0230.090 A1
3 s S s r r S S (6) H93M Patent Application Publication Aug. 14, 2014 Sheet 26 of 65 US 2014/0230.090 A1
5.
:
3 s S s rt rt S S (6) H93M Patent Application Publication Aug. 14, 2014 Sheet 27 of 65 US 2014/0230.090 A1
8IWEdE}}ZIWE'dE}}||WEdE}}8|WE'dE}} ZINWTdHdOWN9W10|E
08 09 Off OZ WNWOWOOSWNOX Patent Application Publication Aug. 14, 2014 Sheet 28 of 65 US 2014/0230.090 A1
8IWE'dE}}
03 09 07 OZ (Bu) LH913M Patent Application Publication Aug. 14, 2014 Sheet 29 of 65 US 2014/0230.090 A1
08 09 OZ Patent Application Publication Aug. 14, 2014 Sheet 30 of 65 US 2014/0230.090 A1
08 09 07 OZ Patent Application Publication Aug. 14, 2014 Sheet 31 of 65 US 2014/0230.090 A1
OZ
||
9
|
OOZ OZ) 08 07 (6u) LHSIM Patent Application Publication Aug. 14, 2014 Sheet 32 of 65 US 2014/0230.090 A1
00|| 06 08 0|| 09 09 07 09 WNWOWOO 99WINOd Patent Application Publication Aug. 14, 2014 Sheet 33 of 65 US 2014/0230.090 A1
878),"5D/-|
WNWOWOO)WINOd Patent Application Publication Aug. 14, 2014 Sheet 34 of 65 US 2014/0230.090 A1
Patent Application Publication Aug. 14, 2014 Sheet 35 of 65 US 2014/0230.090 A1
876],"5D/-|
Patent Application Publication Aug. 14, 2014 Sheet 37 of 65 US 2014/0230.090 A1
S09
(6Lu) LHSIM Patent Application Publication Aug. 14, 2014 Sheet 38 of 65 US 2014/0230.090 A1
—- a N
—- S. N
N
N i
Od Cd go S. s s c d rs S (6W) LHSIM Patent Application Publication Aug. 14, 2014 Sheet 39 of 65 US 2014/0230.090 A1
WICE
96 06 98 Patent Application Publication Aug. 14, 2014 Sheet 40 of 65 US 2014/0230.090 A1
WICE Patent Application Publication Aug. 14, 2014 Sheet 41 of 65 US 2014/0230.090 A1
Patent Application Publication Aug. 14, 2014 Sheet 42 of 65 US 2014/0230.090 A1
6INWTdHdOWN
|||NWTdHdOWNWICE
00|| 08 09 07 OZ O Patent Application Publication Aug. 14, 2014 Sheet 43 of 65 US 2014/0230.090 A1
98 09 OZ Patent Application Publication Aug. 14, 2014 Sheet 44 of 65 US 2014/0230.090 A1
f
7. NW d
OCI
9NW CINW 7 NW NW i. (LNW NW C 9.NWld CINW 7 NW 9NW OLNW NW C 9.NW GNW 7 NW NW i NW NW
Cd ced Cod Cd Cd Cd cd od ced r on WNWOWOO 9WINOd Patent Application Publication Aug. 14, 2014 Sheet 45 of 65 US 2014/0230.090 A1
5
i.
i
Cd Cd Cd Cd Cd Cd Cd Cd N- do lo S. cyrd cin w WNWOWOO 99WINOd Patent Application Publication Aug. 14, 2014 Sheet 46 of 65 US 2014/0230.090 A1
-7LNWild ; LNVld 3
LNVid: DLNWild
H7 LNVld S EINVld
9 NW GLNWld s
re - NY
Cod Cd ced Cd ced Cd cd did ced r- ca. WNWOWOO)WINOd Patent Application Publication Aug. 14, 2014 Sheet 47 of 65 US 2014/0230.090 A1
WNWOWOO)WINOd Patent Application Publication Aug. 14, 2014 Sheet 48 of 65 US 2014/0230.090 A1
GNW s
GLNW
ELNWild
GLNW
9 LNW lo
GLNW i
CINW lo
C C cy S can ( 6
Patent Application Publication Aug. 14, 2014 Sheet 50 of 65 US 2014/0230.090 A1
PERCENT LARVAL RECOVERY
OPPM 5OPPM 500 PPM Snf7 F G. 2 6A
TOTALLARWALWEIGHT (mg)
50 PPM 500 PPM Snf7 FIG 26B
OPPM 50 PPM 5OOPPM Snf7 FIG. 26C Patent Application Publication Aug. 14, 2014 Sheet 51 of 65 US 2014/0230.090 A1
TOMATO PLANT DEFOLIATIONBY CPB
FIG 27A
FIG 27B O FORMULATION GFP
AVERAGE CPBLARWALWEIGHT o
O FIG 27C FORMULATION GFP Patent Application Publication Aug. 14, 2014 Sheet 52 of 65 US 2014/0230.090 A1
WITH CONTROL DUNNETTS TRT (TRIG) O.05 FIG 28A
WITH CONTROL TRT (TRG) Duys's FIG. 28B Patent Application Publication Aug. 14, 2014 Sheet 53 of 65 US 2014/0230.090 A1
WITH CONTROL TRT (TRIG) Duis's FIG 29A
WITH CONTROL TRT (TRIGGER) DUNNETTSO.05 FIG 29B Patent Application Publication Aug. 14, 2014 Sheet 54 of 65 US 2014/0230.090 A1
WITH CONTROL Trt (TRIGGER) DUNNETTS 0.05 FIG 30
Patent Application Publication Aug. 14, 2014 Sheet 57 of 65 US 2014/0230.090 A1
ECGN (CCCCN CCCCN OCCN 6,099W 89CN 199N 9.099N CCCN
i CGIN
(39NWHOOTO)NOISSldX Patent Application Publication Aug. 14, 2014 Sheet 58 of 65 US 2014/0230.090 A1
98.299W
CGIN::CGIN:
(39NWHOOO-) NOISSldX Patent Application Publication Aug. 14, 2014 Sheet 59 of 65 US 2014/0230.090 A1
Lice on Lo st ca re (39NWHOOTO)NOISSldX3 Patent Application Publication Aug. 14, 2014 Sheet 60 of 65 US 2014/0230.090 A1
! : EEEEEEEEEigg, e E. s Cis isE:s s s E69393
EEEEEEs w : E.E. 993 E.E1993assessesses 9999W
9999W
7999W
999W
(99.9W
999W
S. (loop.() NOISS32dX3 Patent Application Publication Aug. 14, 2014 Sheet 61 of 65 US 2014/0230.090 A1
Patent Application Publication Aug. 14, 2014 Sheet 62 of 65 US 2014/0230.090 A1
i.
i
s cy cyd can cin r- r - co co NOISSX 0. Patent Application Publication Aug. 14, 2014 Sheet 63 of 65 US 2014/0230.090 A1
co cs e
L CD CY (5 U
sc
r- r- r- Co Co Co Co Co
NOISSX0SeW Patent Application Publication Aug. 14, 2014 Sheet 64 of 65 US 2014/0230.090 A1
3.
i
C C ca ca r- r Co Co NOISSXHOWN Patent Application Publication Aug. 14, 2014 Sheet 65 of 65 US 2014/0230.090 A1
r- re- r r- re Co. Cd Cd Co. Cd NOISSX HOWN US 2014/0230.090 A1 Aug. 14, 2014
METHODS OF INTRODUCING DSRNATO inherent to tissue culture procedures is at the cutting edge of PLANT SEEDS FOR MODULATING GENE plant molecular biology research. EXPRESSION SUMMARY OF THE INVENTION INCORPORATION OF SEQUENCE LISTING 0008 According to an aspect of some embodiments of the 0001. The ASCII file, entitled P34098 12-26-2013 ST25. present invention there is provided a method of introducing txt, created on Dec. 26, 2013, comprising 109,372 bytes, naked dsRNA into a seed, the method comprising contacting submitted concurrently with the filing of this application is the seed with the naked dsRNA under conditions which allow incorporated herein by reference. penetration of the dsRNA into the seed, thereby introducing the dsRNA into the seed. FIELD OF THE DISCLOSURE 0009. According to an aspect of some embodiments of the 0002 Methods and compositions for improving plant present invention there is provided an isolated seed compris resistance to insect pests are provided. Methods and compo ing an exogenous naked dsRNA, wherein the seed is devoid of sitions for improving plant resistance to viral pathogens are a heterologous promoter for driving expression of the dsRNA also provided. in the plant. 0010. According to an aspect of some embodiments of the BACKGROUND present invention there is provided an isolated seed compris ing an exogenous naked dsRNA3. 0003. With a growing world population, increasing 0011. According to an aspect of some embodiments of the demand for food, fuel and fiber, and a changing climate, present invention there is provided a plant or plant part com agriculture faces unprecedented challenges. Development of prising an exogenous naked dsRNA and being devoid of a plants with improved traits is highly desirable, with some of heterologous promoter for driving expression of the dsRNA the major traits that are of major interest to farmers and seed in the plant. companies include improved abiotic stress tolerance, fertil 0012. According to an aspect of some embodiments of the izer use efficiency, disease resistance, yield and more. present invention there is provided a seed containing device 0004 Plant trait improvement is typically performed by comprising a plurality of the seeds. either genetic engineering or classical breeding. New meth 0013. According to an aspect of some embodiments of the ods for trait improvement through specific gene alteration are present invention there is provided a sown field comprising a highly desirable. These include methods for over-expression plurality of the seeds. of genes or gene silencing. A powerful technique for 0014. According to an aspect of some embodiments of the sequence-specific gene silencing is through RNA interfer present invention there is provided a method of producing a ence (RNAi). First discovered in the nematode C. elegans plant, the method comprising: (Fire etal. 1998, Nature, 391:806-811), RNAi is a mechanism in which expression of an individual gene can be specifically 00.15 (a) providing the seed; and silenced by introducing a double-stranded RNA (dsRNA) 0016 (b) germinating the seed so as to produce the plant. that is homologous to the selected gene into cells. Inside the 0017. According to an aspect of some embodiments of the cell, dsRNA molecules are cut into shorterfragments of 21-27 present invention there is provided a method of modulating nucleotides by an RNase III-related enzyme (Dicer). These gene expression, the method comprising: fragments, called small interfering RNAs (siRNAs), get 0018 (a) contacting a seed of a plant with a naked dsRNA, incorporated into the RNA-induced silencing complex under conditions which allow penetration of the dsRNA into (RISC). After additional processing, the siRNAs are trans the seed, thereby introducing the dsRNA into the seed; and formed into single-stranded RNAS that act as guide sequences optionally to eventually cleave target messenger RNAs. By using RNAi 0019 (b) generating a plant of the seed. to specifically silence relevant target genes, one can alter 0020. According to some embodiments of the invention, basic traits of an organism. Specifically for plants, it holds the naked dsRNA is designed for down regulating expression incredible potential for modifications that may lead to of a gene of the plant. increased stress resistance and better crop yield. 0021. According to some embodiments of the invention, 0005. In plants, RNAi is typically performed by producing the naked dsRNA is designed for down regulating expression transgenic plants that over-express a DNA fragment that is of a gene of a phytopathogen. transcribed to produce a dsRNA. This dsRNA is then pro 0022. According to some embodiments of the invention, cessed into siRNAS that mediate the cleavage and silencing of the penetration is to an endosperm and alternatively or addi target genes. tionally an embryo of the seed. 0006. The major technical limitation for this technology is 0023. According to some embodiments of the invention, that many important plant crop species are difficult or impos the naked dsRNA does not integrate into the genome of the sible to transform, precluding the constitutive expression of seeds. constructs directing production of dsRNA. Moreover, ques 0024. According to some embodiments of the invention, tions concerning the potential ecological impact of virus the conditions result in presence of the dsRNA in the plant for resistant transgenic plants have so far significantly limited at least 10 days following germination. their use (Tepfer, 2002, Annu Rev. Phytopathol. 40,467-491). 0025. According to an aspect of some embodiments of the An additional hurdle for obtaining transgenic plants is attrib present invention there is provided a method of inhibiting uted to the difficulty of having the transformation and regen expression of a target gene in a phytopathogenic organism, eration events occur in the same cell types. the method comprising providing to the phytopathogenic 0007. Therefore the development of a method for obtain organism the plant or plant part, thereby inhibiting expression ing transformed seeds which is independent of the methods of a target gene in the phytopathogenic organism. US 2014/0230.090 A1 Aug. 14, 2014
0026. According to some embodiments of the invention, 0051. According to some embodiments of the invention, the phytopathogenic organism is selected from the group the conditions allow accumulation of the dsRNA in the consisting of a fungus, a nematode and an insect. endosperm and alternatively or additionally embryo of the 0027. According to some embodiments of the invention, seed. the method further comprises observing death or growth inhi 0.052 According to some embodiments of the invention, a bition of the phytopathogen following the providing. concentration of the naked dsRNA is adjusted according to a 0028. According to an aspect of some embodiments of the parameter selected from the group consisting of seed size, present invention there is provided a kit for introducing naked seed weight, seed Volume, seed surface area, seed density and dsRNA to seeds comprising: seed permeability. 0029 (i) naked dsRNA; and 0053 According to some embodiments of the invention, 0030 (ii) a priming solution. the contacting is effected prior to breaking of seed dormancy 0031. According to some embodiments of the invention, and embryo emergence. the naked dsRNA and the priming Solutions are comprised in 0054 According to some embodiments of the invention, separate containers. the seed is a primed seed. 0055 According to some embodiments of the invention, 0032. According to some embodiments of the invention, the seed or the plant comprises RNA dependent RNA poly the dsRNA comprises siRNA. merase activity for amplifying expression of the dsRNA. 0033 According to some embodiments of the invention, 0056. According to some embodiments of the invention, the dsRNA comprises siRNA and dsRNA. the seed is a hybrid seed. 0034. According to some embodiments of the invention, 0057 According some embodiments, there is provided an the contacting is effected by inoculating the seed with the isolated dsRNA comprising a nucleic acid sequence having: dsRNA. 0.058 (i) a homology level to a plant gene sufficient to 0035. According to some embodiments of the invention, induce amplification of secondary siRNA products of the the method further comprises priming the seed prior to the dsRNA in a plant cell comprising same and wherein down contacting. regulation of the plant gene by the dsRNA does not substan 0036. According to some embodiments of the invention, tially affect any of biomass, vigor or yield of the plant; and the priming is effected by: 0059 (ii) a homology level to a gene of a phytopathogenic 0037 (i) washing the seed prior to the contacting; and organism Sufficient to induce degradation of the gene of the 0038 (ii) drying the seed following step (i). phytopathogenic organism, wherein the phytopathogenic 0039. According to some embodiments of the invention, organism depends on the plant for growth and wherein the the washing is effected in the presence of double deionized degradation induces a growth arrest or death of the phyto Water. pathogenic organism. According to Some embodiments, the 0040. According to some embodiments of the invention, nucleic acid sequence is at least 25 bp long. According to the washing is effected for 2-6 hours. some embodiments, the nucleic acid sequence is 25-70 bp 0041 According to some embodiments of the invention, long. According to Some embodiments, the dsRNA wherein the washing is effected at 4-28°C. the nucleic acid sequence is at least 80% identical to the plant 0042. According to some embodiments of the invention, gene. According to some embodiments, the nucleic acid the drying is effected at 25-30°C. for 10-16 hours. sequence is more than 70 bp. According to Some embodi 0043. According to some embodiments of the invention, ments, the nucleic acid sequence comprises a nucleic acid the contacting is effected in a presence of the naked dsRNA at segment at least 70 bp in length which is at least 65% identical a final concentration of 0.1-100 ug/ul. to the plant gene, and/or a second nucleic acid segment at least 0044 According to some embodiments of the invention, 17 bp in length which is at least 85% identical to the plant the contacting is effected in a presence of the naked dsRNA at gene. According to Some embodiments, the first nucleic acid a final concentration of 0.1-0.5ug/ul. segment and the second nucleic acid segment overlap. 0045. According to some embodiments of the invention, According to some embodiments, the first nucleic acid seg the method further comprises treating the seed with an agent ment and the second nucleic acid segment are in no overlap. selected from the group consisting of a pesticide, a fungicide, According to some embodiments, the plant gene is expressed an insecticide, a fertilizer, a coating agent and a coloring in most plant organs starting from germination. According to agent following the contacting. some embodiments of the invention, the isolated dsRNA is at least 80% homologous to the gene of the phytopathogen. 0046 According to some embodiments of the invention, 0060. Several embodiments relate to a method of provid the treating comprises coating the seed with the agent. ing a plant having improved resistance to an insect pest, 0047 According to some embodiments of the invention, comprising: growing a plant from a seed, wherein the Seedhas the seed is free of an agent selected from the group consisting been contacted with an exogenous dsRNA molecule compris ofapesticide, a fungicide, an insecticide, a fertilizer, a coating ing a sequence that is essentially identical or essentially agent and a coloring agent. complementary to at least 18 contiguous nucleotides of a 0048. According to some embodiments of the invention, gene of the insect pest or to the sequence of an RNA tran the dsRNA is for down regulating expression of a coding scribed from said gene, wherein the plant exhibits improved gene. resistance to the insect pest relative to a control plant, wherein 0049 According to some embodiments of the invention, the control plant is grown from a seed not contacted with the the dsRNA is for down regulating expression of a non-coding exogenous dsRNA molecule. In some embodiments, the plant gene. is maize, soybean, rice, wheat, tomato, cucumber, lettuce, 0050. According to some embodiments of the invention, cotton or rapeseed. In some embodiments, the insect pest is the seed is of the Viridiplantae super-family. Spodoptera littoralis, Diabrotica virgifera virgifera or Lepti US 2014/0230.090 A1 Aug. 14, 2014
notarsa decemlineata. In some embodiments, the insect pest Some embodiments, the insect pest is Spodoptera littoralis, gene is selected from the group consisting of ATPase, Diabrotica virgifera virgifera or Leptinotarsa decemlineata. NADPHCytochrome P450 Oxidoreductase, IAP, Chitin Syn In some embodiments, the insect pest gene is selected from thase, EF1C, and B-actin. In some embodiments, the exog the group consisting of ATPase, NADPH Cytochrome P450 enous dsRNA molecule comprises a sequence that is essen Oxidoreductase, IAP, Chitin Synthase, EF1C., and B-actin. In tially identical or essentially complementary to at least 18 Some embodiments, the exogenous dsRNA molecule com contiguous nucleotides of SEQID Nos.: 21-26, 31,34, 37,38, prises a sequence that is essentially identical or essentially 131-133, 144 or 145. In some embodiments, the exogenous complementary to at least 18 contiguous nucleotides of SEQ dsRNA molecule comprises a sequence that is essentially ID Nos.: 21-26, 31, 34, 37,38, 131-133, 144 or 145. In some identical or essentially complementary to at least 18 contigu embodiments, the exogenous dsRNA molecule comprises a ous nucleotides of SEQID Nos.: 146-190. In some embodi sequence that is essentially identical or essentially comple ments, the exogenous dsRNA molecule comprises a nucleic mentary to at least 18 contiguous nucleotides of SEQID Nos.: acid sequence that is at least 80% identical to an endogenous 146-190. In some embodiments, the exogenous dsRNA mol plant gene over at least 25 consecutive bp. In some embodi ecule comprises a nucleic acid sequence that is at least 80% ments, the seed is further treated with an agent selected from identical to an endogenous plant gene over at least 25 con the group consisting of apesticide, a fungicide, an insecticide, secutive bp. In some embodiments, the seed is further treated a fertilizer, a coating agent and a coloring agent. with an agent selected from the group consisting of a pesti 0061. Several embodiments relate to a plant provided by a cide, a fungicide, an insecticide, a fertilizer, a coating agent method comprising: growing a plant from a seed, wherein the and a coloring agent. seed has been contacted with an exogenous dsRNA molecule 0063. Several embodiments relate to a plant provided by a comprising a sequence that is essentially identical or essen method comprising growing the plant from a seed, wherein tially complementary to at least 18 contiguous nucleotides of the seed comprises an exogenous dsRNA molecule compris a gene of the insect pest or to the sequence of an RNA ing a sequence that is essentially identical or essentially transcribed from said gene, wherein the plant exhibits complementary to at least 18 contiguous nucleotides of a improved resistance to the insect pest relative to a control gene of the insect pest or to the sequence of an RNA tran plant, wherein the control plant is grown from a seed not scribed from said gene, wherein the seed is devoid of a het contacted with the exogenous dsRNA molecule. In some erologous promoter for driving expression of the exogenous embodiments, the plant is maize, soybean, rice, wheat, dsRNA molecule, and wherein the plant exhibits improved tomato, cucumber, lettuce, cotton or rapeseed. In some resistance to the insect pest relative to a control plant, wherein embodiments, the insect pest is Spodoptera littoralis, the control plant is grown from a seed not comprising the Diabrotica virgifera virgifera or Leptinotarsa decemlineata. exogenous dsRNA molecule. In some embodiments, the plant In some embodiments, the insect pest gene is selected from is maize, soybean, rice, wheat, tomato, cucumber, lettuce, the group consisting of ATPase, NADPH Cytochrome P450 cotton or rapeseed. In some embodiments, the insect pest is Oxidoreductase, IAP, Chitin Synthase, EF1C, and B-actin. In Spodoptera littoralis, Diabrotica virgifera virgifera or Lepti Some embodiments, the exogenous dsRNA molecule com notarsa decemlineata. In some embodiments, the insect pest prises a sequence that is essentially identical or essentially gene is selected from the group consisting of ATPase, complementary to at least 18 contiguous nucleotides of SEQ NADPHCytochrome P450 Oxidoreductase, IAP, Chitin Syn ID Nos.: 21-26, 31, 34, 37,38, 131-133, 144 or 145. In some thase, EF1C, and B-actin. In some embodiments, the exog embodiments, the exogenous dsRNA molecule comprises a enous dsRNA molecule comprises a sequence that is essen sequence that is essentially identical or essentially comple tially identical or essentially complementary to at least 18 mentary to at least 18 contiguous nucleotides of SEQID Nos.: contiguous nucleotides of SEQID Nos.: 21-26, 31,34, 37,38, 146-190. In some embodiments, the exogenous dsRNA mol 131-133, 144 or 145. In some embodiments, the exogenous ecule comprises a nucleic acid sequence that is at least 80% dsRNA molecule comprises a sequence that is essentially identical to an endogenous plant gene over at least 25 con identical or essentially complementary to at least 18 contigu secutive bp. In some embodiments, the seed is further treated ous nucleotides of SEQID Nos.: 146-190. In some embodi with an agent selected from the group consisting of a pesti ments, the exogenous dsRNA molecule comprises a nucleic cide, a fungicide, an insecticide, a fertilizer, a coating agent acid sequence that is at least 80% identical to an endogenous and a coloring agent. In some embodiments, the plant does plant gene over at least 25 consecutive bp. In some embodi not comprise detectable levels of the exogenous dsRNA mol ments, the seed is further treated with an agent selected from ecule. the group consisting of apesticide, a fungicide, an insecticide, 0062 Several embodiments relate to a method of provid a fertilizer, a coating agent and a coloring agent. In some ing a plant having improved resistance to an insect pest, embodiments, the plant does not comprise detectable levels comprising growing the plant from a seed, wherein the seed of the exogenous dsRNA molecule. comprises an exogenous dsRNA molecule comprising a 0064. Several embodiments relate to a method for gener sequence that is essentially identical or essentially comple ating a plant having insect resistance, the method comprising: mentary to at least 18 contiguous nucleotides of a gene of the a) introducing a non-transcribable trigger molecule compris insect pest or to the sequence of an RNA transcribed from said ing at least one polynucleotide strand comprising at least one gene, wherein the seed is devoid of a heterologous promoter segment of 18 or more contiguous nucleotides of an insect for driving expression of the exogenous dsRNA molecule, pest gene in either anti-sense or sense orientation into an and wherein the plant exhibits improved resistance to the ungerminated seed and b) germinating the seed to generate a insect pest relative to a control plant, wherein the control plant plant exhibiting insect resistance after emerging from said is grown from a seed not comprising the exogenous dsRNA seed. In some embodiments, the plant does not comprise molecule. In some embodiments, the plant is maize, soybean, detectable levels of the trigger molecule after emerging from rice, wheat, tomato, cucumber, lettuce, cotton or rapeseed. In the seed. In some embodiments, the non-transcribable trigger US 2014/0230.090 A1 Aug. 14, 2014
molecule is dsRNA. In some embodiments, the insect pest tially identical or essentially complementary to at least 18 gene is selected from the group consisting of ATPase, contiguous nucleotides of SEQ ID Nos.: 146-190. In some NADPHCytochrome P450 Oxidoreductase, IAP, Chitin Syn embodiments, the seed is primed prior to introducing the thase, EF1C, and B-actin. In some embodiments, the plant is exogenous dsRNA molecule. In some embodiments, the resistant to Spodoptera littoralis, Diabrotica virgifera vir priming is effected by: (i) washing the seed prior to said gifera or Leptinotarsa decemlineata infestation. In some contacting; and (ii) drying the seed following step (i). In some embodiments, the non-transcribable trigger molecule com embodiments, the seed is washed in double deionized water. prises a sequence that is essentially identical or essentially In some embodiments, the seed is washed for 2-6 hours. In complementary to at least 18 contiguous nucleotides of SEQ some embodiments, the seed is washed at 4-28°C. In some ID Nos.: 21-26, 31, 34, 37,38, 131-133, 144 or 145. In some embodiments, the seed is dried at 25-30°C. for 10-16 hours. embodiments, the non-transcribable trigger molecule com In some embodiments, the dsRNA molecule is provided to the prises a sequence that is essentially identical or essentially seed at a concentration of 20-150 ug/ml. In some embodi complementary to at least 18 contiguous nucleotides of SEQ ments, the dsRNA molecule is provided to the seed in a ID Nos.: 146-190. In some embodiments, the non-transcrib solution comprising 0.1 mM EDTA. In some embodiments, able trigger molecule is at least 80% identical to an endog the dsRNA molecule is provided to the seed in the presence of enous plant gene over at least 25 consecutive bp. In some a physical agent. In some embodiments, the physical agent is embodiments, the seed is primed prior to introducing the PEG-modified carbon nanotubes. Several embodiments non-transcribable trigger molecule. In some embodiments, relate to a seed containing device comprising one or more of the priming is effected by: (i) washing the seed prior to said the seeds. Several embodiments relate to a sown field com contacting; and (ii) drying the seed following step (i). prising a plurality of the seeds. 0065. Several embodiments relate to a method of treating 0067. Several embodiments relate to a seed comprising an a seed to improve insect resistance of a plant grown from the exogenous dsRNA molecule comprising a sequence that is seed, the method comprising: introducing an exogenous essentially identical or essentially complementary to at least dsRNA molecule comprising a sequence that is essentially 18 contiguous nucleotides of an insect pest gene or to the identical or essentially complementary to at least 18 contigu sequence of an RNA transcribed from the insect pest gene, ous nucleotides of an insect pest gene or to the sequence of an wherein the seed is devoid of a heterologous promoter for RNA transcribed from the insect pest gene into the seed, driving expression of said dsRNA molecule and wherein the wherein the plant grown from the seed exhibits improved exogenous dsRNA does not integrate into the genome of the insect resistance relative to a control plant. In some embodi seed. In some embodiments, the exogenous dsRNA molecule ments, the exogenous dsRNA molecule comprises a sequence is present in an endosperm of the seed. In some embodiments, that is essentially identical or essentially complementary to at the exogenous dsRNA molecule comprises a sequence that is least 18 contiguous nucleotides of SEQID Nos.: 21-26, 31, essentially identical or essentially complementary to at least 34, 37, 38, 131-133, 144 or 145. In some embodiments, the 18 contiguous nucleotides of SEQID Nos.: 21-26, 31, 34,37. exogenous dsRNA molecule comprises a sequence that is 38, 131-133, 144 or 145. In some embodiments, the exog essentially identical or essentially complementary to at least enous dsRNA molecule comprises a sequence that is essen 18 contiguous nucleotides of SEQID Nos.: 146-190. In some tially identical or essentially complementary to at least 18 embodiments, the seed is primed prior to introducing the contiguous nucleotides of SEQ ID Nos.: 146-190. In some exogenous dsRNA molecule. In some embodiments, the embodiments, the exogenous dsRNA molecule is present in priming is effected by: (i) washing the seed prior to said an embryo of the seed. In some embodiments, the exogenous contacting; and (ii) drying the seed following step (i). In some dsRNA molecule is present at a similar concentration in an embodiments, the seed is washed in double deionized water. embryo and an endosperm of the seed. In some embodiments, In some embodiments, the seed is washed for 2-6 hours. In the exogenous dsRNA molecule is present at a higher con some embodiments, the seed is washed at 4-28°C. In some centration in an endosperm than an embryo and of the seed. In embodiments, the seed is dried at 25-30°C. for 10-16 hours. Some embodiments, the insect pest gene is selected from the In some embodiments, the dsRNA molecule is provided to the group consisting of ATPase, NADPHCytochrome P450 Oxi seed at a concentration of 20-150 ug/ml. In some embodi doreductase, IAP, Chitin Synthase, EF1C., and B-actin. In ments, the dsRNA molecule is provided to the seed in a Some embodiments, the insect pest is Spodoptera littoralis, solution comprising 0.1 mM EDTA. In some embodiments, Diabrotica virgifera virgifera or Leptinotarsa decemlineata. the dsRNA molecule is provided to the seed in the presence of In Some embodiments, the exogenous dsRNA molecule com a physical agent. In some embodiments, the physical agent is prises a nucleic acid sequence that is at least 80% identical PEG-modified carbon nanotubes. over at least 25 consecutive by to an endogenous gene of the 0066. Several embodiments relate to a seed provided by a seed. In some embodiments, the seed is treated with an agent method comprising introducing an exogenous dsRNA mol selected from the group consisting of a pesticide, a fungicide, ecule comprising a sequence that is essentially identical or an insecticide, a fertilizer, a coating agent and a coloring essentially complementary to at least 18 contiguous nucle agent. In some embodiments, the seed is a primed seed. otides of an insect pest gene or to the sequence of an RNA Several embodiments relate to a seed containing device com transcribed from the insect pest gene into the seed, wherein prising one or more of the seeds. Several embodiments relate the plant grown from the seed exhibits improved insect resis to a Sown field comprising a plurality of the seeds. tance relative to a control plant. In some embodiments, the 0068. Several embodiments relate to a plant exhibiting exogenous dsRNA molecule comprises a sequence that is insect resistance after emerging from a seed, wherein a non essentially identical or essentially complementary to at least transcribable trigger molecule comprising at least one poly 18 contiguous nucleotides of SEQID Nos.: 21-26, 31, 34,37. nucleotide Strand comprising at least one segment of 18 or 38, 131-133, 144 or 145. In some embodiments, the exog more contiguous nucleotides of an insect pest gene in either enous dsRNA molecule comprises a sequence that is essen anti-sense or sense orientation is introduced into an ungermi US 2014/0230.090 A1 Aug. 14, 2014
nated seed that gives rise to said plant. In some embodiments, one polynucleotide Strand comprising at least one segment of the plant is selected from the group consisting of maize, 18 or more contiguous nucleotides of a corn root worm gene Soybean, rice, wheat, tomato, cucumber, lettuce, cotton and in either anti-sense or sense orientation into an ungerminated rapeseed. In some embodiments, the plant does not comprise corn seed and b) germinating the corn seed to generate a corn a detectable level of the non-transcribable trigger molecule. plant. In some embodiments, the trigger molecule is dsRNA. In some embodiments, the insect pest gene is selected from In some embodiments, the trigger molecule comprises at least the group consisting of ATPase, NADPH Cytochrome P450 one segment of 18 or more contiguous nucleotides of SEQID Oxidoreductase, IAP, Chitin Synthase, EF1C, and B-actin. In No. 144. In some embodiments, the trigger molecule com Some embodiments, the non-transcribable trigger molecule prises at least one segment of 18 or more contiguous nucle comprises a sequence that is essentially identical or essen otides of SEQID Nos.: 146-190. In some embodiments, the tially complementary to at least 18 contiguous nucleotides of ungerminated corn seed is primed prior to introducing the SEQID Nos.: 21-26, 31, 34, 37,38, 131-133, 144 or 145. In trigger molecule. In some embodiments, the seed is primed Some embodiments, the non-transcribable trigger molecule by: (i) washing the seed prior to said contacting; and (ii) comprises a sequence that is essentially identical or essen drying the seed following step (i). In some embodiments, the tially complementary to at least 18 contiguous nucleotides of seed is washed in double deionized water. SEQID Nos.: 146-190. In some embodiments, the non-tran 0071. Several embodiments relate to a method of provid scribable trigger molecule comprises a nucleic acid sequence ing a plant having improved viral resistance, comprising: that is at least 80% identical over at least 25 consecutive by to growing a plant from a seed, wherein the seed has been an endogenous gene of the seed. In some embodiments, the contacted with an exogenous dsRNA molecule comprising a non-transcribable trigger molecule comprises a nucleic acid sequence that is essentially identical or essentially comple sequence that is at least 17 bp in length and at least 85% mentary to at least 18 contiguous nucleotides of a viral gene identical to an endogenous gene of the seed. In some embodi or to the sequence of an RNA transcribed from said gene, ments, the non-transcribable trigger molecule comprises a wherein the plant exhibits improved viral resistance relative nucleic acid sequence that is at least 70 bp in length and at to a control plant, wherein the control plant is grown from a least 65% identical to an endogenous gene of the seed. seed not contacted with the exogenous dsRNA molecule. In 0069. Several embodiments relate to a plant comprising a Some embodiments, the plant is maize, soybean, rice, wheat, nucleic acid molecule for Suppressing an insect pest gene, tomato, cucumber, lettuce, cotton or rapeseed. In some wherein the nucleic acid molecule is not integrated into a embodiments, the virus is Tomato golden mottle virus (ToG chromosome of the plant, wherein the nucleic acid molecule MoV), Cucumber Mosaic Virus (CMV) or Tomato Spotted is not transcribed from a heterologous transgene integrated Wilt Virus (TSWV). In some embodiments, the viral gene is into a chromosome of the plant, and wherein the insect pest selected from the group consisting of a ToGMoV gene, a gene is Suppressed by introduction of a trigger molecule CMV gene and a TSWV gene. In some embodiments, the comprising at least one polynucleotide strand comprising at viral gene is selected from the group consisting of Nucleo least one segment of 18 or more contiguous nucleotides of an capsid (N) gene, a Replicase gene, a Coat gene and the AC1 insect pest gene in either anti-sense or sense orientation into gene. In some embodiments, the exogenous dsRNA molecule an ungerminated seed giving rise to the plant. In some comprises a sequence that is essentially identical or essen embodiments, the plant is selected from the group consisting tially complementary to at least 18 contiguous nucleotides of of maize, soybean, rice, wheat, tomato, cucumber, lettuce, SEQ ID Nos.: 8, 11 or 185-190. In some embodiments, the cotton and rapeseed. In some embodiments, the trigger mol exogenous dsRNA molecule comprises a nucleic acid ecule is dsRNA. In some embodiments, the insect pest gene is sequence that is at least 80% identical to an endogenous plant selected from the group consisting of ATPase, NADPHCyto gene over at least 25 consecutive bp. In some embodiments, chrome P450 Oxidoreductase, IAP, Chitin Synthase, EF1C. the seed is further treated with an agent selected from the and B-actin. In some embodiments, the trigger molecule com group consisting of a pesticide, a fungicide, an insecticide, a prises a sequence that is essentially identical or essentially fertilizer, a coating agent and a coloring agent. complementary to at least 18 contiguous nucleotides of SEQ 0072. Several embodiments relate to a plant provided by a ID Nos.: 21-26, 31, 34, 37,38, 131-133, 144 or 145. In some method comprising: growing a plant from a seed, wherein the embodiments, the trigger molecule comprises a sequence that seed has been contacted with an exogenous dsRNA molecule is essentially identical or essentially complementary to at comprising a sequence that is essentially identical or essen least 18 contiguous nucleotides of SEQID Nos.: 146-190. In tially complementary to at least 18 contiguous nucleotides of Some embodiments, the trigger molecule comprises a nucleic a viral gene or to the sequence of an RNA transcribed from acid sequence that is at least 80% identical over at least 25 said gene, wherein the plant exhibits improved resistance to consecutive by to an endogenous gene of the seed giving rise the virus relative to a control plant, wherein the control plant to the plant. In some embodiments, the trigger molecule com is grown from a seed not contacted with the exogenous prises a nucleic acid sequence that is at least 17 bp in length dsRNA molecule. In some embodiments, the plant is maize, and at least 85% identical to an endogenous gene of the seed Soybean, rice, wheat, tomato, cucumber, lettuce, cotton or giving rise to the plant. In some embodiments, the trigger rapeseed. In some embodiments, the virus is Tomato golden molecule comprises a nucleic acid sequence that is at least 70 mottle virus (ToGMoV), Cucumber Mosaic Virus (CMV) or bp in length and at least 65% identical to an endogenous gene Tomato Spotted Wilt Virus (TSWV). In some embodiments, of the seed giving rise to the plant. In some embodiments, the the viral gene is selected from the group consisting of a plant does not comprise a detectable level of the trigger mol ToGMoV gene, a CMV gene and a TSWV gene. In some ecule. embodiments, the viral gene is selected from the group con 0070. Several embodiments relate to a method of reducing sisting of Nucleocapsid (N) gene, a Replicase gene, a Coat corn root worm pressure on a corn plant, the method com gene and the AC1 gene. In some embodiments, the exogenous prising: a) introducing a trigger molecule comprising at least dsRNA molecule comprises a sequence that is essentially US 2014/0230.090 A1 Aug. 14, 2014 identical or essentially complementary to at least 18 contigu sequence that is at least 80% identical to an endogenous plant ous nucleotides of SEQ ID Nos.: 8, 11 or 185-190. In some gene over at least 25 consecutive bp. In some embodiments, embodiments, the exogenous dsRNA molecule comprises a the seed is further treated with an agent selected from the nucleic acid sequence that is at least 80% identical to an group consisting of a pesticide, a fungicide, an insecticide, a endogenous plant gene over at least 25 consecutive bp. In fertilizer, a coating agent and a coloring agent. In some Some embodiments, the seed is further treated with an agent embodiments, the plant does not comprise detectable levels selected from the group consisting of a pesticide, a fungicide, of the exogenous dsRNA molecule. an insecticide, a fertilizer, a coating agent and a coloring agent. In some embodiments, the plant does not comprise 0075 Several embodiments relate to a method for gener detectable levels of the exogenous dsRNA molecule. ating a plant having viral resistance, the method comprising: 0073. Several embodiments relate to a method of provid a) introducing a non-transcribable trigger molecule compris ing a plant having improved viral resistance, comprising ing at least one polynucleotide strand comprising at least one growing the plant from a seed, wherein the seed comprises an segment of 18 or more contiguous nucleotides of anviral gene exogenous dsRNA molecule comprising a sequence that is in either anti-sense or sense orientation into an ungerminated essentially identical or essentially complementary to at least seed and b) germinating the seed to generate a plant exhibit 18 contiguous nucleotides of a viral gene or to the sequence of ing viral resistance after emerging from said seed. In some an RNA transcribed from said gene, wherein the seed is embodiments, the plant does not comprise detectable levels devoid of a heterologous promoter for driving expression of of the trigger molecule after emerging from the seed. In some the exogenous dsRNA molecule, and wherein the plant exhib embodiments, the non-transcribable trigger molecule is its improved viral resistance relative to a control plant, dsRNA. In some embodiments, the virus is Tomato golden wherein the control plantis grown from a seed not comprising mottle virus (ToGMoV), Cucumber Mosaic Virus (CMV) or the exogenous dsRNA molecule. In some embodiments, the Tomato Spotted Wilt Virus (TSWV). In some embodiments, virus is Tomato golden mottle virus (ToGMoV), Cucumber the viral gene is selected from the group consisting of a Mosaic Virus (CMV) or Tomato Spotted Wilt Virus (TSWV). ToGMoV gene, a CMV gene and a TSWV gene. In some In some embodiments, the viral gene is selected from the embodiments, the viral gene is selected from the group con group consisting of a ToGMoV gene, a CMV gene and a sisting of Nucleocapsid (N) gene, a Replicase gene, a Coat TSWV gene. In some embodiments, the viral gene is selected gene and the AC1 gene. In some embodiments, the non from the group consisting of Nucleocapsid (N) gene, a Rep transcribable trigger molecule comprises a sequence that is licase gene, a Coat gene and the AC1 gene. In some embodi essentially identical or essentially complementary to at least ments, the exogenous dsRNA molecule comprises a sequence 18 contiguous nucleotides of SEQID Nos. 8, 11 or 185-190. that is essentially identical or essentially complementary to at In some embodiments, the non-transcribable trigger mol least 18 contiguous nucleotides of SEQ ID Nos.: 8, 11 or ecule is at least 80% identical to an endogenous plant gene 185-190. In some embodiments, the exogenous dsRNA mol over at least 25 consecutive bp. In some embodiments, the ecule comprises a nucleic acid sequence that is at least 80% seed is primed prior to introducing the non-transcribable trig identical to an endogenous plant gene over at least 25 con ger molecule. In some embodiments, the priming is effected secutive bp. In some embodiments, the seed is further treated by: (i) washing the seed prior to said contacting; and (ii) with an agent selected from the group consisting of a pesti drying the seed following step (i). cide, a fungicide, an insecticide, a fertilizer, a coating agent 0076 Several embodiments relate to a method of treating and a coloring agent. a seed to improve viral resistance of a plant grown from the 0074. Several embodiments relate to a plant provided by a seed, the method comprising: introducing an exogenous method comprising growing the plant from a seed, wherein dsRNA molecule comprising a sequence that is essentially the seed comprises an exogenous dsRNA molecule compris identical or essentially complementary to at least 18 contigu ing a sequence that is essentially identical or essentially ous nucleotides of a viral gene or to the sequence of an RNA complementary to at least 18 contiguous nucleotides of a viral transcribed from the viral gene into the seed, wherein the gene or to the sequence of an RNA transcribed from said plant grown from the seed exhibits improved viral resistance gene, wherein the seed is devoid of a heterologous promoter relative to a control plant. In some embodiments, the exog for driving expression of the exogenous dsRNA molecule, enous dsRNA molecule comprises a sequence that is essen and wherein the plant exhibits improved viral resistance rela tially identical or essentially complementary to at least 18 tive to a control plant, wherein the control plant is grown from contiguous nucleotides of SEQID Nos.: 8, 11 or 185-190. In a seed not comprising the exogenous dsRNA molecule. In Some embodiments, the seed is primed prior to introducing Some embodiments, the plant is maize, soybean, rice, wheat, the exogenous dsRNA molecule. In some embodiments, the tomato, cucumber, lettuce, cotton or rapeseed. In some priming is effected by: (i) washing the seed prior to said embodiments, the virus is Tomato golden mottle virus (ToG contacting; and (ii) drying the seed following step (i). In some MoV), Cucumber Mosaic Virus (CMV) or Tomato Spotted embodiments, the seed is washed in double deionized water. Wilt Virus (TSWV). In some embodiments, the viral gene is In some embodiments, the seed is washed for 2-6 hours. In selected from the group consisting of a ToGMoV gene, a some embodiments, the seed is washed at 4-28°C. In some CMV gene and a TSWV gene. In some embodiments, the embodiments, the seed is dried at 25-30°C. for 10-16 hours. viral gene is selected from the group consisting of Nucleo In some embodiments, the dsRNA molecule is provided to the capsid (N) gene, a Replicase gene, a Coat gene and the AC1 seed at a concentration of 20-150 ug/ml. In some embodi gene. In some embodiments, the exogenous dsRNA molecule ments, the dsRNA molecule is provided to the seed in a comprises a sequence that is essentially identical or essen solution comprising 0.1 mM EDTA. In some embodiments, tially complementary to at least 18 contiguous nucleotides of the dsRNA molecule is provided to the seed in the presence of SEQ ID Nos.: 8, 11 or 185-190. In some embodiments, the a physical agent. In some embodiments, the physical agent is exogenous dsRNA molecule comprises a nucleic acid PEG-modified carbon nanotubes. US 2014/0230.090 A1 Aug. 14, 2014
0077. Several embodiments relate to a seed provided by a more of the seeds. Several embodiments relate to a sown field method comprising introducing an exogenous dsRNA mol comprising a plurality of the seeds. Several embodiments ecule comprising a sequence that is essentially identical or relate to a plant exhibiting viral resistance after emerging essentially complementary to at least 18 contiguous nucle from a seed, wherein a non-transcribable trigger molecule otides of a viral gene or to the sequence of an RNA transcribed comprising at least one polynucleotide strand comprising at from the viral gene into the seed, wherein the plant grown least one segment of 18 or more contiguous nucleotides of a from the seed exhibits improved viral resistance relative to a viral gene in either anti-sense or sense orientation is intro control plant. In some embodiments, the exogenous dsRNA duced into an ungerminated seed that gives rise to said plant. molecule comprises a sequence that is essentially identical or In some embodiments, the plant is selected from the group essentially complementary to at least 18 contiguous nucle consisting of maize, soybean, rice, wheat, tomato, cucumber, otides of SEQ ID Nos.: 8, 11 or 185-190. In some embodi lettuce, cotton and rapeseed. In some embodiments, the plant ments, the seed is primed prior to introducing the exogenous does not comprise a detectable level of the non-transcribable dsRNA molecule. In some embodiments, the priming is trigger molecule. In some embodiments, the virus is Tomato effected by: (i) washing the seed prior to said contacting; and golden mottle virus (ToGMoV), Cucumber Mosaic Virus (ii) drying the seed following step (i). In some embodiments, (CMV) or Tomato Spotted Wilt Virus (TSWV). In some the seed is washed in double deionized water. In some embodiments, the viral gene is selected from the group con embodiments, the seed is washed for 2-6 hours. In some sisting of a ToGMoV gene, a CMV gene and a TSWV gene. embodiments, the seed is washed at 4-28°C. In some embodi In some embodiments, the viral gene is selected from the ments, the seed is dried at 25-30°C. for 10-16 hours. In some group consisting of Nucleocapsid (N) gene, a Replicase gene, embodiments, the dsRNA molecule is provided to the seed at a Coat gene and the AC1 gene. In some embodiments, the a concentration of 20-150 ug/ml. In some embodiments, the non-transcribable trigger molecule comprises a sequence that dsRNA molecule is provided to the seed in a solution com is essentially identical or essentially complementary to at prising 0.1 mM EDTA. In some embodiments, the dsRNA least 18 contiguous nucleotides of SEQ ID Nos.: 8, 11 or molecule is provided to the seed in the presence of a physical 185-190. In some embodiments, the non-transcribable trigger agent. In some embodiments, the physical agent is PEG molecule comprises a nucleic acid sequence that is at least modified carbon nanotubes. Several embodiments relate to a 80% identical over at least 25 consecutive by to an endog seed containing device comprising one or more of the seeds. enous gene of the seed. In some embodiments, the non-tran Several embodiments relate to a Sown field comprising a scribable trigger molecule comprises a nucleic acid sequence plurality of the seeds. that is at least 17 bp in length and at least 85% identical to an 0078. Several embodiments relate to a seed comprising an endogenous gene of the seed. In some embodiments, the exogenous dsRNA molecule comprising a sequence that is non-transcribable trigger molecule comprises a nucleic acid essentially identical or essentially complementary to at least sequence that is at least 70 bp in length and at least 65% 18 contiguous nucleotides of a viral gene or to the sequence of identical to an endogenous gene of the seed. an RNA transcribed from the viral gene, wherein the seed is 0079. Several embodiments relate to a plant comprising a devoid of a heterologous promoter for driving expression of nucleic acid molecule for Suppressing a viral gene, wherein said dsRNA molecule and wherein the exogenous dsRNA the nucleic acid molecule is not integrated into a chromosome does not integrate into the genome of the seed. In some of the plant, wherein the nucleic acid molecule is not tran embodiments, the exogenous dsRNA molecule is present in scribed from a heterologous transgene integrated into a chro an endosperm of the seed. In some embodiments, the exog mosome of the plant, and wherein the viral gene is Suppressed enous dsRNA molecule is present in an embryo of the seed. In by introduction of a trigger molecule comprising at least one Some embodiments, the exogenous dsRNA molecule is polynucleotide strand comprising at least one segment of 18 present at a similar concentration in an embryo and an or more contiguous nucleotides of a viral gene in either anti endosperm of the seed. In some embodiments, the exogenous sense or sense orientation into an ungerminated seed giving dsRNA molecule is present at a higher concentration in an rise to the plant. In some embodiments, the plant is selected endosperm than an embryo and of the seed. In some embodi from the group consisting of maize, soybean, rice, wheat, ments, the virus is Tomato golden mottle virus (ToGMoV), tomato, cucumber, lettuce, cotton and rapeseed. In some Cucumber Mosaic Virus (CMV) or Tomato Spotted Wilt embodiments, the trigger molecule is dsRNA. In some Virus (TSWV). In some embodiments, the viral gene is embodiments, the virus is Tomato golden mottle virus (ToG selected from the group consisting of a ToGMoV gene, a MoV), Cucumber Mosaic Virus (CMV) or Tomato Spotted CMV gene and a TSWV gene. In some embodiments, the Wilt Virus (TSWV). In some embodiments, the viral gene is viral gene is selected from the group consisting of Nucleo selected from the group consisting of a ToGMoV gene, a capsid (N) gene, a Replicase gene, a Coat gene and the AC1 CMV gene and a TSWV gene. In some embodiments, the gene. In some embodiments, the exogenous dsRNA molecule viral gene is selected from the group consisting of Nucleo comprises a sequence that is essentially identical or essen capsid (N) gene, a Replicase gene, a Coat gene and the AC1 tially complementary to at least 18 contiguous nucleotides of gene. In some embodiments, the trigger molecule comprises SEQ ID Nos.: 8, 11 or 185-190. In some embodiments, the a sequence that is essentially identical or essentially comple exogenous dsRNA molecule comprises a nucleic acid mentary to at least 18 contiguous nucleotides of SEQID Nos.: sequence that is at least 80% identical over at least 25 con 8, 11 or 185-190. In some embodiments, the trigger molecule secutive by to an endogenous gene of the seed. In some comprises a nucleic acid sequence that is at least 80% iden embodiments, the seed is treated with an agent selected from tical over at least 25 consecutive by to an endogenous gene of the group consisting of apesticide, a fungicide, an insecticide, the seed giving rise to the plant. In some embodiments, the a fertilizer, a coating agent and a coloring agent. In some trigger molecule comprises a nucleic acid sequence that is at embodiments, the seed is a primed seed. Several embodi least 17 bp in length and at least 85% identical to an endog ments relate to a seed containing device comprising one or enous gene of the seed giving rise to the plant. In some US 2014/0230.090 A1 Aug. 14, 2014
embodiments, the trigger molecule comprises a nucleic acid fold change of FW 2.2 expression in control (shown in red sequence that is at least 70 bp in length and at least 65% bars) and dsRNA-treated (shown in blue bars) plants, which identical to an endogenous gene of the seed giving rise to the was plotted for each individual plant to demonstrate the varia plant. In some embodiments, the plant does not comprise a tion in expression level of FW 2.2 gene in the two plant detectable level of the trigger molecule. groups. FIG. 6B shows the average expression of FW2.2 in 0080. Unless otherwise defined, all technical and/or sci control (red bar) compared to treated plants (blue bar). Down entific terms used herein have the same meaning as com regulation in expression level of FW 2.2 gene is evident in monly understood by one of ordinary skill in the art to which treated plants compared to control plants. the invention pertains. Although methods and materials simi I0088 FIGS. 7A-B show longer and more developed root lar or equivalent to those described herein can be used in the system in rice seedlings grown from rice seeds treated against practice or testing of embodiments of the invention, examples the Della gene (FIG. 7B) compared to control plants (FIG. of methods and/or materials are described below. In case of 7A). conflict, the patent specification, including definitions, will I0089 FIGS. 8A-B show longer and more developed root control. In addition, the materials, methods, and examples are and shoot systems in rice seedlings grown from rice seeds illustrative only and are not intended to be necessarily limit treated against the NRR gene (FIG. 8B) compared to control 1ng. plants (FIG. 8A) when the seedlings were grown on nitrogen BRIEF DESCRIPTION OF THE DRAWINGS free growth medium. (0090 FIG. 9A-C show the homology between the 0081. Some embodiments of the invention are herein Spodoptera littoralis genes used for seed treatment and the described, by way of example only, with reference to the corn genome. FIG. 9A NADPH gene, sequence 1 (top accompanying drawings. With specific reference now to the panel, SEQID NO: 14 and 22) and sequence 2 (bottom panel, drawings in detail, it is stressed that the particulars shown are SEQID NO: 23 and 24) showing 82% identity over 71 nucle by way of example and for purposes of illustrative discussion otides and 89% identity over 35 nucleotides respectively, of embodiments of the invention. In this regard, the descrip FIG.9B ATPase (SEQ ID NOs: 25 and 26) showing 72% tion taken with the drawings makes apparent to those skilled identity over 484 nucleotides, and FIG.9C IAP sequence 1 in the art how embodiments of the invention may be practiced. (top panel, SEQID NO: 27 and 28) and sequence 2 (bottom 0082 FIG. 1 shows a time-course siCLO-treatment panel, SEQID NO: 29 and 30) showing 81% identity over 36 results on rice seeds. The effect of incubation time with nucleotides and 87% identity over 31 nucleotides respec siGLO dsRNA on fluorescence intensity, indicating quantity tively. "Query” stands for S. littoralis sequences and "Sub and quality of dsRNA penetration, was tested. Control seeds ject' stands for corn sequences. that were left untreated (1), were imaged along with seeds (0091 FIGS. 10A-C show the homology between the treated with siCLO dsRNA for four different incubation Spodoptera littoralis genes used for seed treatment and the times; 10 min (2), 3.5 hours (3), 5.5 hours (4), and 24 hours tomato genome. FIG. 10A NADPH gene, sequence 1 (top (5). panel, SEQID NO:31 and 32) showing 93% identity over 30 I0083 FIGS. 2A-B show silencing the PDS-1 gene in rice nucleotides and 88% identity over 25 nucleotides respec by a dsRNA?siRNA mixture. FIG. 2A—A picture of germi tively and sequence 2 (bottom panel, SEQID NO:33 and 34) nated rice seeds 5 days after treatment, control on the left. FIG. 10B ATPase (SEQID NOS. 35 and 36) showing 73% FIG. 2B A picture of germinated rice seeds 7 days after identity over 359 nucleotides, and FIG. 10C IAP (SEQ ID treatment, control on the bottom. NOs. 37 and 38) showing 93% identity over 28 nucleotides. I0084 FIGS. 3A-C show PDS-1 expression levels as deter “Query' stands for S. littoralis sequences and “Subject’ mined by Real-Time PCR. FIG. 3A is a picture of germinated stands for tomato sequences. rice seeds 7 days after treatment, control on the bottom. FIG. 3B A picture of planted rice seeds 5 weeks after treatment, 0092 FIGS. 11A-D are bar graphs showing mortality and the control plant is on the left and has a darker green color average weight of live S. littoralis larvae. FIG. 11A shows compared to PDS-1 silenced plant. FIG. 3C-RNA was percentage of dead worms eight days after feeding on three extracted from control and PDS-1 silenced plants and PDS-1 43-day-old ATPase dsRNA trigger-treated and control corn expression levels were checked by Real Time PCR. UBQ5 plants. FIG. 11B shows average weight of live S. littoralis expression levels were served as normalizers and the PDS-1 larvae at the same time point. FIG.11C is a bar graph showing expression levels in the control plants served as calibrators percentage of dead S. littoralis larvae three days after feeding and got a value of 1. on 85-days old ATPase-treated and control corn plants. FIG. I0085 FIGS. 4A-B show height distribution of control and 11D is a bar graph showing percentage of dead S. littoralis NFY dsRNA-treated tomato plants 55 days post inoculation. larvae seven days after feeding on 91-day-old ATPase dsRNA FIG. 4A presents the height distribution of control plants trigger-treated and control corn plants. (blue bars) and FIG. 4B shows the height distribution of 0093 FIG. 12 is a bar graph showing percentage of dead S. treated plants (yellow bars). littoralis larvae seven days after feeding on 67-day-old I0086 FIGS.5A-D show the specific distribution of height dsRNA trigger treated (NADPH, IAP and ATPase) and con in control (blue bars) and ARF8 dsRNA-treated (maroon trol (EDTA) corn plants. bars) tomato plants 55 (FIG. 5A), 62 (FIG. 5B) and 72 days (0094 FIGS. 13A-B: FIG. 13A is a bar graph showing (FIG. 5C) following treatment. FIG. 5D shows the average average weight of live S. littoralis larvae eight days after height of control plants compared with that of treated plants feeding on 43-day-old EF1C. dsRNA trigger-treated and con 62 days following treatment. trol (EDTA) corn plants. FIG. 13B is a bar graph showing 0087 FIGS. 6A-B show the results of RT-PCR on RNA percentage of dead S. littoralis larvae five days after feeding extracted from leaves of control and FW2.2 dsRNA treated on 87-day-old EF1C. dsRNA trigger-treated and control tomato plants 9 weeks post germination. FIG. 6A shows the (EDTA) corn plants. US 2014/0230.090 A1 Aug. 14, 2014
0095 FIG. 14 is a bar graph showing average weight of live S. littoralis larvae after feeding for five days on 88-day live S. littoralis larvae eight days after feeding on 43-day-old old ATPase dsRNA trigger-treated and control (EDTA) Beta-actin dsRNA trigger-treated and control (EDTA) corn tomato plants. plants. 0106 FIGS. 24A-B: FIG. 24A is a bar graph showing 0096 FIGS. 15A-B: FIG. 15A is a bar graph showing average weight of S. littoralis larvae after feeding for four average weight of live S. littoralis larvae eight days after days on 95-day-old NADPH dsRNA trigger-treated and con feeding on 43-day-old NADPH dsRNA trigger-treated and trol (EDTA) tomato plants. FIG. 24B is a bar graph showing control (EDTA) corn plants. FIG. 15B is a bar graph showing average weight of S. littoralis larvae after feeding for seven percentage of dead S. littoralis larvae seven days after feeding days on 95-day-old NADPH dsRNA trigger-treated and con on 91-day-old NADPH dsRNA trigger-treated and control trol (ARF8) tomato plants. (EDTA) corn plants. 0107 FIGS. 25A-F: FIGS. 25A and C are bar graphs 0097 FIGS. 16A-B are bar graphs showing average showing percentage of dead S. littoralis larvae perplant eight weight of live S. littoralis larvae six days after feeding on and ten days, respectively, after feeding on 31-day-old 27-day-old dsRNA trigger-treated (IAP or MIX (IAP dsRNA trigger-treated (EF1C.#1, EF1 Cif2, ATPase and NADPH and ATPase)) compared to control (EDTA) plants. NADPH) and control (EDTA and GFP) corn plants. FIGS. 25 FIG. 5A shows average weight per repeat and FIG. 16B Band Darebar graphs combining the data shown in FIGS. 25 shows average weight per treatment. A and C into treatments. FIG. 25E is a bar graph showing 0098 FIGS. 17A-B are bar graphs showing average average weight of live S. littoralis larvae 11 days after feeding weight of live S. littoralis larvae after feeding on EF1C. on treated and control corn plants. Error bars represent stan dsRNA trigger-treated corn plants. FIG. 17A shows average dard deviation of the data. FIG. 25F is a bar graph showing weight nine days after feeding on 35-day-old plants. Error average weight of live S. littoralis larvae after feeding for bars represent standard deviation for each treatment. FIG. eight and nine days on 32-days old treated and control corn 17B shows average weight five days after feeding on 36-day plants. Weight scored after eight days is shown in dark colors old plants. Error bars represent standard deviation for each and weight scored after nine days is shown in bright colors. plant. Error bars represent standard deviation of the data. 0099 FIGS. 18A-B: FIG. 18A is a bar graph showing 0.108 FIGS. 26A-C are bar graphs showing larval recov percentage of dead S. littoralis larvae 12 days after feeding on ery and weight of Western corn rootworm (WCR) fed on corn 56-day-old ATPase dsRNA trigger-treated and control (GUS) plants grown from seeds treated with 0 ppm (Null control), 50 corn plants. FIG. 18B is a bar graph showing percentage of ppm or 500 ppm MON104454 or transgenic maize plants dead S. littoralis larvae four days after feeding on 57-day-old expressing an RNA Suppression construct targeting WCR ATPase dsRNA trigger-treated and control (GUS) corn Snf7 (positive control). FIG. 26A is a bar graph showing the plants. percentage of larval recovery after 4 weeks. FIG. 26B is a bar 0100 FIGS. 19A-B: FIG. 19A is a bar graph showing graph showing the total weight of WCR larvae recovered after average weight of live S. littoralis larvae ten days after feed 4 weeks. FIG. 26C is a bar graph showing the average weight ing on 24-day-old dsRNA trigger-treated and control (EDTA, of the WCR larvae recovered after 4 weeks. EDTA/CNTP and GFP) corn plants. Error bars represent 0109 FIGS. 27A-Care bar graphs showing the results of a standard deviation for each plant. FIG. 19B is a bar graph Colorado potato beetle (CPB) infestation assay on tomato showing average weight of live S. littoralis larvae ten days plants grown from seeds treated with T6593, buffer (“formu after feeding on 25-day-old dsRNA trigger-treated and con lation') or a GFP dsRNA trigger. FIG. 27A shows the average trol (EDTA, EDTA/CNTP and GFP/CNTP) cornplants. Error defoliation of the T6593 treated and control (formulation and bars represent standard deviation for each plant. GFP) tomatoplant by CPB. FIG.27B shows the percentage of 0101 FIGS. 20A-B are bar graphs showing average S. CPB larvae recovered. FIG. 27C shows the average weight of littoralis larvae weight 4 days after feeding on eight-day-old WCR larvae recovered from the treated plants. dsRNA trigger-treated (EF1C. and EF1C/CNTP) and control 0110 FIGS. 28A-B: FIG. 28 shows the results of the (GUS and GUS/CNTP) corn plants. FIG. 20A shows average Quantigene analysis on plants treated with the Tomato golden weight of S. littoralis larvae per plant and mottle virus (ToGMoV) after seed imbibition with dsRNA 0102 FIG. 20B shows average weight of S. littoralis lar polynucleotide sequences. FIG. 28A shows the results after vae per treatment. Error bars represent standard deviation of treatment with the 5'AC1 dsRNA polynucleotide (5') com the data. pared to the GUS treated control (NTrC). FIG.28B shows the 0103 FIG. 21 is a bar graph showing average weight of results after treatment with the 3'AC1 dsRNA polynucleotide live S. littoralis larvae three and seven days after feeding on (3') compared to the GUS treated control (NTrC). 48-day-old dsRNA trigger-treated (NADPH, IAP and MIX 0111 FIGS. 29A-B: FIG. 29 shows the results of the (IAP, ATPase and NADPH)) and control (EDTA) tomato Quantigene analysis on plants treated with the Cucumber plants. Mosaic Virus (CMV) after seed imbibitions with the dsRNA 0104 FIG. 22 is a bar graph showing average weight of polynucleotide sequences. FIG. 28A shows the results after live S. littoralis larvae after feeding for four days on 42-day treatment with the 5' NC dsRNA polynucleotide (5') com old dsRNA trigger-treated (Beta-actin, ATPase and NADPH) pared to the GUS treated control (NTrC). FIG.29B shows the and control (EDTA) tomato plants. result after treatment with the 3'NC dsRNA polynucleotide 0105 FIGS. 23A-B: FIG. 23A is a bar graph showing (3') compared to the GUS control (NTrC). weight of S. littoralis larvae after feeding for six days on 0112 FIG.30 shows the results of the Quantigene analysis 85-day-old ATPase dsRNA trigger-treated and control on plants treated with Tomato Spotted Wilt Virus (TSWV)3' (EDTA) tomato plants relative to their initial weight before NdsRNA polynucleotide sequence (3') compared to the GUS feeding. FIG. 23B is a bar graph showing average weight of treated control (NTrC). US 2014/0230.090 A1 Aug. 14, 2014
0113 FIGS. 31A-B show the homology between the discloses the sequence of its reverse complement, as one Spodoptera littoralis EF1C. gene used for seed treatment and necessarily defines the other, as is known by one of ordinary the corn genome. FIG. 31A—EF1C. gene, sequence 1 show skill in the art. Where a term is provided in the singular, the ing 75% identity over 400 nucleotides. FIG. 31B EF1C. inventors also contemplate aspects of the invention described gene, sequence 2 showing 75% identity over 446 nucleotides. by the plural of that term. “Query stands for S. littoralis sequences and “Subject’ 0119 Before explaining embodiments of the invention in stands for corn sequences. detail, it is to be understood that the invention is not neces 0114 FIGS. 32A-Care bar graphs showing real-time PCR sarily limited in its application to the details set forth in the analyses of corn EF1C. mRNA expression in 20-day-old and following description or exemplified by the Examples. The 48-day-old corn plants germinated from seeds treated with 50 invention is capable of other embodiments or of being prac ug/ml dsRNA for 4 hours. FIG. 32A shows fold change in ticed or carried out in various ways. corn EF1C. mRNA expression following treatment with S. 0.120. With the extensive growth of the world-population littoralis EF1C dsRNA for which GFP dsRNA treatment was and the limited habitats for plant growth and cultivation, there used as control baseline. Expression values per individual is an urgent need to improve plant yields under these changing plants were normalized to the median expression of all plants conditions. RNAi has emerged as a powerful tool for modu treated with GFP dsRNA. The difference in expression rela lating gene expression which can be used for generating tive to control group had a p-value of 0.016. FIG.32B shows plants with improved stress tolerance. In plants, RNAi is fold change in corn EF1C. mRNA expression following treat typically performed by producing transgenic plants that com ment with a mixture of the same dsRNAs as in FIG. 32A and prise a DNA fragment that is transcribed to produce a dsRNA. PEG-modified carbon nanotubes (CNTP). Expression values This dsRNA is then processed into siRNAs that mediate the per individual plants were normalized to the median expres silencing of target genes, typically by targeting cleavage of sion of all plants treated with GFP dsRNA\CNTP. The differ the target gene by an RNA Induced Silencing Complex ence in expression relative to control group had a p-value of (RISC) or by translational repression. The major technical 0.003. FIG.32C shows fold change in the same corn plants 48 limitation for this technology is that many important plant days post seed treatment. Expression values per individual crop species are difficult or impossible to transform, preclud plants were normalized to the median expression of all plants ing the constitutive expression of constructs directing produc treated with GFP dsRNA\CNTP. The difference in expression tion of dsRNA. Moreover, questions concerning the potential relative to control group had a p-value of 0.07. ecological impact of virus-resistant transgenic plants have so 0115 FIG.33 is a bar graph showing real-time PCR analy far significantly limited their use (Tepfer, 2002, Annu Rev. sis of corn EF1C. mRNA expression in nine-week-old corn Phytopathol. 40, 467-491). plants germinated from seeds treated with 132 ug/ml dsRNA I0121 The present embodiments include methods of intro derived from S. littoralis sequence. Expression values per ducing exogenous non-transcribable polynucleotide trigger, individual plants were normalized to the median expression for example dsRNA, molecules into plant seeds for modulat of all control plants. The difference in expression relative to ing gene expression in a plant grown from the seed and/or in control group had a p-value of 0.12. a phytopathic organism that feeds on or infects a plant grown 0116 FIGS.34A-B are bar graphs showing real-time PCR from the treated seed. Several embodiments relate to methods analyses of corn EF1C. mRNA expression in six-day-old corn of introducing exogenous non-transcribable polynucleotide plants germinated from seeds treated with 160 ng/ml dsRNA triggers into plant seeds for controlling insect pest infestation for 7 hours. FIG.34A shows fold change in corn EF1C. mRNA and/or viral infection of plants grown from the seeds. Inges expression with respect to the GUS dsRNA treatment. FIG. tion of plant material produced from seeds treated with exog 34B shows the average fold change in corn EF1C. mRNA enous non-transcribable polynucleotide trigger, for example expression for all plants treated with EF1C. dsRNA (both dsRNA, molecules according to the present embodiments dsRNA #1 and #2, with and without CNTP), GUS dsRNA results in the cessation of feeding, growth, development, (with and without CNTP) and EDTA (with and without reproduction, infectivity, and eventually may result in the CNTP). Error bars represent standard deviation of the data. death of the phytopathogen. In some embodiments, the exog 0117 FIGS.35A-Care bargraphs showing real-time PCR enous non-transcribable polynucleotide triggers are designed analyses of corn ATPase and NADPH mRNA expression in to silence a target gene of an insect pest or viral pathogen. The 27-days old corn plants germinated from seeds treated with polynucleotide triggers can be single- or double-stranded 160 ug/ml dsRNA for 2 hours. FIG. 35A shows the average RNA or single- or double-stranded DNA or double-stranded fold change in corn ATPase mRNA expression. FIGS. 35B DNA/RNA hybrids or modified analogues thereof, and can be and 35C shows the average fold change in corn NADPH of oligonucleotide lengths or longer. Several embodiments mRNA expression. Expression values were normalized to the relate to methods of introducing dsRNA to plant seeds for average expression of plants treated with GFP dsRNA (FIGS. modulating gene expression. 35A and 35B) or to the average expression of EDTA-treated 0.122 The present inventors have now devised a novel control plants (FIG. 35C). Error bars represent standard technology for introducing exogenous non-transcribable deviation of the data. polynucleotide triggers, for example dsRNA molecules, directly to the plant seed. These non-transcribable polynucle DETAILED DESCRIPTION otide trigger, for example dsRNA, molecules enter seeds and 0118. Unless otherwise stated, nucleic acid sequences in start a silencing process, which is continued during the life the text of this specification are given, when read from left to cycle of the plant, resulting in a plant with an improved trait right, in the 5' to 3’ direction. Nucleic acid sequences may be of interest. The introduced polynucleotide triggers are naked provided as DNA or as RNA, as specified; disclosure of one and as Such no exogenous transcription regulatory elements necessarily defines the other, as is known to one of ordinary are introduced into the plant thus lowering the environmental skill in the art. Further, disclosure of a nucleic acid sequence concerns associated with transgenic plants. In some embodi US 2014/0230.090 A1 Aug. 14, 2014
ments, the introduced polynucleotide trigger is naked dsRNA I0127 (i) Introduction of an exogenous non-transcribable and as Such no exogenous transcription regulatory elements polynucleotide trigger molecule, for example naked dsRNA, are introduced into the plant. In addition, the modified seed into the interior of seeds (as opposed to mere seed coating). can be germinated to generate a plant without the need of The introduction is effected by soaking the seeds in a solution going through the laborious and cumbersome steps of tissue which comprises the exogenous non-transcribable poly culture regeneration. nucleotide trigger, for example dsRNA. Such that the exog 0123. The present embodiments provide, in part, a deliv enous non-transcribable polynucleotide trigger penetrates ery system for the delivery of pest control agents to pests through the seed coat or by dipping Such that the exogenous through their exposure to a diet containing plant material non-transcribable polynucleotide trigger coats the seed and produced from seeds treated with exogenous non-transcrib penetrates through the coat after sowing: able polynucleotide trigger, for example dsRNA, molecules I0128 (ii) Amplification of the signal generated by the according to the present embodiments. exogenous non-transcribable polynucleotide trigger, for 0.124. As is illustrated herein below and in the Examples example dsRNA; and section which follows, the present embodiments include con I0129 (iii) Spreading of the signal throughout the plant. figuring the conditions necessary to introduce exogenous 0.130. The first step occurs only once, during and shortly non-transcribable polynucleotide triggers, for example naked after the initial seed treatment, while the second and third dsRNA, into the seeds (see e.g., Example 1). The exogenous steps occur in a repetitive loop for as long as the silencing non-transcribable polynucleotide trigger, for example naked signal remains active in the plant. dsRNA, does not integrate into the genome and is highly I0131 Without being bound by theory, a suggested unbind stable in the plant and in solution (see Examples 2-4). The ing mode of action for the described invention is based on exogenous non-transcribable polynucleotide trigger, for each step: example naked dsRNA, penetrates through the seed coat I0132) Introduction of an exogenous non-transcribable (testa) of both monocot and dicot plants and distributes in the polynucleotide trigger, for example dsRNA, into seeds. endosperm and seed embryo (Examples 5-6). In one aspect, 0.133 A typical mature seed consists of an embryo encap the present embodiments include altering expression of Sulated within a maternal seed coat (testa) and an abundant endogenous genes (Examples 8-15). In some embodiments, layer of endosperm tissue between the embryo and seed coat. the endogenous gene whose expression is altered is an The endosperm serves as a nutrient source for the embryo ortholog of a targeted pest gene. In another aspect, the present during seed development, germination and seedling estab embodiments include introducing into seeds exogenous non lishment. transcribable polynucleotide triggers, for example dsRNA, 0.134 Seed germination typically begins with exposure of directed to exogenous genes (e.g., insect pest genes or viral the seeds to water, which is absorbed by the embryo and genes). These results are reproduced over a number of plants endosperm. The endosperm then expands in Volume, with the of both monocot and dicot groups. In a further aspect, the endosperm of Some plant species being able to grow several present embodiments include introducing into seeds exog fold from their original volume. The embryo, which was enous non-transcribable polynucleotide triggers, for example dormant until this stage, is now released from dormancy and dsRNA, directed to essential genes of insect pests or viral cell division, expansion and differentiation begin. The pathogens in a wide range of doses and kinetics which endosperm feeds the developing embryo until it is developed resulted in a significant alteration of gene expression. Inter enough to begin photosynthesis and autotrophic growth. estingly, the dsRNA introduced according to the present 0.135 Based on these known mechanisms of seed germi embodiments is able to down-regulate essential genes in a nation, two possible modes of action for the initial step of phytopathogen which feeds on or infects a plant grown from “Introduction of the exogenous non-transcribable polynucle a treated seed (e.g., Spodoptera littoralis, Example 7). Thus, otide trigger, for example dsRNA, into seeds are suggested: the present results are sufficient to show that the present 0.136 The exogenous non-transcribable polynucleotide teachings provide a cost-effective treatment of plant seeds to trigger, for example dsRNA, molecules enter the embryo achieve a desired agricultural and horticultural phenotype, directly, carried by the water-based solution which is used for Such as resistance to insect pests and viral pathogens. the seed treatment. 0.125 Provided herein are compositions and methods for 0.137 The exogenous non-transcribable polynucleotide inducing systemic regulation (e.g., systemic Suppression or trigger, for example dsRNA, molecules enter the endosperm silencing) of a target gene in a plant or phytopathogen by as part of the endosperms water-absorption process. These application to the plant seed of a polynucleotide trigger mol molecules then feed the embryo as it develops as part of the ecule with a segment in a nucleotide sequence essentially nutrient flow from the endosperm during germination and identical to, or essentially complementary to, a sequence of seed development. 18 or more contiguous nucleotides in either the target gene or 0.138 Based on the results described in FIGS. 7-13, it is RNA transcribed from the target gene, whereby the compo estimated that a combination of the two options takes place. sition permeates the interior of the plant seed and induces That is, some of the dsRNA enters the embryo directly and systemic regulation of the target gene in the plant grown from Some is retained in the endosperm and feeds the developing the seed or in a phytopathogen of the plant grown from the embryo during seed germination. seed. The polynucleotide trigger molecule can be one or more 0.139 Amplification of the Signal polynucleotide molecules with a single such segment, mul 0140. Once dsRNA molecules enter the embryo, they are tiples of such a segment, multiple different Such segments, or recognized and processed by RNAse III-like enzymes such as a combination thereof. Dicer or Dicer-like (DCL) enzymes. DCL enzymes process 0126 Without being bound by a particular theory, it is the long dsRNA molecules into short, double strand RNAs Suggested that the newly suggested transformation modality (known as siRNAs or shRNAs), which are typically 21-24 and modulation of gene expression is associated with: nucleotides (nt) long. One of the siRNA strands is typically US 2014/0230.090 A1 Aug. 14, 2014
rapidly degraded and the second one can be incorporated in analogues or any combination thereof. In some embodiments, RISC(RNA Induced Silencing Complex) protein complexes, a trigger polynucleotide may be incorporated within a larger which contain an Argonaute (AGO) protein. AGO proteins polynucleotide, for example in a pri-miRNA molecule. In contain a PIWI domain to bind siRNAs and a PAZ domain Some embodiments, a trigger polynucleotide may be pro with RNAse activity. Subsequently, the siRNA/AGO com cessed into a small interfering RNA (siRNA). plex identifies an mRNA molecule, which is complementary 0147 As used herein, the term “target sequence” refers to to the siRNA and results in its silencing by cleavage or trans a nucleotide sequence that occurs in a gene or gene product lational repression. against which a trigger polynucleotide is directed. In this 0141. The siRNA is then released from the RISC complex context, the term “gene' means a locatable region of genomic and can now act as a primer for an RNA-Dependant RNA sequence, corresponding to a unit of inheritance, which Polymerase (RDRP), this is an enzyme which is unique to the includes regulatory regions. Such as promoters, enhancers, 5' plant kingdom and can generate amplification of the silencing untranslated regions, intron regions, 3' untranslated regions, signal by generating new dsRNA molecules (secondary transcribed regions, and other functional sequence regions siRNA). These newly-synthesized dsRNAs can be processed that may exist as native genes or transgenes in a plant genome. again as described above, therefore maintaining and ampli Depending upon the circumstances, the term target sequence fying the silencing signal. can refer to the full-length nucleotide sequence of the gene or gene product targeted for Suppression or the nucleotide Spreading of the Silencing Signal sequence of a portion of the gene or gene product targeted for 0142 Silencing spreading is a known and well-understood Suppression. phenomenon in plants. Not wishing to be bound by a particu 0.148. As used herein, the term "derived from refers to a lar theory, it is believed that short distance, cell-to-cell specified nucleotide sequence that may be obtained from a spreading occurs through plasmodesmata. This process is particular specified source or species, albeit not necessarily thought to be mediated by a 21 nt-long siRNA, which is the directly from that specified Source or species. product of a DCL enzyme. Additionally, systemic spreading 0149. As used herein, the terms “sequence.” “nucleotide is achieved through the phloem across the entire plant from sequence' or “polynucleotide sequence” refer to the nucle Source to sink. otide sequence of a DNA molecule, an RNA molecule or a 0143 Without being bound by particular theory, it is sug portion thereof. gested that in the described methodology, spreading of the 0150. The term “polynucleotide' refers to any polymer of silencing signal occurs once the silencing signal begins and is mononucleotides that are linked by internucleotide bonds. amplified as described above. This may include both short Polynucleotides may be composed of naturally-occurring distance and systematic spreading by various siRNA signal ribonucleotides, naturally-occurring deoxyribonucleotides, molecules. analogs of naturally-occurring nucleotides (e.g., enantio 0144. According to one embodiment, there is provided a meric forms of naturally-occurring nucleotides), or any com method of introducing an exogenous non-transcribable poly bination thereof. Where a polynucleotide is single-stranded, nucleotide trigger, for example naked double-stranded RNA its length can be described in terms of the number of nucle (dsRNA), into a seed, the method comprising contacting the otides. Where a polynucleotide is double-stranded, its length seed with the exogenous non-transcribable polynucleotide can be described in terms of the number of base pairs. trigger, for example naked dsRNA, under conditions which 0151. As used herein, the term “non-transcribable poly allow penetration of the exogenous non-transcribable poly nucleotide' refers to a polynucleotide that does not comprise nucleotide trigger, for example naked dsRNA into the seed, a complete polymerase II transcription unit. thereby introducing the dsRNA into the seed. 0152 The term “gene expression” refers to the process of 0145 Several embodiments described herein relate to a converting genetic information encoded in genomic DNA method of generating a plant having a desirable phenotype, into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through comprisinga) contacting an ungerminated seed with an exog transcription of the gene via the enzymatic action of an RNA enous non-transcribable polynucleotide trigger molecule polymerase, and into protein, through translation of mRNA. under conditions which allow penetration of said trigger mol Gene expression can be regulated at many stages in the pro ecule into the seed and b) germinating said seed to generate a CCSS, plant exhibiting the desired phenotype after emerging from 0153. As used herein, the phrases “inhibition of gene said seed. In some embodiments, the desirable phenotype is expression' or 'gene Suppression' or 'silencing a target insect resistance. In some embodiments, the desirable pheno gene' and similar terms and phrases refer to the absence or type is viral resistance. observable reduction in the level of protein and/or mRNA 0146. As used herein, the term “trigger' or “trigger poly product from the target gene. The consequences of inhibition, nucleotide' refers to a bioactive polynucleotide molecule that Suppression, or silencing can be confirmed by examination of is Substantially homologous or complementary to a poly the outward properties of a cellor organism or by biochemical nucleotide sequence of a target gene or an RNA expressed techniques. from the target gene or a fragment thereof and functions to 0154 As used herein, the term “sequence identity.” Suppress the expression of the target gene or produce a knock “sequence similarity” or “homology” is used to describe the down phenotype. Trigger polynucleotides are generally degree of similarity between two or more nucleotide described in relation to their “target sequence.” Trigger poly sequences. The percentage of “sequence identity” between nucleotides may be single-stranded DNA (ssDNA), single two sequences is determined by comparing two optimally stranded RNA (ssERNA), double-stranded RNA (dsRNA), aligned sequences over a comparison window, such that the double-stranded DNA (dsDNA), or double-stranded DNA/ portion of the sequence in the comparison window may com RNA hybrids. Trigger polynucleotides may comprise natu prise additions or deletions (gaps) as compared to the refer rally-occurring nucleotides, modified nucleotides, nucleotide ence sequence (which does not comprise additions or dele US 2014/0230.090 A1 Aug. 14, 2014 tions) for optimal alignment of the two sequences. The paralogous genes. The term “orthologous' relates to homolo percentage is calculated by determining the number of posi gous genes in different organisms due to ancestral relation tions at which the identical nucleic acid base or amino acid ship. residue occurs in both sequences to yield the number of 0158. As used herein, the terms “exogenous polynucle matched positions, dividing the number of matched positions otide' and “exogenous nucleic acid molecule' relative to an by the total number of positions in the window of comparison, organisms refer to a heterologous nucleic acid sequence and multiplying the result by 100 to yield the percentage of which is not naturally expressed within that organism, for sequence identity. A sequence that is identical at every posi example a plant. An exogenous nucleic acid molecule may tion in comparison to a reference sequence is said to be comprise a nucleic acid sequence which is identical or par identical to the reference sequence and Vice-versa. An align tially homologous to an endogenous nucleic acid sequence of ment of two or more sequences may be performed using any the organism. Suitable computer program. For example, a widely used and 0159. As used herein, the terms “endogenous polynucle accepted computer program for performing sequence align otide' and “endogenous nucleic acid refers to nucleic acid sequences that are found in an organism’s cell. In certain ments is CLUSTALW v1.6 (Thompson, et al. Nucl. Acids aspects, an endogenous nucleic acid may be part of the Res., 22:4673-4680, 1994). nuclear genome or the plastid genome. As used herein, 0155 By “essentially identical or “essentially comple endogenous nucleic acids do not include viral, parasite or mentary' is meant that the bioactive polynucleotide trigger pathogen nucleic acids, for example an endovirus sequence. (or at least one strand of a double-stranded polynucleotide or 0160. As used herein the phrase “naked dsRNA refers to portion thereof, or a portion of a single strand polynucleotide) a dsRNA nucleic acid molecule which is non-transcribable in hybridizes under physiological conditions to the endogenous a plant cell. Thus, the naked dsRNA molecule is not com gene, an RNA transcribed there from, or a fragment thereof, prised in a nucleic acid expression construct such as a viral to effect regulation or Suppression of the endogenous gene. vector. According to some embodiments of the invention, the For example, in Some embodiments, a bioactive polynucle naked dsRNA molecule is not derived from a viral vector. otide trigger has 100 percent sequence identity or at least According to Some embodiments, the dsRNA is not a product about 83, 84,85, 86, 87, 88, 89,90,91, 92,93, 94, 95, 96.97, of a natural pathogenic or viral infection. According to some 98, or 99 percent sequence identity when compared to a embodiments, the naked dsRNA may comprise regulatory sequence of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22. elements for in-vitro transcription, such as the T7 promoter. 23, 24, 25, 26, 27, 28, 29, 30,3132,33,34,35,36, 37,38,39, According to some embodiments of the invention, the naked 40, 41,42, 43,44, 45,46,47, 48,49, 50, 51, 52,53,54, 55,56, dsRNA may be modified e.g., chemically modified, to confer 57, 58, 59, 60 or more contiguous nucleotides in the target higher bioavailability, penetration into the seeds and/or gene or RNA transcribed from the target gene. In some improved shelf-life. embodiments, a bioactive polynucleotide trigger has 100 per (0161. As used herein the term “dsRNA relates to two cent sequence complementarity or at least about 83, 84.85, strands of anti-parallel polyribonucleic acids held together by 86, 87,88, 89,90,91, 92,93, 94, 95, 96, 97,98, or 99 percent base pairing. The dsRNA molecule may be formed by sequence complementarity when compared to a sequence of intramolecular hybridization or intermolecular hybridization. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, In some embodiments, the dsRNA may comprise a single 27, 28, 29, 30, 31, 32,33, 34,35, 36, 37,38, 39, 40, 41,42, 43, strand of RNA that self-hybridizes to form a hairpin structure 44, 45, 46,47, 48,49, 50, 51, 52,53,54, 55,56, 57,58, 59, 60 having an at least partially double-stranded structure includ or more contiguous nucleotides in the target gene or RNA ing at least one segment that will hybridize to an RNA tran transcribed from the target gene. In some embodiments, a scribed from the gene targeted for Suppression. In some bioactive polynucleotide trigger has 100 percent sequence embodiments, the dsRNA may comprise two separate Strands identity with or complementarity to one allele or one family of RNA that hybridize through complementary base pairing. member of a given target gene (coding or non-coding The RNA strands may or may not be polyadenylated; the sequence of a gene). In some embodiments, a bioactive poly RNA strands may or may not be capable of being translated nucleotide trigger has at least about 83, 84,85, 86, 87, 88,89. into a polypeptide by a cells translational apparatus. The two 90, 91, 92,93, 94, 95, 96, 97, 98, or 99 percent sequence strands can be of identical length or of different lengths pro identity with or complementarity to multiple alleles or family vided there is enough sequence homology between the two members of a given target gene. In some embodiments, a strands that a double stranded structure is formed with at least bioactive polynucleotide trigger has 100 percent sequence 80%, 90%, 95% or 100% complementarity over the entire identity with or complementarity to multiple alleles or family length. According to an embodiment of the invention, there members of a given target gene. are no overhangs for the dsRNA molecule. According to another embodiment of the invention, the dsRNA molecule 0156. As used herein, nucleic acid sequence molecules are comprises overhangs. According to other embodiments, the said to exhibit “complete complementarity” when every Strands are aligned Such that there are at least 1, 2, or 3 bases nucleotide of one of the sequences read 5' to 3' is complemen at the end of the strands which do not align (i.e., for which no tary to every nucleotide of the other sequence when read 3' to complementary bases occur in the opposing Strand) Such that 5'. A nucleotide sequence that is completely complementary an overhang of 1, 2 or 3 residues occurs at one or both ends of to a reference nucleotide sequence will exhibit a sequence the duplex when Strands are annealed. identical to the reverse complement sequence of the reference 0162. As will be appreciated by one of ordinary skill in the nucleotide sequence. art, a dsRNA molecule of the present disclosure may refer to 0157 Homologous sequences include both orthologous either strand of the anti-parallel nucleic acids. As will also be and paralogous sequences. The term "paralogous relates to appreciated by one of ordinary skill in the art, a dsRNA gene-duplications within the genome of a species leading to molecule of the present disclosure includes both a sense and US 2014/0230.090 A1 Aug. 14, 2014
antisense Strand and that the sense and antisense Strands are about 750 bp. In another embodiment, the dsRNA in the reverse complements of each other in a region of base pairing. present application is about 850 bp. In a further embodiment, As used herein the sequence of a dsRNA molecule for regu the dsRNA comprises 1-base, 2-base or 3-base 5'-overhangs lating a target gene of interest is provided as the sense on one or both termini. In another embodiment, the dsRNA orientation with respect to the target gene of interest. As used does not comprise 1-base, 2-base or 3-base 5'-overhangs on herein, “the reverse complement of a dsRNA molecule for one or both termini. In a further embodiment, the dsRNA regulating a target gene of interest” refers to a nucleic acid comprises 1-base, 2-base or 3-base 3'-overhangs on one or sequence in the antisense orientation. both termini. In another embodiment, the dsRNA does not 0163 As mentioned, any dsRNA molecule can be used in comprise 1-base, 2-base or 3-base 3'-Overhangs on one or accordance with the present teachings. In some embodi both termini. ments, dsRNA used in the present application is Subject to 0.168. In one embodiment, the dsRNA in the present appli amplification by RNA-Dependant RNA Polymerase cation is between 15 and 500 bp, between 15 and 450 bp, (RDRP). Without being limited, dsRNA can be siRNA, between 15 and 400 bp, between 15 and 350 bp, between 15 shRNA, pre-miRNA, or pri-miRNA. and 300 bp, between 15 and 250 bp, between 15 and 200 bp, (0164. The polynucleotides, DNA, RNA, dsRNA, siRNA, between 15 and 150 bp, between 15 and 100 bp, between 15 shRNA, pre-miRNA, pri-miRNA or miRNA of the present and 90 bp, between 15 and 80 bp, between 15 and 70 bp, embodiments may be produced chemically or enzymatically between 15 and 60 bp, between 15 and 50 bp, between 15 and by one skilled in the art through manual or automated reac 40 bp, between 15 and 35 bp, between 15 and 30 bp, or tions or in Vivo in another organism. RNA may also be pro between 15 and 25bp. In another embodiment, the dsRNA in duced by partial or total organic synthesis; any modified the present application is at least about 20, 25, 30, 35, 40, 45, ribonucleotide can be introduced by in vitro enzymatic or 50, 75, 100, 150, 200,250, 300,350, 400, 500, 600, 800,900, organic synthesis. The RNA may be synthesized by a cellular 1000 bp long. In a further embodiment, the dsRNA in the RNA polymerase or a bacteriophage RNA polymerase (e.g., present application is between 100 and 1000 bp, between 200 T3, T7, SP6). The use and production of an expression con and 1000 bp, between 300 and 1000 bp, between 400 and struct are known in the art (see, for example, WO 97/32016: 1000 bp, between 500 and 1000 bp, between 600 and 1000 bp, U.S. Pat. Nos. 5,593.874, 5,698,425, 5,712,135, 5,789,214, between 700 and 1000 bp, between 800 and 1000 bp, or and 5,804,693). If synthesized chemically or by in vitro enzy between 900 and 1000 bp. matic synthesis, the RNA may be purified prior to introduc (0169. The term “siRNA” refers to small inhibitory RNA tion into the seed. For example, RNA can be purified from a duplexes (generally between 17-30 basepairs, but also longer mixture by extraction with a solvent or resin, precipitation, e.g., 31-50 bp) that induce the RNA interference (RNAi) electrophoresis, chromatography, or a combination thereof. pathway. Typically, siRNAs are chemically synthesized as Alternatively, the RNA may be used with no or a minimum of 21mers with a central 19 bp duplex region and symmetric purification to avoid losses due to sample processing. The 2-base 3'-overhangs on the termini, although it has been RNA may be dried for storage or dissolved in an aqueous recently described that chemically synthesized RNA Solution. The Solution may contain buffers or salts to promote duplexes of 25-30 base length can have as much as a 100-fold annealing, and/or stabilization of the duplex Strands. increase in potency compared with 21 mers at the same loca 0.165. The present teachings relate to various lengths of tion. The observed increased potency obtained using longer dsRNA, whereby the shorter version i.e., X is shorter or equals RNAs in triggering RNAi is theorized to result from provid 50 bp (e.g., 17-50), is referred to as siRNA or miRNA. Longer ing Dicer with a substrate (27 mer) instead of a product (21 dsRNA molecules of 51-600 or more than 600 bp are referred mer) and that this improves the rate or efficiency of entry of to herein as dsRNA, which can be further processed for the siRNA duplex into RISC. siRNA molecules. 0170 It has been found that position of the 3'-overhang 0166 In one embodiment, the dsRNA in the present appli influences potency of a siRNA and asymmetric duplexes cation is between 20 and 100 bp, between 25 and 90 bp, having a 3'-overhang on the antisense Strand are generally between 30 and 80 bp, between 30 and 70 bp, between 30 and more potent than those with the 3'-overhang on the sense 60 bp, or between 30 and 50 bp. In another embodiment, the strand (Rose et al., 2005). This can be attributed to asym dsRNA in the present application is about 50 bp. In a further metrical strand loading into RISC, as the opposite efficacy embodiment, the dsRNA comprises 1-base, 2-base or 3-base patterns are observed when targeting the antisense transcript. 5'-overhangs on one or both termini. In another embodiment, 0171 The strands of a double-stranded interfering RNA the dsRNA does not comprise 1-base, 2-base or 3-base (e.g., a siRNA) may be connected to form a hairpin or stem 5'-overhangs on one or both termini. In a further embodiment, loop structure (e.g., a shRNA). Thus, as mentioned the RNA the dsRNA comprises 1-base, 2-base or 3-base 3'-overhangs silencing agent of Some embodiments of the invention may on one or both termini. In another embodiment, the dsRNA also be a short hairpin RNA (shRNA). does not comprise 1-base, 2-base or 3-base 3'-overhangs on 0172. The term “shRNA, as used herein, refers to an RNA one or both termini. agent having a stem-loop structure, comprising a first and 0167. In another embodiment, the dsRNA in the present second region of complementary sequence, the degree of application is between 100 and 1,000 bp, between 200 and complementarity and orientation of the regions being suffi 900 bp, between 300 and 800 bp, between 400 and 700 bp, cient such that base pairing occurs between the regions, the between 400 and 600 bp, or between 400 and 500 bp. In first and second regions being joined by a loop region, the another embodiment, the dsRNA in the present application is loop resulting from a lack of base pairing between nucle about 450 bp. In another embodiment, the dsRNA in the otides (or nucleotide analogs) within the loop region. The present application is about 550 bp. In another embodiment, number of nucleotides in the loop is a number between and the dsRNA in the present application is about 650 bp. In including 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to 11. another embodiment, the dsRNA in the present application is Some of the nucleotides in the loop can be involved in base US 2014/0230.090 A1 Aug. 14, 2014
pair interactions with other nucleotides in the loop. Examples hydrogenbounds, or G and U involving two hydrogenbounds of oligonucleotide sequences that can be used to form the loop is less strong than between G and C involving three hydrogen include 5'-UUCAAGAGA-3' (Brummelkamp, T. R. et al. bounds. Examples of hairpin sequences are provided in (2002) Science 296:550) and 5'-UUUGUGUAG-3' (Castan Tables 3, 4, 6, 7, 13, 18, 26, 27, 28, 34, 35, 36, and 37 below. otto, D. et al. (2002) RNA 8: 1454). It will be recognized by 0177 Naturally occurring miRNA molecules may be one of skill in the art that the resulting single chain oligo comprised within their naturally occurring pre-miRNA mol nucleotide forms a stem-loop or hairpin structure comprising ecules but they can also be introduced into existing pre a double-stranded region capable of interacting with the miRNA molecule scaffolds by exchanging the nucleotide RNAi machinery. sequence of the miRNA molecule normally processed from 0173 As used herein, the phrase “microRNA (also such existing pre-miRNA molecule for the nucleotide referred to herein interchangeably as “miRNA or “miR) or sequence of another miRNA of interest. The scaffold of the a precursor thereof refers to a microRNA (miRNA) mol pre-miRNA can also be completely synthetic. Likewise, Syn ecule acting as a post-transcriptional regulator. Typically, the thetic miRNA molecules may be comprised within, and pro miRNA molecules are RNA molecules of about 20 to 22 cessed from, existing pre-miRNA molecule scaffolds or Syn nucleotides in length which can be loaded into a RISC com thetic pre-miRNA scaffolds. Some pre-miRNA scaffolds plex and which direct the cleavage of another RNA molecule, may be preferred over others for their efficiency to be cor wherein the other RNA molecule comprises a nucleotide rectly processed into the designed microRNAs, particularly sequence essentially complementary to the nucleotide when expressed as a chimeric gene wherein other DNA sequence of the miRNA molecule. regions, such as untranslated leader sequences or transcrip 0.174 Typically, a miRNA molecule is processed from a tion termination and polyadenylation regions are incorpo “pre-miRNA or as used herein a precursor of a pre-miRNA rated in the primary transcript in addition to the pre-mi molecule by proteins, such as DCL proteins, present in any croRNA. plant cell and loaded onto a RISC complex where it can guide 0.178 According to the present teachings, the dsRNA mol the cleavage of the target RNA molecules. ecules may be naturally occurring or synthetic. 0175 Pre-microRNA molecules are typically processed 0179 The dsRNA can be a mixture of long and short from pri-microRNA molecules (primary transcripts). The dsRNA molecules such as, dsRNA, siRNA, siRNA-dsRNA, single stranded RNA segments flanking the pre-microRNA siRNA+miRNA, or any combination of same. According to a are important for processing of the pri-miRNA into the pre specific embodiment, the dsRNA is a siRNA (100%). miRNA. The cleavage site appears to be determined by the According to a specific embodiment the dsRNA is a siRNA distance from the stem-ssRNAjunction (Hanet al. 2006, Cell dsRNA combination in various ratios. Any dsRNA to siRNA 125, 887-901, 887-901). ratio can be used for the siRNA-dsRNA combination. For (0176). As used herein, a “pre-miRNA moleculeisan RNA example, a ratio of 1 to 1: one dsRNA mixed with the same molecule of about 100 to about 200 nucleotides, preferably sequence after RNAse III treatment. According to another about 100 to about 130 nucleotides which can adopt a sec embodiment, the dsRNA to siRNA ratio is 2:1, 1.5:1, 1.3:1, ondary structure comprising an imperfect double stranded 1:0.01, 1:0.05 or 1:0.1. According to a further embodiment, RNA stem and a single stranded RNA loop (also referred to as the dsRNA to siRNA ratio is 2:1 to 1:0.1. According to a "hairpin') and further comprising the nucleotide sequence of specific embodiment, the dsRNA is purified dsRNA (100%). the miRNA (and its complement sequence) in the double According to another embodiment, the dsRNA to siRNA ratio stranded RNA stem. According to a specific embodiment, the is 1:2, 1:5, 1:10, 1:20, or 1:50. According to a further embodi miRNA and its complement are located about 10 to about 20 ment, the dsRNA is purified siRNA (100%). nucleotides from the free ends of the miRNA double stranded RNA stem. The length and sequence of the single stranded 0180. The dsRNA molecule can be designed for specifi loop region are not critical and may vary considerably, e.g., cally targeting a target gene of interest. In some embodi between 30 and 50 nt in length. The complementarity ments, the target gene is an essential gene of an insect pest. In between the miRNA and its complement need not be perfect Some embodiments, the target gene is a viral gene. It will be and about 1 to 3 bulges of unpaired nucleotides can be toler appreciated that the dsRNA can be used to down-regulate one ated. The secondary structure adopted by an RNA molecule or more target genes. If a number of target genes are targeted, can be predicted by computer algorithms conventional in the a heterogenic composition which comprises a plurality of art such as mFOLD. The particular strand of the double dsRNA molecules for targeting a number of target genes is stranded RNA stem from the pre-miRNA which is released by used. Alternatively, said plurality of dsRNA molecules are DCL activity and loaded onto the RISC complex is deter separately applied to the seeds (but not as a single composi mined by the degree of complementarity at the 5' end, tion). According to a specific embodiment, a number of dis whereby the strand which at its 5' end is the least involved in tinct dsRNA molecules for a single target are used, which hydrogen bounding between the nucleotides of the different may be separately or simultaneously (e.g., co-formulation) strands of the cleaved dsRNA stem is loaded onto the RISC applied. complex and will determine the sequence specificity of the 0181. According to one embodiment, the target gene is target RNA molecule degradation. However, if empirically endogenous to the plant. Down regulating such a gene is the miRNA molecule from a particular synthetic pre-miRNA typically important for conferring the plant with an improved, molecule is not functional (because the “wrong strand is agricultural, horticultural, nutritional trait (“improvement” or loaded on the RISC complex); it will be immediately evident an “increase' is further defined herein below). It will be that this problem can be solved by exchanging the position of appreciated that the treatment with the dsRNA may result in the miRNA molecule and its complement on the respective an up-regulation of the target gene (which follows a Sug strands of the dsRNA stem of the pre-miRNA molecule. As is gested mechanism that is provided herein below) however known in the art, binding between A and U involving two Such an up-regulation may be transient. US 2014/0230.090 A1 Aug. 14, 2014
0182. According to another embodiment, the target gene is dsRNA targets a gene that contains regions that are poorly exogenous to the plant. In some embodiments, the target gene conserved between individual phytopathogenic organisms, or is an insect pest gene. In some embodiments, the target gene between the phytopathogenic organism and the host plant. In is a viral gene. It will further be appreciated that the treatment certain embodiments it may be desirable to target a gene in a with the dsRNA may result in an up-regulation of a plant phytopathogenic organism that has no known homologs in ortholog of the target gene. other organisms, such as the host plant. 0183. Several embodiments described herein relate to 0187. In some embodiments, a non-transcribable poly guidelines for the design and selection of non-transcribable nucleotide trigger, for example dsRNA, molecule is selected polynucleotide trigger, for example dsRNA, molecules for of Sufficient homology to a plant gene to mediate its degra efficient RNA silencing in phytopathogens, which nourish or dation in an RNA interference mediated function. depend on a plant for growth/replication and/or survival. Not 0188 According to one embodiment, there is provided a wishing to be bound by a particular theory, non-transcribable method of introducing naked double-stranded RNA (dsRNA) polynucleotide trigger, for example dsRNA, molecules hav into a seed, the method comprising contacting the seed with ing a sufficient level of homology to an endogenous plant the naked dsRNA under conditions which allow penetration gene allows for degradation and amplification of the primary of a nucleic acid sequence having: siRNAs (those which are triggered by Dicer processing) to 0189 (i) a homology level to a plant gene sufficient to generate secondary siRNAs formed by Dicer-Like 4 (DCL4). induce amplification of secondary siRNA products of said Such non-transcribable polynucleotide trigger, for example dsRNA in a plant cell comprising the same and wherein dsRNA, molecules can be selected for having minimal effect modification of the expression of the plant gene by said on the plant growth and viability. In some embodiments, the dsRNA does not substantially affect any of biomass, vigor or secondary siRNAS are of Sufficient homology to a gene of a yield of said plant; and phytopathogen so as allow the degradation of the targeted 0.190 (ii) a homology level to a gene of a phytopathogenic phytopathogen gene via an RNA interference mode. In some organism sufficient to induce degradation of said gene of said embodiments, a phytopathogen provided with a plant mate phytopathogenic organism, wherein said phytopathogenic rial grown from a seed treated with a non-transcribable poly organism depends on said plant for growth and wherein said nucleotide trigger, for example dsRNA, molecule as degradation induces a growth arrest or death of said phyto described herein will lose viability either by the induction of pathogenic organism. growth arrest or death. Such non-transcribable polynucle 0191 In some embodiments, the dsRNA has a homology otide trigger, for example dsRNA molecules are considered level to a plant gene sufficient to induce amplification of as valuable pesticides and can have wide applications in agri secondary siRNA products of said dsRNA in a plant cell culture and horticulture. comprising the dsRNA and wherein altering expression of the 0184 Without being bound by particular theory, it is sug plant gene by said dsRNA does not substantially affect any of gested that one mode of modulation of gene expression is biomass, vigor or yield of said plant. The plant gene can be associated with: (i) introduction of non-transcribable poly naturally expressed in the plant (endogenous) or a result of nucleotide trigger, for example dsRNA, molecules into the genetic transformation (transgenic plant). interior of seeds (as opposed to mere seed coating); (ii) ampli 0.192 In some embodiments, the dsRNA has a homology fication of the signal produced from introduction of the non level to a plant gene that: transcribable polynucleotide trigger, for example dsRNA, 0193 (i) is expressed in all or most plant organs, starting molecule; and spreading of the signal throughout the plant. from germination; The first step occurs only once, during and shortly after the 0194 (ii) is a non-vital gene, such that its down regulation initial seed treatment, while the second and third steps occur or up regulation does not affect the plant or any of the plants in a repetitive loop for as long as the silencing signal remains biomass, yield, vigor, and/or active in the plant. As mentioned, introduction of the compo 0.195 (iii) is not associated with endurance of abiotic or sitions of the present invention can also be performed to other biotic stress. organs/cells of the plant (as opposed to seeds) using conven 0196. The plant gene can be selected having at least one of tional delivery methods such as particle bombardment, graft the above characteristics i.e., (i), (ii) or (iii). Alternatively, the ing, soaking, topical application with a transfer agent and the plant gene fulfils two criteria Such as (i) and (ii), (i) and (iii) or like. Thus steps (i) and (ii), defined above, are shared also by (ii) and (iii). Alternatively all the three criteria prevail i.e., (i), this mode of administration. (ii) and (iii). In some embodiments, the dsRNA has a homol 0185. A phytopathogen feeding-on or infecting a plant ogy level to a plant gene that does not affect the biomass, which comprises any of the dsRNA, primary siRNA or sec yield, and/or vigor of the plant when measures are taken to ondary siRNAS which target an essential gene of the phyto grow the plant under optima/normal conditions or conditions pathogen will exhibit a growth arrest or death, thereby reduc which do not require function of the gene for optimal growth, ing its injurious effect on the plant or plant product. vigor, biomass, and/or yield. As used herein the phrase “does 0186. In some embodiments, there is provided a method of not substantially affect” refers to no effect as compared to the introducing naked double-stranded RNA (dsRNA) into a same characteristic in an isogenic plant of the same develop seed, the method comprising contacting the seed with the mental stage and growth conditions. Alternatively, said char naked dsRNA under conditions which allow penetration of a acteristic is only slightly affected by no more than 10%, 8%, nucleic acid sequence having: a homology level to a gene of 7 c'6, 6%. 5%, 4%, 3%, 2% or 1%. a phytopathogenic organism Sufficient to induce degradation 0.197 According to some embodiments, the nucleic acid of said gene of said phytopathogenic organism, wherein said sequence of the non-transcribable polynucleotide trigger, for phytopathogenic organism depends on said plant for growth example dsRNA, molecule is selected so as to exhibit suffi and wherein said degradation induces a growth arrest or death cient homology to recruit the RDR6 system and generate of said phytopathogenic organism. In some embodiments, the secondary siRNA transcripts. Such a homology level is typi US 2014/0230.090 A1 Aug. 14, 2014 cally at least 80% identity to an endogenous plant gene over the nucleic acid sequence of the non-transcribable polynucle at least 25 consecutive bp. According to an alternative otide trigger, for example dsRNA, molecule comprises a sec embodiment, the homology level of the non-transcribable ond nucleic acid segment at least 17 bp in length (over at least polynucleotide trigger, for example dsRNA, molecule is at 17 consecutive bp) which is at least 95% identical to a plant least 85% identity to a plant gene over at least 25 consecutive gene. According to a specific embodiment, the nucleic acid bp. According to an alternative embodiment, the homology sequence of the non-transcribable polynucleotide trigger, for level of the non-transcribable polynucleotide trigger, for example dsRNA, molecule comprises a second nucleic acid example dsRNA, molecule is at least 88% identity to the plant segment at least 17 bp in length (over at least 17 consecutive gene over at least 25 consecutive bp. According to an alter bp) which is 100% identical to a plant gene. native embodiment, the homology level of the non-transcrib 0201 According to a specific embodiment, the first able polynucleotide trigger, for example dsRNA, molecule is nucleic acid segment and the second nucleic acid segment at least 90% identity to the plant gene over at least 25 con overlap (by at least 5%, 10%, 20%, 40%, 50% or more). secutive by of the target gene. According to an alternative According to a specific embodiment, the overlap is by 5-99%, embodiment, the homology level of the non-transcribable 5-95%, 5-90%, 5-80%, 5-70%, 5-60%. According to a spe polynucleotide trigger, for example dsRNA, molecule is at cific embodiment, the first nucleic acid segment and the sec least 92% identity to the plant gene over at least 25 consecu ond nucleic acid segment are in no overlap. tive bp. According to an alternative embodiment, the homol 0202 In some embodiments, the nucleic acid sequence of ogy level of the non-transcribable polynucleotide trigger, for the non-transcribable polynucleotide trigger, for example example dsRNA, molecule is at least 95% identity to the plant dsRNA, molecule is selected having a homology level to a gene over at least 25 consecutive bp. According to an alter gene of a phytopathogenic organism Sufficient to induce deg native embodiment, the homology level of the non-transcrib radation of the gene of the phytopathogenic organism, able polynucleotide trigger, for example dsRNA, molecule is wherein the phytopathogenic organism depends on the plant at least 25 consecutive bp. for growth and wherein the degradation induces a growth 0198 According to some embodiments, the non-tran arrest or death of the phytopathogenic organism. scribable polynucleotide trigger, for example dsRNA, mol 0203 Thus, the non-transcribable polynucleotide trigger, ecule is at least is 70 bp or longer say 70-700, 70-600, 70-500, for example dsRNA, molecule exhibits at least 80%, 85%, 70-400, 70-300, 70-200, 70-100 bp. 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 0199 According to some embodiments, the non-tran 99% or even 100% identity to the gene of the phytopathogen. scribable polynucleotide trigger, for example dsRNA, mol 0204. In some embodiments, the non-transcribable poly ecule comprises a nucleic acid segment at least 70 bp in length nucleotide trigger, for example dsRNA, molecule can be which is at least 65% identical to the plant gene. According to designed for specifically targeting a target gene of interest. It a specific embodiment, the nucleic acid sequence comprises a will be appreciated that the non-transcribable polynucleotide nucleic acid segment at least 70 bp in length which is at least trigger, for example dsRNA, molecule can be used to down 70% identical (over the entire sequence) to the plant gene. regulate one or more target genes of the phytopathogen or According to a specific embodiment, the nucleic acid plant (in the latter case to increase the amplification). If a sequence comprises a nucleic acid segment at least 70 bp in number of target genes are targeted, a heterogenic composi length which is at least 75% identical (over the entire tion which comprises a plurality of non-transcribable poly sequence) to the plant gene. According to a specific embodi nucleotide trigger, for example dsRNA, molecules for target ment, the nucleic acid sequence comprises a nucleic acid ing a number of target genes is used. Alternatively said segment at least 70 bp in length which is at least 80% identical plurality of non-transcribable polynucleotide trigger, for (over the entire sequence) to the plant gene. According to a example dsRNA molecules are separately applied to the seeds specific embodiment, the nucleic acid sequence comprises a (but not as a single composition). nucleic acid segment at least 70 bp in length which is at least 85% identical (over the entire sequence) to the plant gene. 0205 Down-regulation of the target gene may be impor According to a specific embodiment, the nucleic acid tant for conferring improved tolerance to biotic stress induced sequence comprises a nucleic acid segment at least 70 bp in by phytopathogen. The biotic stress can affect any of the length which is at least 90% identical (over the entire plant's biomass, vigor or yield, as well as tolerance to abiotic sequence) to the plant gene. According to a specific embodi stress and nitrogen use efficiency. The target gene (plant of ment, the nucleic acid sequence comprises a nucleic acid phytopathogen) may comprise a nucleic acid sequence which segment at least 70 bp in length which is at least 95% identical is transcribed to an mRNA which codes for a polypeptide. (over the entire sequence) to the plant gene. According to a 0206. As used herein, the term “endogenous” refers to a specific embodiment, the nucleic acid sequence comprises a gene whose expression (mRNA or protein) takes place in the nucleic acid segment at least 70 bp in length which is % plant. Typically, the endogenous gene is naturally expressed identical (over the entire sequence) to the plant gene. in the plant or originates from the plant. Thus, the plant may 0200. In some embodiments, the nucleic acid sequence of be a wild-type plant. However, the plant may also be a geneti the non-transcribable polynucleotide trigger, for example cally modified plant (transgenic). dsRNA, molecule comprises a second nucleic acid segment at 0207. As used herein the term “isolated refers to the least 17 bp in length (over at least 17 consecutive bp) which is isolation from the physiological, natural environment. In the at least 85% identical to a plant gene. According to a specific case of dsRNA, isolation from cellular organelles, such as the embodiment, the nucleic acid sequence of the non-transcrib cytosol or nucleus. In the case of a seed, isolation from other able polynucleotide trigger, for example dsRNA, molecule plant parts Such as the fruit. According to a specific embodi comprises a second nucleic acid segment at least 17 bp in ment, an isolated dsRNA molecule is in a form of naked RNA. length (over at least 17 consecutive bp) which is at least 90% 0208 Down regulation of the target gene may be impor identical to a plant gene. According to a specific embodiment, tant for conferring improved one of , or at least one of (e.g., US 2014/0230.090 A1 Aug. 14, 2014
two of or more), biomass, vigor, yield, abiotic stress toler 0217. As mentioned, the naked dsRNA molecule is ance, biotic stress tolerance or improved nitrogen use effi directly contacted with the seed. ciency. 0218. The seed may be of any plant, such as of the Virid 0209 Examples of target genes include, but are not limited iplantae Super family including monocotyledon and dicoty to, an enzyme, a structural protein, a plant regulatory protein, ledon plants. Other plants are listed herein below. According a miRNA target gene, or a non-coding RNA such as a miRNA to an embodiment of the invention, the cells of the plant of the plant. WO2011067745, WO 2009 125401 and WO comprise RNA dependent RNA polymerase activity and the 2012056401 provide examples of miRNA sequences or tar target RNA molecule of the dsRNA to ensure amplification of gets of miRNAs (e.g., mRNA167, miRNA 156, miR164 and the dsRNA. targets thereof NFY, SPL17 and NAC, respectively) which 0219. The term “plant’ as used herein encompasses whole expression can be silenced to improve a plant trait. Other plants, ancestors and progeny of the plants and plant parts, examples of target genes which may be subject to modulation including seeds, shoots, stems, roots (including tubers), and according to the present teachings are described in the isolated plant cells, tissues and organs. The plant may be in Examples section which follows. any form including Suspension cultures, embryos, meristem 0210. The target gene may comprise a nucleic acid atic regions, callus tissue, leaves, gametophytes, sporophytes, sequence which is transcribed to an mRNA which codes for a pollen, and microspores. It will be appreciated, that the plant polypeptide. Alternatively, the target gene can be a non-cod or seed thereof may be transgenic plants. ing gene Such as a miRNA or a siRNA. 0220. As used herein the phrase “plant cell refers to plant 0211 For example, in order to silence the expression of an cells which are derived and isolated from disintegrated plant mRNA of interest, synthesis of the dsRNA suitable for use cell tissue or plant cell cultures. Plant cells may be reproduc with some embodiments of the invention can be selected as tive cells (i.e., cells from a tissue contributing directly to the follows. First, the mRNA sequence is scanned including the 3' sexual reproduction of a plant) or non-reproductive cells (i.e., UTR and the 5' UTR. cells from a tissue not involved in the sexual reproduction of 0212 Second, the mRNA sequence is compared to an a plant). Plant cells may be cells that are capable of regener appropriate genomic database using any sequence alignment ating into a whole plant or cells that cannot regenerate into a software, such as the BLAST software available from the whole plant, for example, enucleated mature sieve tube cells. NCBI server (wwwdotncbidotnlmdotnihdot.gov/BLAST/). 0221. As used herein the phrase “plant cell culture” refers Putative regions in the mRNA sequence which exhibit sig to any type of native (naturally occurring) plant cells, plant nificant homology to other coding sequences are filtered out. cell lines and genetically modified plant cells, which are not assembled to form a complete plant, Such that at least one 0213 Qualifying target sequences are selected as template biological structure of a plant is not present. Optionally, the for dsRNA synthesis. Preferred sequences are those that have plant cell culture of this aspect of the present invention may as little homology to other genes in the genome to reduce an comprise a particular type of a plant cell or a plurality of “off-target” effect. different types of plant cells. It should be noted that optionally 0214. In one embodiment, the dsRNA may comprise a plant cultures featuring a particular type of plant cell may be target sequence in an intron, exon, 3' UTR, 5' UTR, or a originally derived from a plurality of different types of such regulatory element of a target gene, or combinations thereof. plant cells. In one embodiment, the dsRNA of the present application 0222 Any commercially or scientifically valuable plant is may comprise a target site residing in a promoter. envisaged in accordance with some embodiments of the 0215. It will be appreciated that the RNA silencing agent invention. Plants that are particularly useful in the methods of of some embodiments of the invention need not be limited to the invention include all plants which belong to the super those molecules containing only RNA, but further encom family Viridiplantae, in particular monocotyledonous and passes chemically-modified nucleotides and non-nucle dicotyledonous plants including a fodder or forage legume, otides. ornamental plant, food crop, tree, or shrub selected from the 0216. The dsRNA may be synthesized using any method list comprising Acacia spp., Acer spp., Actinidia spp., Aescu known in the art, including either enzymatic syntheses or lus spp., Agathis australis, Albizia amara, Alsophila tricolor, Solid-phase syntheses. These are especially useful in the case Andropogon spp., Arachis spp., Areca catechu, Astelia fra of short polynucleotide sequences with or without modifica grams, Astragalus cicer; Baikiaea plurijuga, Betula spp., tions as explained above. Equipment and reagents for execut Brassica spp., Bruguiera gymnorrhiza, Burkea africana, ing Solid-phase synthesis are commercially available from, Butea frondosa, Cadaba farinosa, Calliandra spp., Camellia for example, Applied Biosystems. Any other means for Such Sinensis, Canna indica, Capsicum spp., Cassia spp., Centro synthesis may also be employed; the actual synthesis of the ema pubescens, Chacoomeles spp., Cinnamomum cassia, oligonucleotides is well within the capabilities of one skilled Coffea arabica, Colophospermum mopane, Coronillia varia, in the art and can be accomplished via established method Cotoneaster serotina, Crataegus spp., Cucumis spp., Cupres ologies as detailed in, for example: Sambrook, J. and Russell, sus spp., Cyathea dealbata, Cyclonia Oblonga, Cryptomeria D. W. (2001), “Molecular Cloning: A Laboratory Manual': japonica, Cymbopogon spp., Cynthea dealbata, Cyclonia Ausubel, R. M. et al., eds. (1994, 1989), “Current Protocols in oblonga, Dalbergia monetaria, Davallia divaricata, Desmo Molecular Biology. Volumes I-III, John Wiley & Sons, Bal dium spp., Dicksonia squarosa, Dibeteropogon amplectens, timore, Md.: Perbal, B. (1988), “A Practical Guide to Molecu Dioclea spp., Dolichos spp., Dorycnium rectum, Echinochloa lar Cloning.” John Wiley & Sons, New York; and Gait, M.J., pyramidalis, Ehrafia spp., Eleusine coracana, Eragrestis ed. (1984), “Oligonucleotide Synthesis; utilizing solid spp., Erythrina spp., Eucalyptus spp., Euclea Schimperi, phase chemistry, e.g., cyanoethyl phosphoramidite followed Eulalia vi/losa, Pagopyrum spp., Feijoa sellowlana, Fragaria by deprotection, desalting, and purification by, for example, spp., Flemingia spp., Freycinetia banksli, Geranium thun an automated trityl-on method or HPLC. bergii, GinAgo biloba, Glycine javanica, Gliricidia spp., Gos US 2014/0230.090 A1 Aug. 14, 2014 19 sypium hirsutum, Grevillea spp., Guibourtia Coleosperma, centration of the detergent may be 0.01-0.2% or 0.2-1%. Hedysarum spp., Hemafhia altissima, Heteropogon contof According to another embodiment, the detergent concentra fits, Hordeum vulgare, Hyparrhenia rufa, Hypericum erec tion can be about 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, tum, Hypefhelia dissolute, Indigo incamata, Iris spp., Lep 0.5%, 1% or higher. tarrhena pyrolifolia, Lespediza spp., Lettuca spp., Leucaena 0227. The seed may be subjected to priming or washing leucocephala, Loudetia simplex, Lotonus bainesli, Lotus prior to contacting with the dsRNA. spp., Macrotyloma axillare, Malus spp., Manihot esculenta, 0228. As used herein the term “priming refers to control Medicago Saliva, Metasequoia glyptostroboides, Musa sapi ling the hydration level within seeds so that the metabolic entum, Nicotianum spp., Onobrychis spp., Ornithopus spp., activity necessary for germination can occur but radicle emer Oryza spp., Peltophorum africanum, Pennisetum spp., Persea gence is prevented. Different physiological activities within gratissima, Petunia spp., Phaseolus spp., Phoenix canarien the seed occur at different moisture levels (Leopold and Ver sis, Phormium cookianum, Photinia spp., Picea glauca, tucci, 1989; Taylor, 1997). The last physiological activity in Pinus spp., Pisum sativam, Podocarpus totara, Pogonarthria the germination process is radicle emergence. The initiation flecki, Pogonafhria squamosa, Populus spp., Prosopis cin of radicle emergence requires a high seed water content. By eraria, Pseudotsuga menziesii, Pterolobium Stellatum, Pyrus limiting seed water content, all the metabolic steps necessary communis, Quercus spp., Rhaphiolepsis umbellata, Rhopalo for germination can occur without the irreversible act of stylis sapida, Rhus natalensis, Ribes grossularia, Ribes spp., radicle emergence. Prior to radicle emergence, the seed is Robinia pseudoacacia, Rosa spp., Rubus spp., Salix spp., considered desiccation tolerant, thus the primed seed mois Schyzachyrium sanguineum, Sciadopity's vefficillata, Sequoia ture content can be decreased by drying. After drying, primed sempervirens, Sequoiadendron giganteum, Sorghum bicolor, seeds can be stored until time of sowing. Spinacia spp., Sporobolus fimbriatus, Stiburus alopecuroi 0229. Several different priming methods are used com des, Stylosanthos humilis, Tadehagi spp., Taxodium disti mercially. Among them, liquid or osmotic priming and solid chum, Themeda triandra, Trifolium spp., Triticum spp., Tsuga matrix priming appear to have the greatest following (Khanet heterophylla, Vaccinium spp., Vicia spp., Vitis vinifera, Wat al., 1991). Sonia pyramidata, Zantedeschia aethiopica, Zea mays, ama 0230. According to an embodiment of the invention, prim ranth, artichoke, asparagus, broccoli, Brussels sprouts, cab ing is effected in the presence of salt, a chelating agent, bage, canola, carrot, cauliflower, celery, collard greens, flax, polyethylene glycolora combination of same (e.g., chelating kale, lentil, oilseed rape, okra, onion, potato, rice, soybean, agent and salt). Straw, Sugar beet, Sugar cane, Sunflower, tomato, squash tea, 0231. Alternatively, priming is effected in the presence of maize, wheat, barley, rye, oat, peanut, pea, lentil and alfalfa, water such as deionized water or double deionized water. cotton, rapeseed, canola, pepper, Sunflower, tobacco, egg According to a specific embodiment, the priming is effected plant, eucalyptus, a tree, an ornamental plant, a perennial in the presence of 100% ddW. grass and a forage crop. Alternatively algae and other non 0232 Several types of seed priming are commonly used: Viridiplantae can be used for the methods of the present 0233 Osmopriming (osmoconditioning)—is the standard invention. priming technique. Seeds are incubated in well aerated solu 0223) According to some embodiments of the invention, tions with a low water potential, and afterwards washes and the plant used by the method of the invention is a crop plant dried. The low water potential of the solutions can be including, but not limited to, cotton, Brassica vegetables, achieved by adding osmotica like mannitol, polyethyleneg oilseed rape, Sesame, olive tree, palm oil, banana, wheat, corn lycol (PEG) or salts like KC1. or maize, barley, alfalfa, peanuts, Sunflowers, rice, oats, Sug 0234 Hydropriming (drum priming) is achieved by arcane, soybean, turf grasses, barley, rye, Sorghum, Sugar continuous or Successive addition of a limited amount of cane, chicory, lettuce, tomato, Zucchini, bell pepper, egg water to the seeds. A drum is used for this purpose and the plant, cucumber, melon, watermelon, beans, hibiscus, okra, water can also be applied by humid air. On-farm steeping is apple, rose, Strawberry, chili, garlic, pea, lentil, canola, a cheap and useful technique that is practiced by incubating mums, Arabidopsis, broccoli, cabbage, beet, quinoa, spinach, seeds (cereals, legumes) for a limited time in warm water. Squash, onion, leek, tobacco, potato, Sugarbeet, papaya, pine 0235 Matrix.priming (matriconditioning) is the incuba apple, mango, Arabidopsis thaliana, and also plants used in tion of seeds in a solid, insoluble matrix (vermiculite, diato horticulture, floriculture or forestry, such as, but not limited maceous earth, cross-linked highly water-absorbent poly to, poplar, fir, eucalyptus, pine, an ornamental plant, a peren mers) with a limited amount of water. This method confers a nial grass and a forage crop, coniferous plants, moss, algae, as slow imbibition. well as other plants listed in World Wide Web (dot) nation 0236 Pregerminated seeds is only possible with a few master (dot) com/encyclopedia/Plantae. species. In contrast to normal priming, seeds are allowed to 0224. According to a specific embodiment, the plant is perform radicle protrusion. This is followed by sorting for selected from the group consisting of corn, rice, wheat, specific stages, a treatment that reinduces desiccation toler tomato, cotton and Sorghum. ance, and drying. The use of pregerminated seeds causes 0225. According to a specific embodiment, the seed is an rapid and uniform seedling development. uncoated or fresh seed that hasn't been subjected to chemical/ 0237 Thus, according to one embodiment, the seeds are physical treatments. primed seeds. 0226. In some embodiments, washing of the seeds is 0238. Of note, it may be possible that the seeds are treated effected for 30 minutes to 4 hours. Other examples of wash with water (double-distilled water, ddW), prior to contacting ranges are 1 minute to 10 minutes, 10 minutes to 30 minutes. with the dsRNA without effecting any priming on the seeds. According to Some embodiments, washing of the seeds can be For instance, treatment for a short while with water (e.g., 30 as short as 5, 10, 20, 30, 45, or 60 seconds. The wash solution seconds to 1 hour, 30 seconds to 0.5 hour, 30 seconds to 10 may include a weak detergent such as Tween-20. The con minutes, 30 seconds to 5 minutes or 45 seconds to 5 minutes). US 2014/0230.090 A1 Aug. 14, 2014 20
According to Some embodiments, treatment with water can ug/ml, 0.1-1 lug/ml, 0.1-0.5 g/ml, 0.15-0.5 g/ml, 0.1-0.3 be as short as 5, 10, 20, or 30 seconds. ug/ml, 0.01-0.1 lug/ml, 0.01-0.05 g/ml, 0.02-0.04 ug/ml, or 0239. It will be appreciated that the non-transcribable 0.001-0.02 ug/ml. polynucleotide trigger, for example dsRNA, molecule can be 0255. In another embodiment, the dsRNA concentration comprised in water (e.g., tap water, distilled water or double in the treating Solution is about 5-10 ug/ml, 10-15 lug/ml. distilled water) i.e., free of any of the above mentioned prim 15-20 lug/ml, 20-25 ug/ml, 25-30 ug/ml, 30-35 ug/ml, 35-40 ing effective concentration of salts, a chelating agents, poly ug/ml. 40-45ug/ml. 45-50 g/ml, 50-55ug/ml, 55-60 ug/ml, ethylene glycol or combinations of same (e.g., chelating 60-65 g/ml, 65-70 ug/ml, 70-75ug/ml, 75-80 ug/ml, 80-85 agent and salt). In some embodiments, the non-transcribable ug/ml, 85-90 ug/ml, 90-95 g/ml, 95-100 g/ml, 100-105 polynucleotide trigger, for example dsRNA, molecule is pro ug/ml, 105-110 ug/ml, 110-115 lug/ml, 115-120 ug/ml, 120 vided to the seed in a buffer solution, such as EDTA. 125 g/ml, 125-130 ug/ml, 130-135 ug/ml, 135-140 ug/ml, 0240. In some embodiments, the seeds are non-primed 140-145 lug/ml, 145-150 g/ml, 150-155 ug/ml, 155-160 seeds. ug/ml, 160-165 lug/ml, 165-170 ug/ml, 170-175ug/ml, 175 0241. A non-limiting method of introducing the dsRNA 180 g/ml, 180-185ug/ml, 185-190 ug/ml, 190-195ug/ml, into the seed is provided in Example 1, which is considered as 195-200 ug/ml, 200-210 g/ml, 210-220 ug/ml, 220-230 an integral part of the specification. ug/ml, 230-240 ug/ml, 240-250 ug/ml, 250-260 ug/ml, 260 0242. The temperature at the washing/priming and drying 270 g/ml, 270-280 ug/ml, 280–290 ug/ml, 290-300 ug/ml, steps may be the same or differ. 300-310 ug/ml, 310-320 g/ml, 320-330 ug/ml, 330-340 ug/ml, 340-350 ug/ml, 350-360 ug/ml, 360-370 ug/ml, 370 0243 According to one embodiment, the washing/prim 380 g/ml, 380-390 ug/ml, 390-400 ug/ml. 400-410 ug/ml, ing is effected at 4-28°C. 410-420 ug/ml. 420-430 ug/ml. 430-440 ug/ml. 440-450 0244. According to one embodiment, the priming/wash ug/ml. 450-460 ug/ml. 460-470 ug/ml. 470-480 ug/ml. 480 ing solution or the dsRNA containing Solution is devoid of a 490 ug/ml, or about 490-500 g/ml. solid carrier. 0256 In another embodiment, the dsRNA concentration 0245 According to one embodiment, the priming/wash in the treating solution is 0.0001-3 lug/ul, 0.0001-2.5 lug/ul, ing solution or the dsRNA containing Solution is devoid of a 0.0001-2 ug/ul, 0.0001-1.5 g/ul, 0.0001-1 ug/ul, 0.0001-0.9 transferring agent such as a Surfactant or a salt. ug/ul, 0.0001-0.8 ug/ul, 0.0001-0.7 ug/ul, 0.0001-0.6 g/ul, 0246 According to a further embodiment of the invention, 0.0001-0.5ug/ul, 0.0001-0.4 ug/ul, 0.0001-0.3 ug/ul, 0.0001 the seeds subject to contacting with the dsRNA molecule are 0.2 g/ul, 0.0001-0.1 g/ul, 0.0001-0.05 g/ul, 0.0001-0.02 washed in order to remove agents, to which the seeds have ug/ul, 0.0001-0.01 g/ul, 0.0001-0.005 ug/ul, 0.0001-0.001 been Subjected. Such as a pesticide, a fungicide, an insecti ug/ul, or 0.0001-0.0005 g/l. cide, a fertilizer, a coating agent and a coloring agent. 0257. In another embodiment, the dsRNA concentration 0247 Thus, according to one embodiment, the seeds in the treating solution is 0.0001-3 lug/ul, 0.0005-3 lug/ul, (prior to treatment with dsRNA) are substantially free (i.e., do 0.001-3 ug/ul, 0.005-3 lug/ul, 0.01-3 lug/ul, 0.05-3 lug/ul, 0.1-3 not comprise effective amounts) of pesticide, a fungicide, an ug/ul, 0.2-3 ug/ul, 0.3-3 ug/ul, 0.4-3 ugful, 0.5-3 ug/ul, 0.6-3 insecticide, a fertilizer, a coating agent and a coloring agent. ug/ul, 0.7-3 g/ul, 0.8-3 ugful, 0.9-3 g/ul, 1-3 ug/ul, or 2-3 0248. The seeds are then subjected to drying. In some Lig/l. embodiments, drying is optional. 0258. In another embodiment, the dsRNA concentration 0249 According to one embodiment, the drying is in the treating solution is 0.0001-3 lug/ul, 0.0005-2.5 lug/ul, effected at 20–37° C., 20-30° C., 22-37° C., 15-22° C. or 0.001-2 g/ul, 0.005-1.5 lug/ul, 0.01-1 ug/ul, 0.05-0.5 g/ul, 20-25° C. for 10-20 hours, 10-16 hours or even 2-5 hours. 0.1-0.4 ug/ul, or 0.2-0.3 ugful. 0250 Various considerations are to be taken when calcu 0259. According to a specific embodiment, the contacting lating the concentration of the dsRNA in the contacting solu with the dsRNA is effected in the presence of a chelating tion. agent Such as EDTA or another chelating agent such as DTPA 0251. These are dependent on at least one of seed size, (0.01-0.1 mM). seed weight, seed Volume, seed surface area, seed density and 0260. In some embodiments, the treating solution may seed permeability. comprise a transferring agent Such as a surfactant or a salt. 0252 For example, related to seed size, weight, volume Examples of Such transferring agents include but are not and Surface area, it is estimated that corn seeds will require limited salts such as Sodium or lithium salts of fatty acids longer treatment than Arabidopsis and tomato seeds. Regard (such as tallow or tallowamines or phospholipids lipo ing permeability and density, it is estimated that wheat seeds fectamine or lipofectin (1-20 nM, or 0.1-1 nM)) and organo will require longer treatments at higher concentrations than silicone surfactants. Other useful Surfactants include organo tomato seeds. silicone surfactants including nonionic organosilicone 0253 Examples of concentrations of dsRNA in the treat Surfactants, e.g., trisiloxane ethoxylate surfactants or a sili ing Solution include, but are not limited to, 0.01-0.3 ugful, cone polyether copolymer Such as a copolymer of polyalky 0.01-0.15ug/ul, 0.04-0.15ug/ul, 0.1-100 g/ul; 0.1-50 ug/ul, lene oxide modified heptamethyl trisiloxane and allyloxy 0.1-10, ug/ul, 0.1-5ug/ul, 0.1-1 ug/ul, 0.1-0.5 g/ul, 0.15-0.5 polypropylene glycol methylether (commercially available ug/ul, 0.1-0.3 ug/ul, 0.01-0.1 lug/ul, 0.01-0.05 g/ul, 0.02-0. as SilwetTML-77 surfactant having CAS Number 27306-78-1 04 Lug/ul, 0.001-0.02 ug/ul. According to a specific embodi and EPA Number: CAL.REG.NO. 5905-50073-AA, cur ment, the concentration of the dsRNA in the treating solution rently available from Momentive Performance Materials, is 0.01-0.15 or 0.04-0.15ug/ul. Albany, N.Y.). 0254. In one embodiment, the dsRNA concentration in the 0261. In some embodiments, the treating solution may treating solution is 0.01-0.3 ug/ml, 0.01-0.15 ug/ml, 0.04-0. comprise a physical agent. Examples of physical agents 15 lug/ml, 0.1-100 ug/ml, 0.1-50 ug/ml, 0.1-10 ug/ml, 0.1-5 include: (a) abrasives Such as carborundum, corundum, sand, US 2014/0230.090 A1 Aug. 14, 2014
calcite, pumice, garnet, and the like, (b) nanoparticles Such as between 10 and 60, between 20 and 60, between 30 and 60, carbon nanotubes and (c) a physical force. Carbon nanotubes between 40 and 60, between 50 and 60, between 1 and 50, are disclosed by Kam et al. (2004) J. Am. Chem. Soc., 126 between 1 and 40, between 1 and 30, between 1 and 20, (22): 6850-6851, Liu et al. (2009) Nano Lett., 9(3):1007 between 1 and 10, between 1 and 5, between 5 and 50, 1010, and Khodakovskaya et al. (2009) ACS Nano, 3(10): between 10 and 40, and between 20 and 30 minutes. 3221-3227. Physical force agents can include heating, chill 0269. In one embodiment, the dipping time may be ing, the application of positive pressure, or ultrasound between 1 and 60, between 2 and 60, between 5 and 60, treatment. Agents for laboratory conditioning of a plant to between 10 and 60, between 20 and 60, between 30 and 60, permeation by polynucleotides include, e.g., application of a between 40 and 60, between 50 and 60, between 1 and 50, chemical agent, enzymatic treatment, heating or chilling, between 1 and 40, between 1 and 30, between 1 and 20, treatment with positive or negative pressure, or ultrasound between 1 and 10, between 1 and 5, between 5 and 50, treatment. Agents for conditioning plants in a field include between 10 and 40, and between 20 and 30 seconds. chemical agents such as Surfactants and salts. 0270. According to a specific embodiment, contacting 0262 Contacting of the seeds with the dsRNA can be occurs prior to breaking of seed dormancy and embryo emer effected using any method known in the art as long as an gence. effective amount of the dsRNA enters the seeds. These 0271 Following contacting, preferably prior to breaking examples include, but are not limited to, soaking, spraying or of seed dormancy and embryo emergence, the seeds may be coating with powder, emulsion, Suspension, or solution; simi Subjected to treatments (e.g., coating) with the above agents larly, the polynucleotide molecules are applied to the plant by (e.g., pesticide, fungicide etc.). any convenient method, e.g., spraying or wiping a solution, 0272 Contacting is effected such that the dsRNA enters emulsion, or Suspension. the embryo, endosperm, the coat, or a combination of the 0263. As used herein “an effective amount” refers to an three. amount of dsRNA which is sufficient to down regulate the 0273. After contacting with the treatment solution, the target gene by at least 20%, 30%, 40%, 50%, or more, say seeds may be subjected to drying for up to 30 hours at 25-37 60%, 70%, 80%, 90% or more even 100%. The effective C. For example, the seeds may be dried for 16 hours at 30°C. amount can be a result of the formation of amplification in the 0274. According to a specific embodiment, the seed (e.g., plant or the phytopathogen. isolated seed) comprises the exogenous naked dsRNA and 0264. According to a specific embodiment contacting may wherein at least 10 or 20 molecules of the dsRNA are in the be effected by soaking (i.e., inoculation) so that shaking the endosperm of the isolated seed. seeds with the treating Solution may improve penetration and 0275. As used herein the term "isolated refers to separa soaking and therefore reduce treatment time. Shaking is typi tion from the natural physiological environment. In the case cally performed at 50-150 RPM and depends on the volume of seed, the isolated seed is separated from other parts of the of the treating solution. Shaking may be effected for 4-24 plant. In the case of a nucleic acid molecule (e.g., dsRNA) hours (1–4 hours, 10 minutes to 1 hour or 30 seconds to 10 separated from the cytoplasm. minutes). The present teachings further envisage short incu 0276 According to a specific embodiment, the dsRNA is bation time such as up to 10 minutes. Examples include but not expressed from the plant genome, thereby not being an are not limited to 30 seconds to 7 minutes, to 30 seconds to 5 integral part of the genome. minutes, to 30 seconds to 3 minutes, to 30 seconds to 2 0277 According to a specific embodiment there is pro minutes, to 30 seconds to 1 minute, 1 minute to 10 minutes or vided an isolated seed comprising an exogenous dsRNA to 1 minute to 5 minutes. being presentata similar concentration (e.g., about 1:1, 2:1 or 0265. In one embodiment, the incubation time may be 1:2) in an embryo and an endosperm of the seed. It is Sug between 1 and 60, between 2 and 60, between 5 and 60, gested that the direct introduction of the naked dsRNA to the between 10 and 60, between 20 and 60, between 30 and 60, seed results in higher concentration of the dsRNA in the between 40 and 60, between 50 and 60, between 1 and 50, endosperm than that observed when the dsRNA is expressed between 1 and 40, between 1 and 30, between 1 and 20, from a nucleic acid expression construct. between 1 and 10, between 1 and 5, between 5 and 50, 0278. According to a specific embodiment there is pro between 10 and 40, and between 20 and 30 seconds. vided an isolated seed comprising an exogenous dsRNA 0266. In another embodiment, the incubation time may be being spatially distributed in an embryo and an endosperm of between 1 and 60, between 2 and 60, between 5 and 60, the plant seed in a spatial distribution that differs from a between 10 and 60, between 20 and 60, between 30 and 60, spatial distribution of the exogenous dsRNA in a seed derived between 40 and 60, between 50 and 60, between 1 and 50, from a transgenic plant that recombinantly expresses said between 1 and 40, between 1 and 30, between 1 and 20, exogenous dsRNA. between 1 and 10, between 1 and 5, between 5 and 50, 0279 Methods of measuring the localization of RNA mol between 10 and 40, and between 20 and 30 minutes. ecules in the seed are well known in the art. The use of siGlo 0267 Dipping is also considered under the scope of the as described in the Examples section is an example for such. present embodiments. Thus, the seeds are dipped into the 0280 According to an alternative oran additional embodi dsRNA solution for seconds e.g., 1-10 seconds, 1-5 seconds, ment, there is provided an isolated seed comprising an exog 1-3 seconds or 1-2 seconds. During this period, the dsRNA enous dsRNA, wherein a concentration ratio of said exog may adsorb on the seed surface. The adsorbed dsRNA, which enous dsRNA to siRNA maturing there from is higher in the coats the seed, may penetrate the seed or the seedling during seed as compared to a transgenic seed recombinantly express germination. The incubation takes place in the dark at 4-28° ing said exogenous dsRNA. C. or 15-22°C. (e.g., 8-15°C., 4-8°C., 22-28°C.). 0281. As used herein the term “higher refers to at least 0268. In one embodiment, the dipping time may be about 3%. 5%, 7%, 10%, 15%, 20%, 25%, 30%, 50%, 60%, between 1 and 60, between 2 and 60, between 5 and 60, 70%, 80%, 90% or even a few folds higher. US 2014/0230.090 A1 Aug. 14, 2014 22
0282. According to an alternative oran additional embodi 0297. The phrase "abiotic stress' as used herein refers to ment, there is provided an isolated seed comprising an exog any adverse effect on metabolism, growth, viability and/or enous dsRNA, wherein the plant seed is devoid of a heterolo reproduction of a plant. Abiotic stress can be induced by any gous promoter for driving expression of said exogenous of Suboptimal environmental growth conditions such as, for dsRNA, wherein a spatial distribution of said exogenous example, water deficit or drought, flooding, freezing, low or dsRNA and/or siRNA maturing there from is altered in the high temperature, strong winds, heavy metal toxicity, anaero seed as compared to same in a transgenic seed recombinantly biosis, high or low nutrient levels (e.g. nutrient deficiency), expressing said exogenous dsRNA. high or low salt levels (e.g. salinity), atmospheric pollution, 0283. The term “recombinantly expressing refers to an high or low light intensities (e.g. insufficient light) or UV expression from a nucleic acid construct. irradiation. Abiotic stress may be a short term effect (e.g. 0284. According to a further embodiment there is pro acute effect, e.g. lasting for about a week) or alternatively vided a plant seed obtainable (or obtained) by any of the may be persistent (e.g. chronic effect, e.g. lasting for example methods described herein. 10 days or more). The present invention contemplates situa 0285 Methods of qualifying successful introduction of tions in which there is a single abiotic stress condition or the dsRNA include but are not limited to, RT-PCR (e.g., alternatively situations in which two or more abiotic stresses quantifying the level of the target gene or the naked dsRNA), OCCU. phenotypic analysis such as biomass, vigor, yield and stress 0298. According to one embodiment, the abiotic stress tolerance, root architecture, leaf dimensions, grain size and refers to salinity. weight, oil content, cellulose, as well as cell biology tech 0299. According to another embodiment, the abiotic stress niques. refers to drought. 0286 According to some embodiments, an alteration of 0300. According to another embodiment, the abiotic stress the expression level of the plant ortholog of the insect pest refers to a temperature stress. gene targeted by the seed treatment, as described herein, is 0301 As used herein the phrase “abiotic stress tolerance' observed. See for instance Examples 45 and 46 of the refers to the ability of a plant to endure an abiotic stress Examples section which follows. without exhibiting Substantial physiological or physical dam 0287. Seeds may be stored for 1 day to several months age (e.g. alteration in metabolism, growth, viability and/or prior to planting (e.g., at 4-10°C.). reproducibility of the plant). 0288 The resultant seed can be germinated in the dark so 0302 As used herein the phrase “nitrogen use efficiency as to produce a plant. (NUE)” refers to a measure of crop production per unit of 0289 Thus there is provided a plant or plant part compris nitrogen fertilizer input. Fertilizer use efficiency (FUE) is a ing an exogenous naked dsRNA and devoid of a heterologous measure of NUE. Crop production can be measured by bio promoter for driving expression of the dsRNA in the plant. mass, vigor or yield. The plant's nitrogen use efficiency is 0290. As used herein “devoid of a heterologous promoter typically a result of an alteration in at least one of the uptake, for driving expression of the dsRNA' means that the plant or spread, absorbance, accumulation, relocation (within the plant cell doesn't include a cis-acting regulatory sequence plant) and use of nitrogen absorbed by the plant. Improved (e.g., heterologous) transcribing the dsRNA in the plant. As NUE is with respect to that of a non-transgenic plant (i.e., used herein the term "heterologous” refers to exogenous, lacking the transgene of the transgenic plant) of the same not-naturally occurring within the native plant cell (such as by species and of the same developmental stage and grown under position of integration, or being non-naturally found within the same conditions. the plant cell). Thus the isolated seed in the absence of a 0303 As used herein the phrase “nitrogen-limiting condi heterologous promotersequence for driving expression of the tions' refers to growth conditions which include a level (e.g., dsRNA in the plant, comprises a homogenic (prior to ampli concentration) of nitrogen (e.g., ammonium or nitrate) fication) or heterogenic (secondary siRNAS, following ampli applied which is below the level needed for optimal plant fication) population of plant non-transcribable dsRNA. metabolism, growth, reproduction and/or viability. 0291. The present methodology can be used for modulat 0304. As used herein the term/phrase “biomass”, “biom ing gene expression Such as in a plant, the method compris ass of a plant’ or “plant biomass” refers to the amount (e.g., ing: measured ingrams of air-dry tissue) of a tissue produced from 0292 (a) contacting a seed of the plant with a naked the plant in a growing season. An increase in plant biomass dsRNA, under conditions which allow penetration of the can be in the whole plant or in parts thereof such as above dsRNA into the seed, thereby introducing the dsRNA into the ground (e.g. harvestable) parts, vegetative biomass, roots seed; and optionally and/or seeds or contents thereof (e.g., oil, starch etc.). 0293 (b) generating a plant of the seed. 0305 As used herein the term/phrase “vigor”, “vigor of a 0294. When used for down-regulating a plant gene, the plant’ or “plant vigor” refers to the amount (e.g., measured by naked dsRNA is designed of the desired specificity using weight) of tissue produced by the plant in a given time. bioinformatic tools which are well known in the art (e.g., Increased vigor could determine or affect the plant yield or BLAST). the yield per growing time or growing area. In addition, early 0295) This methodology can be used in various applica vigor (e.g. seed and/or seedling) results in improved field tions starting from basic research Such as in order to assess stand. gene function and lasting in generating plants with altered (0306. As used herein the term/phrase "yield”, “yield of a traits which have valuable commercial use. plant’ or “plant yield’ refers to the amount (e.g., as deter 0296 Such plants can exhibit agricultural beneficial traits mined by weight or size) or quantity (e.g., numbers) of tissues including altered morphology, altered flowering, altered tol or organs produced perplant or per growing season. Increased erance to stress (i.e., biotic and/or abiotic), altered biomass yield of a plant can affect the economic benefit one can obtain vigor and/or yield and the like. from the plant in a certain growing area and/or growing time. US 2014/0230.090 A1 Aug. 14, 2014
0307 According to one embodiment, the yield is mea 0316. As used herein, the term “phytopathogen refers to Sured by cellulose content, oil content, starch content and the an organism that benefits from an interaction with a plant, and like. has a negative effect on that plant. The term "phytopathogen 0308 According to another embodiment, the yield is mea includes insects, arachnids, crustaceans, fungi, bacteria, sured by oil content. viruses, nematodes, flatworms, roundworms, pinworms, 0309 According to another embodiment, the yield is mea hookworms, tapeworms, trypanosomes, Schistosomes, bot Sured by protein content. flies, fleas, ticks, mites, and lice and the like that may ingest or 0310. According to another embodiment, the yield is mea contact one or more cells, tissues, or fluids produced by a sured by seed number, seed weight, fruit number or fruit plant. weight per plant or part thereof (e.g., kernel, bean). 0317. The methods described herein can be used to gen 0311 A plant yield can be affected by various parameters erate a plant that is resistant to one or more phytopathogens. including, but not limited to, plant biomass; plant vigor, plant In some embodiments, the phytopathogen is an insect pest. growth rate; seed yield; seed or grain quantity; seed or grain When an insect is the target pest for the present invention, quality; oil yield; content of oil, starch and/or protein in such pests include but are not limited to: from the order harvested organs (e.g., seeds or vegetative parts of the plant); Lepidoptera, for example, Acleris spp., Adoxophyes spp., number of flowers (e.g. florets) per panicle (e.g. expressed as Aegeria spp., Agrotis spp., Alabama argillaceae, Amylois a ratio of number of filled seeds over number of primary spp., Anticarsia gemmatalis, Archips spp., Argyrotaenia spp., panicles); harvest index; number of plants grown per area; Autographa spp., Busseola fisca, Cadra cautella, Carposina number and size of harvested organs per plant and per area; nipponensis, Chilo spp., Choristoneura spp., Clysia ambig number of plants per growing area (e.g. density); number of uella, Cnaphalocrocis spp., Cnephasia spp., Cochylis spp., harvested organs in field; total leaf area; carbon assimilation Coleophora spp., Crocidolomia binotalis, Cryptophlebia leu and carbon partitioning (e.g. the distribution/allocation of cotreta, Cydia spp., Diatraea spp., Diparopsis Castanea, Ear carbon within the plant); resistance to shade; number of har ias spp., Ephestia spp., Eucosma spp., Eupoecilia ambig Vestable organs (e.g. seeds), seeds per pod, weight per seed; uella, Euproctis spp., Euxoa spp., Grapholita spp., Hedva and modified architecture Such as increase stalk diameter, nubiferana, Heliothis spp., Hellula undalis, Hyphantiria thickness or improvement of physical properties (e.g. elastic cunea, Keiferia lycopersicella, Leucoptera scitella, Lithocol ity). lethis spp., Lobesia botrana, Lymantria spp., Lyonetia spp., 0312 Improved plant NUE is translated in the field into Malacosoma spp., Mamestra brassicae, Manduca sexta, either harvesting similar quantities of yield, while imple Operophtera spp., Ostrinia Nubilalis, Pammene spp., Pande menting less fertilizers, or increased yields gained by imple mis spp., Panolis flammea, Pectinophora gossypiella, menting the same levels of fertilizers. Thus, improved NUE Phthorimaea operculella, Pieris rapae, Pieris spp., Plutella or FUE has a direct effect on plant yield in the field. xylostella, Prays spp., Scirpophaga spp., Sesamia spp., Spar 0313 As used herein “biotic stress' refers stress that ganothis spp., Spodoptera spp., Synanthedon spp., Thaume occurs as a result of damage done to plants by other living topoea spp., Tortrix spp., Trichoplusia ni and Yponomeuta organisms, such as bacteria, viruses, fungi, parasites, benefi spp.; from the order Coleoptera, for example, Agriotes spp., cial and harmful insects, weeds, and cultivated or native Anthonomus spp., Atomaria linearis, Chaetocnema tibialis, plants. Examples 7, and 20-38 of the Examples section which Cosmopolites spp., Curculio spp., Denrmestes spp., follows, describes implementation the present teachings Diabrotica spp., Epillachna spp., Eremnus spp., Leptinotarsa towards conferring resistance to Spodoptera littoralis. decemlineata, Lissorhoptrus spp., Melolontha spp., Orycae Examples 38 and 39 of the Examples section which follows, philus spp., Otiorhynchus spp., Phlyctinus spp., Popillia spp., describes implementation the present teachings towards con Psylliodes spp., Rhizopertha spp., Scarabeidae, Sitophilus ferring resistance to Coleopteran pests. Examples 40-52 of spp., Sitotroga spp., Tenebrio spp., Tribolium spp. and Tro the Examples section which follows, describes implementa goderma spp.; from the order Orthoptera, for example, Blatta tion the present teachings towards conferring resistance to spp., Blattella spp., Gryllotalpa spp., Leucophaea maderae, viral infection. Locusta spp., Periplaneta ssp., and Schistocerca spp.; from 0314. As used herein the term “improving or “increas the order Isoptera, for example, Reticulitenes ssp. from the ing refers to at least about 2%, at least about 3%, at least order Psocoptera, for example, Liposcelis spp.; from the order about 4%, at least about 5%, at least about 10%, at least about Anoplura, for example, Haematopinus spp., Linognathus 15%, at least about 20%, at least about 25%, at least about spp., Pediculus spp., Pemphigus spp. and Phylloxera spp.; 30%, at least about 35%, at least about 40%, at least about from the order Mallophaga, for example, Damalinea spp. and 45%, at least about 50%, at least about 60%, at least about Trichodectes spp.; from the order Thysanoptera, for example, 70%, at least about 80%, at least about 90% or greater Franklinella spp., Hercinothrips spp., Taeniothrips spp., increase in NUE, in tolerance to stress, in yield, in biomass or Thrips palmi, Thrips tabaci and Scirtothrips aurantii; from in vigor of a plant, as compared to a native or wild-type plants the order Heteroptera, for example, Cimex spp., Distantiella i.e., isogenic plants (not grown from seeds treated with theobroma, Dysdercus spp., Euchistus spp., Eurygaster spp., dsRNA) of the present embodiments. Leptocorisa spp., Nezara spp., Piesma spp., Rhodnius spp., 0315. In some embodiments, the target gene of the dsRNA Sahlbergella singularis, Scotinophara spp., Triatoma spp., may not be an endogenous plant gene but rather a gene exog Miridae family spp. Such as Lygus hesperus and Lygus lin enous to the plant, such as a gene of a phytopathogenic eoloris, Lygaeidae family spp. Such as Blissus leucopterus, organism which feeds on the plant or depends thereon for and Pentatomidae family spp.; from the order Homoptera, for growth/replication (e.g., bacteria or viruses) and/or Survival. example, Aleurothrixus floccosus, Aleyrodes brassicae, In some embodiments, the target gene is an essential gene of Aonidiella spp., Aphididae, Aphis spp., Aspidiotus spp., an insect pest. In some embodiments, the target gene is a viral Bemisia tabaci, Ceroplaster spp., Chrysomphalus aonidium, gene. Chrysomphalus dictyospermi, Coccus hesperidum, US 2014/0230.090 A1 Aug. 14, 2014 24
Empoasca spp., Eriosoma larigerum, Erythroneura spp., etables, P. brachyurus which infects pineapple and P thornei Gascardia spp., Laodelphax spp., Lacanium corni, Lepi which infects interalia, wheat. dosaphes spp., Macrosiphus spp., Myzus spp., Nehotettix 0320 Several embodiments relate to a method of inhibit spp., Nilaparvata spp., Paratoria spp., Pemphigus spp., ing expression of a target gene in an insect pest, the method Planococcus spp., Pseudaulacaspis spp., Pseudococcus spp., comprising providing (e.g., feeding) to the insect pest a plant Psylla spp., Pulvinaria aethiopica, Ouadraspidiotus spp., grown from a seed treated with an exogenous dsRNA as Rhopalosiphum spp., Saissetia spp., Scaphoideus spp., described herein, thereby inhibiting expression of the target Schizaphis spp., Sitobion spp., Trialeurodes vaporariorum, gene in the insect pest. Insects that may cause damage and Trioza erytreae and Unaspis citri: from the order disease in plants belong to three categories, according to their Hymenoptera, for example, Acromyrmex, Atta spp., Cephus method offeeding: chewing, Sucking and boring. Major dam spp., Diprion spp., Diprionidae, Gilpinia polytoma, Hoplo age is caused by chewing insects that eat plant tissue, Such as campa spp., Lasius spp., Monoimorium pharaonis, Neodip leaves, flowers, buds and twigs. Examples from this large rion spp., Solenopis spp. and Vespa ssp. from the order insect category include beetles and their larvae (grubs), web Diptera, for example, Aedes spp., Antherigona soccata, Bibio worms, bagworms and larvae of moths and sawflies (cater hortulanus, Caliphora erythrocephala, Ceratitis spp., Chry pillars). By comparison, sucking insects insert their mouth somyia spp., Culex spp., Cuterebra spp., Dacus spp., Droso parts into the tissues of leaves, twigs, branches, flowers or phila melanogaster, Fannia spp., Gastrophilus spp., Glossina fruit and Suck out the plant's juices. Typical examples of spp., Hypoderma spp., Hippobosca spp., Lirionysa spp., Sucking insects include but are not limited to aphids, mealy Lucilia spp., Melanagromyza spp., Musca S.Sp., Oestrus spp., bugs, thrips and leaf-hoppers. Damage caused by these pests Orseolia spp., Oscinella fit, Pegomyia hyoscyami, Phorbia is often indicated by discoloration, drooping, wilting and spp., Rhagoletis pomonella, Sciara spp., Stomoxys spp., general lack of vigor in the affected plant. 0321 Several embodiments relate to a method of provid Tabanus spp., Tannia spp. and Tipula spp., from the order ing resistance to an insect pest, the method comprising grow Siphonaptera, for example, Ceratophyllus spp. and Xenop ing a plant from a seed treated with an exogenous dsRNA as sylla cheopis and from the order Thysanura, for example, described herein. In some embodiments, the insect pest is Lepisma saccharina. Thus, according to one embodiment, selected from the orders Coleoptera, Lepidoptera, Diptera, there is provided a method of inhibiting expression of a target Orthoptera, Heteroptera, Ctenophalides, Arachnidiae, and gene in a phytopathogenic organism, the method comprising Hymenoptera. In some embodiments, the insect pest is a providing (e.g., feeding or contacting under infecting condi beetle or larvae. According to a specific embodiment, the tions) to the phytopathogenic organism the plantas described phytopathogen is prodentia of the family Noctuidae e.g., herein (at least part thereof includes the naked dsRNA), thereby inhibiting expression of a target gene in the phyto Spodoptera littoralis. pathogenic organism. In some embodiments, the target gene 0322 Examples of significant bacterial plant pathogens is an “essential gene. As used herein, the term "essential include, but are not limited to, Burkholderia, Proteobacteria gene' refers to a gene of an organism that is essential for its (Xanthomonas spp. and Pseudomonas spp., Pseudomonas Survival or reproduction. In some embodiments, the target syringae pv. tomato). gene is expressed in the insect gut, for example, V-ATPase. In 0323) A number of virus genera are transmitted, both per Some embodiments, the target gene is involved in the growth, sistently and non-persistently, by soil borne Zoosporic proto development, and reproduction of an insect. Examples of Zoa. These protozoa are not phytopathogenic themselves, but parasitic. Transmission of the virus takes place when they Such genes include, but are not limited to, CHD3 gene and a become associated with the plant roots. Examples include beta-tubulin gene. Polymyxa graminis, which has been shown to transmit plant 0318. The phytopathogenic organism refers to a multicel viral diseases in cereal crops and Polymyxa betae which trans lular organism e.g., insects, fungi, animals or a microorgan mits Beet necrotic yellow vein virus. Plasmodiophorids also ism that can cause plant disease, including viruses, bacteria, create wounds in the plant's root through which other viruses fungi as well as oomycetes, chytrids, algae, and nematodes. can enter. 0319 Reference herein to a “nematode” refers to a mem 0324 Specific examples of viruses which can be targeted ber of the phylum Nematoda. Members of the family Hetero according to the present teachings include, but are not limited deridae are sedentary parasites that form elaborate permanent tO: associations with the target host organism. They deprive 0325 (1) Tobacco mosaic virus (TMV. RNA virus) which nutrients from cells of an infected organism through a spe infects plants, especially tobacco and other members of the cialized stylet. The cyst nematodes (genera Heterodera and family Solanaceae. Globodera) and root-knot nematodes (genus Meliodogyne), 0326 (2) Tomato spotted wilt virus (TSWV. RNA virus) in particular, cause significant economic loss in plants, espe which causes serious diseases of many economically impor cially crop plants. Examples of cyst nematodes include, inter tant plants representing 35 plant families, including dicots alia, H. avenae (cereal cyst nematodes), H. glycines (beet cyst and monocots. This wide host range of ornamentals, Veg nematode) and G. pallida (potato cyst nematode). Root-knot etables, and field crops is unique among plant-infecting nematodes include, for example, M. javanica, M. incognita viruses. Belongs to tospoviruses in the Mediterranean area, and M. arenaria. These pathogens establish “feeding sites” in affect vegetable crops, especially tomato, pepper and lettuce the plant, by causing the morphological transformation of (Turina et al., 2012, Adv. Virus Res 84; 403-437). root cells into giant cells. Hence, nematode “infestation” or 0327 (3) Tomato yellow leafcurl virus (TYLCV) which is “infection” refers to invasion of and feeding upon the tissues transmitted by whitefly, mostly affects tomato plants. Gemi of the host plant. Other nematodes that cause significant niviruses (DNA viruses) in the genus Begomovirus (includ damage include the lesion nematodes Such as Pratylenchus, ing Sweepoviruses and legumoviruses)—most devastating particularly P. penetrans, which infects maize, rice and Veg pathogens affecting a variety of cultivated crops, including US 2014/0230.090 A1 Aug. 14, 2014
cassava, Sweet potato, beans, tomato, cotton and grain 0346 Insect pests causing plant disease include those legumes (Rey et al. 2012, Viruses 4; 1753-1791). Members from the families of for example, Apidae, Curculionidae, include TYLCV above and tomato leaf curl virus (ToICV). Scarabaeidae, Tephritidae, Tortricidae, amongst others. 0328 (4) Cucumber mosaic virus (CMV) CMV has a 0347 The target gene of the phytopathogenic organism wide range of hosts and attacks a great variety of vegetables, encodes a product essential to the viability and/or infectivity ornamentals, and other plants (as many as 191 host species in of the pathogen, therefore its down-regulation (by the naked 40 families). Among the most important vegetables affected dsRNA) results in a reduced capability of the pathogen to by cucumber mosaic are peppers (Capsicum annuum L.), Survive and infect host cells. Hence, Such down-regulation cucurbits, tomatoes (Lycopersicon esculentum Mill.), and results in a “deleterious effect” on the maintenance viability bananas (Musa L. spp.). and/or infectivity of the phytopathogen, in that it prevents or 0329. Other vegetable hosts include: cucumber, musk reduces the pathogen's ability to feed off and survive on melon, squash, tomato, spinach, celery, peppers, water cress, nutrients derived from host cells. By virtue of this reduction in beet, Sweet potato, turnip, chayote, gherkin, watermelon, the phytopathogen's viability and/or infectivity, resistance pumpkin, citron, gourd, lima bean, broad bean, onion, and/or enhanced tolerance to infection by a pathogen is facili ground-cherry, eggplant, potato, rhubarb, carrot, dill, fennel, tated in the cells of the plant. Genes in the pathogen may be parsnip, parsley, loofah, and artichoke (Chabbouh and targeted at the mature (adult), immature (juvenile) or embryo Chemf, 1990, FAO Plant Prot. Bull. 38:52-53.). Stages. 0330. Ornamental hosts include: China aster, chrysanthe 0348 Examples of genes essential to the viability and/or mum, delphinium, Salvia, geranium, gilia, gladiolus, helio infectivity of the pathogen are provided herein. Such genes trope, hyacinth, larkspur, lily, marigold, morning glory, nas may include genes involved in development and reproduc turtium, periwinkle, petunia, phlox, Snapdragon, tulip, and tion, e.g. transcription factors (see, e.g. Xue et al., 1993; Zinnia (Chupp and Sherf, 1960; Agrios, 1978). Finney et al., 1988), cell cycle regulators such as wee-1 and 0331 (5) Potato virus Y (PVY)– one of the most impor incc-1 proteins (see, e.g. Wilson et al., 1999; Boxem et al., tant plant viruses affecting potato production. 1999) and embryo-lethal mutants (see, e.g. Schnabel et al., 0332 (6) Cauliflower mosaic virus (CaMV, DNA virus 1991); proteins required for modeling such as collagen, ChR3 (Rothnie et al., 1994)). and LRP-1 (see, e.g. Yochem et al., 1999; Kostrouchova et al., 0333 (7) African cassava mosaic virus (ACMV). 1998; Ray et al., 1989); genes encoding proteins involved in 0334 (8) Plum pox virus (PPV) is the most devastating the motility/nervous system, e.g. acetycholinesterase (see, viral disease of stone fruit from the genus Prunus. e.g. Piotee et al., 1999; Talesa et al., 1995; Arpagaus et al., 0335 (9) Brome mosaic virus (BMV)—commonly 1998), ryanodine receptor such as unc-68 (see, e.g. Maryonet infects Bromus inermis and other grasses, can be found al., 1998; Maryonet al., 1996) and glutamate-gated chloride almost anywhere wheat is grown. channels or the avermeetin receptor (see, e.g., Cully et al., 0336 (10) Potato virus X (PVX) There are no insect or 1994; Vassilatis et al., 1997: Dent et al., 1997); hydrolytic fungal vectors for this virus. This virus causes mild or no enzymes required for deriving nutrition from the host, e.g. symptoms in most potato varieties, but when Potato virus Y is serine proteinases such as HGSP-1 and HGSP-III (see, e.g. present, synergy between these two viruses causes severe Lilley et al., 1997); parasitic genes encoding proteins symptoms in potatoes. required for invasion and establishment of the feeding site, 0337 Additional Viruses: e.g. cellulases (see, e.g. de Boer et al., 1999; Rosso et al., 0338 Citrus tristeza virus (CTV)—causes the most eco 1999) and genes encoding proteins that direct production of nomically damaging disease to Citrus, including sour orange stylar or amphidial secretions such as Sec-1 protein (see, e.g. (Citrus aurantium), and any Citrus species grafted onto Sour Ray et al., 1994: Ding et al., 1998); genes encoding proteins orange root Stock, Sweet orange (C. sinensis), grapefruit (C. required for sex or female determination, e.g. tra-1, tra-2 and paradisi), lime and Seville orange (C. aurantifolia), and man egl-1, a Suppressor of ced9 (see, e.g. Hodgkin, 1980; darin (C. reticulata). CTV is also known to infect Aegilopsis Hodgkin, 1977; Hodgkin, 1999; Gumienny et al., 1999; chevalieri, Afraegle paniculata, Pamburus missionis, and Zarkower et al., 1992); and genes encoding proteins required Passiflora gracilis. CTV is distributed worldwide and can be for maintenance of normal metabolic function and homeosta found wherever citrus trees grow. sis, e.g. Sterol metabolism, embryo lethal mutants (see, e.g. 0339 Barley yellow dwarf virus (BYDV)—most widely Schnabel et al., 1991) and trans-spliced leader sequences distributed viral disease of cereals. It affects the economically (see, e.g. Ferguson et al., 1996), pos-1, cytoplasmic Zn finger important crop species barley, oats, wheat, maize, triticale protein; pie-1, cytoplasmic Zn finger protein; mei-1, ATPase; and rice. dif-1, mitochondrial energy transfer protein, rba-2, chromatin (0340 Potato leafroll virus (PLRV) infects potatoes and assembly factor, skin-1, transcription factor, plk-1, kinase; other members of the family Solanaceae. gpb-1, G-protein B subunit; par-1, kinase; bir-1, inhibitor of (0341 Tomato bushy stunt virus (TBSV), RNA virus, a apoptosis; mex-3, RNA-binding protein, unc-37, G-protein B member of the genus Tombusvirus and mostly affects toma Subunit; hlh-2, transcription factor, par-2, dnc-1, dynactin; toes and eggplant. par-6, dhc-1, dynein heavy chain; and pal-1, homeobox. Such 0342. Additional Reviews: genes have been cloned from parasitic nematodes such as 0343 Hamilton et al., 1981, J Gen Virol 54; 223-241– Meliodogyne and Heterodera species or can be identified by mentions TMV, PVX, PVY, CMV, CaMV. one of skill in the art using sequence information from cloned 0344. Additional Scientific Papers: C. elegans orthologs (the genome of C. elegans has been (0345 Makkouk et al., 2012, Adv Virus Res 84; 367-402 sequenced and is available, see The C. elegans Sequencing Viruses affecting peas and beans with narrow (Faba bean Consortium (1998)). necrotic yellow virus (FBNYN)) and wide (alfalfa mosaic 0349. Several embodiments relate to a method of confer virus (AMV) and CMV) host range. ring pathogen resistance on a plant, the method comprising US 2014/0230.090 A1 Aug. 14, 2014 26 contacting a seed with an exogenous dsRNA molecule com 0355. When it is said that some effects are “synergistic,” it prising a sequence that is essentially identical or essentially is meant to include the synergistic effects of the combination complementary to at least 18 contiguous nucleotides of a on the pesticidal activity (or efficacy) of the combination of gene of a phytopathogenic organism, and growing a plant the bioactivity of a plant grown from a dsRNA treated seed from the seed. As used herein, a “pathogen resistance' trait is and the pesticide. However, it is not intended that such syn a characteristic of a plant that causes the plant host to be ergistic effects be limited to the pesticidal activity, but that resistant to attack from a pathogen that typically is capable of they should also include Such unexpected advantages as inflicting damage or loss to the plant. Not wishing to be bound increased scope of activity, advantageous activity profile as by a particular theory, once the phytopathogen is provided related to type and amount of damage reduction, decreased with the plant material produced from a seed comprising the cost of pesticide and application, decreased pesticide distri naked dsRNA, expression of the gene within the target patho bution in the environment, decreased pesticide exposure of gen is Suppressed, and the Suppression of expression of the personnel who produce, handle and plant seeds, and other gene in the target pathogen results in the plant being resistant advantages known to those skilled in the art. to the pathogen. 0356. In addition, plants generated according to the teach 0350. In the embodiments described herein, the target ings of the present embodiments or parts thereof can exhibit gene can encode an essential protein or transcribe an non altered nutritional or therapeutic efficacy and as such can be coding RNA which, the predicted function is for example employed in the food or feed and drug industries. Likewise, selected from the group consisting of ion regulation and trans the plants generated according to the teachings of the present port, enzyme synthesis, maintenance of cell membrane embodiments or parts thereof can exhibit altered oil or cellu potential, amino acid biosynthesis, amino acid degradation, lose content and as such can be implemented in the construc development and differentiation, infection, penetration, tion or oil industry. development of appressoria or haustoria, mycelial growth, 0357 The seeds of the present invention can be packed in melanin synthesis, toxin synthesis, siderophore synthesis, a seed containing device which comprises a plurality of seeds sporulation, fruiting body synthesis, cell division, energy at least Some of which (e.g., 5%, 10% or more) containing an metabolism, respiration, and apoptosis, among others. exogenous naked dsRNA, wherein the seed is devoid of a 0351. According to a specific embodiment, the phyto heterologous promoter for driving expression of the dsRNA. pathogenic organism is selected from the group consisting of 0358. The seed containing device can be a bag, a plastic a fungus, a nematode, a virus, a bacteria and an insect. bag, a paper bag, a soft shell container or a hard shell con 0352 To substantiate the anti-pest activity, the present tainer. teachings also contemplate observing death or growth inhi 0359. Several embodiments described herein relate to a bition and the degree of host symptomotology following said Solution for treating seeds comprising a non-transcribable providing. polynucleotide trigger, for example dsRNA, molecule com 0353 To improve the anti-phytopathogen activity, prising a sequence that is essentially complementary or embodiments of the present invention further provide a com essentially identical to at least 18 contiguous nucleotides of a position that contains two or more different agents each toxic target gene. In some embodiments, the solution may further to the same plant pathogenic microorganism, at least one of comprise buffer, for example, EDTA. As used herein “solu which comprises a dsRNA described herein. In certain tion” refers to homogeneous mixtures and non-homogeneous embodiments, the second agent can be an agent selected from mixtures such as Suspensions, colloids, micelles, and emul the group consisting of inhibitors of metabolic enzymes sions. In some embodiments, the solution may be provided in involved in amino acid or carbohydrate synthesis; inhibitors a kit. In some embodiments, the kit may further comprises of cell division; cell wall synthesis inhibitors; inhibitors of one or more of seeds, containers, priming solution, and seed DNA or RNA synthesis, gyrase inhibitors, tubulin assembly growth medium. inhibitors, inhibitors of ATP synthesis: oxidative phosphory 0360 Reagents of the present invention can be packed in a lation uncouplers; inhibitors of protein synthesis: MAP kit including the non-transcribable polynucleotide trigger, for kinase inhibitors; lipid synthesis or oxidation inhibitors; ste example dsRNA, molecule, instructions for introducing the rol synthesis inhibitors; and melanin synthesis inhibitors. non-transcribable polynucleotide trigger, for example 0354. In some embodiments, a seed comprising an exog dsRNA, molecule into the seeds and optionally a priming enous dsRNA as described herein is treated with a non-poly Solution. nucleotide pesticide. It is believed that the combination of a 0361 Compositions of some embodiments of the inven plant exhibiting bioactivity against a target pest as a result of tion may, if desired, be presented in a pack or dispenser treating the seed from which the plant is grown with an device, which may contain one or more dosage forms con exogenous dsRNA coupled with treatment of the seed with taining the active ingredient. The pack may, for example, certain chemical or protein pesticides provides unexpected comprise metal or plastic foil. Such as ablisterpack. The pack synergistic advantages to seeds having Such treatment, or dispenser device may be accompanied by instructions for including unexpectedly Superior efficacy for protection introduction to the seed. against damage to the resulting plant by the target pest. The 0362 According to one embodiment, the non-transcrib seeds of the present embodiments are believed to have the able polynucleotide trigger, for example dsRNA, molecule property of decreasing the cost of pesticide use, because less and priming solution are comprised in separate containers. of the pesticide can be used to obtain a required amount of 0363 As used herein the term “about refers to +10%. protection than if the innovative composition and method is 0364 The terms “comprises.” “comprising.” “includes.” not used. Moreover, because less pesticide is used it is “including.” “having and their conjugates mean “including believed that the subject method is therefore safer to the but not limited to.” operator and to the environment, and is potentially less expen 0365. The term “consisting of means “including and lim sive than conventional methods. ited to US 2014/0230.090 A1 Aug. 14, 2014 27
0366. The term “consisting essentially of means that the include molecular, biochemical, microbiological and recom composition, method or structure may include additional binant DNA techniques. Such techniques are thoroughly ingredients, steps and/or parts, but only if the additional explained in the literature. See, for example, “Molecular ingredients, steps and/or parts do not materially alter the basic Cloning: A laboratory Manual Sambrook et al., (1989); and novel characteristics of the claimed composition, method Or Structure. “Current Protocols in Molecular Biology” Volumes I-III 0367. As used herein, the singular form “a”“an” and “the Ausubel, R. M., ed. (1994); Ausubel et al., “Current Protocols include plural references unless the context clearly dictates in Molecular Biology”, John Wiley and Sons, Baltimore, Md. otherwise. For example, the term “a compound' or “at least (1989); Perbal, “A Practical Guide to Molecular Cloning, one compound may include a plurality of compounds, John Wiley & Sons, New York (1988); Watson et al., “Recom including mixtures thereof. binant DNA, Scientific American Books, New York; Birren 0368. Throughout this application, various embodiments et al. (eds) "Genome Analysis: A Laboratory Manual Series'. of this invention may be presented in a range format. It should Vols. 1-4, Cold Spring Harbor Laboratory Press, New York be understood that the description in range format is merely (1998); methodologies as set forth in U.S. Pat. Nos. 4,666, for convenience and brevity and should not be construed as an 828; 4,683,202: 4,801,531; 5,192,659 and 5,272,057; “Cell inflexible limitation on the scope of the invention. Accord ingly, the description of a range should be considered to have Biology: A Laboratory Handbook'', Volumes I-III Cellis, J. specifically disclosed all the possible Subranges as well as E., ed. (1994): “Culture of Animal Cells—A Manual of Basic individual numerical values within that range. For example, Technique” by Freshney, Wiley-Liss, N.Y. (1994), Third Edi description of a range such as from 1 to 6 should be consid tion: “Current Protocols in Immunology” Volumes I-III Coli ered to have specifically disclosed Subranges Such as from 1 gan J. E., ed. (1994); Stites et al. (eds), “Basic and Clinical to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 Immunology” (8th Edition), Appleton & Lange, Norwalk, to 6 etc., as well as individual numbers within that range, for Conn. (1994); Mishell and Shiigi (eds), “Selected Methods in example, 1, 2, 3, 4, 5, and 6. This applies regardless of the Cellular Immunology”. W. H. Freeman and Co., New York breadth of the range. (1980); available immunoassays are extensively described in 0369. Whenever a numerical range is indicated herein, it is the patent and scientific literature, see, for example, U.S. Pat. meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging/ranges Nos. 3,791,932; 3,839,1533,850,752; 3,850,578; 3,853.987; between a first indicate number and a second indicate num 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; ber and “ranging/ranges from a first indicate number “to a 3.996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and second indicate number are used herein interchangeably and 5,281.521; “Oligonucleotide Synthesis' Gait, M. J., ed. are meant to include the first and second indicated numbers (1984): “Nucleic Acid Hybridization’ Hames, B. D., and and all the fractional and integral numerals there between. Higgins S. J., eds. (1985): “Transcription and Translation' 0370. As used herein the term “method’ refers to manners, Hames, B. D., and Higgins S. J., eds. (1984); 'Animal Cell means, techniques and procedures for accomplishing a given Culture' Freshney, R.I., ed. (1986): “Immobilized Cells and task including, but not limited to, those manners, means, Enzymes' IRL Press, (1986): “A Practical Guide to Molecu techniques and procedures either known to, or readily devel lar Cloning Perbal, B., (1984) and “Methods in Enzymol oped from known manners, means, techniques and proce dures by practitioners of the agronomic, chemical, pharma ogy” Vol. 1-317, Academic Press: “PCR Protocols: A Guide cological, biological, biochemical and medical arts. To Methods And Applications'. Academic Press, San Diego, 0371. It is appreciated that certain features of the inven Calif. (1990); Marshak et al., “Strategies for Protein Purifi tion, which are, for clarity, described in the context of separate cation and Characterization—A Laboratory Course Manual embodiments, may also be provided in combination in a CSHL Press (1996); all of which are incorporated by refer single embodiment. Conversely, various features of the ence as if fully set forth herein. Other general references are invention, which are, for brevity, described in the context of a provided throughout this document. The procedures therein single embodiment, may also be provided separately or in any are believed to be well known in the art and are provided for suitable subcombination or as suitable in any other described the convenience of the reader. All the information contained embodiment of the invention. Certain features described in therein is incorporated herein by reference. the context of various embodiments are not to be considered essential features of those embodiments, unless the embodi ment is inoperative without those elements. Example 1 0372 Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the Protocols for dsRNA Production and Seed Treatment claims section below find experimental support in the follow ing Examples. The following Examples are presented for the 0375 Generating the dsRNA?siRNA Sequences purposes of illustration and should not be construed as limi 0376. The dsRNA sequences were custom-created for tations. each gene using in vitro transcription of PCR products. Part of the mRNA, including either the ORF, 3' UTR or 5' UTR for EXAMPLES which dsRNA to be produced was PCR-amplified using gene 0373) Reference is now made to the following Examples, specific primers, which contain the sequence of the T7 pro which together with the above descriptions illustrate the moter on either side. This product was used as a template for invention in a non limiting fashion. dsRNA production using commercial kits such as the Maxi 0374 Generally, the nomenclature used herein and the Script dsRNA kit (Life Technologies) or T7 High Yield RNA laboratory procedures utilized in the present invention Synthesis kit (NEB). Next, the sample is treated with DNase US 2014/0230.090 A1 Aug. 14, 2014 28
Turbo at 37° C. for 15-30 min followed by phenol treatment Example 2 and nucleic acid precipitation. Next, one of two different - 0 reactions is carried out: (1) dsRNA is ready to use, or (2) Stability of the dsRNA in Seedlings of Rice, Tomato processing of the dsRNA with Dicer (Shortcut RNase 111 and Sorghum. (NEB)) to create small interfering RNAs (siRNA). 0380. As an example for an exogenous gene that is not 0377. Either dsRNA or a combination of dsRNA and present/expressed in plants, the ORFs encoding the replicase siRNA were used for seed treatments as described below and coat protein of CGMMV (accession number AF417242) 0378 General Seed Treatment Protocol for Gene Silenc were used to as targets for dsRNA treatment of plant seeds ing Using a dsRNA?siRNA Mixture using the protocol described in Example 1. Rice, tomato and 0379 Uncoated organic corn seeds were from variety sorghum seeds were washed for 4 hours at 20°C., tomato and popcorn, uncoated organic whole grain rice seeds, organic sorghum were dried at 30° C. and rice at 20°C. for overnight. soybean and wheat seeds were purchased from Nitsat Hadu Seeds were immediately treated at 15° C. with 132.7 ug/ml vdevan (Israel). Fresh tomato seeds were retrieved from M82 dsRNA (final concentration) for 39 hours for rice, 93.8 ug/ml tomato fruits, which are propagated in-house. Uncoated or dsRNA (final concentration) for 48 hours for tomato, and 75 fresh plant seeds were washed with double distilled water ug/ml dsRNA (final concentration) for 40 hours for sorghum. (DDW) prior to treatment for four hours. Next, seeds were (0381 Briefly, the virus-derived ORFs were amplified by dried at 30° C. for 10-16 hours. Following the drying step, PCR with specifically designed forward and reverse primers seeds were treated with a solution containing the dsRNA that contain the T7 sequence (5'-TAATACGACTCACTAT formulation, which is made of dsRNAata final concentration AGGG-3', SEQ ID NO: 1) at their 5' (see Table 1, below). of 40-150 g/ml in 0.1 mM EDTA. Treatment was performed PCR products were purified from agarose gel and since they by gently shaking the seeds in the solution for 24 hours in a carry T7 promoters at both ends they were used as templates dark growth chamber at 15° C. Finally, seeds were washed for T7-dependent in-vitro transcription, resulting in dsRNA twice briefly and planted on soil or dried for 0-30 hours and product of the CGMMV genes. PCR on a housekeeping gene, germinated at 25°C. in a darkgrowth chamber and planted in tubulin, was used as a positive control (forward primer soil or planted directly in soil. Control seeds were treated in a 5'-GGTGCTCTGAACGTGGATG-3' (SEQ ID NO: 2), and similar way, with a formulation that lacked the dsRNA or with reverse primer 5'-CATCATCGCCATCCTCATTCTC-3' non-specific dsRNA. (SEQID NO:3)). TABLE 1. PCR primers served as Templates for in vitro Transcription and detection of CGMMV and CGMMV dsRNA products.
Forward Product primer / Reverse primer/ Wirus Name Name Product Sequence/SEQ ID NO : SEQ ID NO : SEQ ID NO:
1) CGMVW TAATACGACT CACTATAGGGGGTAAGCG TAATACGACT Set 1: CGMMV dsRNA GCATTCTAAACCTCCAAATCGGAGGTTG CACTATAGGG TAATACGACTCA (NCBI product 1 GACTCTGCTTCTGAAGAGTCCAGTTCTGT GGTAAGCGGC CTATAGGGGAAG Accession TTCTTTTGAAGATGGCTTACAATCCGATC ATTCTAAACC/ ACCCTCGAAACT number ACACC TAGCAAACTTATTGCGTTTAGTG (SEO ID NO; 5) AAGCA AF417242) CTTCTTATGTTCCCGTCAGGACTT TACTT (SEQ ID NO : 4) AATTTTCTAGTTGCTTCACAAGGTACCGC CTTCTTATGTT Set 2: TTTCCAGACTCAAGCGGGAAGAGATTCT CCCGTCAGG/ ACTCAGCAGTCG TTCCGCGAGTCCCTGTCTGCGTTACCCTC (SEO ID NO: 7) TAGGATTG/ GTCTGTCGTAGATATTAATTCTAGATTCC (SEQ ID NO : 6) CAGATGCGGGTTTTTACGCTTTCCTCAAC GGTCCTGTGTTGAGGCCTATCTTCGTTTC GCTTCTCAGCTCCACGGATACGCGTAAT AGGGTCATTGAGGTTGTAGATCCTAGCA ATCCTACGACTGCTGAGTCGCTTAACGC CGTAAAGCGTACTGATGACGCGTCTACG GCCGCTAGGGCTGAGATAGATAATTTAA TAGAGTCTATTTCTAAGGGTTTTGATGTT TACGATAGGGCTTCATTTGAAGCCGCGT TTTCGGTAGTCTGGTCAGAGGCTACCAC CTCGAAAGCTTAGTTTCGAGGGTCTTCC CCTATAGTGAGTCGTATTA/ (SEO ID NO: 8) CGMVW TAATACGACT CACTATAGGGGCTTTACC TAATACGACT Set 3: dsRNA GCCACTAAGAACTCTGTACACTCCCTTG CACTATAGGG TAATACGACTCA product 2 CGGGTGGTCTGAGGCTTCTTGAATTGGA GCTTTACCGC CTATAGGGCATC ATATATGATGATGCAAGTGCCCTACGGC CACTAAGAAC/ ACCATCGACCCT TCACCTTGTTATGACATCGGCGGTAACT (SEQ ID NO: 1.O) AAAC/ ATACGCAGCACTTGTTCAAAGGTAGATC (SEO ID NO: 9) ATATGTGCATTGCTGCAATCCGTGCCTA GATCTTAAAGATGTTGCGAGGAATGTGA TGTACAACGATATGATCACGCAACATGT ACAGAGGCACAAGGGATCTGGCGGGTG CAGACCTCTTCCAACTTTCCAGATAGAT GCATTCAGGAGGTACGATAGTTCTCCCT GTGCGGT CACCTGTTCAGACGTTTTCCA US 2014/0230.090 A1 Aug. 14, 2014 29
TABLE 1 - Continued PCR primers served as Templates for in vitro Transcription and detection of CGMMV and CGMMV dsRNA products.
Forward Product primer/ Reverse primer/ Wirus Name Name Product Sequence/SEQ ID NO : SEQ ID NO : SEQ ID NO :
AGAGTGTTCCTATGATTTTGGGAGTGGT AGGGATAATCATGCAGTCTCGTTGCATT CAATCTACGATATCCCTTATTCTTCGATC GGACCTGCTCTTCATAGGAAAAATGTGC GAGTTTGTTATGCAGCCTTTCATTTCTCG GAGGCATTGCTTTTAGGTTCGCCTGTAG GTAATTTAAATAGTATTGGGGCTCAGTT TAGGGTCGATGGTGATGCCCTATAGTGA GTCGTATTA/ (SEO ID NO : 11
0382 dsRNA homologous to green mottle mosaic virus is TABLE 2 - continued stable in rice seedlings. Rice seeds were treated at 15°C. with 132.7 ug/ml dsRNA (final concentration) for 39 hours and Tubulin Primers Used for PCR. Amplification. dsRNA was detected. At one week post germination, dsRNA was detectable in 9 out of 10 seedlings. Detection of tubulin Primer Name and Primer Sequence/ Primer cDNA served as a positive control for the cDNA quality. At Direction (SEQ ID NO: ) Length two weeks post germination, dsRNA is detectable in 10 out of 10 seedlings. At 3 weeks post germination, dsRNA homolo osa TubA11342R CATCATCGCCATCCTCATTCTC 22 gous to green mottle mosaic virus is detected in 5 out of 5 (SEQ ID NO: 13) samples in rice seedlings 0383 Tomato seeds were treated at 15°C. with 93.8 g/ml dsRNA (final concentration) for 48 hours and sorghum seeds treated at 5 g/ml dsRNA (final concentration) for 40 hours. Example 4 CGMMV dsRNA was detected by RT-PCR in 5 out of 13 tomato seedlings tested at 10 day post-germination and 3 out of four Sorghum seedlings 4 weeks after germination. Exogenous dsRNA Molecules are Highly Stable in 0384 The exogenous dsRNA was found to be stable for at Solution and do not Get Incorporated into the least three weeks in rice seedlings and at least 10 days in Genome of Treated Plants tomato seedlings and four weeks in Sorghum plants. 0387 Corn seeds were treated using the protocol Example 3 described in Example 1, seeds were washed for 4 hat 20°C., dried at 30° C. overnight and immediately treated with 40 The dsRNA is not Integrated into the Genome of ug/ml dsRNA (final concentration) directed against the B-glu Rice curonidase (GUS) reporter gene for 60 hours at 15°C., dried 0385 Rice seeds were treated with an exogenous dsRNA and were germinated. Leaves and roots were harvested from as in Example 2. Plants were germinated and grown for five control and dsGUS-treated plants 7 and 15 days following weeks, DNA was extracted and PCR reactions were per germination. RNA was extracted from the harvested tissues formed to demonstrate that the dsRNA did not integrate into and RT-PCR with specific GUS primers was run (Table 3). In the rice's genome. Two sets of primers that gave a positive addition, a corn endogenous housekeeping gene (ubiquitin) reaction when checked on the RNA level were used, set 1 (see Table 2) of primers were the set of primers used to amplify the was used as a positive control for the PCR reaction. The GUS template (all the dsRNA sequence). Set 2 (see Table 3) are the dsRNA molecules were found to be extremely stable in the primers that were used in the PCR above. A rice endogenous treated seeds, and can be detected in corn plants 7 and 15 days housekeeping gene (tubulin) was used as a positive control for post germination of the seeds. the PCR reaction (see Table 2). 0386 Three different DNA PCR reactions were carried 0388 GUS dsRNA can is detected in corn seedlings by out on dsRNA treated and untreated plants. No amplified RT-PCR at 7 and 15 days after germination according to an DNA corresponding to CGMMV was detected in any treated aspect of the present disclosure. At one week, GUS dsRNA is or untreated plant. detected in shoots of nine of eleven corn seedlings tested. GUS dsRNA is not detected in untreated plants. At 1 week TABLE 2 post-germination, GUS dsRNA is detected in five of five treated corn seedlings' roots 1 week post germination. At 15 Tubulin Primers Used for PCR. Amplification. days post germination, GUS dsRNA is detected in corn seed Primer Name and Primer Sequence/ Primer lings roots. Direction (SEQ ID NO: ) Length 0389 GUS dsRNA molecules do not get incorporated in osa TubA1 736F GGTGCTCTGAACGTGGATG 19 the genome of treated corn plants one week after germination (SEQ ID NO: 12) as determined by agarose gel electrophoresis of DNA PCR reactions on GUS sequence. US 2014/0230.090 A1 Aug. 14, 2014 30
TABLE 3 Primers for PCR. Amplification of GUS and Ubiquitin Genes and GUS dsRNA product.
Primer Primer Length Primer Sequence/SEQ ID NO : Name GUS T7 For TAATACGACT CACTATAGGGAGATCGACGGCCTGTGGGCATTCA (SEQ ID NO: 15) GUS T7 Rev TAATACGACT CACTATAGGGAGCATTCCCGGCGGGATAGTCTG/ 43 (SEQ ID NO: 16) GUS2O8For CAGCGCGAAGTCTTTATACC/ (SEO ID NO: 17) 43 GUS289Rew CTTTGCCGTAATGAGTGACCA (SEO ID NO: 18) 2O zmaUBQ-94.7F CCATAACCCTGGAGGTTGAGA (SEO ID NO : 19) 2O zmaUBQ104.3R ATCAGACGCTGCTGGTCTGG/ (SEO ID NO: 2O) 2O
GUS dsRNA TAATACGACT CACTATAGGGAGATCGACGGCCTGTGGGCATTC product AGTCTGGATCGCGAAAACTGTGGAATTGATCAGCGTTGGTGG GAAAGCGCGTTACAAGAAAGCCGGGCTATTGCTGTGCCAGGC AGTTTTAACGATCAGTTCGCCGATGCAGATATTCGTAATTATG CGGGCAACGTCTGGTATCAGCGCGAAGTCTTTATACCGAAAG GTTGGGCAGGCCAGCGTATCGTGCTGCGTTTCGATGCGGTCAC TCATTACGGCAAAGTGTGGGT CAATAATCAGGAAGTGATGGA GCATCAGGGCGGCTATACGCCATTTGAAGCCGATGTCACGCC GTATGTTATTGCCGGGAAAAGTGTACGTATCACCGTTTGTGTG AACAACGAACTGAACTGGCAGACTATCCCGCCGGGAATGCTC CCTATAGTGAGTCGTATTA/ (SEO ID NO : 21)
Example 5 sliced to view the interior distribution of the fluorescent dsRNA using a fluorescent microscope and fluorescent Fluorescence Microscopy of siRNA Sequences in siRNA molecules detected in the treated seed. Fluorescent Various Plant Seeds siGLO RNA is detected in the endosperm and the embryo. 0390 Plant seeds as per the protocol described in Example 0395 Penetration of fluorescent siRNA molecules into 1. Seeds were washed for 4 h at 20° C., dried at 25° C. and tomato seeds was observed at 48 hours following treatment were immediately treated with a fluorescent siRNA (siCLO, with siCLO dsRNA. siGLO-treated and control tomato seeds 2 uM final concentration, Thermo Scientific) at 15° C. for 24 were sliced to view the interior distribution of the fluorescent h. The quality of the siCLO before application to a plant seed dsRNA using a fluorescent microscope. Fluorescent siCLO was verified by gel electrophoresis analysis Bands c corre RNA is detected in the endosperm and the embryo. sponding to the expected size of 20-24 bp of the fluorescent 0396 Penetration of fluorescent siRNA molecules into siRNA molecules was detected. cucumber seeds was observed at 48 hours following treat 0391 Fluorescent pictures of the seeds were taken 24-48 ment with siCLO dsRNA. siCLO-treated and control cucum hours post treatment using an Olympus microscope at the ber seeds were sliced to view the interior distribution of the lowest objective magnification (5x for bigger seeds Such as florescent dsRNA using a fluorescent microscope. Fluores rice and tomato seeds, and 10x for Smaller seeds Such as cent siCLO RNA is detected in the endosperm and the Arabidopsis seeds). To eliminate the possibility of non-spe embryo. cific auto-fluorescence, dsRNA-treated seeds are compared 0397 Penetration of fluorescent siRNA molecules is to control untreated seeds. Penetration of fluorescent siRNA detected in sliced seeds of various plant species, including molecules into plant seeds was observed at 24 hours after seed bean, tomato, Sorghum and wheat, 48 hours following treat treatment with siRNA at 2 uM final concentration in Arabi ment with siCLO dsRNA. siCLO-treated and control seeds dopsis seeds, rice seeds, and tomato seeds. were sliced to view the interior distribution of the fluorescent 0392 Penetration of fluorescent siRNA molecules into dsRNA using a fluorescent microscope. Light images were rice seeds was observed at 24 hours following treatment with also taken for each seed and are shown alongside the fluores SiGLO dsRNA. cent image of the seed for reference. 0393. In order to evaluate the distribution efficiency of the 0398 FIG. 1 presents fluorescent images of siGLO-treat fluorescent siRNA inside the seeds, different plant seeds were ment of rice seeds over a 24 hour period. The effect of incu cut into slices and imaged with a fluorescent microscope 48 bation time with siCLO dsRNA on fluorescence intensity, hours after treatment. Each treated seed was imaged along indicating quantity and quality of dsRNA penetration, was side a control untreated seed. Light and fluorescent images tested. Control seeds that were left untreated (1), were imaged were taken where applicable for rice, tomato, cucumber, along with seeds treated with siCLO dsRNA for four different bean, Sorghum and wheat seed samples. incubation times; 10 min (2), 3.5 hours (3), 5.5 hours (4), and 0394 Penetration of fluorescent siRNA molecules into 24 hours (5). rice seeds was observed at 48 hours following treatment with 0399. It is clear that the siRNA is distributed at various siGLO dsRNA. siGLO-treated and control rice seeds were levels between the embryo and the endosperm. Accordingly, US 2014/0230.090 A1 Aug. 14, 2014
dsRNA molecules enter the embryo directly. Though not to be TABLE 4 limited by any particular theory, the dsRNA molecules are carried by the water-based solution used for the seed treat Sequences of Spodoptera littoralis Genes for Down regulation and ment. The dsRNA molecules enter the endosperm as part of Primers used for dsRNAMolecules Generation. the endosperms water-absorption process. These molecules SEQ then are transferred to the embryo as it develops as part of the Gene Name Organism ID NO endosperm to embryo nutrient flow during germination and NADPH Spodoptera littoralis NADPH 21 seed development. cytochrome P450 oxidoreductase mRNA, 0400. These present findings suggest the RNA molecules complete cols (JX310073.1) used to treat the seeds both penetrate the embryo and function ATPase Spodoptera littoralis H(+)- 22 in the embryo as it develops and also penetrate the endosperm ATPase B subunit mRNA, and feed the embryo following germination. partial cds (AY1694.09.1) IAP Spodoptera littoralis mRNA 23 for inhibitor of apoptosis Example 6 (iap gene) (AM709785.1) Chitin synthase Spodoptera exiglia chitin 24 synthase A mRNA, complete Time Course Experiment with siCLO Treatment cols (DQ062153) NADPH dsRNAi 1 Spodoptera littoralis 25 04.01. A time course experiment was performed on rice NADPH dsRNAii Spodoptera littoralis 26 NADPH dsRNAH1 frwd Spodoptera littoralis 27 seeds to monitor the kinetics of siCLO penetration into the NADPH dsRNAH1 rew Spodoptera littoralis 28 seeds following the seed treatment (FIG. 1). The results indi NADPH dsRNAH2 frwd Spodoptera littoralis 29 cate that the siRNA efficiently penetrates the plant seeds NADPH dsRNAH2 rew Spodoptera littoralis 30 using the protocol described in Example 1. ATPase dsRNAH1 Spodoptera littoralis 31 ATPase dsRNAH1 frwd Spodoptera littoralis 32 ATPase dsRNAH1 rew Spodoptera littoralis 33 Example 7 IAP dsRNAH1 Spodoptera littoralis 34 IAP dsRNAH1 frwd Spodoptera littoralis 35 IAP dsRNAH1 rew Spodoptera littoralis 36 Seed Treatment Against Spodoptera littoralis Genes Chitin synthase dsRNAi 1 Spodoptera exiglia 37 Chitin synthase dsRNAH2 Spodoptera exiglia 38 0402 Spodoptera littoralis (or Prodenia littoralis), also Chitin synthase dsRNA#1 frwd Spodoptera exigua 39 Chitin synthase dsRNAH2 frwd Spodoptera exigua 40 known as the African Cotton Leafworm or Egyptian Cotton Chitin synthase dsRNAH2 rev Spodoptera exiglia 41 Leafworm is a moth found widely in Africa and Mediterra Chitin synthase dsRNAi1 rev Spodoptera exiglia 42 nean Europe. It is a common pest on vegetables, fruits, flow ers and other crops. 04.04 Experiment 1 0403. RNA was extracted for dsRNA production from Spodoptera littoralis larvae, and a cDNA library was pre 04.05 Spodoptera littoralis leafworms were placed in petri pared from 0.5 g total RNA. Several genes (ATPase, dishes with corn leaves from germinated control or dsRNA NADPH Cytochrome P450 oxidoreductase (herein referred treated seeds and were monitored daily for consumption of to as NADPH), inhibitor of apoptosis (IAP) and Chitin Syn leaves and for body weight gain. Data for S. littoralis body thase) were selected to test the effect of feeding S. littoralis weight gain after 24 hours, 48 hours and 5 days are shown in with plants grown from seeds treated with dsRNA directed Table 5 respectively. A negative effect on body weight gain of against these genes (see Table 4). Corn seeds were washed for the worms feeding on any dsRNA-treated leaves compared to 4h, dried at 30°C. and immediately were treated with dsRNA worms feeding on control untreated leaves is noted. Body molecules at a final concentration of 40 g/ml (for IAP and weight gain of S. littoralis fed on the control leaves was ATPase), 80 g/ml (for NADPH, 40 ug/ml for each dsRNA normalized to a value of 1. sequence, see Table 4), or a mix solution (80 ug/ml final) 04.06 Experiment 2 containing all three genes (20 ug/ml for each of the four 0407. In this experiment, dsRNA molecules for silencing dsRNA sequences), for 24 hours. Fresh tomato seeds were not of the S. littoralis NADPH or IAP genes were used to treat washed and immediately treated with dsRNA molecules at a corn seeds. Leaves from seedlings grown from these seeds, as final concentration of 66 g/ml (for IAP), 133 Lug/ml (for well as control leaves, were used as a food source for 5 NADPH), or a mix solution (80 g/ml final) containing Spodoptera littoralis leafworms in a single petri dish (two dsRNA targeting these two genes, for 48 hours. Treated seeds plates for each treatment). Control leaves were treated with were germinated and grown into plants. Control seeds which dsRNA directed against the GUS gene. Body weight gain was were not treated with dsRNA directed against S. littoralis recorded for control and treated groups 48 hours from begin genes but were incubated with a similar Solution, either not ning of the experiment (Table 5). The strongest effect on body containing dsRNA or containing dsRNA directed against an weight gain was seen in worms feeding on NADPH-dsRNA unrelated gene. Such as GUS, were germinated and grown treated leaves. Body weight gain of S. littoralis fed on the alongside the treated plants. The leaves of treated and control control leaves was normalized to a value of 1. plants were placed in petridishes and used as sole food source 04.08 Experiment 3 for S. littoralis (typically, about 5 caterpillars per plate). Total 04.09. In this experiment, dsRNA molecules for silencing body weight of the caterpillars was recorded at the beginning of the S. littoralis NADPH or IAP genes were used to treat of each experiment, and was tracked throughout. New leaves tomato seeds. An additional treatment was also included, were Supplemented as needed and their weight was recorded where seeds were treated with a mix solution containing the as well. Body weight gain of the caterpillars was calculated dsRNA molecules targeted against both genes. Leaves from and used as an indicator to their well-being and Survivability. seedlings grown from these seeds, as well as control leaves, US 2014/0230.090 A1 Aug. 14, 2014 32 were used as a food source for 5 Spodoptera littoralis leaf TABLE 6-continued worms in a single petri dish. Body weight gain was recorded for control and treated groups 72 hours after treatment is Two PDS-1 Gene Products to be Silenced by dsRNA?siRNA Mixture. presented in Table 5. Body weight gain of S. littoralis fed on NCBI Accession the control leaves was normalized to a value of 1. Sequence name Organism Number SEQID NO 0410 Experiment 4 Phytoene desaturase Zea mayS BTO84155.1 44 0411. In this experiment, dsRNA molecules for silencing PDS1 dsRNA2 of the S. littoralis NADPH, IAP or ATPase genes were used to treat corn seeds. An additional treatment was also included, where seeds were treated with a mix solution containing the 0413. The experiment was performed in three biological dsRNA molecules targeted against all three genes. Leaves repeats and the results are presented in FIGS. 2A-B. from seedlings grown from these seeds, as well as control leaves, were used as a food source for 5 Spodoptera littoralis Example 9 leafworms in a single petri dish. On day 4, the treated corn leaves were replaced with untreated lettuce leaves as the only Chlorophyll Bleaching and Growth Inhibition food source. Body weight gain was recorded for control and Following PDS Silencing treated groups for up to 8 days. The body weight of all worms 0414 Rice seeds were treated as described in Example 8 at 24 hours was used as a reference point and body weight and their Subsequent development and seedling growth were gain of S. littoralis fed on the control leaves was normalized monitored. Thirty days post PDS-1 silencing treatment the to a value of 1. Data of relative body weight gain of worms overall phenotype of the two plant groups, control and PDS feeding on control or treated corn leaves is presented in Table silenced, was recorded. PDS silencing has been reported to 5. cause chlorophyll bleaching and growth inhibition (Peretz, et al., 2007, Plant Physiol 145: 1251-1263), which correlates TABLE 5 with the phenotype of the PDS-silenced plants of the inven Spodoptera littoralis body weight gain after twenty four hours tion. Treated rice plants after thirty days appeared Smaller in on dsRNA treated leaves size and paler in color, respectively, compared to control plants. Expt. Time control NADPH LAP Mix ATPase gus 24 hours 1.O O.64 O.38 na O.8 na Example 10 1 48 hours 1.O O.69 0.57 na 0.7 na 1 5 days 1.O O.36 O.84 na O.94 na Detection of the Two PDS-1 Gene Products by 2 48 hours 1.O 0.55 O.9 1.O Real-Time PCR 3 48 hours 1 0.55 O.9 3 72 hours 1 O.9S O.91 O.90 4 5 days' 1.O O.76 0.73 O.99 1.11 0415. Following treatment with the dsRNA?siRNA mix 4 7 days? 1.O O.88 O.87 O.89 O.91 ture (ratio 1:1) as described in Example 8, expression levels of 4 8 days 1.O O.9 O.78 0.97 1.12 PDS-1 gene products are determined by real-time PCR using specifically designed primers: four days of treated corn and 1 day of lettuce; 'four days of treated corn and 3 days of lettuce; four days of treated corn and 4 days of lettuce SEO ID NO: 45 Forward: GATTGCTGGAGCAGGATTAG;
Example 8 SEO ID NO: 46 Reverse: CCCTTGCCTCAAGCAATATG, . Silencing the PDS-1 Gene in Rice by a dsRNA?siRNA Mixture 0416) For normalization purposes, UBQ5 expression was also determined using primers: 0412 Rice seeds were washed in wash solution for 4 hat 20°C., dried at 25°C. and immediately treated with a mixture of dsRNA?siRNA at a total concentration of 5ug/ml at 15° C. SEO ID NO: 47 Seeds were germinated at room temperature for several days forward-ACCACTTCGACCGCCACTACT, ; and seed development was monitored. Seeds treated with the PDS and dsRNA?siRNA mixture exhibited Stunted and SEO ID NO: 48 delayed development, as seen by Smaller seedlings and reverse-ACGCCTAAGCCTGCTGGTT, . reduced rooting. For efficiency considerations and in order to increase the likelihood of an observed effect, two products of 0417. The results are shown in FIGS. 3 A-C. the PDS-1 gene are combined (see Table 6). Example 11 TABLE 6 HAP2E Target Gene Silencing Two PDS-1 Gene Products to be Silenced by dsRNA?siRNA Mixture. 0418 Rice seeds were treated using the protocol described NCBI Accession in Example 1. Seeds were washed for 4 hat room tempera Sequence name Organism Number SEQ ID NO ture, dried overnight at 25°C. and immediately treated with a Phytoene Desaturase Zea mays BTO84155.1 43 Hap2e dsRNA concentration of 152 m/ml, for 41 hours at 15° PDS1 dsRNA1 C. (for Hap2e dsRNA sequences see Table 7). Control and Hap2e dsRNA-treated rice seeds that were germinated 5 days US 2014/0230.090 A1 Aug. 14, 2014 33 post treatment did not exhibit any differences in their root pared to control plants, was achieved with an efficiency of development. RNA was extracted from shoots of germinated 31.25% (Table 9). seeds, 5 and 7 days post germination, and RT-PCR was run. After testing 3 different sets of primers (see Table 7), located 0419. Other rice seeds were treated in same conditions in various regions of the dsRNA molecules (Table 8, showing with a Hap2e dsRNA concentration of 145.7 ug/ml, for 42 the fold change relative to the control), the best primer set hours. RT-PCR using random primers+Oligo dT on RNA (primer set 3) was used to evaluate the endogenous Hap2e extracted from seedlings 18 days postgermination also exhib expression levels in dsRNA-treated plants versus control (un ited down-regulation of Hap2e mRNA in dsRNA-treated treated) plants. Down-regulation of Hap2e mRNA expression plants (Table 10), with 50% efficiency of reaching down in the treated plants, at a level of over 50% silencing com regulation of over 25% compared to control. TABL E 7
Primers used for RT-PCR of Hap2e dsRNA Molecules.
Primer SEQ Primer Set Primer Name ID Set Location and Direction Primer Sequence No. :
In oSaHAP2ESO1F3 ACCGGCATCAGCTCAGTCTC 49 cSRNA disalaP2E589R3 T.GCTGTTCTCTGGGCACAGG SO
Junction osaHAP2E11F5 TCCCCTCAGATATTAACAAC 51 disaap2E108R5 AGGAGGAAAGGCAGCTTCTGTG 52
Out of osa.HAP2E122F7 GTGACTCGTCACCAACAAAG 53 dsRNA osa.AP2E2O2R7 TGTGTTGTCCGTTGAGACTG 54
TABLE 8 Treatment of Rice seeds with Hap2e dsRNA (target of mir 169) Primer evaluation.
control. EM47766 EM477.67 EM477.69 EM47772 EM47773
Primer Set 1 1.O O.87 0.7 O.81 O.62 Primer Set 2 1.O O.99 O.82 O.89 0.44 Primer Set 3 1.O O.76 0.73 O.78 0.4
Fold change relative to untreated control (control = 1.0)
TABLE 9 Treatment of Rice seeds with Hap2e dsRNA (target of nir 169) at 7 days. control EM47796 EM47798 EM47799 EM478O3 EM47804 EM47769 Relative Fold change Fold change relative to untreated control (control = 1.0)
TABLE 10 Treatment of Rice seeds with Hap2e dsRNA (target of mir 109) at 18 days. EM EM EM EM EM EM EM EM EM EM EM control 49050 49051 49052 49053 49054 49056 49047 49060 49061 49063 49064
1.O Fold change relative to untreated control (control = 1.0) US 2014/0230.090 A1 Aug. 14, 2014 34
Example 12 TABLE 12 NFY Target Gene Silencing in Corn Seeds Treatment of corn seeds with NFY dsRNA (target of mir169). 0420 Corn seeds were treated using the protocol EM EM EM EM EM EM EM EM described in Example 1. Seeds were washed for 4 hat room control 48006 48007 48009 48010 48011 48.012 48013 48014 temperature, dried overnight at 30° C. and immediately 1.O O.S1 O.62 0.67 O.33 O.SO O.76 O.85 O.11 treated with a NFY dsRNA concentration of 56 m/ml, for 40 hours at 15° C. (for NFY dsRNA sequence see Table 11). Fold change relative to untreated control (control = 1.0) RT-PCR on RNA extracted from control and NFY dsRNA treated corn seeds 10 days after germination was performed to Example 10 determine the expression level of NFY target gene (see Table 11). Down-regulation of the gene was successfully achieved as exhibited in Table 12. NFY Target Gene Silencing in Tomato Seeds 0421 Tomato seeds were treated using the protocol TABL E 11 described in Example 1. Unwashed seeds were treated with a NFY dsRNA concentration of 200ug/ml, for 24 hours at 15° Primers used for RT-PCR of NFYA dsRNA. Molecules in C., seeds were washed twice briefly and immediately planted Corn Seeds 310 Days after Germination. in soil without drying. RT-PCR on RNA extracted from con Primer Name SEQ trol and NFY dsRNA-treated tomato seeds 3 weeks after and Direction Primer Sequence ID No. : germination was performed to determine the expression level of NFY target gene (see Table 13). Down-regulation of the zma-NFYA3 345 F3 TCGGAAGCCGTACCTTCGTG 55 gene was successfully achieved as exhibited in Table 14. zma-NFYA3 442R3 CCTGGAGCTGCTGCTTTGTG 56 0422 Tomato plants 55 days post treatment with NFY dsRNA molecules were compared to same age control plants. zma-NFYA3 457F4 TACCAGGCGTCGAGTGGTTC f Major phenotypic differences were evident upon comparison, most notably was a shift in height, where treated plants zma-NFY-A3 542R4 GAAGAGGGCGTGCAAATGGG 58 appeared significantly shorter than untreated control plants (FIG. 4). TABL E 13
Primers used for RT-PCR of NFYA dsRNA. Molecules in Tomato and NFY dsRNA product.
SEO ID Sequence Name Sequence No. :
slyNFYA125F3 CTATTGCGTGTGCTCCAAAC 59
slyNFYA212R3 ACATGAGGAGGAACCAAAGG 6 O
NFY csRNA CTAATACGACTCACTATAGGGAGAGGCTCAAGAACCAG 61 product 1 TTTATGTTAATGCTAAGCAGTATCGAAGGATCCTGCAGC GAAGACAGTCACGTGCTAAAGCAGAACTTGAAAAGAAG CAAATAAAGGGTAGAAAGCCATATCTTCACGAGTCTCG ACATCAGCATGCACTGAGGAGGGTAAGGGCCTCGGGTG GACGTTTTGCCAAAAAGACAGATGCTTCTAAGGGTACT GGTTCTGTGAGTTCATCGGGTTCTGAACCTTTGCAGTTC AATGCTGCTGATATTCAAAAGAGGAATGAAAATGGAAG GTTGGCCGAGCTTCAGCAGTCTTATTCAAATGGTAGCAG TTATGGCAATCAAAGTAGCTTTCAAGAATCCAAGGATG AGTACCAGTTTGCTAAAAGCAGGGAAGGAGGTTTTTTT GTCAAGTAATTGGAGATACGTTCATGTGTAAACTAGCTC TTGCCCTCTCCCTATAGTGAGTCGTATTAG
NFY csRNA CTAATACGACT CACTATAGGGAGAGCAGTTATGGCAAT 62 product 2 CAAAGTAGCTTTCAAGAATCCAAGGATGAGTACCAGTT TGCTAAAAGCAGGGAAGGAGGTTTTTTTGTCAAGTAATT GGAGATACGTTCATGTGTAAACTAGCTCTTGCCCTGCAA CGAGGGTAGAGTATGAGCAAGAGGAGTTTACAGGGATT GTTTCATTTCTTGGCTTTTCAAGATAGGCGGCAATTCAT TCTTGGCTTTTTACTTTAGTGTTAAAGGGAGCAACAGAG GTGACGAGGGTATCAGTGTTGCAGCATTTGCTTGGAGAT TACATCTTCCCTTATGTACAGAGATGGATGAACTTAGAA CTAGGATTAGAAAGTTTTTCAGTAAGTTTATGTTTGGCC AGTTACTGTAGTTTTAGTTTAGGAGACCATGTAAAAAGG TTGTTAGTTTTGCAAAAGGATCTTTTTTCTTTCCCTAATT GGTGCATTCTCCCTATAGTGAGTCGTATTAG