CD47 blockade augmentation of Trastuzumab antitumor efficacy dependent upon antibody-dependent-cellular-phagocytosis
Li-Chung Tsao, … , Herbert Kim Lyerly, Zachary C. Hartman
JCI Insight. 2019. https://doi.org/10.1172/jci.insight.131882.
Research In-Press Preview Immunology Oncology
The HER2-specific monoclonal antibody (mAb), Trastuzumab, has been the mainstay of therapy for HER2+ breast cancers (BC) for ~20 years. However, its therapeutic mechanism of action (MOA) remains unclear, with antitumor responses to Trastuzumab remaining heterologous and metastatic HER2+ BC remaining incurable. Consequently, understanding its MOA could enable rational strategies to enhance its efficacy. Using both novel murine and human versions of Trastuzumab, we found its antitumor activity dependent on Fcγ-Receptor stimulation of tumor-associated- macrophages (TAM) and Antibody-Dependent-Cellular-Phagocytosis (ADCP), but not cytotoxicity (ADCC). Trastuzumab also stimulated TAM activation and expansion, but did not require adaptive immunity, natural killer cells, and/or neutrophils. Moreover, inhibition of the innate immune ADCP checkpoint, CD47, significantly enhanced Trastuzumab- mediated ADCP, TAM expansion and activation, resulting in the emergence of a unique hyper-phagocytic macrophage population, improved antitumor responses and prolonged survival. In addition, we found tumor-associated CD47 expression was inversely associated with survival in HER2+ BC patients and that human HER2+ BC xenografts treated with Trastuzumab+CD47 inhibition underwent complete tumor regression. Collectively, our study identifies Trastuzumab- mediated ADCP as a significant antitumor MOA that may be clinically enabled by CD47 blockade to augment therapeutic efficacy.
Find the latest version: https://jci.me/131882/pdf 1 CD47 blockade augmentation of Trastuzumab antitumor efficacy dependent upon 2 antibody-dependent-cellular-phagocytosis 3 4 Li-Chung Tsao1, Erika J. Crosby1, Timothy N. Trotter1, Pankaj Agarwal1, Bin-Jin Hwang1, 5 Chaitanya Acharya1, Casey W. Shuptrine1, Tao Wang1, Junping Wei1, Xiao Yang1, Gangjun 6 Lei1, Cong-Xiao Liu1, Christopher A. Rabiola1, Lewis A. Chodosh2, William J. Muller3, Herbert 7 Kim Lyerly1,4,5, Zachary C. Hartman1,5
8 1Department of Surgery, Duke University, Durham NC, USA
9 2Department of Cancer Biology, University of Pennsylvania, Philadelphia PA, USA
10 3Department of Biochemistry, McGill University, Montreal Quebec, Canada
11 4Department of Immunology, Duke University, Durham NC, USA
12 5Department of Pathology, Duke University, Durham NC, USA
13
14 Keywords: Breast cancer, HER2, Trastuzumab, antibody therapeutics, ADCP, Macrophages, 15 CD47, checkpoint blockade, Cancer immunotherapy
16
17 Corresponding Author:
18 Zachary C. Hartman
19 Department of Surgery and Pathology
20 Division of Surgical Sciences, Center for Applied Therapeutics
21 Duke University Medical Center
22 MSRBI Room 414 Box 2606, 203 Research Drive, Durham NC 27710
23 Phone- 919-613-9110
25
26 27 COI Statement:
28 The authors declare no potential conflicts of interest. An invention disclosure at Duke 29 University’s Office of Licensing and Ventures has been generated for “identifying phagocytic 30 macrophage as a biomarker” by the following authors: LT, ZH and HKL. Patent # T-006575. 31 Abstract
32 The HER2-specific monoclonal antibody (mAb), Trastuzumab, has been the mainstay of
33 therapy for HER2+ breast cancers (BC) for ~20 years. However, its therapeutic mechanism of
34 action (MOA) remains unclear, with antitumor responses to Trastuzumab remaining
35 heterologous and metastatic HER2+ BC remaining incurable. Consequently, understanding its
36 MOA could enable rational strategies to enhance its efficacy. Using both novel murine and
37 human versions of Trastuzumab, we found its antitumor activity dependent on Fcγ-Receptor
38 stimulation of tumor-associated-macrophages (TAM) and Antibody-Dependent-Cellular-
39 Phagocytosis (ADCP), but not cytotoxicity (ADCC). Trastuzumab also stimulated TAM activation
40 and expansion, but did not require adaptive immunity, natural killer cells, and/or neutrophils.
41 Moreover, inhibition of the innate immune ADCP checkpoint, CD47, significantly enhanced
42 Trastuzumab-mediated ADCP, TAM expansion and activation, resulting in the emergence of a
43 unique hyper-phagocytic macrophage population, improved antitumor responses and prolonged
44 survival. In addition, we found tumor-associated CD47 expression was inversely associated with
45 survival in HER2+ BC patients and that human HER2+ BC xenografts treated with
46 Trastuzumab+CD47 inhibition underwent complete tumor regression. Collectively, our study
47 identifies Trastuzumab-mediated ADCP as a significant antitumor MOA that may be clinically
48 enabled by CD47 blockade to augment therapeutic efficacy.
49
50
51
52
53 54 Introduction:
55 Approximately 20% of Breast Cancer (BC) overexpress HER2, recognized as an
56 oncogenic driver of an aggressive cancer phenotype with a poor prognosis (1, 2). Monoclonal
57 antibodies (mAbs) targeting HER2 were developed in the 1980s to inhibit HER2 oncogenic
58 signaling, leading to the clinical development and regulatory approval of Trastuzumab in 1998
59 for metastatic HER2 overexpressed BC, followed by clinical trials of Trastuzumab use in the
60 adjuvant setting. Following its approval, additional HER2 targeting mAbs have also been
61 generated to improve outcomes (3, 4). However, the clinical benefit associated with HER2 mAb
62 therapies in patients with HER2 overexpressing BC remains heterologous and metastatic
63 HER2+ BC remains incurable (5, 6). Consequently, mechanistic studies of the antitumor
64 mechanism(s) of action (MOA) of Trastuzumab and its resistance remain critical, not only to
65 improve outcomes in patients with HER2+ BC, but also to gain insight into mechanisms that
66 would extend mAb therapies to other types of cancers.
67 While suppression of HER2 signaling was a primary focus of early mechanistic studies,
68 subsequent studies also focused on the role of immunity in mediating the antitumor effects of
69 Trastuzumab (7). In particular, studies have shown the interaction of anti-HER2 antibodies with
70 Fcγ-receptors (FCGR) expressed on innate immune cells such as macrophages, monocytes,
71 natural killer (NK) cells and dendritic cells may be involved in its therapeutic activity (8, 9). The
72 consequences of crosstalk with FCGR-bearing immune cells (8-10) are supported by the clinical
73 observation that some host FCGR polymorphisms are associated with improved clinical
74 outcome in HER2+ BC patients treated with Trastuzumab (11). Specifically, several studies
75 have suggested the importance of these receptors in mediating Antibody-Dependent-Cellular-
76 Cytotoxicity (ADCC), through NK cells or neutrophils for Trastuzumab efficacy (8, 9, 12-14).
77 However, other studies have suggested the importance of adaptive immunity in mediating
78 Trastuzumab efficacy, indicating that T cells may be critical for its antitumor MOA (8, 15). 79 While multiple MOAs involving either innate or adaptive immunity are possible, an
80 underexplored mechanism is through mAb engagement of FCGRs to stimulate macrophage
81 mediated Antibody- Dependent-Cellular-Phagocytosis (ADCP). Inconsistent reports about the
82 role of ADCP exist, with a recent study demonstrating the ability of Trastuzumab to elicit ADCP
83 (16), while another study suggests that Trastuzumab-mediated ADCP triggers macrophage
84 immunosuppression in HER2+ BC (17). These disparate results may be partially attributed to
85 the use of a wide range of tumor models (many not specifically driven by active HER2-
86 signaling), as well as the use of different HER2-specific mAb clones of varied isotypes, which
87 can elicit a range of different responses from various FCGRs (18, 19). Thus, the immunologic
88 basis for the activity of Trastuzumab remains inconclusive, but could be effectively investigated
89 through the development and use of appropriate HER2 targeting mAbs and model systems.
90 In this study, we developed and utilized fully murinized Trastuzumab mAbs (clone 4D5)
91 with isotypes of different activating-to-inhibitory ratio (A/I ratio, calculated by dividing the affinity
92 of a specific IgG isotype for an activating receptor by the affinity for the inhibitory receptor) (19),
93 as well as clinical-grade Trastuzumab, to determine the MOA for Trastuzumab antitumor
94 efficacy. These mAbs were tested in multiple settings to interrogate ADCC and ADCP, as well
95 as the impact on HER2 signaling and complement-dependent cytotoxicity (CDC). To determine
96 the antitumor efficacy of these HER2 mAbs, we employed orthotopic implantation of HER2+
97 murine BC cells (transformed using a constitutively active isoform of human HER2) in
98 immunocompetent models, as well as Fcgr-/-, immune-deficient backgrounds, and human
99 HER2+ BC xenograft models. In addition, we utilized a novel transgenic HER2+ BC model
100 driven by an oncogenic isoform of human HER2 to simulate an endogenous mammary tumor
101 immune microenvironment (20, 21). Collectively, these studies revealed an essential role for
102 tumor-associated macrophages (TAMs) in mediating the therapeutic activity of Trastuzumab
103 through promoting ADCP of HER2+ tumor cells without evidence for significant induction of 104 adaptive T cell responses against HER2. We also observed that this effect was subverted by
105 innate mechanisms of immunosuppression in the tumor microenvironment that limit
106 macrophage ADCP.
107 Previous studies have demonstrated that ADCP is principally regulated by anti-
108 phagocytic “don’t eat me” signals that are amplified in many cancers (22, 23). Chief among
109 these is CD47, which has been shown to be highly expressed in different cancers and functions
110 to suppress phagocytosis through binding to and triggering signaling of macrophage SIRPα (23,
111 24). Notably, CD47 expression is also upregulated in BC (25). As a potential means to subvert
112 innate immune regulation and enhance ADCP and possibly alter the macrophage phenotype in
113 HER2+ BC, we also targeted the CD47-SIRPα innate immune checkpoint. In this study, we
114 demonstrate that TAM ADCP can be significantly enhanced by blocking the CD47-SIRPα
115 checkpoint to enable Trastuzumab-mediated macrophage phagocytosis of HER2+ tumor cells.
116 Collectively, these findings support the importance of the ADCP MOA, as well as suggest the
117 therapeutic potential of utilizing CD47-SIRPα checkpoint blockade in combination with
118 Trastuzumab in HER2+ BC and potentially in other resistant HER2+ cancers (i.e. gastric,
119 bladder, etc) (26).
120
121 Results:
122 Generation of murine Trastuzumab (4D5) and its antitumor dependence on ADCP by
123 tumor-associated macrophages (TAMs).
124 Trastuzumab was based on a HER2-specific mouse IgG1 monoclonal antibody (4D5-IgG1, low
125 A/I ratio), which was subsequently ‘humanized’ to a human IgG1 isotype (high A/I ratio) that
126 allows for superior activation of Fc receptors (27). Thus, to accurately study the function of
127 Trastuzumab in an immunocompetent mouse model, we constructed a murine 4D5 monoclonal 128 antibody, but using the IgG2A isotype (4D5-IgG2A, high A/I ratio, Figure 1A) to better
129 approximate an Fc-receptor activating ‘murine version' of Trastuzumab (18, 19, 28).
130 Unsurprisingly, we found that 4D5-IgG2A HER2 binding is equivalent to Trastuzumab (Figure
131 S1A). This allowed us to interrogate the importance of the HER2-antibody Fc region as well as
132 minimize the humoral immune responses against Trastuzumab, a human antibody, when
133 administered into a murine host (Figure S1B).
134 To test the antitumor efficacy of 4D5-IgG2A, we began by interrogating its impact on
135 oncogenic HER2 signaling. As HER2 is weakly transformative in most cell lines, we employed a
136 highly oncogenic isoform of human HER2 (HER2Δ16) that constitutively dimerizes to create a
137 transformed BALB/c mammary cell line dependent upon HER2 signaling (21). In studies using
138 HER2Δ16, we observed that both 4D5-IgG2A and Trastuzumab could suppress HER2 signaling
139 (although not as potent as Lapatinib (Figure S1C-D), but not significantly enough to prevent
140 tumor cell growth in vitro (Figure S1E). This is in line with several recent studies, suggesting that
141 the impact of Trastuzumab is mediated through immune based mechanisms (29, 30). Using
142 transformed MM3MG-HER2Δ16 as a model for HER2-driven BC growth in vivo, we next
143 implanted these cells in the mammary fat pad of immunocompetent BALB/c mice. Tumor
144 bearing mice were treated weekly with 4D5-IgG2A or clinical-grade Trastuzumab to determine if
145 they could suppress tumor growth in an immunocompetent context. We found that both 4D5-
146 IgG2A and Trastuzumab significantly suppressed HER2+ BC growth demonstrating that murine
147 IgG2A was capable of significant antitumor activity (Figure 1B). Notably, we observed that 4D5-
148 IgG2A and Trastuzumab significantly increased the levels of tumor-associated macrophages
149 (TAMs) (Figure 1C), but did not increase other immune infiltrates such as NK cells and T cells
150 (Figure S2A). Furthermore, using IFN-γ ELISPOT assays we found 4D5-IgG2A and
151 Trastuzumab treatment had no effect on systemic adaptive T cells responses against human
152 HER2 epitopes (Figure S2B-C). In agreement with published reports (12), we observed NK cell- 153 mediated ADCC was increased by 4D5 or Trastuzumab treatment in co-culture systems (Figure
154 S2D). To determine if NK cells and/or adaptive immune cells mediate antitumor immunity in
155 vivo, we next tested HER2 mAb ability to suppress HER2+ BC growth in T cell, B cell, and NK
156 cell deficient SCID-Beige mice. Contrary to published reports (8), we found surprisingly no
157 change in its antitumor efficacy (Figure 1D), suggesting the roles of adaptive immune and NK
158 cells are minimal in Trastuzumab/4D5 action in our in vivo model system. As neutrophil levels
159 (LY6G+ CD11b+) were suppressed (Figure S2A) and previous studies have also implicated
160 neutrophils in Trastuzumab-mediated immunity (14), we next depleted neutrophils using anti-
161 LY6G in SCID-Beige studies (Figure S3D-E), but did not observe any difference in antitumor
162 efficacy (Figure 1E). To investigate the possible role of complement dependent cytotoxicity
163 (CDC), we performed CDC assays in vitro and found that neither 4D5-IgG2A nor Trastuzumab
164 were able to induce CDC in comparison to polyclonal HER2 Abs, in line with other studies of
165 Trastuzumab (31) (Figure S2E).
166 The increase of TAMs levels after treatment suggested a functional role in Trastuzumab
167 antitumor immunity. We therefore implemented several strategies to deplete macrophages in
168 our SCID-beige HER2+ BC model. Using a prolonged anti-CSF1R antibody injection strategy
169 (32), we achieved significant reduction of TAMs and which also limited TAM increase in 4D5-
170 treated tumors (Figure 1F). Importantly, the reduction of TAM levels resulted in a significant
171 decrease of HER2 mAb therapeutic efficacy (Figure 1G). We also utilized clodronate liposome
172 injection to deplete macrophages in this model, but found we could only readily deplete
173 macrophages in systemic circulation and not those in the tumor (Figure S3A). Interestingly, this
174 depletion had no effect on HER2 mAb therapy (Figure S3B), suggesting that macrophages in
175 the mammary tumor are the major antitumor effectors. To explore the efficacy of macrophage-
176 mediated HER2-specific antitumor activity, we established a BMDM co-culture system to
177 investigate the relative ADCC and ADCP activity mediated by 4D5-IgG2A and Trastuzumab 178 (33). Using Latrunculin A, an inhibitor of actin polymerization and therefore blocking
179 phagocytosis of immune complexes (34), we revealed the dominant antitumor activity of HER2
180 mAbs mediated by macrophages is through ADCP (Figure 1H). Concanamycin A, an V-ATPase
181 inhibitor reported to also inhibit perforin and cytotoxicity (35), had no effect on HER2 mAb
182 activities. Collectively, these results suggested that Trastuzumab therapy modifies the tumor
183 microenvironment by promoting TAM expansion, and that the dominant mechanism of action by
184 Trastuzumab is mediated by ADCP of HER2+ tumor cells by macrophages.
185
186 The ADCP activity of 4D5 requires the engagement with Fcγ-Receptors and is isotype
187 dependent
188 To further validate the mechanism of ADCP by 4D5-IgG2A treatment, we utilized Fcer1g-/-
189 animals to test the requirement for Fcγ-receptor (FCGR) engagement on phagocytic immune
190 cells. Using macrophages cultured from Fcer1g-/- and control mice, in vitro ADCP assays
191 revealed that FCGRs on macrophages are critical for 4D5-induced ADCP of HER2+ BC (Figure
192 2A). Accordingly, we found the in vivo antitumor efficacy of 4D5-IgG2A therapy are mostly
193 ablated in Fcer1g-/- mice (Figure 2B). Importantly, FCGR expression was also required for
194 macrophage expansion by 4D5-IgG2A in the tumor microenvironment (Figure 2C).
195 These data demonstrated that HER2 mAb engagement with macrophage FCGRs is required for
196 ADCP activity. Among the four mouse FCGRs, FCGR4 is the predominant FCGR mediating
197 macrophage ADCP, plays a central role for mouse IgG2A activity, and has also been shown to
198 exhibit the strongest binding affinity for Trastuzumab (16, 36-38). To determine the impact of
199 HER2-mAb isotype on FCGR4 engagement and antitumor efficacy, we compared the efficacy of
200 4D5-IgG1 (low A/I ratio) and compared its antitumor efficacy with 4D5-IgG2A (Figure 1A). We
201 found that unlike 4D5-IgG2A which elicited significant antitumor effects in vivo and ADCP in 202 vitro, 4D5-IgG1 has no effect against HER2+ BC in vivo (Figure 2D) and was inferior in
203 promoting tumor ADCP by BMDM (Figure 2E). To determine their impact on FCGR4 and other
204 activating FCGRs directly, we developed a mouse FCGR activation and signaling to NFAT-
205 luciferase reporter system based on published methods (39). In agreement with established
206 literatures on mouse IgG subclasses and FCGR biology (18, 19, 40), we found that 4D5-IgG2A
207 engages with all three activating FCGRs, whereas 4D5-IgG1 only weakly activates FCGR3
208 (Figure 2F-2H). Additionally, mouse FCGR1 and FCGR4 have strong human-murine cross-
209 reactivity with clinical grade human Trastuzumab (human IgG1 isotype) as reported before (40),
210 thus potentially explaining its in vivo efficacy in mice. Collectively, these results illustrate that
211 HER2 mAb’s antitumor activity requires the successful engagement and activation of Fcγ-
212 receptors on macrophages to induce ADCP.
213
214 CD47 Blockade increased therapeutic efficacy of 4D5 and augments tumor-associated
215 macrophage expansion and phagocytosis.
216 Our findings strongly supported an ADCP MOA for Trastuzumab antitumor efficacy, which
217 suggests strategies to enhance ADCP may be synergistic with Trastuzumab therapies. As
218 previous studies have demonstrated that blockade of CD47-SIRPα can enhance mAb
219 therapeutic efficacy, we investigated if targeting this ADCP-specific axis would enhance HER2
220 mAb ADCP without affecting ADCC activity. To begin our investigation, we documented the
221 elevated expression of Cd47 in our MM3MG-HER2Δ16 tumors and generated CD47-KO cells
222 (Figure S4A) to determine the contribution of this axis to ADCP and ADCC in vitro. We observed
223 that CD47-KO tumor cells exhibited generally enhanced ADCP that was significantly enhanced
224 by HER2 mAbs, but had no effect on ADCC (Figure 3A). Additionally, we found that 4D5-
225 mediated ADCP of CD47-KO tumors elicited the expression of pro-inflammatory cytokines and
226 chemokines by macrophages (e.g. IL6, TNFα, CCL3, CCL4 etc.), presumably due to enhanced 227 ADCP activity (Figure 3B and Figure S5). This demonstrates that 4D5-IgG2A alone triggers
228 ADCP but was insufficient to stimulate significant pro-inflammatory activation within
229 macrophages. However, upon blockade of the CD47 negative regulatory axis, ADCP and an
230 associated pro-inflammatory phenotype was significantly enhanced in macrophages.
231 As CD47 directly altered ADCP and macrophage activation in vitro, we next evaluated the
232 impact of CD47-KO expression on tumor growth and HER2 mAb therapy in vivo. We found that
233 CD47-KO HER2+ BC cells showed a delayed growth when implanted into mice, and were
234 significantly more susceptible to 4D5-IgG2A inhibition (Figure 3C). Furthermore, we found
235 significantly elevated TAM levels in CD47-KO tumors compared to the control tumors after 4D5-
236 IgG2A treatment (Figure 3D). In a reciprocal approach, we overexpressed Cd47 in the tumor
237 cells (Figure S4B) and found this increased tumor resistance to 4D5-IgG2A therapy (Figure 3E)
238 and prevented TAMs increase (Figure 3F). These two genetic approaches validated the role of
239 CD47 in suppressing Trastuzumab ADCP-mediated antitumor activity, and suggest blockade of
240 CD47 could unleash the full potential of Trastuzumab therapeutic efficacy by altering
241 macrophage activation and expansion.
242 As recent studies have suggested CD47 blockade antibodies can elicit clinical responses
243 (41), we next wanted to determine if CD47 blockade may enhance Trastuzumab efficacy. Thus,
244 we combined 4D5-IgG2A mAb with CD47 blockade antibody MIAP410 in immunocompetent
245 mice bearing the MM3MG-HER2Δ16 tumors. While 4D5-IgG2A and CD47 blockade
246 monotherapies both showed therapeutic efficacy, their combination significantly suppressed
247 tumor growth more effectively than either 4D5-IgG2A or CD47 alone and also further increased
248 TAM levels (Figure 4A and 4B and S7). In contrast, we observed that levels of other infiltrating
249 immune cell types, except for regulatory T cells, were not significantly increased by weekly
250 treatment of 4D5-IgG2A with CD47 blockade (Figure S6A). As regulatory T cells were altered,
251 we speculated that adaptive immune responses could also play a role in these enhanced 252 responses. To explore the impact of adaptive immunity in the context of CD47 blockade, we
253 repeated our in vivo experiments in adaptive immune-deficient SCID-Beige mice (Figure 4C). As
254 before, we observed a strong combinatorial effect between HER2 mAb and CD47 blockade,
255 suggesting adaptive immunity and NK cells were not essential to the enhanced response with
256 this combination therapy. Also as before, we found that CD47 blockade with 4D5-IgG2A further
257 increased TAMs levels (Figure 4D), suggesting that relieving the CD47 checkpoint specifically
258 promotes macrophage expansion and phagocytosis in tumors.
259 In order to directly demonstrate tumor ADCP by endogenous macrophages in the tumor
260 microenvironment, we labeled MM3MG-HER2Δ16 tumor cells with DiD dye (a carbocyanine
261 membrane-binding probe) prior to implantation, a strategy to detect phagocytosis of labeled
262 target cells in vivo (42). When the tumors reached a volume of ~1000 mm3, we treated the
263 animals with 4D5-IgG2A antibody or in combination with CD47 blockade (Figure 4E). FACS
264 analysis showed increased phagocytosis of labeled tumor cells by TAMs in 4D5-IgG2A treated
265 animals (Figure 4F), directly demonstrating 4D5-IgG2A treatment promotes ADCP of HER2+
266 tumor cells in vivo. Furthermore, we found the addition of CD47 blockade further increased
267 ADCP of labeled tumor cells by TAMs (Figure 4F). As expected, this therapeutic mechanism
268 requires the engagement with FCGRs on macrophages, since 4D5+αCD47 induced ADCP of
269 tumor cells in vivo was completely abolished in Fcer1g-KO mice (Figure 4G). In sum, these
270 studies demonstrate that HER2 mAb stimulates ADCP from endogenous TAMs against HER2+
271 BC, which can be boosted via combination with CD47 blockade therapy.
272
273 CD47 blockade synergizes 4D5 therapeutic activity in a transgenic HER2+ breast cancer
274 mouse model 275 Having demonstrated efficacy in an orthotopic model of HER2+ BC, we wanted to extend our
276 study using a spontaneous model of HER2+ BC that approximates a late stage HER2+ BC
277 (where HER2 mAbs are not highly effective) (43). Analogous to a clinical trial (Figure 5A), the
278 individual animals with palpable breast tumors (~200mm3) were enrolled in a specific treatment
279 group. We found that mice in the 4D5-IgG2A monotherapy treatment group had a significant
280 increase in survival time and delayed tumor growth, whereas CD47 blockade monotherapy had
281 no significant effect compared to the control group (Figure 5B and 5C). Strikingly, combination
282 therapy of 4D5-IgG2A with CD47 blockade resulted in a further prolonged survival rate and
283 delayed tumor growth compared to 4D5 monotherapy, suggesting that this combination may be
284 efficacious in advanced HER2+ BCs. To determine if these therapies again alter the immune
285 infiltrates, we analyzed the composition of the tumor microenvironment by flow cytometry. As
286 before, we found an increase in TAMs within the 4D5-IgG2A monotherapy group, whereas the
287 combination therapy group showed an even higher increase (Figure 5D). Additionally, we also
288 observed a slight reduction of T cell infiltration and neutrophil levels (Figure S6B).
289
290 Single-cell transcriptome analysis of TAMs in HER2+ BC after 4D5 with CD47 blockade
291 combination therapy
292 To further determine if macrophages were differentially activated, we performed single-cell RNA
293 sequencing on dissociated tumors from the HER2 transgenic mice. These studies confirmed the
294 increase of macrophages upon 4D5-IgG2A plus αCD47 treatment and also revealed the
295 emergence of a distinct group of macrophages (that we termed “Phag MΦ” cluster) that are
296 phenotypically distinct from the resident macrophage clusters (i.e. “M1 MΦ” and “M2 MΦ”
297 clusters) (Figure 6A and 6B). Notably, we found that this Phag MΦ cluster contained large
298 quantities of human HER2 RNA and other tumor specific transcripts (such as Epcam and Cyto-
299 keratins), indicating that they have actively phagocytosed tumor cells. This cluster was 300 expanded by 4D5-IgG2A treatment and increased further by combination 4D5+CD47 mAbs
301 treatment (Figure 6B and Table 1). In agreement with our FACS analysis, the level of total
302 macrophages were significantly increased while T cell and neutrophil levels were reduced after
303 4D5 or combination therapy (Figure 6B and Table 1). Interestingly, the frequency of cytotoxic
304 gene expression (Ifng and Gzmb) among CD8+ T cells were increased following treatments
305 (Figure 6 and Table S1).
306 Using differential gene expression analysis, we first assessed the impact of our treatments on
307 the M1-like and M2-like macrophage clusters in comparison to control (Figure 7A and 7B). Of
308 note, these two macrophage clusters do not demonstrate evidence for hyper-phagocytosis of
309 tumor cells at this time point of analysis, as evidenced by their lack of tumor marker uptake
310 (Figure 6B). Gene expression data revealed our treatments promoted macrophage polarization
311 into a pro-inflammatory antitumor phenotype, as evidenced by an increase in genes involved in
312 interferon, inflammatory cytokines, chemokines and TLR pathways (Figure 7A and 7B).
313 Accordingly, these changes were the most significant with combination therapy, and also more
314 strongly observed in the M1-like MΦ cluster.
315 In contrast, the Phag MΦ cluster (predominantly presence in the combination treatment group)
316 have surprisingly increased expression of gene signatures for wound-repair (e.g.
317 Thrombospondins and Tenascins), ECM remodeling (e.g. Collagens and MMPs), growth factors
318 (e.g. Igf1, Tgfb and Egf) and anti-inflammatory genes (e.g. IL4, IL13, IL1r) compared to the
319 other two MΦ clusters (Figure 7C). This is also accompanied by decreased expression of genes
320 for pro-inflammatory cytokines/chemokines, phagocytosis/opsonization, and antigen
321 presentation (Figure 7C).
322 These scRNAseq analyses revealed that while Trastuzumab with CD47 blockade polarizes
323 macrophages into an antitumor phenotype and greatly increases tumor phagocytosis, prolonged
324 treatment and continuous tumor hyper-phagocytosis may also trigger a transcriptional switch in 325 TAMs for repair of ADCP-induced tissue damage. Thus, while these studies demonstrate the
326 antitumor efficacy of Trastuzumab+CD47 blockade, it also suggest that prolonging this process
327 can trigger a wound healing response in macrophages that could have pro-tumor and/or
328 immunosuppressive functions (44-46).
329
330 Human CD47 gene expression is a prognostic factor in HER2+ breast cancer and limits
331 the therapeutic activity of Trastuzumab.
332 As all of our investigations had been performed on different murine HER2+ BC models, we also
333 wanted to determine if ADCP activity of Trastuzumab can be seen in human HER2+ BC and if
334 CD47 could likewise limit its antitumor efficacy. Based on our findings, we hypothesized that
335 CD47 expression may allow for resistance and reduced survival of HER2+ BC patients
336 undergoing Trastuzumab therapies. To investigate this hypothesis, we utilized the METABRIC
337 (Molecular Taxonomy of Breast Cancer International Consortium) gene expression dataset (47)
338 and stratified breast cancer patients of different molecular subtypes into “CD47 high” and “CD47
339 low” groups based on optimum threshold. This analysis revealed that CD47 gene expression
340 associates with lower patient overall survival (Figure 8A) and was most significant in the HER2+
341 molecular subtype compared to TNBC or ER+ subtypes (Figure 8B). This suggests that CD47
342 signaling may be an important resistance mechanism for HER2+ breast cancer and
343 Trastuzumab therapy.
344 We next investigated whether human CD47 limits the ADCP effect of Trastuzumab against
345 amplified HER2+ human BC cells. To address this in vitro, we first generated CD47-KO KPL-4
346 (HER2+ BC) cells (Figure S4C) and compared them to controls after Trastuzumab treatment in
347 ADCP experiments using human PBMC derived macrophages. As in mouse studies, we found
348 loss of human CD47 in tumor cells increased their susceptibility to ADCP elicited by 349 Trastuzumab (Figure 8C). To determine if this antitumor effect also occurs in vivo against
350 human HER2+ BC cells, we implanted KPL-4 control and CD47-KO cell lines into SCID-beige
351 mice (which contain a mouse SIRPα that can bind to human CD47 (48)) and treated with clinical
352 grade Trastuzumab. As before, we saw a strong effect from Trastuzumab treatment that was
353 significantly enhanced with CD47-KO, resulting in tumors being completely eliminated (Figure
354 8D). In Trastuzumab-treated mice, we again found a significant increase of TAMs (Figure 8E)
355 and an upregulation of pro-inflammatory genes (Figure 8F) as seen in the murine tumor model.
356 Unfortunately, the complete regression of CD47KO+Trastuzumab tumors precluded any further
357 analysis of these tumors. Collectively, these studies suggest that the dominant antitumor
358 mechanism of Trastuzumab therapy is through ADCP of HER2+ tumor cells, which can be
359 substantially impaired through the CD47-SIRPα axis. This suggests that combinatorial therapy
360 with CD47 blockade could be beneficial in patients with Trastuzumab resistance.
361
362 Discussion:
363 Even since the demonstration of clinical benefit provided by therapeutic HER2 specific mAbs
364 to patients with HER2 overexpressing BC, the mechanism of action for the therapeutic HER2
365 mAb, Trastuzumab has been the subject of numerous studies. Some reports suggest that
366 Trastuzumab may both block oncogenic HER2 signaling as well as inducing ADCC (7, 49, 50).
367 Using reflective murine versions of clinically approved HER2 specific mAb Trastuzumab, our in
368 vitro studies confirmed these reported MOAs, specifically blockade of HER2 signaling and
369 Trastuzumab-mediated ADCC by NK cells. In contrast, the in vivo antitumor mechanisms of
370 Trastuzumab/4D5 remain less conclusive, with early studies suggesting the importance of signal
371 blockade (51, 52), and subsequent studies demonstrating the direct involvement of ADCC
372 eliciting FcR-expressing cells (10) (such as neutrophils and NK cells), and more recent studies
373 highlighting the importance of adaptive immunity) (8, 15). Notably, few studies have examined 374 Trastuzumab-mediated ADCP with a single study documenting the ability of Trastuzumab to
375 elicit ADCP in vivo (16), while another study suggested that Trastuzumab-mediated ADCP from
376 tumor-associated macrophages (TAMs) is immunosuppressive (17). Consequently, our novel
377 models and agents provided a reliable platform and opportunity to interrogate the in vivo
378 antitumor mechanism of HER2 specific mAbs against HER2 driven BC.
379 In this study using multiple models of human HER2 expressing BC, i.e. MM3MG-HER2Δ16,
380 KPL-4 and an endogenous transgenic HER2+ BC model that is tolerant to human HER2, and
381 using the murine version of Trastuzumab with the functionally equivalent mouse isotype (4D5-
382 IgG2A), we demonstrate that macrophages are the major effectors carrying out the antitumor
383 immunity of Trastuzumab therapy through antibody-dependent-cellular-phagocytosis (ADCP).
384 Although TAMs have been shown to promote tumor progression, it is known that they also
385 retain their Fc-dependent antitumor function when induced by targeted therapies (i.e.
386 monoclonal antibodies) (53, 54). Our conclusion about the therapeutic impact of TAMs is
387 supported by the following findings: (1) the therapeutic effect of Trastuzumab is equivalent in
388 wild type and in SCID-beige mice and does not alter systemic HER2-specific adaptive immunity
389 and T cell/NK cell infiltration in tumors, indicating adaptive immunity and NK cells are not
390 necessary immune cells to mediate antitumor effects; (2) The depletion of macrophages but not
391 neutrophils had a significant negative effect on Trastuzumab efficacy, (3) Trastuzumab
392 treatment greatly and consistently increased TAMs frequency; (4) Trastuzumab treatment
393 induced ADCP of HER2+ tumor cells in vitro and in vivo in a Fc-receptor dependent fashion; (5)
394 Blocking of the innate immune ADCP CD47-SIRP1α regulatory axis significantly enhanced
395 Trastuzumab therapeutic outcomes and also increased ADCP of tumor cells; (6) Trastuzumab
396 combination with CD47 blockade induced TAMs into a highly phagocytic, immune-stimulatory
397 and antitumor phenotype but also produced a wound-healing, immune-regulatory group of
398 TAMs after prolonged tumor phagocytosis. 399 Our study provides insight on the potential of utilizing TAMs as a potent mediator of innate
400 antitumor immunity that can be further exploited. It was initially believed that macrophages were
401 present in high numbers in solid tumors as a mechanism of rejection. However, it soon became
402 clear that TAMs are typically unable to induce an effective antitumor response in the
403 immunosuppressive tumor microenvironment (55). Furthermore, high TAMs infiltration levels are
404 often associated with poor patient prognosis in breast, lung, prostate, liver, thyroid, pancreas,
405 kidney and many other solid cancer malignancies (56). Indeed, studies have shown that
406 immunosuppressive TAMs can support tumor development by promoting angiogenesis, tissue
407 invasion, metastasis and suppressing tumor attack by NK and CTL cells (57). In contrast, TAMs
408 in colorectal cancer have a more activated, immune-stimulatory phenotype and interestingly,
409 high TAM density in colorectal cancer correlates with increased patient survival, (54, 58).
410 Nonetheless, TAMs in multiple histologic types of tumors retain their expression of Fcγ-
411 receptors and increasing evidence suggests mAbs can phenotypically modify
412 immunosuppressive TAMs towards an antitumor phenotype (53, 54, 59). As such, the
413 manipulation of TAMs, potentially through a tumor targeting mAb (e.g. Trastuzumab) or
414 targeting of regulatory axis receptors (e.g. CD47/SIRPα), are promising therapeutic approaches
415 for multiple types of cancer.
416 While previous studies (8, 9) have documented the involvement of T cell immunity in
417 mediating HER2 mAbs efficacy, we were unable to detect a significant enhancement of adaptive
418 T cell responses with Trastuzumab monotherapy in either our orthotopic or HER2-tolerant
419 endogenous models of HER2+ BC. This may be due to the nature of our tumor models, the
420 timing of our analysis, or the specific mAb utilized. In our immunocompetent in vivo studies, we
421 utilized both murine and human HER2 mAbs similar to Trastuzumab (isotypes with a high A/I
422 ratio), as well as both human HER2 transformed cells and an endogenous mouse model of
423 HER2+ BC. Previous studies (8, 9, 17) have utilized rat neu expressing ErbB2 models, non- 424 HER2 transformed cells, and/or alternate Ab isotypes (mouse IgG1 with a low A/I ratio), which
425 may account for a lack of ADCP activity and alteration of immunogenicity. Of note, a recent
426 study using 4D5 antibody containing mouse IgG1 isotype reported that HER2 mAb elicited
427 macrophage ADCP is an immunosuppressive mechanism (17). Given that the mouse IgG1
428 subclass strongly activates inhibitory FCGR signaling on effector cells (low A/I ratio) and
429 therefore being very different from Trastuzumab (human IgG1, high A/I ratio) (18, 19, 40), this
430 emphasizes the need of using functionally equivalent mouse isotypes in translational studies to
431 accurately model human antibody therapy. Nevertheless, clinical studies have demonstrated
432 significant associations between adaptive immune responses and Trastuzumab +
433 chemotherapy efficacy (60). Phagocytosis of tumor cells by macrophages has been
434 documented to boost the priming of tumor specific adaptive CD4+ and CD8+ T cells (36, 61),
435 while different types of chemotherapy have been documented to enhance phagocytosis and
436 augment immunogenic tumor cell death (62). Taken together, we believe that the clinical use of
437 immunogenic chemotherapy combinations could stimulate adaptive immunity that would be
438 potentially enhanced by Trastuzumab-mediated ADCP. However, in the absence of strong
439 immune-stimulation (potentially through chemotherapy or immunogenic cell lines), Trastuzumab
440 does not appear highly effective at eliciting adaptive immunity and functions mainly through the
441 stimulation of ADCP.
442 In identifying ADCP as a critical mechanism for Trastuzumab efficacy, we also explored if it
443 could be further enhanced through the blockade of the CD47 innate immune checkpoint. CD47
444 is highly expressed in BC and functions to suppress phagocytosis through binding with SIRPα
445 on macrophages (23, 24). Interestingly, we found CD47 gene expression is a negative
446 prognostic factor in human BC, most significantly in HER2+ BC. As treatment of HER2
447 overexpressing tumors with Trastuzumab has been available for many years, this observation
448 suggests that CD47 may be functioning in Trastuzumab-treated patients to mediate 449 ADCP/therapeutic resistance. This conclusion is supported by the enhanced effects observed
450 between Trastuzumab and CD47 blockade in augmenting ADCP and antitumor effects in our
451 study. Moreover, single cell transcriptome analysis of the tumor microenvironment demonstrates
452 that Trastuzumab therapy stimulates TAMs into a pro-inflammatory antitumor phenotype, which
453 is further boosted by CD47 blockade (Figure 7A and 7B). Such changes in macrophage
454 phenotypes were also observed in co-cultured ADCP experiments. This suggests combination
455 of targeted mAbs therapy with CD47-SIRPα blockade could be beneficial in HER2+ BC and
456 potentially other solid tumors. Proof-of-concept studies using tumor-targeting mAbs and CD47
457 blockade have been demonstrated in preclinical lymphoma models, as well as a recent phase I
458 study of anti-CD20 mAbs (Rituximab) and CD47 blockade, in Rituximab-refractory Non-
459 Hodgkins Lymphoma patients (41, 63).
460 Additionally by implementing different methods, such as multi-color FACS analysis and
461 single-cell transcriptome analysis, we are the first to demonstrate in vivo tumor phagocytosis by
462 macrophages upon combination of Trastuzumab with CD47 blockade therapies. Moreover, we
463 were able to identify a distinct cluster of hyper-phagocytic TAMs within the TME. The
464 identification of this population of TAMs may also serve as a predictive biomarker of this form of
465 therapy. Gene expression analysis suggested that after profound phagocytosis of tumor cells,
466 these macrophages switched to a tissue repair phenotype, as evidenced by their upregulation of
467 gene signatures for wound-healing, growth factors, ECM remodeling, and anti-inflammatory
468 markers compared to resident macrophages (Figure 7C). Indeed, several studies have
469 demonstrated that cellular phagocytosis over time influences macrophage phenotype, causing a
470 switch from pro-inflammatory to a growth promoting, reparative phenotype (44-46). Interestingly,
471 while the total number of CD8+ TILs were reduced by prolonged combination therapy, the
472 relative percentage of cytotoxic T cells was greatly increased (Figure S7), possibly suggesting a
473 boost in overall tumor-specific T cells frequency. In this manner, this combination therapy may 474 allow for enhanced tumor antigen presentation at the earlier time points of treatment through
475 increasing tumor phagocytosis and antigen uptake, while prolonged treatment limits general T
476 cell infiltration after progression to a wound-healing TAM phenotype. Future experiments using
477 Trastuzumab+αCD47 mAbs analyzing multiple treatment time points, reducing the length of
478 treatment, or combining with other immune checkpoint blockades could potentially improve the
479 infiltration of tumor-specific CTLs.
480 While this is an area in need of additional study, our results suggest that strategies to
481 specifically enhance ADCP activity may be critical in overcoming resistance to HER2 mAb
482 therapies by inhibiting tumor growth and potentially enhancing antigen presentation. While only
483 a single clinical trial using combination of a therapeutic mAb (anti-CD20) and CD47 mAbs has
484 been reported, this study demonstrated a ~50% response rate (11 of 22 patients) and ~36%
485 complete response rate (8 of 22 patients) in resistant/refractory non-Hodgkins’ lymphoma (41).
486 These clinical findings, in conjunction with our recent preclinical studies, strongly suggest
487 combination therapy approach of Trastuzumab with CD47-SIPRα checkpoint blockade could
488 potentially show more benefits and insights of Trastuzumab therapy in HER2+ BC patients.
489 However, the transcriptional switch seen in macrophages after prolonged ADCP also requires
490 attention in future studies that utilize CD47 blockade in combination with targeted mAbs.
491 In sum, our study suggests that the dominant therapeutic MOA for Trastuzumab is through its
492 elicitation of TAM mediated ADCP, which can be enhanced by strategies to specifically augment
493 ADCP. This has potential implications for the use of Trastuzumab in HER2+ cancers, as well as
494 the utilization of other targeted therapies (such as EGFR, CD20, etc.), where efforts to enhance
495 and control ADCP have not been prioritized.
496
497 Methods: 498 Cell lines and genetic modifications strategies.
499 Mouse mammary gland cell lines MM3MG and EPH4 were obtained from ATCC and cultured as
500 described by ATCC protocol. The cDNA of a naturally occurring splice variant of human HER2
501 (HER2Δ16), ), or wild type HER2, were transduced into MM3MG and NMUMG cells using
502 lentiviral transduction. Human HER2+ breast cancer cell line KPL4 was a kind gift from Dr.
503 Kurebayashi (University of Kawasaki Medical School, Kurashiki, Japan) (64) and SKBR3 were
504 purchased from ATCC and cultured as described by ATCC protocol. Jurkat-NFAT-LUC line
505 were obtained from Invivogen (jktl-nfat). CRISPR-Cas9 approached were used to knockout
506 mouse Cd47 in MM3MG-HER2Δ16 cells or human CD47 in KPL4 cells. Gene targeting of
507 mouse Cd47, human CD47 and control gene GFP by CRISPR/Cas9 was accomplished through
508 the use of pLentiCRISPRv2 (Addgene plasmid # 52961) using published protocols (65). Genes
509 were targeted using the guide sequences (cccttgcatcgtccgtaatg and ggataagcgcgatgccatgg) for
510 mouse Cd47, (atcgagctaaaatatcgtgt and ctactgaagtatacgtaaag) for human CD47, and
511 (GGGCGAGGAGCTGTTCACCG) for the GFP control. Successful targeting of CD47 was
512 determined by flow cytometry screening after single cell clonal selection. The overexpression
513 vector of mouse Cd47 was generated by synthesizing the Cd47 gene and cloning it into
514 pENTR1a (using NEB Gibson Isothermal Assembly Mix) and then using L/R clonase to
515 generate expression lentiviruses (pLenti-CMV-Puro) and cells were selected using puromycin.
516
517 Mice
518 Female Balb/c (Jackson Labs, Bar Harbor, MA), SCID-beige (C.B-Igh-1b/GbmsTac-Prkdcscid-
519 Lystbg N7; Taconic Biosciences, Model# CBSCBG), Fcer1g-/- (C.129P2(B6)-Fcer1gtm1Rav N12;
520 Taconic Biosciences, Model# 584) mice between the ages of 6 and 10 weeks old were used for
521 all experiments. The HER2Δ16 transgenic model was generated by crossing MMTV-rtTA strain 522 (a kind gift by Dr. Lewis Chodosh, UPenn, Philadelphia, USA) with TetO-HER2d16-IRES-EGFP
523 strain (a kind gift by Dr. William Muller, McGill University, Montreal, Canada) (20). 6-weeks old
524 mice were put on doxycycline diet and enrolled for experiments when they develop palpable
525 breast tumor (usually in 4-6 weeks post dox diet).
526
527 Therapeutic antibodies and other experimental reagents
528 Clinical Grade Trastuzumab (human IgG1) were obtained from Duke Medical Center. 4D5, the
529 murine version of Trastuzumab (with the IgG2A and IgG1 mouse isotypes) were produced by
530 GenScript through special request. CD47 Blockade antibody MIAP410 (BE0283) and control
531 mouse IgG2A (BE0085) were purchased from BIOXCELL. Neutrophil depletion anti-LY6G
532 antibody (IA8, BP0075-1) and macrophage depletion antibody anti-CSF1R (AS598, BE0213)
533 were purchased from BIOXCELL. Clodronate liposomes were purchased from
534 www.clodronateliposomes.org
535
536 Orthotopic implanted HER2+ breast cancer mouse models and therapeutic antibody
537 treatments
538 MM3MG cells expressing human HER2Δ16 were implanted into their mammary fat pads (1x106
539 cells) of Balb/c mice. For the human xenograft model, KPL-4 cells (1x106 cells) were implanted
540 into mammary fat pads (MFP) of SCID-Beige Balb/c mice. Tumor growth were measured with
541 caliper-based tumor volume measurement (length x width x depth) over time. For therapeutic
542 treatments, Trastuzumab or 4D5 were administered weekly (200 µg per mice intraperitoneally)
543 around 4-5 days post tumor implantation. CD47 blockade (MIAP410) were administered weekly
544 when indicated (300 µg per mice intraperitoneally) around 4-5 weeks post tumor implantation.
545 For macrophage depletion, anti-CSF1R antibody were administered triweekly (300 µg per mice 546 intraperitoneally), starting at two weeks before tumor implantation and with treatment
547 maintained over the course of the experiment. Clodronate liposomes were administered
548 biweekly (100 µL per mice, intraperitoneally). For neutrophil depletion, anti-LY6G antibody were
549 administered biweekly (300 µg per mice intraperitoneally) for the first two weeks post tumor
550 implantation.
551
552 Transgenic HER2Δ16 mouse model and therapeutic antibody treatments
553 The HER2Δ16 transgenic mouse model was generated by crossing two strains of mice, TetO-
554 HER2Δ16-IRES-EGFP and MMTV-rtTA. This system was described previously (20), but utilizes
555 a TET-ON system (with MTV-rtTA) to drive expression of HER2Δ16 to generate HER2+ BC. For
556 experiments, one-month old mice were put on Doxycycline diet (200mg/kg, Bio-Serv,
557 Flemington, NJ) to induce spontaneous HER2-driven breast cancer. Individual animals were
558 randomly enrolled into a specific treatment group as soon as palpable breast tumors were
559 detected (~200mm3) in any of the eight mammary fat pads. Control and 4D5-IgG2A antibodies
560 were treated 200 µg weekly, whereas MIAP410 were treated 300 µg weekly intraperitoneally.
561 Animals were terminated once their total tumor volume reached >2000 mm3.
562
563 Flow Cytometry Analysis of tumor infiltrating immune cells
564 When tumor growth reached humane end point size (>1000 mm3), whole tumors from mice
565 were harvested and cut into <1 mm small pieces, and incubated for 1 hour in digestion buffer
566 (DMEM + 100 µg/mL collagenase + 0.2 U/mL DNAse + 1 µg/mL hyalurodinase). Single cell
567 suspensions were spin down through a 70 µm filter and washed with medium. Approximately 5
568 million cells were used for staining and flow cytometry analysis. The following panel of immune
569 cell markers (Biolegend) were used: CD45 BV650, CD11b PE-Cy7, LY6G APC, LY6C BV410, 570 F4/80 PerCP-CY5.5, CD8B APC-CY7, CD4 PE-TR, CD49b FITC and viability dye (Aqua or
571 Red). Tumor-associated macrophages (TAM) were identified by F4/80+ LY6G- LY6C- CD11b+
572 CD45+ gating. LY6G+ neutrophils were identified by LY6G+ CD11b+ CD45+ gating, whereas
573 LY6C+ monocytes were gated on LY6C+ CD11b+ CD45+ cells.
574
575 In vivo ADCP assay
576 MM3MG-HER2Δ16 cells were labeled with Vybrant DiD labeling solution (Thermo V22887)
577 according to manufacturer’s protocol, and labeled cells were implanted (1x106) into MFP of
578 Balb/c mice. Once tumor reaches around 1000 mm3 in sizes, mice were treated with either
579 control antibody (200 µg), 4D5 (200 µg), or 4D5 in combination with MIAP410 (300 µg) per day
580 for two consecutive days. Tumor associated macrophages were analyzed by FACS (CD11b+,
581 F4/80+, LY6G-, LY6C-) and the percentage of TAMs that have taken up DiD-labeled tumor cells
582 were quantified for in vivo ADCP analysis.
583
584 In vitro ADCP and ADCC assays
585 ADCP and ADCC by macrophages – Bone marrow derived macrophages (BMDM) were
586 generated from mouse tibia, differentiated for 10 days with 50 ng/mL mouse MCSF (Peprotech
587 315-02). Briefly, 50 million bone marrow cells were plated in 10 cm2 tissue culture dish with
588 MCSF on day 0. Unattached cells in supernatant were removed and fresh media + MCSF were
589 added on day 3, day 6 and day 9. BMDM were used for ADCP/ADCC assays on day 10. Tumor
590 cells MM3MG-HER2Δ16 were labeled with Brilliant Violet 450 Dye (BD 562158) according to
591 manufacturer’s protocol, and incubated with control or anti-HER2 antibodies (10 µg/mL) in 96-
592 wells (100,000 cells/well) for 30 minutes at 37 0C. BMDM were then added for co-culture at a
593 3:1 ratio of Tumor vs BMDM. After 2 hours co-culture, phagocytosis of BV450-labeled tumor 594 cells by BMDM were analyzed by FACS with CD45-APC staining and Live-death (Red) staining.
595 When indicated, ADCP inhibitor Latrunculin A (120 nM, Thermo L12370) and ADCC inhibitor
596 Concanamycin A (1 µM, Sigma C9705) were added as assay controls. For human
597 macrophages ADCP assay, human monocytes-derived macrophages (hMDM) were generated
598 from three donors’ PBMCs. hMDM were generated with 50 ng/mL human MCSF (Peprotech
599 300-25) and 50 ng/mL human GM-CSF (Peprotech 300-03). KPL-4 cells were used as human
600 HER2+ tumor targets and labeled and co-cultured similarly as with mouse ADCP assay.
601
602 FCGR binding/activation assay
603 Jurkat cells expressing mouse Fcgr1, Fcgr2b, Fcgr3 or Fcgr4 with NFAT-Luciferase reporter
604 were generated with lentiviral transduction and selected with puromycin (validated in Figure
605 S4D-F). For the assay, MM3MG breast cancer lines expressing HER2 were first plated and
606 treated with Trastuzumab or 4D5 antibodies or control IgG for 1 hour. Jurkat-FCGR-NFAT-LUC
607 effector cells were added and co-cultured for 4 hours. FCGR signaling activation were assessed
608 by luciferase activity quantification.
609
610 Multiplex cytokine and chemokine assay.
611 BMDM were co-cultured with MM3MG-HER2Δ16 cells for 24 hours, and supernatants were
612 harvested for analysis of cytokines/chemokines levels. The 26-Plex Mouse ProcartaPlex™
613 Panel1 kit (Thermo) was used and analyzed using the Luminex MAGPIX system.
614
615 METABRIC analysis of CD47 expression in breast cancer patients 616 Pre-processing METABRIC data: Previously normalized gene expression and clinical data were
617 obtained from the European Genome-Phenome Archive (EGA) under the accession id
618 EGAS00000000098 after appropriate permissions from the authors (47). The discovery dataset
619 was composed of 997 primary breast tumors and a second validation set was composed of 995
620 primary breast tumors. The expression data were arrayed on Illumina HT12 Bead Chip
621 composed of 48,803 transcripts. Multiple exon-level probe sets from a transcript cluster
622 grouping were aggregated to a single gene-level probe set using maximum values across all the
623 probes for a given gene. The resulting gene expression matrix consists of 28,503 genes.
624 In order to assess the prognostic significance of CD47 in METABRIC data we generated
625 Kaplan-Meier survival curves on patients stratified by the average expression of CD47 (in to low
626 and high groups) using R package ‘survminer’ (version 0.4.3). Distributions of Kaplan-Meier
627 survival curves for progression-free and overall survival were compared using log-rank test, and
628 a log-rank test p- value ≤ 0.05 is considered to be statistically significant.
629
630 Single-Cell RNA-Seq Analysis
631 Fastq files from 10X library sequencing were processed using the CellRanger pipeline available
632 from 10X genomics. As part of the processing the assembled sequencing reads were mapped
633 to the mm10 mouse genome. In order to obtain the transcript counts of human ERBB2 (HER2)
634 the sequencing reads were separately aligned to the current version of the human genome,
635 GRCh38.
636 The gene expression files consisting of raw counts at the gene level for each cell which was
637 analyzed using version 2.3.4 of the Seurat package. The human ERBB2 counts were combined
638 with the mm10 based counts into once expression matrix for each sample. Briefly, the data
639 analysis steps using Seurat consisted of combining the gene counts for all the cells in the 640 different conditions into one matrix, filtering low quality cells, normalizing, and adjusting for cell
641 cycle and batch effects. Unsupervised clustering was done to separate the cell types and
642 markers for the cell types were identified using differential gene expression. These markers
643 were then used for identifying the cell subpopulations within the tumor microenvironment,
644 namely the Immune cells, Tumor cells and Fibroblasts. The normalized gene counts were used
645 to generate tSNE maps for visualization of the cell types and heatmaps for the cell type specific
646 gene expression. Expression of predefined gene sets representing pathways of interest where
647 obtained from previous publications and summarized in Table S2. The data discussed in this
648 publication have been deposited in NCBI's Gene Expression Omnibus and are accessible
649 through GEO Series accession number GSE139492
650 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE139492)
651
652 Statistical methods
653 All statistical analysis of tumor growth comparisons and tumor immune infiltrates were
654 performed with GraphPad Prism (v8) using two-way ANOVA or one-way ANOVA test with
655 Tukey’s multiple comparisons. Unless otherwise indicated in the figure, tests results were
656 shown between treatment vs control group. Group sizes for animal tumor growth experiments
657 were determined based on preliminary datasets. All subjects in animal experiments were
658 randomized into a treatment or control group. For in vitro experiments, i.e. ADCP/ADCC/CDC
659 assays, ELISPOT assays, FCGR signaling assay and cytokine assays, all data were statistically
660 analyzed by one-way ANOVA test with Tukey’s multiple comparisons, and performed with at
661 least four biological replicates per experiment and repeated at least two times. RT-qPCR data
662 were analyzed by two-sided Student’s t test for each target gene. 95% confidence interval was
663 considered for statistics and p<0.05 was considered significant. 664
665 Study Approval:
666 All animals were maintained, bred, in accordance with Duke Institutional Animal Care and Use
667 Committee–approved protocol (A198-18-08), and supervised by Division of Laboratory Animal
668 Resources (DLAR).
669
670 Author Contributions:
671 Li-Chung Tsao, H. Kim Lyerly and Zachary C. Hartman conceived the project and wrote the
672 manuscript. Li-Chung Tsao and Zachary C. Hartman designed the experiments, analyzed and
673 interpreted the data. Li-Chung Tsao performed the animal experiments, with assistance from
674 Erika J. Crosby, Bin-Jin Hwang, Xiao Yi Yang, Cong-Xiao Liu and Christopher A. Rabiola. Tao
675 Wang provided technical support and suggestions for flow cytometry. Zachary C. Hartman
676 generated various cell lines and CRISPR knock outs with assistance from Junping Wei and
677 Gangjun Lei. Li-Chung Tsao performed the in vitro cell culture assays. Li-Chung Tsao designed
678 single-cell RNA sequencing experiment and generated 10X Genomics cDNA libraries. Pankaj
679 Agawal performed the clustering and statistical analysis and illustration of single-cell RNA-Seq
680 results. Chaitanya Acharya conducted the stratification and statistical analysis of METABRIC
681 datasets. Erika J. Crosby, Timothy N. Trotter and Casey W. Shuptrine provided intellectual input
682 and discussions. The MMTV-rtTA mouse strain was provided by Dr. Lewis Chodosh (UPenn)
683 and TetO-HER2d16-IRES-EGFP mouse by Dr. William Muller (McGill University).
684
685 Acknowledgements: This research was supported by grants from the National Institutes of
686 Health (NIH) (5K12CA100639-09 to ZCH, 1R01CA238217-01A1 to ZCH) and (T32CA009111 to
687 LCT), Department of Defense (DOD) (BC113107 to HKL), Merck MISP Program (LKR160831 to 688 ZCH), and Susan G. Komen (CCR14299200 to ZCH). We would also like to acknowledge all of
689 the members of the Applied Therapeutics Center for their generous technical assistance, help
690 and insights into this project.
691 692 References: 693 694 1. Slamon DJ, Clark GM, Wong SG, Levin WJ, Ullrich A, and McGuire WL. Human breast cancer: 695 correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science (New 696 York, NY). 1987;235(4785):177-82. 697 2. Di Fiore PP, Pierce JH, Kraus MH, Segatto O, King CR, and Aaronson SA. erbB-2 is a potent 698 oncogene when overexpressed in NIH/3T3 cells. Science (New York, NY). 1987;237(4811):178- 699 82. 700 3. Hudis CA. Trastuzumab--mechanism of action and use in clinical practice. The New England 701 journal of medicine. 2007;357(1):39-51. 702 4. Untch M, Rezai M, Loibl S, Fasching PA, Huober J, Tesch H, et al. Neoadjuvant treatment with 703 trastuzumab in HER2-positive breast cancer: results from the GeparQuattro study. Journal of 704 clinical oncology : official journal of the American Society of Clinical Oncology. 2010;28(12):2024- 705 31. 706 5. Gianni L, Pienkowski T, Im Y-H, Tseng L-M, Liu M-C, Lluch A, et al. 5-year analysis of neoadjuvant 707 pertuzumab and trastuzumab in patients with locally advanced, inflammatory, or early-stage 708 HER2-positive breast cancer (NeoSphere): a multicentre, open-label, phase 2 randomised trial. 709 The Lancet Oncology. 2016;17(6):791-800. 710 6. de Azambuja E, Holmes AP, Piccart-Gebhart M, Holmes E, Di Cosimo S, Swaby RF, et al. Lapatinib 711 with trastuzumab for HER2-positive early breast cancer (NeoALTTO): survival outcomes of a 712 randomised, open-label, multicentre, phase 3 trial and their association with pathological 713 complete response. The Lancet Oncology. 2014;15(10):1137-46. 714 7. Bianchini G, and Gianni L. The immune system and response to HER2-targeted treatment in 715 breast cancer. The Lancet Oncology. 2014;15(2):e58-e68. 716 8. Park S, Jiang Z, Mortenson ED, Deng L, Radkevich-brown O, Yang X, et al. The Therapeutic Effect 717 of Anti-HER2 / neu Antibody Depends on Both Innate and Adaptive Immunity. Cancer Cell. 718 2010;18(2):160-70. 719 9. Stagg J, Loi S, Divisekera U, Foong S, Duret H, and Yagita H. Anti – ErbB-2 mAb therapy requires 720 type I and II interferons and synergizes with anti – PD-1 or anti-CD137 mAb therapy. 2011:10-5. 721 10. Clynes RA, Towers TL, Presta LG, and Ravetch JV. Inhibitory Fc receptors modulate in vivo 722 cytoxicity against tumor targets. Nature Medicine. 2000;6:443. 723 11. Musolino A, Naldi N, Dieci MV, Zanoni D, Rimanti A, Boggiani D, et al. Immunoglobulin G 724 fragment C receptor polymorphisms and efficacy of preoperative chemotherapy plus 725 trastuzumab and lapatinib in HER2-positive breast cancer. The pharmacogenomics journal. 726 2016;16(5):472-7. 727 12. Muntasell A, Cabo M, Servitja S, Tusquets I, Martinez-Garcia M, Rovira A, et al. Interplay 728 between Natural Killer Cells and Anti-HER2 Antibodies: Perspectives for Breast Cancer 729 Immunotherapy. Front Immunol. 2017;8:1544. 730 13. Muntasell A, Rojo F, Servitja S, Rubio-Perez C, Cabo M, Tamborero D, et al. NK Cell Infiltrates and 731 HLA Class I Expression in Primary HER2(+) Breast Cancer Predict and Uncouple Pathological 732 Response and Disease-free Survival. Clinical cancer research : an official journal of the American 733 Association for Cancer Research. 2019;25(5):1535-45. 734 14. Albanesi M, Mancardi DA, Jonsson F, Iannascoli B, Fiette L, Di Santo JP, et al. Neutrophils 735 mediate antibody-induced antitumor effects in mice. Blood. 2013;122(18):3160-4. 736 15. Mortenson ED, Park S, Jiang Z, Wang S, and Fu YX. Effective anti-neu-initiated antitumor 737 responses require the complex role of CD4+ T cells. Clinical cancer research : an official journal 738 of the American Association for Cancer Research. 2013;19(6):1476-86. 739 16. Shi Y, Fan X, Deng H, Brezski RJ, Rycyzyn M, Jordan RE, et al. Trastuzumab triggers phagocytic 740 killing of high HER2 cancer cells in vitro and in vivo by interaction with Fcgamma receptors on 741 macrophages. J Immunol. 2015;194(9):4379-86. 742 17. Su S, Zhao J, Xing Y, Zhang X, Liu J, Ouyang Q, et al. Immune Checkpoint Inhibition Overcomes 743 ADCP-Induced Immunosuppression by Macrophages. Cell. 2018;175(2):442-57 e23. 744 18. Bruhns P, and Jonsson F. Mouse and human FcR effector functions. Immunol Rev. 745 2015;268(1):25-51. 746 19. Nimmerjahn F, and Ravetch JV. Divergent Immunoglobulin G Subclass Activity Through Selective 747 Fc Receptor Binding. Science. 2005;310(5753):1510. 748 20. Turpin J, Ling C, Crosby EJ, Hartman ZC, Simond AM, Chodosh LA, et al. The ErbB2ΔEx16 splice 749 variant is a major oncogenic driver in breast cancer that promotes a pro-metastatic tumor 750 microenvironment. Oncogene. 2016;35(47):6053-64. 751 21. Crosby EJ, Wei J, Yang XY, Lei G, Wang T, Liu CX, et al. Complimentary mechanisms of dual 752 checkpoint blockade expand unique T-cell repertoires and activate adaptive anti-tumor 753 immunity in triple-negative breast tumors. Oncoimmunology. 2018;7(5):e1421891. 754 22. Jaiswal S, Chao MP, Majeti R, and Weissman IL. Macrophages as mediators of tumor 755 immunosurveillance. Trends in immunology. 2010;31(6):212-9. 756 23. Mantovani A, and Longo DL. Macrophage Checkpoint Blockade in Cancer — Back to the Future. 757 New England Journal of Medicine. 2018;379(18):1777-9. 758 24. Huang Y, Ma Y, Gao P, and Yao Z. Targeting CD47: The achievements and concerns of current 759 studies on cancer immunotherapy. Journal of Thoracic Disease. 2017;9(2):E168-E74. 760 25. Zhang H, Lu H, Xiang L, Bullen JW, Zhang C, Samanta D, et al. HIF-1 regulates CD47 expression in 761 breast cancer cells to promote evasion of phagocytosis and maintenance of cancer stem cells. 762 Proceedings of the National Academy of Sciences. 2015;112(45):E6215. 763 26. Yan M, Schwaederle M, Arguello D, Millis SZ, Gatalica Z, and Kurzrock R. HER2 expression status 764 in diverse cancers: review of results from 37,992 patients. Cancer metastasis reviews. 765 2015;34(1):157-64. 766 27. Carter P, Presta L, Gorman CM, Ridgway JB, Henner D, Wong WL, et al. Humanization of an anti- 767 p185HER2 antibody for human cancer therapy. Proceedings of the National Academy of 768 Sciences. 1992;89(10):4285. 769 28. Stewart R, Hammond SA, Oberst M, and Wilkinson RW. The role of Fc gamma receptors in the 770 activity of immunomodulatory antibodies for cancer. Journal for ImmunoTherapy of Cancer. 771 2014;2(1):1-10. 772 29. Moasser MM. Two dimensions in targeting HER2. Journal of clinical oncology : official journal of 773 the American Society of Clinical Oncology. 2014;32(19):2074-7. 774 30. Moasser MM, and Krop IE. The Evolving Landscape of HER2 Targeting in Breast Cancer. JAMA 775 Oncol. 2015;1(8):1154-61. 776 31. Wang Y, Yang YJ, Wang Z, Liao J, Liu M, Zhong XR, et al. CD55 and CD59 expression protects 777 HER2-overexpressing breast cancer cells from trastuzumab-induced complement-dependent 778 cytotoxicity. Oncol Lett. 2017;14(3):2961-9. 779 32. Gordon SR, Maute RL, Dulken BW, Hutter G, George BM, McCracken MN, et al. PD-1 expression 780 by tumour-associated macrophages inhibits phagocytosis and tumour immunity. Nature. 781 2017;545(7655):495-9. 782 33. Willingham SB, Volkmer JP, Gentles AJ, Sahoo D, Dalerba P, Mitra SS, et al. The CD47-signal 783 regulatory protein alpha (SIRPa) interaction is a therapeutic target for human solid tumors. 784 Proceedings of the National Academy of Sciences. 2012;109(17):6662-7. 785 34. Oliveira CA, Kashman Y Fau - Mantovani B, and Mantovani B. Effects of latrunculin A on 786 immunological phagocytosis and macrophage spreading-associated changes in the F-actin/G- 787 actin content of the cells. (0009-2797 (Print)). 788 35. Toda H, Araki K, Moritomo T, and Nakanishi T. Perforin-dependent cytotoxic mechanism in 789 killing by CD8 positive T cells in ginbuna crucian carp, Carassius auratus langsdorfii. 790 Developmental & Comparative Immunology. 2011;35(1):88-93. 791 36. Guilliams M, Bruhns P, Saeys Y, Hammad H, and Lambrecht BN. The function of Fcgamma 792 receptors in dendritic cells and macrophages. Nat Rev Immunol. 2014;14(2):94-108. 793 37. Bournazos S, Wang TT, and Ravetch JV. The Role and Function of Fcgamma Receptors on 794 Myeloid Cells. Microbiol Spectr. 2016;4(6). 795 38. Nimmerjahn F, Lux A, Albert H, Woigk M, Lehmann C, Dudziak D, et al. FcγRIV deletion reveals its 796 central role for IgG2a and IgG2b activity in vivo. Proceedings of the National Academy of 797 Sciences. 2010;107(45):19396. 798 39. Parekh BS, Berger E, Sibley S, Cahya S, Xiao L, LaCerte MA, et al. Development and validation of 799 an antibody-dependent cell-mediated cytotoxicity-reporter gene assay. MAbs. 2012;4(3):310-8. 800 40. Dekkers G, Bentlage AEH, Stegmann TC, Howie HL, Lissenberg-Thunnissen S, Zimring J, et al. 801 Affinity of human IgG subclasses to mouse Fc gamma receptors. MAbs. 2017;9(5):767-73. 802 41. Advani R, Flinn I, Popplewell L, Forero A, Bartlett NL, Ghosh N, et al. CD47 Blockade by Hu5F9-G4 803 and Rituximab in Non-Hodgkin's Lymphoma. N Engl J Med. 2018;379(18):1711-21. 804 42. Lawson MA, McDonald MM, Kovacic N, Hua Khoo W, Terry RL, Down J, et al. Osteoclasts control 805 reactivation of dormant myeloma cells by remodelling the endosteal niche. Nature 806 Communications. 2015;6:8983. 807 43. Turpin J, Ling C, Crosby EJ, Hartman ZC, Simond AM, Chodosh LA, et al. The ErbB2DeltaEx16 808 splice variant is a major oncogenic driver in breast cancer that promotes a pro-metastatic tumor 809 microenvironment. Oncogene. 2016;35(47):6053-64. 810 44. Fadok VA, Bratton DL, Konowal A, Freed PW, Westcott JY, and Henson PM. Macrophages that 811 have ingested apoptotic cells in vitro inhibit proinflammatory cytokine production through 812 autocrine/paracrine mechanisms involving TGF-beta, PGE2, and PAF. The Journal of clinical 813 investigation. 1998;101(4):890-8. 814 45. Lech M, and Anders H-J. Macrophages and fibrosis: How resident and infiltrating mononuclear 815 phagocytes orchestrate all phases of tissue injury and repair. Biochimica et Biophysica Acta 816 (BBA) - Molecular Basis of Disease. 2013;1832(7):989-97. 817 46. Minutti CM, Knipper JA, Allen JE, and Zaiss DMW. Tissue-specific contribution of macrophages to 818 wound healing. Seminars in Cell & Developmental Biology. 2017;61:3-11. 819 47. Curtis C, Shah SP, Chin S-F, Turashvili G, Rueda OM, Dunning MJ, et al. The genomic and 820 transcriptomic architecture of 2,000 breast tumours reveals novel subgroups. Nature. 821 2012;486:346. 822 48. Kwong LS, Brown MH, Barclay AN, and Hatherley D. Signal-regulatory protein α from the NOD 823 mouse binds human CD47 with an exceptionally high affinity-- implications for engraftment of 824 human cells. Immunology. 2014;143(1):61-7. 825 49. Hurvitz SA, Betting DJ, Stern HM, Quinaux E, Stinson J, Seshagiri S, et al. Analysis of Fcgamma 826 receptor IIIa and IIa polymorphisms: lack of correlation with outcome in trastuzumab-treated 827 breast cancer patients. Clinical cancer research : an official journal of the American Association 828 for Cancer Research. 2012;18(12):3478-86. 829 50. Barok M, Isola J, Pályi-Krekk Z, Nagy P, Juhász I, Vereb G, et al. Trastuzumab causes antibody- 830 dependent cellular cytotoxicity–mediated growth inhibition of submacroscopic JIMT-1 breast 831 cancer xenografts despite intrinsic drug resistance. Molecular Cancer Therapeutics. 832 2007;6(7):2065. 833 51. Ritter CA, Perez-Torres M, Rinehart C, Guix M, Dugger T, Engelman JA, et al. Human breast 834 cancer cells selected for resistance to trastuzumab in vivo overexpress epidermal growth factor 835 receptor and ErbB ligands and remain dependent on the ErbB receptor network. Clinical cancer 836 research : an official journal of the American Association for Cancer Research. 2007;13(16):4909- 837 19. 838 52. Yakes FM, Chinratanalab W, Ritter CA, King W, Seelig S, and Arteaga CL. Herceptin-induced 839 inhibition of phosphatidylinositol-3 kinase and Akt Is required for antibody-mediated effects on 840 p27, cyclin D1, and antitumor action. Cancer research. 2002;62(14):4132-41. 841 53. Grugan KD, McCabe FL, Kinder M, Greenplate AR, Harman BC, Ekert JE, et al. Tumor-Associated 842 Macrophages Promote Invasion while Retaining Fc-Dependent Anti-Tumor Function. The Journal 843 of Immunology. 2012;189(11):5457. 844 54. Gul N, and van Egmond M. Antibody-Dependent Phagocytosis of Tumor Cells by Macrophages: A 845 Potent Effector Mechanism of Monoclonal Antibody Therapy of Cancer. Cancer Res. 846 2015;75(23):5008-13. 847 55. Brown JM, Recht L, and Strober S. The Promise of Targeting Macrophages in Cancer Therapy. 848 Clinical cancer research : an official journal of the American Association for Cancer Research. 849 2017;23(13):3241-50. 850 56. Ruffell B, Affara NI, and Coussens LM. Differential macrophage programming in the tumor 851 microenvironment. Trends Immunol. 2012;33(3):119-26. 852 57. Noy R, and Pollard JW. Tumor-associated macrophages: from mechanisms to therapy. Immunity. 853 2014;41(1):49-61. 854 58. Zhang QW, Liu L, Gong CY, Shi HS, Zeng YH, Wang XZ, et al. Prognostic significance of tumor- 855 associated macrophages in solid tumor: a meta-analysis of the literature. PLoS One. 856 2012;7(12):e50946. 857 59. Mantovani A, Marchesi F, Malesci A, Laghi L, and Allavena P. Tumour-associated macrophages as 858 treatment targets in oncology. Nature reviews Clinical oncology. 2017;14(7):399-416. 859 60. Taylor C, Hershman D Fau - Shah N, Shah N Fau - Suciu-Foca N, Suciu-Foca N Fau - Petrylak DP, 860 Petrylak Dp Fau - Taub R, Taub R Fau - Vahdat L, et al. Augmented HER-2 specific immunity 861 during treatment with trastuzumab and chemotherapy. (1078-0432 (Print)). 862 61. Abès R, Gélizé E, Fridman WH, and Teillaud J-L. Long-lasting antitumor protection by anti-CD20 863 antibody through cellular immune response. Blood. 2010;116(6):926. 864 62. Pfirschke C, Engblom C, Rickelt S, Cortez-Retamozo V, Garris C, Pucci F, et al. Immunogenic 865 Chemotherapy Sensitizes Tumors to Checkpoint Blockade Therapy. Immunity. 2016;44(2):343- 866 54. 867 63. Chao MP, Alizadeh AA, Tang C, Myklebust JH, Varghese B, Gill S, et al. Anti-CD47 antibody 868 synergizes with rituximab to promote phagocytosis and eradicate non-Hodgkin lymphoma. Cell. 869 2010;142(5):699-713. 870 64. Kurebayashi J, Otsuki T, Tang CK, Kurosumi M, Yamamoto S, Tanaka K, et al. Isolation and 871 characterization of a new human breast cancer cell line, KPL-4, expressing the Erb B family 872 receptors and interleukin-6. BrJCancer. 1999;79(5-6):707-17. 873 65. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen TS, et al. Genome-Scale CRISPR- 874 Cas9 Knockout Screening in Human Cells. Science. 2014;343(6166):84. 875 876 877 878 Figure and figure legends:
A B MM3MG-HER2Δ16 grow th in Balb/c mice
2000 Control IgG Trastuzumab
3 1500 4D5-IgG2A
m
m
e z
i 1000
s
r
o m
u **** T 500 ****
0 0 5 10 15 20 25 30 Days post tumor injection C Control IgG 4D5-IgG2A Trastuzumab Tumor-associated macrophages (TAMs)
80 ***
- ***
C 6
Y 60
L
/
-
s
l
l
G
e
6
c
Y
+ L
/ 40
5
+ 4
13.1% 0
D
8 C 82.6% 4
75.8%
f
F
/ LY6G
o 20
+
b
1
1 D
C 0 F4/80 % Control IgG 4D5-IgG2A Trastuzumab Gated on liv e CD45+ CD11b+ Ly 6C- tumor inf iltrates
D SCID-Beige mice E F Neutrophil depletion Depletion of TAMs G Macrophage depletion Control IgG s 1200 Control IgG
1500 s
n 80 * l
Control IgG l o
Trastuzumab i
1000 e t
) Control IgG + CSF1R
c
3
a
l
** ) 1000 )
Control IgG + LY6G - 3
4D5-IgG2A u
3 4D5-IgG2A
C p
m 60 n.s
m
6 m
750 o 4D5-IgG2A + CSF1R m
Y 800 m 4D5-IgG2A p
m 1000 (
n.s
(
L
(
+
e
-
e
e
5
z z
i ***
4D5-IgG2A + LY6G G
i z 4 600
i 40
s
s
6
s
500 D ***
r
r
Y
r
C
o
o
L
o
400
+
m m
500 +
m
b
u u
0 20 u
**** 1
T T
250 8
/ T
1 200 4
**** n.s D
F
C
%
n 0 0 0 0 i x R A R 0 5 10 15 20 25 0 5 10 15 20 0 5 10 15 20 25 R 1 2 1 l F G F ro S g S t C -I C Days post tumor injection Days post tumor injection Days post tumor injection n 5 o D C 4 + A 2 G g -I 5 D 4
Macrophages w ith dye-labeled HER2+ BC H ADCP ADCC Macrophages with 4D5-IgG2A **** 4 20 unlabeled HER2+ BC Control IgG 4D5-IgG2A + ADCP inhibitor **** **** ****
h 3
t a
6.6% 18% 4.8% 15 e
s
d
i
l
s
l
o e
MΦ t y
c 2
c
r o
23% 10 o
g
a
m
h
u
t
p %
% 1
Tumor 5 CD45 76% 0 0 r r r r 5 b r r r r G 5 b G a o o o o D a to to to to Ig D it it it it Ig i i i i l 4 m ib ib ib ib l 4 m ib ib ib ib o u h h h h o u h h h h tr z n n n n tr z n n n n n tu i i i i n tu i i i i Brilliant Violet 450+ (Tumor label dy e) o s P P C C o s P P C C C ra C C C C C ra C C C C T D D D D T D D D D A A A A A A A A + + + + + + + + G 5 G 5 5 5 Ig D Ig D G G l 4 l 4 Ig D Ig D o o l 4 l 4 tr tr o o n n tr tr o o n n C C o o C C 879 880 Figure 1. Generation of murine Trastuzumab and its antitumor dependence on Antibody- 881 Dependent-Cellular-Phagocytosis (ADCP) by tumor-associated macrophages (TAMs). (A) 882 Cartoon presentation of Trastuzumab and 4D5 antibodies used in this study. (B) MM3MG cells 883 expressing human HER2Δ16 were implanted into the mammary fat pads (1x106 cells) of Balb/c 884 mice. Trastuzumab (human IgG1) or 4D5 (mouse IgG2A) were administered weekly (200 µg per 885 mice). n = 8-10. (C) Tumors (>1000 mm3 volume) were processed into single cell suspensions, 886 and TAMs (%CD11b+ F4/80+ LY6G- LY6C- of CD45+ cells) were analyzed by FACS. n = 8-10. 887 (D) Experiment as in Figure 1B was repeated in SCID-Beige animals. n = 8. (E) Experiment in 888 SCID-Beige was repeated using neutrophils-depleting anti-LY6G antibodies (clone IA8, 300 µg 889 per mice biweekly). (F-G) To deplete macrophages, SCID-Beige mice were pre-treated with 890 anti-CSF1R antibody (clone AFS98, 300µg, 3 times per week) for two weeks. (F) Macrophage 891 depletion were verified by FACS. (G) 4D5-IgG2A injection were performed, with anti-CSF1R 892 treatment maintained throughout the experiment. n = 8. (H) Trastuzumab/4D5 induced ADCP of 893 HER2+ BC cells by Bone-marrow-derived-macrophages (BMDM). MM3MG-HER2Δ16 cells 894 were labeled with Brilliant Violet 450 Dye, and co-cultured with BMDM (3:1 ratio) with control or 895 anti-HER2 antibodies (10 µg/mL). ADCP rates were measured by percentage of BMDM uptake 896 of labeled tumor cells (CD45+ and BV450+), and Antibody-dependent-cellular-cytotoxicity 897 (ADCC) rates were measured by percentage of dying free tumor cells (CD45- and LIVE/DEAD 898 stain+). ADCP inhibitor (Latrunculin A) or ADCC inhibitor (Concanamycin A) were added as 899 assay controls. n = 3, experiment has been repeated three separate times. (B, D, E and G) 900 Tumor growth were measured with caliper-based tumor measurement over time. Two-way 901 ANOVA test with Tukey’s multiple comparisons (C, F and H) One-way ANOVA test with Tukey’s 902 multiple comparisons. All data represent mean ±SEM, **P<0.01, ***P < 0.001, ****P<0.0001. 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922
ADCP B A Wild type Balb/c Fcer1g-/- Balb/c *** Control IgG 800 Control IgG 1500 100 4D5-IgG2A Control IgG
) 4D5-IgG2A 3 ) 4D5-IgG2A
600 3 m
s 80
i
m
s
m
) (
o 1000
m
x t
( n.s
e
a
y z
60 e i
c 400
M
z
s
i
o
r
s
g
%
o
r
a (
40 o m
h **** 500
u m
P 200
T u
20 T 0 0 0 0 5 10 15 20 WT BMDM Fcer1g-/- BMDM 0 5 10 15 20 days post tumor injection days post tumor injection
C Tumor-associated macrophages D MM3MG-HER2Δ16 grow th E Control IgG ADCP
**** 1400 **** s
l 80
l 4D5-IgG1
e )
s 100 c
3 1200
n
- o
m 4D5-IgG2A
i C t 60
6 1000
m a
l 80
(
Y
u
s
i
L e
p n.s
s )
- 800
z
o
x
o
i
t p a 60
G *
s y
40
c
6
M
+
r
600 o
Y
b
o
g
%
L
1
( a
40
m
1
h +
u 400 ****
p D
0 20
T
8
C /
20 4
n 200
i F
% 0 0 0 G A G A 0 5 10 15 20 25 Control IgG 4D5-IgG1 4D5-IgG2A Ig 2 Ig 2 l G l G o g o g tr -I tr -I n 5 n 5 Days post tumor injection o D o D C 4 C 4 + + + + T T O O W W -K -K g g r1 r1 e e c c F F
F Mouse FCGR1 activation G Mouse FCGR3 activation H Mouse FCGR4 activation 100000 10000 100000 *** ****
**** y ****
y t
t Control IgG ****
i
y
i
t
v i
v **** Control IgG **** i
i **** Control IgG
t
v
t
i
c t
c 4D5-IgG2A
c a a 10000 10000
4D5-IgG2A **** 4D5-IgG2A
**** a
g
g )
) 4D5-IgG1
)
g
n
n
e
e
i
i
l
l
e n
4D5-IgG1 s s 4D5-IgG1
i 1000
l
s a
a ** a
a Trastuzumab
r
r
a
n
a n
r Trastuzumab
e e
n Trastuzumab g
g **
f
f
i
i
e
i
i
g
f
i
s
s
i
c
c
s
c
u
u 4
4 1000 1000
u
L
4
L
R
R
-
-
L
R
-
T
T
G
G
T
G
c
c
A
A
c
A
F
F
F
F
F
F
m
N
N
m
( ( N
m 100
(
e
e
e
v
v
i
i
v t
t 100 100
i
t
a
a
l
l
a
l
e
e
e
R R R
10 10 10 0.01 0.1 1 10 100 0.01 0.1 1 10 100 0.01 0.1 1 10 100 Ab (ug/mL) Ab (ug/mL) 923 Ab (ug/mL) 924 Figure 2. The Antibody-dependent-cellular-phagocytosis (ADCP) activity of mouse 925 Trastuzumab (4D5) requires the engagement with Fcγ-receptors (FCGR) and is IgG2A 926 isotype dependent. (A) Fcγ-receptors are required for 4D5-induced ADCP of HER2+ BC cells 927 by Bone-marrow-derived-macrophages (BMDM) in vitro. BMDM were generated from wild type -/- 928 and Fcer1g mice, and ADCP experiment were performed with the conditions described in 929 Figure 1E. n = 3. (B-C) FCGR is required for the antitumor activity of 4D5 therapy. (B) Wild type -/- 930 or Fcer1g Balb/c mice were implanted with MM3MG-HER2Δ16 cells as before (Figure 1B). 931 4D5-IgG2A or control antibodies were administered weekly (200 µg per mice intraperitoneally) 932 and tumor growth were measured. n = 5. (C) Tumor-associated macrophages (TAMs) from 933 tumors in Figure 2B were analyzed by FACS. n = 4-5. (D-F) The ADCP activity of 4D5 is IgG2A 934 isotype dependent. (D) MM3MG-HER2Δ16 tumor growth in mice were repeated using 4D5 935 antibodies containing the mouse IgG1 as comparison to previous IgG2A isotype. n = 8-10. (E) 936 ADCP experiments with BMDM cultures were performed using 4D5-IgG1 versus 4D5-IgG2A 937 antibody isotypes. n = 4. (F-H) Mouse FCGR signaling activation assay. MM3MG breast cancer 938 cells expressing HER2 were plated and treated with indicated antibodies concentrations for 1 939 hour. Jurkat cells containing NFAT-luciferase reporter and expressing mouse FCGR1 (F), 940 FCGR3 (G) or FCGR4 (H) were added to the target cells containing antibodies and co-cultured 941 for 4 hours. FCGR signaling activation were assessed by luciferase activity quantification. n = 4. 942 (A, C, and E) One-way ANOVA with Tukey’s multiple comparisons. (B, D, F, G and H) Two-way 943 ANOVA test with Tukey’s multiple comparisons to control IgG group. All data represent mean 944 ±SEM, *P < 0.05, ***P < 0.001, ****P < 0.0001. 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970
A Control IgG 4D5-IgG2A 6.69% 16.5% ADCP ADCC GFP-KO 40 Control IgG 3 Control IgG 4D5-IgG2A 4D5-IgG2A ***
30
h
t
s i a 2
s ***
e o
15.7% d
28.6% t
l
y
l
c e
o 20
*** c
g
r a
CD47-KO o
h
m p
u 1
t %
10 %
0 0 CD45 GFP-KO CD47-KO GFP-KO CD47-KO Brilliant Violet 450+ (Tumor label dye)
B IL6 TNFα CCL3 CCL4 * 800 Control 600 Control *** Control *** 800 1500 Control *** 4D5-IgG2A 4D5-IgG2A 4D5-IgG2A 4D5-IgG2A 600 600
400 1000
L
L
L
L
m
m
m
m /
400 / /
/ 400
g
g
g
g
p
p
p p 200 500 200 200
0 0 0 0 GFP-KO CD47-KO GFP-KO CD47-KO GFP-KO CD47-KO GFP-KO CD47-KO
C MM3MG-HER2Δ16 grow th D TAMs GFP-KO, Control Treatment 80 Control IgG
GFP-KO, 4D5-IgG2A Treatment s
s 4D5-IgG2A
l *** n
1000 CD47-KO, Control Treatment l
o
e
i t
c 60
a
CD47-KO, 4D5-IgG2A Treatment l
-
) u
3 800
G
p
6
m
o
Y m
p *
(
L
600 40
+
e
+
z
b
i
0
s
1
8
r 1
400 /
o 4
D 20
m
F
C
u
T %
200 n i 0 0 0 5 10 15 20 25 30 35 GFP-KO CD47-KO days post tumor development
E Parental MM3MG-HER2Δ16 MM3MG-HER2Δ16 CD47-OE F TAMs 2000 Control IgG 1500
Control IgG 80 *** Control IgG
s
)
s l
4D5-IgG2A n
3 l
) 4D5-IgG2A o
3 4D5-IgG2A
1500 e
i
t c
m 60
a
l
- m
m 1000 u
( 1.5x
G
m
p
( 6
e 4.4x
o z
1000 Y e
i **
p
z s
L 40
i
+
r
s
+
b
o
r
0
1
o
m 8
500 1
*** / u
500 m
4
D u
T 20
F
C
T
%
n i 0 0 0 0 5 10 15 20 25 0 5 10 15 20 25 Parental tumor CD47-OE tumor days post tumor injection days post tumor injection 971 972 Figure 3. CD47 suppresses the anti-tumor activity of mouse Trastuzumab (4D5). (A) CD47 973 knockout cells were generated from MM3MG-HER2Δ16 cells using CRISPR-Cas9 technology. 974 A control GFP knockout line was generated in parallel. Control and CD47-KO MM3MG- 975 HER2Δ16 cells were labeled with Brilliant Violet 450 Dye, and incubated with Bone-marrow- 976 derived-macrophages (BMDM) at 3:1 ratio with control or 4D5 antibodies (10 µg/mL). Antibody- 977 dependent-cellular-phagocytosis (ADCP) and cytotoxicity (ADCC) activity were measured by as 978 described in Figure 1H. n = 3. Experiment has been repeated two separate times using CD47- 979 KO clones containing a different guide RNA. (B) Secreted cytokines and chemokines by 980 macrophages from co-culture experiment with HER2+ BC were analyzed using the Luminex 981 platform. Additional cytokines detected can be found in Figure S5. n = 3. (C-D) Control and 982 CD47-KO MM3MG-HER2Δ16 cells were implanted into mouse mammary fat pads and treated 983 with 4D5-IgG2A or control antibodies as described before. TAMs were analyzed by FACS after 984 tumor volume reached >1000mm3. n = 5. (E-F) Cd47 overexpressing cells (CD47-OE) were 985 generated in MM3MG-HER2Δ16 cells after transduction with Cd47 cDNA under control of the 986 EF1s promoter. CD47-OE tumor cell growth were compared to parental MM3MG-HER2Δ16 987 cells in mice treated with control antibody or 4D5-IgG2A. TAMs were analyzed by FACS. n = 5. 988 (A, B, D and F) One-way ANOVA with Tukey’s multiple comparisons test. (C and E) Two-way 989 ANOVA test with Tukey’s multiple comparisons. All data represent mean ±SEM, *P < 0.05, ***P 990 < 0.001, ****P < 0.0001. 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010
MM3MG-HER2Δ16 grow th MM3MG-HER2Δ16 grow th A B C In SCID-Beige D 800 TAMs TAMs Control IgG Control-IgG
100 1400 s L
** I 100 ****
T
) s
) CD47
s
3 CD47
l n
3 1200 +
600 l
o
b e
i 80
m
t
m 1
c 80
a 4D5-IgG2A 1
m 4D5-IgG2A l
- 1000
m
(
D
u (
*
G
p
C e
6 60
e **** o 60
z 4D5-IgG2A +CD47 n
4D5-IgG2A + CD47 Y
i i
p 800
400 z
i
L
s
-
+
s
+
r
G b
40 r 6
0 40 o
1 600
o
8
Y
1
/
m
L
4
D
* m
u +
200 F C
20 u 400 20
T
**** 0
%
T
n
8
i /
200 4 0 F 0 0 % 7 5 7 7 5 7 G 4 4 G 4 4 0 Ig D Ig D l D 4 D 0 5 10 15 20 l D 4 D o C C o C C tr tr 0 5 10 15 20 25 n n o + o + 5 Days post tumor injection 5 C D C D 4 4 Days post tumor injection E
4D5-IgG2A Control IgG 4D5-IgG2A 4D5-IgG2A + αCD47 Control IgG + αCD47 G
F umor
t
/C
in
Φ
Balb M
WT WT 58.2%
unlabeled unlabeled 31.6% -
9.5% 17.3% 28.0% /
-
in
Φ Fcerg
M 15.8% 13.3% labeled labeled tumor
In vivo ADCP by TAMs In vivo ADCP by TAMs 50
*** *** Control IgG )
) 60
s
s
l
l
l
l
s
e e
40 * s 4D5-IgG2A + CD47
c
e
c
e
g
g
+
+
a
a
0 0
h *
h
8 8
p n.s /
30 / 40
p
o
4
4
o
r
r
F
F
c
c
-
-
a
a
1
1
r m
20 r
m
G
G
+
+ 20
+
D
+
i
D
b
i
b D
1 10
1
D
1
%
1
%
D
D
C
C ( 0 ( 0 WT mice Fcer1g-KO G A 7 g 2 4 l I G o g D tr -I C n 5 a o D + C 4 A 2 G Ig 5- 4D 1011 1012 Figure 4. CD47 Blockade increased therapeutic efficacy of mouse Trastuzumab and 1013 augments tumor-associated macrophage (TAMs) expansion and phagocytosis. (A) Tumor 1014 growth experiment (as in Figure 1B) were repeated using CD47 blockade antibody (MIAP410, 1015 300 µg per mice) alone or in combination with 4D5-IgG2a. (B) TAM populations were analyzed 1016 by FACS after tumor volume reached >1000mm3. Analysis of additional immune cell types are 1017 shown in Figure S4D. Mean ±SEM, n = 8-10. (C) Repeat of similar tumor growth experiment 1018 and treatments in SCID-Beige mice. (D) TAM populations from SCID-Beige experiment were 1019 analyzed by FACS. n = 10. (E) Schematic representation of in vivo Antibody-dependent-cellular- 1020 phagocytosis (ADCP) experiment. MM3MG-HER2Δ16 cells were labeled with Vybrant DiD dye 1021 and implanted (1x106 cells) into mammary fat pads of Balb/c mice. Once tumor volume reaches 1022 ~1000 mm3, mice were treated with either control antibody, 4D5-IgG2A (200 µg), or in 1023 combination with MIAP410 (300 µg). On the next day, tumors were harvested and tumor- 1024 phagocytic macrophages were quantified by FACS. (F) Representative FACS plots and 1025 graphical summary showing frequency of macrophages (CD11b+, F4/80+, LY6G-, LY6C-) that 1026 have phagocytosed DiD-labeled tumor cells. n = 6. (G) Similar in vivo ADCP experiment were 1027 repeated in Fcer1g-/- mice. n = 8. (A and C) Two-way ANOVA test with Tukey’s multiple 1028 comparisons. (B, D, G and G) One-way ANOVA test with Tukey’s multiple comparisons. All data 1029 represent mean ±SEM *P < 0.05, **P < 0.01, ***P < 0.001, ****P<0.0001 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 A
B Transgenic HER2Δ16 BC mouse model C Transgenic HER2Δ16 BC mouse model Survival Tumor grow th Control 100 Control IgG
aCD47 3000 CD47
l 3
a 80
m 4D5-IgG2A v
i 4D5-IgG2A
m
v
r e u 4D5-IgG2A + aCD47 4D5-IgG2A + CD47
s 60 2000
m
t
u
l
n
o
e
v
c
40 r
r o
e ****
**** m P 1000
n.s ## u t
20
l
a
t o
0 T 0 10 20 30 40 50 0 0 2 4 6 days post tumor development weeks post tumor development
Tumor-associated macrophages
D 40 * -
s ***
C
n
6
o
i t
Y 30 ***
a
L
l
-
u
p
G
o
6
p Y
20
L
+
b
+
1
0
1
8 /
D 10
4
C
F
n
i % 0 x 7 A 7 R 4 2 4 l D G D ro C g C t -I n 5 o D + C 4 A 2 G g -I 5 D 4 1053 1054 Figure 5. CD47 blockade synergizes with mouse Trastuzumab therapeutic activity in a 1055 transgenic human HER2+ breast cancer (BC) mouse model. (A) Schematic representation 1056 of experiment using the endogenous human HER2 transgenic mouse model. Spontaneous 1057 breast tumors in the transgenic animals were induced with doxycycline diet. Four treatment 1058 arms were set up: Control IgG (200 µg weekly, n= 15), CD47 blockade (MIAP410, 300 µg 1059 weekly, n= 14), 4D5-IgG2A (200 µg weekly, n=16) and 4D5-IgG2A combined with MIAP410 1060 (n=16). Individual animals were consecutively enrolled into a specific treatment arm as soon as 1061 palpable breast tumors were detected (~200mm3). (B) Survival of mice in each treatment arm, 1062 time of start is on the day of palpable tumor detection and treatment enrollment. Log-rank 1063 (Mantel-Cox) test for survival analysis, ****P < 0.0001 of treatment vs control group, ## P < 0.01 1064 significant difference observed between “4D5” group vs “4D5+αCD47” group. (C) Tumor burden 1065 in animals from each treatment arm were measured over time after enrollment in treatment arm. 1066 Each individual animal develops 1 to 4 total tumors in their mammary fat pads. The total tumor 1067 burden per mice is shown. Animals were terminated when their total tumor volume 1068 reached >2000 mm3 (D) Tumors in the transgenic mice were harvested, processed into single 1069 cell suspensions, and analyzed by FACS. Each individual tumor were treated as an individual 1070 measurement. Mean ±SEM, Control IgG n=23, αCD47 n=27, 4D5 n=38, 4D5+ αCD47 n=32, 1071 One-way ANOVA with Tukey’s multiple comparisons test, *P < 0.05, **P < 0.01, ***P < 0.001. 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094
Φ M
A B Tumor Control IgG Phag Gene Category M1-like MΦ M2-like MΦ Neutr CD8/NK CD4 M1 MΦ APC
M2 MΦ Immune markers T/NK APC Tumor markers Myeloid markers
Macrophage markers Neutrophils
Phag_MΦ Neutrophil markers
Control IgG Phagocytosis genes
APC genes
M1 MΦ Inflammatory genes
M2 MΦ T/NK Complements APC B cell markers DC markers
Neutrophils T/NK cell markers Phag_MΦ
Cytotoxic genes αCD47 LY6C genes M2 markers
Wound healing Collagens Matrix M1 MΦ C Metalloproteases4D5-IgG2A + αCD47 M2 MΦ
T/NK M1-like MΦ M2-like MΦ Tumor Phagocytic MΦ CD8/CD4/NK APC Gene Category Neutrophils APC Immune markers
Tumor markers Neutrophils Myeloid markers Phag_MΦ Macrophage markers
4D5 Neutrophil markers
Phagocytosis genes
APC genes M1 MΦ
M2 MΦ T/NK Inflammatory APC genes
Complements
Neutrophils Phag_MΦ B cell markers DC markers
T/NK cell markers 4D5 + αCD47 Cytotoxic genes LY6C genes M2 markers
1095 Wound healing Collagens 1096 Figure 6. Single-cell transcriptome analysisMatrix of immune clusters within HER2+ breast Metalloproteases 1097 cancer after Trastuzumab with CD47 blockade therapy. HER2+ tumors from HER2Δ16 1098 transgenic animals were isolated for Single-Cell RNA-Sequencing using 10X Genomics 1099 platform. Data from all tumors were pooled for clustering and gene expression analysis. (A) 1100 tSNE plots showing distinct clusters of immune cells in tumors from four treatment groups: 1101 control IgG, αCD47, 4D5-IgG2A or combination. (B-C) Heat map of relevant gene markers 1102 confirmed the various immune cell clusters in control tumors (B), and the expansion of 1103 macrophage clusters in the combination therapy treated tumors (C). Macrophages that contains 1104 tumor specific transcripts (e.g. hERBB2, Epcam, Krt8) were labeled as tumor phagocytic 1105 macrophages (Phag MΦ, predominantly found in combination treatment group). 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 B C A Activation of Activation of MΦ comparisons M1-like TAM M2-like TAM
Wound
healing Interferon Interferon M2 markers ECM remodeling Growth factors
Anti-
inflammatory
inflammatory
inflammatory
-
- Pro Pro Chemotaxis
Pro- Chemotaxis
Chemotaxis inflammatory
kB
kB
-
-
NF
NF
TLR/MyD88 TLR/MyD88
Antigen
CD47
CD47
CD47
CD47
IgG2A α
IgG2A presentation
α
-
α
α
-
4D5
4D5
Control Control IgG
Control IgGControl
IgG2A +
IgG2A + -
- Phagocytosis 4D5
4D5 & opsonization
Φ
Φ
Φ
M
M1 M M1 M2 M M2 1133 Phag 1134 Figure 7. Differential gene expression analysis of TAM clusters in HER2+ BC after 1135 Trastuzumab with CD47 blockade therapy. (A-B) Differential gene expression analysis of 1136 gene signatures for IFN, pro-inflammation, chemotaxis and TLR/MyD88/NFkb pathways in M1- 1137 like MΦ clusters (A) and M2-like MΦ clusters (B) revealed how they were affected by the 1138 treatment regimens. (C) Differential gene expression analysis of immuno-regulatory gene 1139 signatures (wound-healing, ECM remodeling, growth factors, anti-inflammation) versus immuno- 1140 stimulatory gene signatures (pro-inflammation, chemotaxis, antigen presentation, 1141 phagocytosis/opsonization) among the three distinct macrophage clusters in the combined 1142 dataset. 1143 1144 1145 1146 1147 1148 1149 CD47 High CD47 Low A CD47 High CD47 Low B subtype: ER+ subtype: HER2+ subtype: TNBC
p = 0.0038 p = 0.035 p = 0.012 p = 0.6
0 2500 5000 Time (Days) 0 2500 5000 0 2500 5000 0 2500 5000 Time (Days)
Human MDM phagocytosis of KPL-4 cells KPL-4 grow th in SCID-Beige Tumor-associated macrophages C Control IgG D Control IgG E Trastuzumab
50 *** 1500 Trastuzumab 15 ****
s l
CD47-KO + Control IgG l e
40 )
c
s
3
i -
s CD47-KO + Trastuzumab
+
m
1
r
o 5
t 1000
m 10
4
( y
30 G
c
D e
*** +
o
z
C
i
0
g
s
8
a
+
20 /
r
h
b
4
o
p 1
500 F 5
m
1
%
u %
10 D
T ****
C
n 0 i 0 0 Parental KPL4 CD47-KO KPL4 0 20 40 60 80 b G a G Ig Ig Days post tumor injection l m l o u o tr z tr n tu n o s o C ra C Sorted TAMs T + O -K F n 15 gene expression
7 o i Control Rx 4 s D
s * C e
r Trastuzumab p
x 10
e
e n
e ** *** * g *** *
e 5 *
v
i
t
a
l
e R 0 IL-6 TNFA IRF1 Cxcl2 Ccl3 TLR4 iNOS IL-10 IL-4 IRF4 CXCR4 1150 Inflammatory Anti-inflammatory 1151 Figure 8. Human CD47 gene expression is a prognostic factor in HER2+ breast cancer 1152 and limits the therapeutic activity of Trastuzumab. (A-B) Kaplan-Meier survival curve for 1153 breast cancer (BC) patients METABRIC Dataset. (A) Stratified into low and high groups based 1154 on average expression of CD47 in all patients. (B) The same patient stratification based on 1155 disease subtype (ER+, HER2+ and TNBC). (C) CD47 knockout in human HER2+ BC line KPL-4 1156 was generated using CRISPR-Cas9 approach. Control and CD47-KO KPL-4 cells were labeled 1157 with Brilliant Violet 450 Dye, and incubated with human monocytes-derived-macrophages 1158 (hMDM) at a 3:1 ratio, in the presence of control or Trastuzumab (10 µg/mL). Antibody- 1159 dependent-cellular-phagocytosis (ADCP) activity were measured by percentage of hMDM 1160 uptake of labeled KPL-4 cells (CD45+ and BV450+). Mean ±SEM, biological replicates n = 4. 1161 Experiment has been repeated using hMDMs generated from three healthy PBMC donors. (D) 1162 Control or CD47-KO KPL-4 cells were implanted into mammary fat pads of SCID-Beige Balb/c 1163 mice (5x105 cells). Trastuzumab (50 µg) or control human IgG1 were administered weekly and 1164 tumor volume were measured. Two-way ANOVA test with Tukey’s multiple comparisons, 1165 ****P<0.0001. (E) Tumor infiltrating macrophages (F4/80+ Gr1- CD11b+) populations were 1166 analyzed by FACS, except for “CD47-KO + Trastuzumab” group as no tumor growths have 1167 occurred. Mean ±SEM, n = 7. (F) Tumor-associated macrophages from control treated and 1168 trastuzumab treated tumors were sorted by FACS (F4/80+ Gr1- CD11b+CD45+) and analyzed 1169 with RT-qPCR for the expression of pro- and anti-inflammatory genes. Mean ±SEM , n=7. 1170 Multiple two-sided t-test. (C and E) One-way ANOVA test with Tukey’s multiple comparisons, * 1171 P <0.05, ** P <0.01, ***P < 0.001 1172 1173 1174
1175
1176
1177
1178
1179
1180
1181
1182
1183
1184
1185
1186
1187
1188
1189
1190
1191
1192
1193
1194 1195 Table 1
Treatment # of tumors Average length on MΦ cluster size Tumor Phagocytic MΦ analyzed treatment regimen (% MΦ among (% MΦ containing
immune cells) hERBB2 transcripts) Control 3 28 days 2354/4527 (52 %) 4.22 % αCD47 2 36 days 1228/2154 (57 %) 3.95 %
4D5-IgG2A 4 45 days 2938/3815 (77 %) 9.07 %
4D5-IgG2A + αCD47 4 56 days 4673/5079 (92 %) 48.44 %
Table 1. Single-Cell Transcriptome Analysis of macrophage cluster sizes and frequency of tumor phagocytic macrophages. Numbers represent mean of replicates in each treatment group.