Sex-Determining Region Y Box 4 Is a Transforming Oncogene in Human Prostate Cancer Cells

Research Article

Pengbo Liu,1 Sumathi Ramachandran,1 Mohamed Ali Seyed,1 Christopher D. Scharer,1,3 Noelani Laycock,1 W. Brian Dalton,1,4 Holly Williams,1 Suresh Karanam,1 Milton W. Datta,1,2 David L. Jaye,1 and Carlos S. Moreno1,2

1Department of Pathology and Laboratory Medicine and 2Winship Cancer Institute, Emory University School of Medicine and Programs in 3Genetics and Molecular Biology and 4Biochemistry, Cell, and Developmental Biology, Emory University, Atlanta, Georgia

Abstract mice, SOX4 is also expressed in the mammary gland and uterus Prostate cancer is the most commonly diagnosed noncuta- and is hormonally regulated by progesterone and estradiol (6). neous neoplasm and second most common cause of cancer- SOX4 is essential for heart, lymphocyte, and thymocyte development, and SOX4-null mice die from cardiac defects (7). Moreover, related mortality in western men. To investigate the mechanisms of prostate cancer development and progression, the proliferative capacity of B-cell progenitors is severely decreased we did expression profiling of human prostate cancer and in cells from SOX4 knockout mice (8). The only well-described benign tissues. We show that the SOX4is overexpressed in molecular function of SOX4 is to mediate activation of transcrip- a prostate tumor samples compared with benign tissues by tional targets of the interleukin (IL)-5 receptor- (9). Three microarray analysis, real-time PCR, and immunohistochem- independent studies screening for important oncogenes have istry. We also show that SOX4expression is highly correlated found that SOX4 is commonly altered by retroviral insertions with Gleason score at the mRNA and protein level using (10–12). In fact, SOX4 was the most common target of the murine tissue microarrays. Genes affected by SOX4expression were leukemia virus, which stabilized the SOX4 message, producing also identified, including BCL10, CSF1, and NcoA4/ARA70. B-cell lymphomas with increased SOX4 message levels (12). TLE-1 and BBC3/PUMA were identified as direct targets of In humans, SOX4 is expressed in the normal breast and breast SOX4. Silencing of SOX4 by small interfering RNA transfec- cancers, and SOX4 expression is increased by progestins leading to tion induced apoptosis of prostate cancer cells, suggesting increased SOX-mediated transcriptional activity (13). SOX4 is also overexpressed in classic medulloblastomas (14) and lung cancers that SOX4could be a therapeutic target for prostate cancer. Stable transfection of SOX4into nontransformed prostate (15), suggesting that SOX4 may be important in multiple tumor cells enabled colony formation in soft agar, suggesting that, types. in the proper cellular context, SOX4can be a transforming We and others have observed by gene expression profiling that SOX4 is significantly overexpressed in prostate cancer tissues oncogene. (Cancer Res 2006; 66(8): 4011-9) relative to benign prostate. In fact, SOX4 overexpression has been detected by microarray analysis in no less than six independent Introduction studies of prostate cancer (16–22). However, no study has gone The sex-determining region Y (SRY) box, or SOX, family consists, beyond microarray analysis to evaluate SOX4 changes at the in humans, of 20 highly conserved transcription factors that play protein level in prostate cancer or to investigate the effects of loss important roles in development (1) and is defined by a conserved or gain of SOX4 expression on prostate cancer cells. signature sequence in the high-mobility group (HMG) DNA- We have confirmed SOX4 overexpression in prostate cancer binding domain (DBD; ref. 2). SOX4 is a 47-kDa protein that is patient tissues by quantitative real-time PCR and immunohisto- encoded by a single exon gene that is highly conserved in chemistry. Transfection of the LNCaP prostate cancer cell line with vertebrates. In fact, there is 88% identity at the DNA level between small interfering RNA (siRNA) duplexes strongly decreased cell Homo sapiens and Fugu rubripes in the NH2-terminal SOX4-T-cell viability and induced apoptosis. Stable overexpression of SOX4 in factor (TCF)-HMG box DBD. At the amino acid level, the SOX4 the immortalized, nontransformed RWPE-1 prostate cell line DBD is 32% identical with the DBD of the TCF transcription factor enabled anchorage-independent growth and colony formation in that is bound by h-catenin as a consequence of activated Wnt soft agar. These data suggest that, in the proper cellular context, signaling. Other SOX factors, SOX17 and SOX3, physically interact SOX4 can be a transforming oncogene and further provide a strong with h-catenin and modulate expression of Wnt target genes rationale for consideration of SOX4 as a target for treatment of during Xenopus embryonic development (3, 4). prostate cancer. SOX4 is specifically expressed in the ovary, testis, and thymus of adult mice and in mouse T and pre-B lymphocytic cell lines (5). In Materials and Methods Patient samples. The methods for RNA sample preparation have been Note: Supplementary data for this article are available at Cancer Research Online described previously (23) but are summarized here. In brief, all patients (http://cancerres.aacrjournals.org/). P. Liu and S. Ramachandran contributed equally to this work. enrolled had biopsy-proven prostate cancer and had undergone radical Requests for reprints: Carlos S. Moreno, Department of Pathology and Laboratory prostatectomy: 26 patients at Emory University (Atlanta, GA)–affiliated Medicine, Winship Cancer Institute, Emory University School of Medicine, Whitehead hospitals and 15 patients at other institutions participating in the Research Building, Room 105J, 615 Michael Street, Atlanta, GA 30322. Phone: 404-712- Cooperative Prostate Cancer Tissue Resource (CPCTR; Silver Spring, MD). 2809; Fax: 404-727-8538; E-mail: [email protected]. I2006 American Association for Cancer Research. Cases were chosen at random from 1999 to 2002. Fourteen of the tumor doi:10.1158/0008-5472.CAN-05-3055 samples had Gleason grade sum of 6, 17 had Gleason grade sum of 7, 11 www.aacrjournals.org 4011 Cancer Res 2006; 66: (8). April 15, 2006

Downloaded from cancerres.aacrjournals.org on October 5, 2021. © 2006 American Association for Cancer Research. Cancer Research had a Gleason grade sum of 8, and 4 had a Gleason grade sum of 9. The 11 following primers: BCL2 binding component 3 (BBC3/PUMA), ACACC- adjacent normal samples correspond to normal prostate tissue taken from CACGGACACACATACATCA (forward) and GTTTGGCTTGTGTGT- the same frozen sections as 11 of the prostate tumor specimens. Seven CTGGCATCA (reverse); transducin-like enhancer of split (TLE-1), Gleason 6 cases, 9 Gleason 8 cases, and 4 Gleason 9 cases were obtained GGTAGGACCGTGGATGAGGAA (forward) and ATGTGGCCAGATTCAT- through the CPCTR. GGTACAGG (reverse); and prostate-specific membrane antigen (PSMA) Microarray analysis. Total RNA was prepared by Trizol extraction of intron 3, CTTGCCTTCTAAAATGAGTTGG (forward) and TTGGGAGGCT- serial sections from snap-frozen tissues. For each frozen specimen of GAGGTGGAAGAA (reverse). prostate, one frozen section was stained with H&E to map areas A of carcinoma and nonneoplastic prostate, after which 15- m-thick serial Results sections were cut for isolation of total RNA. Histologic confirmation was obtained in all cases, and dissection of cancer foci was done to assure that Prostate cancer patient expression profiling. We reported f90% of cells collected were malignant epithelial cells. Further details can previously that we have profiled 28 prostate cancer patient samples, be found in the Supplementary Data. Heat maps were generated using 11 adjacent benign patient samples, and a commercial pool of Spotfire DecisionSite 7.2 for Functional Genomics. Complete microarray normal prostate RNA (Clontech Laboratories, Inc., Mountain View, datasets have been deposited in the public ArrayExpress database CA) using Affymetrix (Santa Clara, CA) U133 GeneChip array sets (accession no. E-TABM-26). (23). We used the Significance Analysis of Microarrays (SAM) siRNA design and transient transfection. siRNA duplexes targeting software (28) to identify 63 up-regulated and 80 down-regulated SOX4 were designed, synthesized, annealed, and purified (MWG Biotech, High Point, NC). Optimal transfection of LNCaP cells was obtained with a probe sets that were significantly different between prostate cancer combination of eight different siRNAs to SOX4 used as a cocktail at a final and benign tissues. We have now extended our data to include concentration of 100 nmol/L. All siRNA sequences were subjected to BLAST 45 prostate cancers and 13 normal samples and identified 117 search to confirm the absence of homology to any additional known coding up-regulated and 613 down-regulated probe sets (Supplementary sequences in the human genome. The SOX4 siRNA target sequences are Table S1). In agreement with several prostate microarray studies given in the Supplementary Data. Transient siRNA transfections were done (16, 17, 29), 3 of these 117 significantly up-regulated probe sets using DMRIE-C Reagent (Invitrogen, Carlsbad, CA) for prostate cancer cells corresponded to SOX4 (Fig. 1A). SOX4 was also one of the genes in six-well plates. At the end of 48 hours, cells were harvested for total RNA most highly correlated with Gleason grade and was highly significant isolation and protein lysate was harvested for immunoblots, flow cytometry, after correction for multiple hypothesis testing (Spearman’s q =0.51; and viability assays. Protein lysates were prepared as described (24), and q = 0.003). Figure 1B shows the average SOX4 signal in patients with total RNA was prepared using RNeasy kits (Qiagen, Valencia, CA) according to the manufacturer’s instructions. Gleason scores of 6, 7, or 8 and above. The correlation of SOX4 with Western blots. Immunoblots were probed with monoclonal antibody Gleason score was confirmed by quantitative real-time PCR using (mAb) to Lamin A/C (Santa Cruz Biotechnology, Santa Cruz, CA) and RNA prepared from 16 prostate cancer samples and matched benign our polyclonal antisera to SOX4. We synthesized three synthetic peptides adjacent tissue also used in for expression profiling (Fig. 1C). specific to SOX4 (MVQQTNNAENTEALLAGESSDSC, ASSPTPGSTASTGG- Global analysis of SOX family gene expression. To further KADDPSWC, and ASGGGANSKPAQKKSC), linked them to keyhole limpet examine the expression of SOX genes in prostate cancer, we mined hemocyanin (KLH) with maleimide-activated KLH (Pierce, Inc., Rockford, our global expression profiles to analyze the gene expression IL), and raised polyclonal rabbit antisera (Rockland Immunochemicals patterns for all members of the SOX gene family of transcription Inc., Gilbertsville, PA). Blots were then probed using a mAb to protein factors. Figure 1D shows a heat map of the log transformed, robust phosphatase 2A (PP2A) catalytic subunit (BD Biosciences, San Jose, CA) 2 multichip average (RMA) normalized signals of all SOX family genes to normalize for equal protein loading. Immunohistochemistry. The CPCTR prostate tissue microarray (TMA) present on Affymetrix U133A and U133B GeneChips. An examina- 2 (Gleason TMA) was used for immunohistochemistry. Immunohistochem- tion of the expression levels of SOX family genes shows that SOX1, ical staining was done using the EnVision Double-Labeling System SOX9, SOX10, SOX13, SOX15,andSRY are all expressed in both (DakoCytomation, Carpinteria, CA) on formalin-fixed, paraffin-embedded benign and cancerous prostate tissues to varying degrees. However, human prostate cancer tissue. Sections were incubated with rabbit SOX4 is the only SOX family gene that is consistently up-regulated in polyclonal anti-SOX4 antisera (1:2,000) for 1 hour followed by incubation prostate cancer tissues compared with benign prostate tissues as with anti-rabbit secondary antibodies conjugated to horseradish peroxi- measured by microarray analysis. Three separate probe sets that V dase–linked labeled polymers. 3,3 -Diaminobenzidine-positive substrate- measure SOX4 expression produced consistently higher signals in chromogen was incubated for 5 minutes for color development. Finally, prostate cancers relative to benign prostate samples (Fig. 1D). slides were counterstained with hematoxylin (Richard-Allan Scientific, A total of five probe sets on the U133 set are annotated to the Kalamazoo, MI) for 5 seconds, dehydrated, and mounted. Soft agar assays. Soft agar assays were done essentially as described SOX4 gene. However, one probe set (213665_at) that had no (25). Briefly, 10,000 cells were seeded in 0.3% Noble Agar, keratinocyte expression and showed no difference between tumor and normal serum-free medium supplemented with bovine pituitary extract and samples is actually oriented in the opposite sense to the other four insulin-like growth factor (Invitrogen) fungizome, penicillin-streptomycin, probes, and, thus, is not complementary to the SOX4 message. The and L-glutamine. Colony number was determined using 3-(4,5-dimethylth- other probe set (213668_s_at) was not included in our dataset of iazol-2-yl)-2,5-diphenyltetrazolium bromide dye staining as described (26). significant probe sets because the maximal expression it showed for Chromatin immunoprecipitations. Two p150 culture dishes (Corning, any sample was below our cutoff threshold for expressed genes. This Inc., Acton, MA) each of RWPE-1 FLAG-SOX4 and parental RWPE-1 cells probe set is complementary to sequences in the open reading frame were grown to confluency. Cells were fixed, harvested, and lysed as of SOX4, f3 kb upstream of the 3V-end of the transcript. Analysis of described previously (27). Sonicated chromatin was precleared overnight the data from this probe set showed that although the overall signal with 50 AL Dynal M-280 sheep anti-mouse IgG magnetic beads (Invitrogen) followed by a 5-hour incubation with 50 AL magnetic beads prebound with was much lower than the three significant probe sets, it was 15 Ag M5 anti-FLAG mAb (Sigma Immunochemicals, St. Louis, MO) or nevertheless 1.9-fold higher in the tumor samples than in the normal mouse IgG. Supernatant (400 AL) from the IgG control was saved as input. samples. Although one probe set for the SOX9 gene showed some Beads were washed, antibodies were eluted, and DNA was purified as increase in prostate cancers, this difference was not statistically described previously (27). Purified DNA was subjected to PCR using the significant by SAM analysis.

Cancer Res 2006; 66: (8). April 15, 2006 4012 www.aacrjournals.org

Figure 1. A, expression patterns of 143 probe sets significantly altered in prostate cancer tissue compared with benign tissues (q < 0.01). Arrow, probes corresponding to SOX4. B, average microarray signal of SOX4 from prostate tumors and benign tissue. RMA normalized Affymetrix signal for SOX4 (probe set 201417_at) for normal (N) tissues (n = 13), Gleason 6 (G6) tumors (n = 14), Gleason 7 (G7) tumors (n = 17), and Gleason 8 and 9 (G8-9) tumors (n = 15). C, verification of increased SOX4 mRNA expression by quantitative real-time PCR (QRT-PCR) using RNA from matched patient tumor and benign samples. Average fold increase of tumor versus benign from Gleason score 6-7 (n = 9) and Gleason score 8-9 (n = 7) samples. D, heat map representation of RMA normalized microarray expression data for all SOXfamily genes present on Affymetrix U133A and U133B GeneChips. Yellow, higher expression; blue, lower expression. SOX4 is the only SOXgene that is significantly up-regulated in prostate cancer tissues compared with benign prostate tissues.

SOX4protein is overexpressed in prostate cancer cells. To prostate cancer cells relative to adjacent benign prostate epithe- test whether the increase in SOX4 expression is also seen at the lium and that staining is more intense in higher grade tumors. protein level, we generated polyclonal antisera to SOX4-specific Reactivity was not detected in nonepithelial cells, except for peptides and immunoblotted cell lysates from primary prostate infiltrating lymphocytes. Expression seemed to be both cytoplas- epithelial cells (PrEC, Cambrex BioScience, Walkersville, MD), mic and nuclear, consistent with previous reports of SOX4 locali- immortalized RWPE-1 prostate cells, and the LNCaP and DU145 zation in mouse pre-B-cell lines after stimulation with IL-5 (9). To prostate cancer cell lines (Fig. 2A). SOX4 protein was greater in verify the specificity of our antibodies in immunohistochemistry, prostate cancer cells than in normal prostate cells. To investigate we probed sections of embryos from wild-type and SOX4 knock- SOX4 levels in patient prostate tissues, we used our SOX4 out mice. Day E13.5-E14 embryos were stained because whole- polyclonal antisera in immunohistochemistry on formalin-fixed, mouse targeted deletion of SOX4 is an embryonic lethal mutation paraffin-embedded prostate tissue microarrays. The tissue micro- (7). Staining with our purified SOX4 antibodies was much arrays used contained cores from 299 cases. Cores were scored on more intense on wild-type embryos than in knockout embryos a scale of 0 to 3 for absent, weak, moderate, or strong staining (Supplementary Fig. S1). and were also scored for tumor grade (0, 3, 4, or 5). Figure 2B SOX4siRNA induces apoptosis in LNCaP cells. The observa- shows the average SOX4 staining intensity for each tumor grade, tion that SOX4 was the only SOX family gene that was significantly which shows that SOX4 is correlated with tumor grade at the up-regulated in prostate cancer tissues prompted us to examine À protein level (N = 371; Spearman’s q = 0.32; P =2.4Â 10 10). the effects of depletion of cellular pools of SOX4 mRNA in prostate Representative examples of cores from this tissue microarray cancer cells. We did transient siRNA transfections using pools of (Fig. 2C) show that reactivity for SOX4 protein is increased in SOX4 siRNA duplexes in the LNCaP prostate cancer cell line and www.aacrjournals.org 4013 Cancer Res 2006; 66: (8). April 15, 2006

Downloaded from cancerres.aacrjournals.org on October 5, 2021. © 2006 American Association for Cancer Research. Cancer Research prepared total RNA and whole-cell protein lysates 48 hours after transfected cells compared with GFP siRNA-transfected cells. transfection. Parallel transfections using siRNA directed against To determine whether SOX4 siRNA-induced cell death was due to Lamin A/C served as a positive control and against green apoptosis, immunoblots were probed for the caspase-cleaved form fluorescent protein (GFP) as a negative control. Specific mRNA of poly(ADP-ribose) polymerase (PARP), a marker of apoptosis, depletion and decreased protein levels of SOX4 and Lamin A/C were which increased in a time-dependent manner (Fig. 3C). assayed by immunoblotting with SOX4 polyclonal antisera and Because SOX4 has been detected in breast cancers (13), we also mAbs to Lamin A/C (Fig. 3A). Densitometry scanning of tested whether SOX4-directed siRNAs could induce apoptosis in immunoblots for SOX4 determined that the SOX4 siRNA trans- two breast cancer lines (MCF-7 and BT-474). Figure 3D shows fections produced an average of 4-fold knockdown of SOX4 protein. that siRNA directed against SOX4-induced apoptosis in both of By 48 hours after transfection, SOX4 siRNA experiments consis- these cell lines to varying degrees, whereas GFP control siRNA tently produced an f2-fold lower yield of total protein lysate and duplexes did not. Baseline levels of SOX4 were similar in the 5-fold lower yield of total RNA than the GFP control siRNA-treated MCF-7 and BT-474 cell lines as in LNCaP and HeLa cells (Fig. 3D). LNCaP cells (data not shown), suggesting either decreased growth Thus, sensitivity to SOX4 siRNA-induced apoptosis may be a more or increased cell death in SOX4 siRNA-treated cells. Consequently, general phenomenon of epithelial cancers. we measured cell viability by trypan blue dye exclusion after SOX4 SOX4siRNA-induced apoptosis is specific. Because there is siRNA transfection over a time course of 5 days. SOX4 siRNA extensive sequence homology between members of the SOX family, significantly (P < 0.05) inhibited cell proliferation (Fig. 3B) we examined whether SOX4 siRNA duplexes might produce off- compared with the GFP-transfected cells. Floating, dead cells were target effects on other members of the SOX family. To ensure that present in the culture medium after 48 hours of siRNA treatment, the apoptotic effect due to SOX4 siRNA transfection was specific, suggesting that knockdown of SOX4 expression is lethal to LNCaP we did quantitative real-time PCR on the RNA from LNCaP cells cells. To quantitate percentage cell death, cells were prepared 0, 48, transiently transfected with SOX4 siRNA duplexes or GFP siRNA. and 96 hours after transfection with GFP or SOX4 siRNA duplexes, The SOX family member with the greatest sequence similarity to stained for DNA content with propidium iodide, and analyzed by our SOX4 siRNAs was SOX12 (17-bp perfect match). Using flow cytometry. The sub-G0-G1 population of LNCaP cells 48 hours quantitative real-time PCR primers that are specific for SOX4 after SOX4 siRNA transfection was f35% greater than the GFP and SOX12, we determined that SOX4 was repressed 27-fold by our siRNA control-transfected cells (Fig. 3C). By 96 hours, the dead siRNAs (Fig. 4A) far more than SOX12. Furthermore, our analysis of LNCaP cell population was 234% greater in the SOX4 siRNA- the expression of SOX4 family members shows that SOX12 is

Figure 2. A, immunoblot of lysates from normal prostate epithelial cells (PrEC), immortalized prostate cells (RWPE-1), androgen-dependent prostate cancer cells (LNCaP), and androgen-independent prostate cancer cells (DU145) probed for SOX4 protein and the catalytic subunit of PP2A as a loading control. B, quantitation of immunohistochemical staining of the CPCTR Gleason TMA2 for SOX4. Columns, mean for the indicated tumor grades; bars, SE. C, representative cores from immunohistochemistry of formalin-fixed, paraffin-embedded prostate samples from the CPCTR Gleason TMA2 with SOX4 antisera (1:2,000). Dark brown, SOX4 detection; blue, nuclei were counterstained with hematoxylin. Arrowhead, dark staining of nuclei from infiltrating lymphocytes. Negative controls without primary antibody showed no staining of any cell type (data not shown). Magnification, Â100 (top) and Â600 (bottom).

Cancer Res 2006; 66: (8). April 15, 2006 4014 www.aacrjournals.org

Figure 3. Transient siRNA transfection specifically represses SOX4 and induces apoptosis in LNCaP cells. A, immunoblots of LNCaP whole-cell lysates prepared 48 hours after transfection with siRNA complementary to Lamin A/C, SOX4, GFP, or vehicle control. SOX4 protein was depleted using a SOX4-specific pool of siRNA but not by GFP-specific siRNA. Lamin A/C was degraded in cells transfected with Lamin A/C siRNA but not vehicle control. The blot was dried and probed with PP2A C subunit to check for equal loading of protein. Densitometry scanning determined an average of 4-fold knockdown in SOX4 protein normalized relative to loading controls. B, cell viability as assessed by trypan blue exclusion assay at different time points ranging from 0 to 120 hours in LNCaP cells transfected with siRNA duplexes complementary to GFP (y) and SOX4 (n). Points, mean of triplicate experiments; bars, SD. C, apoptosis was quantitated by the % cells with sub-G0 DNA content by flow cytometry at different time points ranging from 0 to 120 hours in LNCaP cells transfected with control GFP (white columns) and SOX4 (black columns) siRNAs (S1-S8 pool). Columns, mean of triplicate experiments; bars, SD. Immunoblots of LNCaP cells 0, 48, and 96 hours after transfection with siRNA duplexes complementary to GFP or SOX4. Cell death is due to apoptosis due to the presence of the caspase-cleaved form of PARP. The blot was dried and probed with PP2A C subunit to check for equal loading of protein. D, apoptosis of MCF-7 and BT-474 cells transfected with control GFP and SOX4 siRNA duplexes was quantitated by flow cytometry 0 (white columns) and 72 hours (black columns) after transfection. Immunoblot of whole-cell lysates from HeLa, LNCaP, MCF-7 and BT-474 cell lines shows all lines express SOX4 protein.

expressed at very low levels in prostate tissues (Fig. 1D), suggesting did microarray analysis of LNCaP cells treated with SOX4 siRNAs that the apoptotic effect is not due to decreased levels of SOX12. and overexpressing SOX4. For these siRNA microarray experi- Next, we cotransfected the SOX4 siRNAs complementary to ments, there were three sets of transfections, each including both the 3V-untranslated region (UTR) of SOX4 with the pcDNA-SOX4 siRNA and plasmid DNA. In the control set of transfections, the construct lacking the 3V-UTR of SOX4 and quantitated the effect on cells were treated with GFP siRNA and empty vector DNA. In the apoptosis. Figure 4B shows that cotransfection of pcDNA-SOX4 SOX4 knockdown experiment, cells were transfected with SOX4 with SOX4 siRNAs partially rescued the apoptotic effect compared siRNA and empty vector, whereas, in the overexpression expe- with the SOX4 siRNAs alone. Cotransfection with empty vector did riment, cells were transfected with SOX4 expression plasmid not significantly reduce the percentage of apoptotic LNCaP cells and GFP siRNA. We identified 466 genes significantly altered by induced by SOX4 siRNA transfection. SOX4 levels by SAM analysis using a false discovery rate of <1% Finally, we did DNA microarray analysis on LNCaP cells treated (Fig. 4C; Supplementary Table S2), but, based on these data, it is with SOX4 siRNA duplexes or transfected with a SOX4 cDNA not possible to discriminate between direct and indirect targets expression plasmid and examined the effect on all SOX family of SOX4. These 466 genes were those that were consistently members (Fig. 4A). The only member of the SOX family that was responsive both to knockdown and overexpression of SOX4. strongly down-regulated by SOX4 siRNA transfection was SOX4. We also have analyzed these target genes for conserved SOX However, SOX9 seemed to be somewhat down-regulated by SOX4 binding sites and found conserved SOX sites in 137 of 466 (29%) siRNA treatment and up-regulated by overexpression of SOX4. It is target genes. There were conserved SRY binding sites (which unlikely that SOX4 siRNAs repress SOX9 expression directly because are less specific) in 225 of 466 target genes (Supplementary SOX9 signals were increased on overexpression of SOX4. No Table S2). However, this result is puzzlingly low compared alignments could be made that would suggest the possibility of with our global analysis of all human Refseq transcripts in cross-hybridization between SOX4 mRNA and the SOX9 microarray which 59% of promoters contained conserved SOX sites,5 probe sets. Thus, our data are consistent with the hypothesis that because the 29% of SOX4 targets with conserved SOX sites SOX9 may be a downstream target of SOX4, although we cannot conclude whether SOX4 might regulate SOX9 directly or indirectly. Genes affected by SOX4expression play roles in Wnt 5 S. Karanam et al. Global promoter analysis of the human genome identifies signaling, inflammation, and apoptosis. As noted above, we functional gene clusters, submitted for publication. www.aacrjournals.org 4015 Cancer Res 2006; 66: (8). April 15, 2006

Figure 4. SOXsiRNA-induced apoptosis is specific. A, quantitative real-time PCR measurement of the off-target effects of transient transfections with SOX4 siRNA duplexes. Although there is a repressive effect on SOX12, it is much less than the 27-fold decrease in SOX4 mRNA levels. Heat map representation of RMA normalized microarray expression data for all SOXfamily genes present on Affymetrix U133A and U133B GeneChips after overexpression of SOX4 or SOX4 siRNA knockdown in LNCaP cells. Yellow, higher expression; blue, lower expression. SOX4 and SOX9 are the only SOXgenes that are significantly affected by SOX4 siRNA transfection. B, immunoblot probed for caspase-cleaved form of PARP as a marker of apoptosis in cells transfected with GFP siRNA and SOX4-specific siRNA (3V-UTR, S9 and S10 SOX4 duplexes) transfected cells. The blot was dried and reprobed with mAbs specific to PP2A catalytic subunit to check for equal protein loading. Apoptosis was quantitated by the % cells with sub-G0 DNA content by flow cytometry in LNCaP cells expressing control GFP siRNA, SOX4 siRNA (3V-UTR, S9 and S10), and SOX4 siRNA cotransfected with pcDNA-SOX4 containing the SOX4 open reading frame but lacking the 3V-UTR. Columns, mean of triplicate experiments; bars, SD. C, heat map of SOX4 transcriptional targets in response to depletion of SOX4 by siRNA transfection or transient overexpression of SOX4 in LNCaP cells. Quantitative real-time PCR verification of mRNA changes of SOX4 target genes in response to SOX4 siRNA transfection of LNCaP cells. D, chromatin immunoprecipitation of FLAG-SOX4 bound to the promoters of TLE-1 and BBC3/PUMA. Lane 1, input chromatin; lanes2 and 3, immunoprecipitations from cells expressing FLAG-SOX4; lanes4 and 5,: immunoprecipitations from cells with no FLAG-SOX4. Lane 3, DNA from the TLE-1 and BBC3/PUMA promoters was specifically immunoprecipitated with FLAG-SOX4. DNA from these promoters was not amplified with nonspecific mouse IgG (lanes2 and 4) or with anti-FLAG antibodies in cells not expressing FLAG-SOX4 (lane 5). Lane 3, there was no DNA amplified from the promoter of PSMA, a prostate-specific gene not affected by SOX4 perturbations in anti-FLAG immunoprecipitations from cells expressing FLAG-SOX4. represents a decrease rather than enrichment over background for (31). We confirmed that BBC3/PUMA and TLE-1 are direct targets SOX binding sites. of SOX4 by chromatin immunoprecipitation assay against the Nevertheless, we confirmed these changes by quantitative real- FLAG epitope tag in RWPE-1 cells stably expressing FLAG-SOX4 time PCR for five SOX4 targets (Fig. 4C). Among those genes that (Fig. 4D). As negative controls, we did chromatin immunopre- were activated by SOX4 overexpression and reduced by SOX4 cipitation assays on RWPE-1 cells that do not express FLAG-SOX4 knockdown (Fig. 4C) was the ortholog of the groucho repressor, and on the PSMA gene in FLAG-SOX4 cells, which was not affec- TLE-1, which may function as a negative feedback regulator to ted by SOX4 levels. repress SOX4 expression in the absence of Wnt signals. Other Fully transformed human cell lines express SOX4and are SOX4 targets identified by microarray analysis included BCL10, sensitive to SOX4siRNA-induced apoptosis. To investigate the colony stimulating factor 1 (CSF1), BBC3/PUMA, and nuclear mechanism by which loss of SOX4 can induce apoptosis in receptor coactivator 4 (NcoA4/ARA70). BCL10 is an adaptor pro- cancer cells, we probed immunoblots of HeLa and LNCaP cells tein that has been shown to activate nuclear factor-nB (NF-nB) depleted for SOX4 by siRNA. Figure 5A shows that depletion of by mediating Lys63-linked ubiquitination of NF-nB essential SOX4 results in stabilized p53 protein and loss of survivin modulator, resulting in activation of the InB-specific kinase expression, consistent with decreased NF-nB activation. SV40 complex (30). BBC3/PUMA is a downstream target of p53 that is large tumor (LT) antigen binds and inactivates both p53 and Rb essential for both p53-dependent and p53-independent apoptosis proteins but, combined with constitutively activated Ras-V12, it

Cancer Res 2006; 66: (8). April 15, 2006 4016 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on October 5, 2021. © 2006 American Association for Cancer Research. Role of SOX4 in Prostate Cancer is still not sufficient for transformation of normal human cells. Discussion To accomplish complete transformation of human cells, addi- In this study, we have shown that SOX4 mRNA and protein is tional molecular changes are necessary that can be induced by increased in human prostate cancer tissues. We have also shown expression of SV40 small tumor (ST) antigen (32). We have that loss of SOX4 expression reduces viability and induces analyzed the transcriptional changes induced in two human apoptosis of LNCaP cells, whereas overexpression of SOX4 enables embryonic kidney (HEK) cell lines. The TERST cells express immortalized RWPE-1 cells to grow in soft agar, suggesting that telomerase, mutant Ras-V12, LT, and ST and can form tumors in SOX4 plays a critical role in growth and survival of prostate nude mice. The TERV vector control HEK cells (TERV) express cancer cells. The fact that overexpression of SOX4 transforms telomerase, mutant Ras, and LT, but not ST, and cannot form RWPE-1 cells does not imply that SOX4 alone could transform tumors without ST expression. Each line represents pools of normal primary prostate cells. Because the immortalizing HPV18 hundreds of clones that can capture the effects of SV40 ST on E6 and E7 oncoproteins are present in RWPE-1 cells, they bind gene expression. We found that ST expression produced a and inactivate the Rb and p53 tumor suppressor proteins. dedifferentiated phenotype, with repression of cell-cell adhesion However, cells that have been compromised in regulation of the molecules, increases in stem-cell markers (33) and expression of Rb and/or p53 pathways in some way may be susceptible to SOX4 (Fig. 5B). Transient siRNA transfections against SOX4 transformation by SOX4 as a second or third hit along the road to induced apoptosis in the tumorigenic TERST cells but not in the cancer formation. In fact, p53 inactivation may be a prerequisite control TERV cells (Fig. 5C). Thus, expression of SOX4 may be a for SOX4 transformation because SOX4 induces expression of critical component of the final pathway necessary for complete BBC3/PUMA. BBC3/PUMA is an essential proapoptotic target of transformation of human cells and may be necessary for the p53 (31), suggesting that one normal function of SOX4 may be to survival of some fully transformed cells. prime cells for apoptosis. This would explain the observed SOX4overexpression transforms RWPE-1 prostate cells. sensitivity of HEK-TERST cells to SOX4 depletion, whereas HEK- To further investigate the effects of SOX4 expression on trans- TERV cells were resistant to SOX4 siRNA. The induction of BBC3/ formation of human prostate cells, we tested whether SOX4 PUMA raises the question how can SOX4 induce proapoptotic overexpression could yield a transformed phenotype in non- genes and still be necessary for survival? It must be noted that transformed prostate cells. The RWPE-1 cell line was originally established by human papillomavirus 18 (HPV18) infection of nonneoplastic primary prostatic epithelial cells (34). The RWPE-1 line is responsive to androgen, does not form colonies in soft agar, and does not form tumors when injected into nude mice (34). We subcloned the open reading frame of the human SOX4 gene into the pcDNA vector downstream of a FLAG-tag epitope to generate a NH2-terminal FLAG-SOX4 fusion product. The pcDNA- FLAG-SOX4 plasmid and the empty pcDNA-FLAG vector were then stably transfected into the RWPE-1 prostate cell line, and multiple individual clones as well as pools of clones were obtained. Stable expression of FLAG-SOX4 was verified by immunoblotting (Fig. 6A). The ability of cells to form colonies in anchorage-independent medium, such as soft agar, has long been used as an assay for cellular transformation. To determine whether SOX4 overexpression enabled anchorage-independent growth of RWPE-1 cells, we plated 10,000 RWPE-1 parental cells, the RWPE-1-pcDNA vector cells, and RWPE-1-FLAG-SOX4 cells. Two individual clones (RFSOX4-clone7 and RFSOX4-clone8) and a pool of dozens of individual colonies were plated in soft agar and allowed to grow for 17 days, and the number of colonies were counted. Results from all SOX4-expressing clones were identical and showed robust colony formation, whereas RWPE-1 parental cells and cells stably transfected with empty vector formed few if any colonies (Fig. 6B). Figure 6C shows the quantitation of colony growth for each soft agar assay from three independent experiments. Thus, we conclude that in the proper cellular context, SOX4 can be a Figure 5. A, immunoblots of HeLa and LNCaP cells transiently transfected with transforming oncogene similar to SV40 ST, which provides some GFP control or SOX4 siRNA and probed for SOX4, p53, survivin, or PP2A C subunit as a loading control. SOX4 depletion results in p53 stabilization in of the key changes in gene expression that are necessary for LNCaP cells and in loss of survivin expression in HeLa cells. LNCaP cells do not anchorage-independent growth of human cells. It is somewhat express survivin regardless of SOX4 status. B, SOX4 siRNA induces apoptosis in fully transformed TERST cells that express SV40 ST but not immortalized surprising that a relatively small increase in SOX4 expression can TERV cells. HEK-TERST cells express SOX4 protein. Immunoblots of whole-cell enable anchorage-independent growth, but this may be due to lysates from the HEK-TERV and HEK-TERST cell lines were probed for SOX4. the fact that very high levels of expression might induce Actin was also probed as a control for protein loading. C, apoptosis of TERV and TERST cells transfected with control GFP and SOX4 siRNA duplexes was apoptosis selecting against cells with extremely high SOX4 quantitated by flow cytometry 0 (white columns) and 72 hours (black columns) expression. after transfection. www.aacrjournals.org 4017 Cancer Res 2006; 66: (8). April 15, 2006

SOX family transcription factors are essential for embryonic development and play critical roles in cell fate determination, differentiation, and proliferation. SOX4 is important for proliferation of B-cell progenitors (8) and has been implicated in lymphoma animal models (10–12). Moreover, SOX4 is aberrantly expressed in medulloblastomas (14) and carcinomas of the lung (15), breast (13), colon (41), and prostate (16–22). How and why is SOX4 expression increased in so many types of cancers? To gain insights into regulation of SOX4, we analyzed the genomic sequences upstream of the human and mouse SOX4 genes using our CONFAC software (42). We have identified DNA sequences and transcription factor binding sites (TFBS) that are conserved upstream of SOX4 between murine and human genomes. We identified conserved TFBS for NF-nB, signal transducers and activators of transcription, forkhead, LEF/TCF, E2F, HOX, and hypoxia-inducible factor 1-a (HIF1-a) family transcription factors. These data are consistent with reports that SOX4 is affected by HIF1-a (43), forkhead in rhabdomyosarcoma (44) estradiol (6), and tumor necrosis factor-a (45). Thus, SOX4 may be among the downstream targets of NF-nB important for transformation that also includes antiapoptotic genes, such as Bcl-2, and growth-stimulatory genes, such as c-myc, cyclin D1, and IL-6 (46). Through its activation of CSF1, SOX4 may contribute to chronic inflammation via paracrine stimulation of macrophages and to survival via autocrine activation of the AKT/mammalian target of rapamycin pathway (47). HOXC6 can repress SOX4 in Figure 6. A, immunoblot of whole-cell lysates prepared from RWPE-1 cells stably transfected with pcDNA vector or pcDNA-FLAG-SOX4 and probed with LNCaP cells (23) possibly through the conserved HOX sites, thus SOX4 polyclonal antisera. B, soft agar assays seeded with RWPE-1 vector cells preventing very high SOX4 expression that might induce or RWPE-1-FLAG-SOX4 cells after 17 days. Magnification, Â10 and Â20. apoptosis. This complex confluence of multiple signal transduc- C, quantitation of the number of colonies for RWPE-1 parental cells, RWPE-1 vector cells, two individual stable clones that express SOX4, and a pool of tion pathways on regulation of SOX4 expression seems to result multiple clones that express SOX4. Columns, mean of three independent in SOX4 expression being highly correlated with the cellular assays; bars, SD. environment of a cancer cell. Proliferative, survival, hypoxic, and inflammatory signals seem to activate SOX4 expression, whereas SOX4 has also been shown to have proapoptotic effects when developmental differentiation signaling seem to repress SOX4 overexpressed in HeLa and HEK293 cells (35–37). This may be expression. why we observed only an f2-fold overexpression of SOX4 in the Our data also suggest that SOX4 may be a novel potential RWPE-FLAG-SOX4 cells because very high overexpression could therapeutic target for human prostate cancer. Our results show have been selected against. Nevertheless, it is not unprecedented that SOX4 siRNA can effectively down-regulate SOX4 over- for transforming oncogenes to have both proliferative and expression in LNCaP cells and induce apoptosis in LNCaP apoptotic effects as has been shown in many studies of c-myc prostate cancer cells and BT-474 and MCF-7 breast cancer cells, (38). Like c-myc, SOX4 is a transcription factor that affects and that this effect can be reversed by overexpression of SOX4. expression of many genes, some of which (e.g., CSF1) promote cell Future work to examine the effectiveness of SOX4 knockdown on survival, and the balance of the proapoptotic and antiapoptotic prostate cancer in preclinical animal models will help determine SOX4 targets may determine cellular survival. Thus, the levels of whether this approach represents a potential avenue for clinical antiapoptotic SOX4 targets may be reduced more rapidly than the trials. proapoptotic SOX4 targets on depletion of SOX4 mRNA. This hypothesis is supported by our data, showing p53 stabilization in Acknowledgments LNCaP cells and loss of survivin expression in HeLa cells on depletion of SOX4. Received 8/25/2005; revised 1/9/2006; accepted 2/16/2006. Grant support: NIH grants K22-CA96560 and R01-CA106826 (C.S. Moreno), NIH We showed recently that another developmental transcription grants CA91435 and DK60647 (D.L. Jaye), and the Department of Pathology and factor, homeobox C6 (HOXC6), is also overexpressed in prostate Laboratory Medicine (Emory University School of Medicine). The costs of publication of this article were defrayed in part by the payment of page cancer tissues and that loss of HOXC6 expression can induce charges. This article must therefore be hereby marked advertisement in accordance apoptosis of LNCaP cells (23). There is growing evidence that with 18 U.S.C. Section 1734 solely to indicate this fact. SOX family transcription factors exert their effects on transcrip- We thank Cissy Geigerman for technical assistance, Dr. Christine Farr (University of Cambridge) for the generous gift of a human SOX4 clone, Dr. William Sellers tion via cooperative binding to DNA with transcription factor (Dana-Farber Cancer Institute) for the pcDNA3-FLAG vector, Drs. Jeffrey Franklin and partners (2). For example, SOX11 has been shown to coopera- Robert Coffey (Vanderbilt University) for frozen sections of SOX4 knockout embryos, tively bind and synergize with the homeobox POU factor Brn-1 Dr. Paula Vertino (Emory University) for MCF-7 and BT-474 cells, Dr. Jeremy Boss (Emory University) for use of the Bio-Rad iCycler (Bio-Rad Laboratories, Hercules, (39), and SOX2 forms complexes with the homeodomain factor CA), and Drs. Paul Wade, Keqiang Ye, and David Pallas for critical reading of the Oct1 (40). Thus, it is tempting to speculate that SOX4 and article and helpful discussions. Several prostate tissue samples for microarray analysis were obtained from the CPCTR. Tissue microarray slides were provided by the HOXC6 might cooperate to modulate gene expression in prostate CPCTR, which is funded by the National Cancer Institute. Other investigators may cancer cells. have received slides from these same array blocks.

Cancer Res 2006; 66: (8). April 15, 2006 4018 www.aacrjournals.org

References 17. Rhodes DR, Barrette TR, Rubin MA, Ghosh D, 33. Moreno CS, Ramachandran S, Ashby D, et al. Chinnaiyan AM. Meta-analysis of microarrays: inter- Signaling and transcriptional changes critical for 1. Schepers GE, Teasdale RD, Koopman P. Twenty pairs study validation of gene expression profiles reveals transformation of human cells by SV40 small tumor of sox: extent, homology, and nomenclature of the pathway dysregulation in prostate cancer. Cancer Res antigen or protein phosphatase 2A B56g knockdown. mouse and human sox transcription factor gene 2002;62:4427–33. Cancer Res 2004;64:6978–88. families. DevCell 2002;3:167–70. 18. Ernst T, Hergenhahn M, Kenzelmann M, et al. 34. Bello D, Webber MM, Kleinman HK, Wartinger DD, 2. Wilson M, Koopman P. Matching SOX: partner proteins Decrease and gain of gene expression are equally Rhim JS. Androgen responsive adult human prostatic and co-factors of the SOX family of transcriptional discriminatory markers for prostate carcinoma: a gene epithelial cell lines immortalized by human papilloma- regulators. Curr Opin Genet Dev2002;12:441–6. expression analysis on total and microdissected pros- virus 18. Carcinogenesis 1997;18:1215–23. 3. Zorn AM, Barish GD, Williams BO, Lavender P, tate tissue. Am J Pathol 2002;160:2169–80. 35. Kim BE, Lee JH, Kim HS, Kwon OJ, Jeong SW, Kim IK. Klymkowsky MW, Varmus HE. Regulation of Wnt 19. Lapointe J, Li C, Higgins JP, et al. Gene expression Involvement of Sox-4 in the cytochrome c-dependent signaling by Sox proteins: XSox17 a/h and XSox3 phy- profiling identifies clinically relevant subtypes of AIF-independent apoptotic pathway in HeLa cells sically interact with h-catenin. Mol Cell 1999;4:487–98. prostate cancer. Proc Natl Acad Sci U S A 2004;101: induced by D12-prostaglandin J2. Exp Mol Med 2004; 4. Sinner D, Rankin S, Lee M, Zorn AM. Sox17 and h- 811–6. 36:444–53. catenin cooperate to regulate the transcription of 20. Luo J, Duggan DJ, Chen Y, et al. Human prostate 36. Hur EH, Hur W, Choi JY, et al. Functional endodermal genes. Development 2004;131:3069–80. cancer and benign prostatic hyperplasia: molecular identification of the pro-apoptotic effector domain in 5. van de Wetering M, Oosterwegel M, van Norren K, dissection by gene expression profiling. Cancer Res human Sox4. Biochem Biophys Res Commun 2004;325: Clevers H. Sox-4, an Sry-like HMG box protein, is a 2001;61:4683–8. 59–67. transcriptional activator in lymphocytes. EMBO J 1993; 21. Magee JA, Araki T, Patil S, et al. Expression profiling 37. Ahn SG, Kim HS, Jeong SW, et al. Sox-4 is a positive 12:3847–54. reveals hepsin overexpression in prostate cancer. Cancer regulator of Hep3B and HepG2 cells’ apoptosis induced 6. Hunt SM, Clarke CL. Expression and hormonal Res 2001;61:5692–6. by prostaglandin (PG)A(2) and y(12)-PGJ(2). Exp Mol regulation of the Sox4 gene in mouse female reproduc- 22. Welsh JB, Sapinoso LM, Su AI, et al. Analysis of gene Med 2002;34:243–9. tive tissues. Biol Reprod 1999;61:476–81. expression identifies candidate markers and pharmaco- 38. Hemann MT, Bric A, Teruya-Feldstein J, et al. Evasion 7. Ya J, Schilham MW, de Boer PA, Moorman AF, logical targets in prostate cancer. Cancer Res 2001;61: of the p53 tumour surveillance network by tumour- Clevers H, Lamers WH. Sox4-deficiency syndrome in 5974–8. derived MYC mutants. Nature 2005;436:807–11. mice is an animal model for common trunk. Circ Res 23. Ramachandran S, Liu P, Young AN, et al. Loss of 39. Kuhlbrodt K, Herbarth B, Sock E, Enderich J, 1998;83:986–94. HOXC6 expression induces apoptosis in prostate cancer Hermans-Borgmeyer I, Wegner M. Cooperative function 8. Schilham MW, Oosterwegel MA, Moerer P, et al. cells. Oncogene 2005;24:188–98. of POU proteins and SOX proteins in glial cells. J Biol Defects in cardiac outflow tract formation and pro-B- 24. Moreno CS, Park S, Nelson K, et al. WD40 repeat Chem 1998;273:16050–7. lymphocyte expansion in mice lacking Sox-4. Nature proteins striatin and S/G(2) nuclear autoantigen are 40. Di Rocco G, Gavalas A, Popperl H, Krumlauf R, 1996;380:711–4. members of a novel family of calmodulin-binding Mavilio F, Zappavigna V. The recruitment of SOX/OCT 9. Geijsen N, Uings IJ, Pals C, et al. Cytokine-specific proteins that associate with protein phosphatase 2A. complexes and the differential activity of HOXA1 and transcriptional regulation through an IL-5Ra interacting J Biol Chem 2000;275:5257–63. HOXB1 modulate the Hoxb1 auto-regulatory enhancer protein. Science 2001;293:1136–8. 25. Hahn WC, Counter CM, Lundberg AS, Beijersbergen function. J Biol Chem 2001;276:20506–15. 10. Suzuki T, Shen H, Akagi K, et al. New genes involved RL, Brooks MW, Weinberg RA. Creation of human 41. Reichling T, Goss KH, Carson DJ, et al. Transcrip- in cancer identified by retroviral tagging. Nat Genet tumour cells with defined genetic elements. Nature tional profiles of intestinal tumors in Apc(Min) mice are 2002;32:166–74. 1999;400:464–8. unique from those of embryonic intestine and identify 11. Lund AH, Turner G, Trubetskoy A, et al. Genome- 26. Kuppumbatti YS, Rexer B, Nakajo S, Nakaya K, novel gene targets dysregulated in human colorectal wide retroviral insertional tagging of genes involved in Mira-y-Lopez R. CRBP suppresses breast cancer cell tumors. Cancer Res 2005;65:166–76. cancer in Cdkn2a-deficient mice. Nat Genet 2002;32: survival and anchorage-independent growth. Oncogene 42. Karanam S, Moreno CS. CONFAC: automated applica- 160–5. 2001;20:7413–9. tion of comparative genomic promoter analysis to DNA 12. Shin MS, Fredrickson TN, Hartley JW, Suzuki T, Agaki 27. Odom DT, Zizlsperger N, Gordon DB, et al. Control of microarray datasets. Nucleic Acids Res 2004;32:W475–84. K, Morse HC III. High-throughput retroviral tagging for pancreas and liver gene expression by HNF transcrip- 43. Manalo DJ, Rowan A, Lavoie T, et al. Transcriptional identification of genes involved in initiation and tion factors. Science 2004;303:1378–81. regulation of vascular endothelial cell responses to progression of mouse splenic marginal zone lympho- 28. Tusher VG, Tibshirani R, Chu G. Significance analysis hypoxia by HIF-1. Blood 2005;105:659–69. mas. Cancer Res 2004;64:4419–27. of microarrays applied to the ionizing radiation 44. Ramaswamy S, Nakamura N, Sansal I, Bergeron L, 13. Graham JD, Hunt SM, Tran N, Clarke CL. Regulation response. Proc Natl Acad Sci U S A 2001;98:5116–21. Sellers WR. A novel mechanism of gene regulation and of the expression and activity by progestins of a 29. Luo JH, Yu YP, Cieply K, et al. Gene expression tumor suppression by the transcription factor FKHR. member of the SOX gene family of transcriptional analysis of prostate cancers. Mol Carcinog 2002;33: Cancer Cell 2002;2:81–91. modulators. J Mol Endocrinol 1999;22:295–304. 25–35. 45. Banno T, Gazel A, Blumenberg M. Effects of tumor 14. Lee CJ, Appleby VJ, Orme AT, Chan WI, Scotting PJ. 30. Zhou H, Wertz I, O’Rourke K, et al. Bcl10 activates necrosis factor-a (TNFa) in epidermal keratinocytes Differential expression of SOX4 and SOX11 in medullo- the NF-nB pathway through ubiquitination of NEMO. revealed using global transcriptional profiling. J Biol blastoma. J Neurooncol 2002;57:201–14. Nature 2004;427:167–71. Chem 2004;279:32633–42. 15. Friedman R, Bangur C, Zasloff E, et al. Molecular and 31. Jeffers JR, Parganas E, Lee Y, et al. Puma is an 46. Suh J, Rabson AB. NF-nB activation in human immunological evaluation of the transcription factor essential mediator of p53-dependent and -independent prostate cancer: important mediator or epiphenome- SOX-4 as a lung tumor vaccine antigen. J Immunol 2004; apoptotic pathways. Cancer Cell 2003;4:321–8. non? J Cell Biochem 2004;91:100–17. 172:3319–27. 32. Hahn WC, Dessain SK, Brooks MW, et al. Enumer- 47. Glantschnig H, Fisher JE, Wesolowski G, Rodan GA, 16. Dhanasekaran SM, Barrette TR, Ghosh D, et al. ation of the simian virus 40 early region elements Reszka AA. M-CSF, TNFa, and RANK ligand promote Delineation of prognostic biomarkers in prostate necessary for human cell transformation. Mol Cell Biol osteoclast survival by signaling through mTOR/S6 cancer. Nature 2001;412:822–6. 2002;22:2111–23. kinase. Cell Death Differ 2003;10:1165–77.

www.aacrjournals.org 4019 Cancer Res 2006; 66: (8). April 15, 2006

Pengbo Liu, Sumathi Ramachandran, Mohamed Ali Seyed, et al.

Cancer Res 2006;66:4011-4019.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/66/8/4011

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2006/04/26/66.8.4011.DC1

Cited articles This article cites 47 articles, 21 of which you can access for free at: http://cancerres.aacrjournals.org/content/66/8/4011.full#ref-list-1

Citing articles This article has been cited by 37 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/66/8/4011.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/66/8/4011. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.