Regulation of Germ-Line Expression of the Caenorhabditis Elegans Gene Fem-1 by Maternal Transcripts

Regulation of germ-line expression of the Caenorhabditis elegans gene fem-1 by maternal transcripts

Cheryl Lynn Johnson

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Graduate Department of Molecular Genetics University of Toronto

Regulation of germ-line expression of the Caenorhabditis elegans gene fem-1 by maternal transcripts

Cheryl Lynn Johnson

Doctor of Philosophy

Department of Molecular Genetics University of Toronto

2010 Abstract

In addition to previously identified roles for RNA, several new ways in which RNA serves as a regulator of gene expression have recently been described. RNA molecules are involved in both transcriptional and post-transcriptional forms of regulation, sometimes heritably affecting gene activity. Whereas most previously characterized regulatory roles of RNA involve downregulation, I describe a role for maternal transcripts of a gene in promoting zygotic activity of that gene, which I term the licensing of genetic activity. This regulation occurs in the germ line, a tissue notable for its abundance of genetic surveillance mechanisms.

The maternal-effect regulation described here was identified using alleles of a sex- determining gene in Caenorhabditis elegans called fem-1. Females homozygous for fem-1 deletions produce heterozygous offspring that exhibit germ-line feminization and have reduced fem-1 activity and transcript accumulation. This phenotype can be rescued by injecting fem-1

RNA into the maternal germ line. The reduction in activity of the zygotic fem-1 locus is heritable, suggesting that the gene is becoming epigenetically silenced. Thus the maternal fem-1

RNA licenses the activity of the zygotic locus by preventing its silencing. By restricting germ-

ii line activity to genes that were expressed in the germ line of the previous generation, this process may contribute to protecting the identity and integrity of the germ line.

I performed an RNAi screen of candidate genes to ask whether they are required for maternal-effect silencing or licensing. Several enhancers and suppressors of germ-line feminization in the descendants of fem-1 deficiency homozygotes were identified. Chromatin regulation may be involved, and small-RNA pathways are important for both the silencing and licensing components of fem-1 regulation. Based on my characterization of this phenomenon, I proposed models of how maternal-effect regulation of fem-1 may be mediated. To test predictions of certain models, I examined whether specific characteristics of fem-1 make it susceptible to this silencing. Results of these experiments limit the possible models of maternal- effect regulation and suggest directions for future investigation.

iii

Acknowledgments

My supervisor, Dr. Andrew Spence, is the person who first noticed the unusual inheritance patterns associated with fem-1 deficiency alleles. I am grateful that he perceived my interest in genetics and matched me with such an interesting project. I thank him for his mentorship in designing and performing experiments, thinking about broader scientific ideas, and learning to present with greater clarity. Our discussions were fun and productive, and he always heartened me when I entered his office discouraged. My committee members Dr. Brigitte Lavoie and Dr. Howard Lipshitz also helped me to develop as a scientist. I thank them for their input at committee meetings and for providing feedback about the manuscripts and my thesis. I was challenged and encouraged by them both throughout my degree.

My fellow Spence lab members were one of the great joys of graduate school. They were my travelling companions on the road to my Ph.D., and I am so happy and honoured to have been their friend and colleague. Thanks to Kathleen Dawson, Leslie Magtanong, Holly Sassi, Jonathan Boetto, Dr. Fiona Broackes-Carter, Dr. Ramona Cooperstock, Dr. Mara Schvarzstein, Stephanie Grouios and Michael Schertzberg. They embraced me from the first day of my rotation and saved my worm pick just in case I decided to join the lab. Likewise, the Roy lab has been wonderful scientifically and socially in Toronto and at conferences. I’m thankful for the camping, the karaoke, the book club, many a great meal with excellent companions, and the general merriment. They injected a lot of fun into my grad school years and have continuously buoyed my spirits in hard times. My thanks go to Caroline Fernandes who helped with the RNAi screen and to everyone who contributed expertise and reagents as listed throughout this thesis.

My family and friends have been invaluable during this undertaking. Having my Aunt George Perrier and my cousin Michelle Perrier-Martinen nearby has been fantastic for my transition from Alberta. My sister Dana Johnson and my friends Lindsay LeBlanc and Loretta Foley continue to keep me laughing and smiling. I look up to Grandpa and Grandma Wakelin who have been unceasingly loving and generous. My parents Randy and Darlene Johnson always have supreme confidence in me. Their love and support keep me going, and I dedicate this work to them. (I got the paper, Dad!) My husband Andrew Keeping makes everything in my world shine brighter. He cheerfully supports me in everything, and that makes all the difference. iv

Table of Contents

Abstract ...... ii

Acknowledgments ...... iv

Table of Contents ...... v

List of Tables ...... xi

List of Figures ...... xiii

List of Abbreviations and Gene Names ...... xvi

Chapter 1 Introduction ...... 1

1 Introduction ...... 2

1.1 The germ line and epigenetic changes ...... 2

1.2 Epigenetic phenomena and RNA-mediated effects ...... 3

1.2.1 Mechanisms of heritable change in genetic activity ...... 3

1.2.2 Overview of chromatin structure ...... 4

1.2.3 Overview of RNA regulatory mechanisms ...... 6

1.2.4 RNA-mediated effects that heritably reduce gene activity ...... 7

1.2.5 RNA-mediated gene activation ...... 13

1.2.6 RNA-mediated regulation and heritable effects in C. elegans ...... 15

1.2.6.1 MicroRNAs ...... 15

1.2.6.2 Small interfering RNAs ...... 19

1.2.6.3 Piwi-interacting RNAs (21U-RNAs) ...... 22

1.2.6.4 Genomic imprinting ...... 24

1.3 Sex determination and the genetics of fem-1 ...... 25

1.3.1 Genetics in C. elegans ...... 25

1.3.2 Sexual dimorphism in C. elegans ...... 26

1.3.3 Overview of somatic sex determination ...... 28

1.3.4 Roles of the fem genes ...... 30

1.3.5 Germ-line sex determination ...... 33

1.4 Development and regulation of the C. elegans germ line ...... 36

1.4.1 Overview of germ-line development in C. elegans ...... 36

1.4.2 Factors required for establishment and maintenance of the germ-line ...... 38

1.4.3 Surveillance processes in the C. elegans germ line ...... 41

1.5 Thesis objectives ...... 44

Chapter 2 Licensing of fem-1 in the germ line by maternal transcripts ...... 45

2 Licensing of fem-1 in the germ line by maternal transcripts ...... 46

2.1 Abstract ...... 46

2.2 Introduction ...... 46

2.3 Materials and Methods ...... 48

2.3.1 Nematode maintenance and alleles ...... 48

2.3.2 C. elegans strains ...... 49

2.3.3 General molecular biological methods ...... 49

2.3.4 Plasmid information ...... 51

2.3.5 Polymerase chain reaction conditions ...... 53

2.3.6 Delimiting the breakpoints of deficiency alleles ...... 54

2.3.7 Quantification of maternal-effect embryonic lethality ...... 54

2.3.8 Characterization of fem-1 transcript from idDf1 ...... 55

2.3.9 RNA isolation and quantification ...... 56

2.3.10 Quantification of germ-line feminization ...... 56

2.3.11 Isolating paternal disomics for chromosome IV ...... 57

2.3.12 RNA injection ...... 57

2.3.13 Measuring fem-1 maternal rescue ...... 60

2.3.14 Measuring fem-2 maternal rescue ...... 60 vi

2.3.15 RNA in situ hybridization ...... 60

2.3.16 Heritable effects on germ-line feminization ...... 61

2.3.17 Restoring activity to compromised alleles ...... 62

2.4 Results ...... 62

2.4.1 Germ-line feminization of fem-1(Df)/+ m-z+ animals ...... 62

2.4.2 RNA production by fem-1 alleles ...... 70

2.4.3 Injection of fem-1 RNA into the germ line of fem-1(Df) females rescues germ- line feminization of their progeny ...... 72

2.4.4 Germ-line fem-1 levels are reduced in fem-1(Df)/+ m-z+ animals ...... 82

2.4.5 Evidence of a heritable change in genetic activity in fem-1(Df)/+ m-z+ animals ...... 89

2.5 Discussion ...... 93

2.5.1 Heritable silencing of fem-1 in the absence of maternal RNA ...... 93

2.5.2 Models for licensing of zygotic germ-line gene expression by fem-1 RNA ...... 94

2.5.3 Potential benefits of licensing gene expression in the C. elegans germ line ...... 97

Chapter 3 Genetic factors influencing maternal-effect germ-line feminization ...... 99

3 Genetic factors influencing maternal-effect germ-line feminization ...... 100

3.1 Abstract ...... 100

3.2 Introduction ...... 100

3.3 Materials and Methods ...... 106

3.3.1 Nematode maintenance and alleles ...... 106

3.3.2 C. elegans strains used ...... 106

3.3.3 Genotyping of strains carrying deletion alleles ...... 110

3.3.4 Preparing strains from the RNAi feeding library ...... 113

3.3.5 RNAi screening of fem-1/+ m-z+ animals...... 117

3.3.6 Statistics for the RNAi screen ...... 117

3.3.7 RNAi screening of temperature-sensitive fem-1 alleles ...... 118 vii

3.3.8 Measuring the effect of candidate gene mutations on inheritance of the Fog phenotype ...... 118

3.3.9 Testing the effect of a smg-1 mutation on inheritance of the Fog phenotype ..... 118

3.3.10 RNA injection of rde-1 animals ...... 119

3.3.11 RNA isolation and quantification ...... 120

3.4 Results ...... 120

3.4.1 RNAi screen of candidate genes as modifiers of the Fog phenotype ...... 120

3.4.2 Addressing differences between the three fem-1(Df) alleles ...... 144

3.4.3 Validation of the RNAi screen using mutant alleles of candidate modifiers ...... 148

3.5 Discussion ...... 158

3.5.1 Maternal-effect regulation of fem-1 has distinct genetic requirements...... 158

3.5.2 T12E12.2 contributes to the penetrance of germ-line feminization detected in descendants of fem-1(Df) females ...... 160

3.5.3 Germ-line silencing of fem-1 likely involves RNA ...... 161

3.5.4 Licensing of fem-1 expression by maternal RNA ...... 164

Chapter 4 Investigating the targeting of fem-1 for silencing ...... 168

4 Investigating the targeting of fem-1 for silencing ...... 169

4.1 Abstract ...... 169

4.2 Introduction ...... 169

4.3 Materials and Methods ...... 172

4.3.1 Nematode maintenance and alleles ...... 172

4.3.2 C. elegans strain information ...... 173

4.3.3 Plasmids used ...... 175

4.3.4 Plasmids constructed ...... 176

4.3.5 Measuring fem-2(tm337) RNA production ...... 177

4.3.6 Testing fem-2(tm337) for a maternal effect ...... 178

4.3.7 Small RNA analysis ...... 178 viii

4.3.8 Randomly integrated transgenes with full length fem-1(+) ...... 178

4.3.9 Single-copy fem-1 minigenes ...... 179

4.3.10 Verifying transgene integration in MosSCI-generated lines ...... 180

4.3.11 Attempting to delete fem-1 using MosSCI ...... 180

4.3.12 RNA injection into animals with a silenced transgene ...... 181

4.4 Results ...... 181

4.4.1 Testing the ability of RNA injection to desilence a transgene ...... 181

4.4.2 Examining another gene for susceptibility to silencing ...... 182

4.4.3 Testing cis sequence requirements for silencing ...... 185

4.5 Discussion ...... 192

4.5.1 Maternal RNA does not desilence a germ-line transgene ...... 192

4.5.2 fem-2(tm337) does not produce a maternal absence effect ...... 193

4.5.3 Silencing of fem-1 does not require intron 8 or the gene’s position on chromosome IV ...... 193

Chapter 5 General Discussion ...... 195

5 General Discussion ...... 196

5.1 Characterization of maternal-effect silencing and licensing in the C. elegans germ line 196

5.2 Comparison with previously known forms of regulation ...... 197

5.3 Models for the mechanisms of maternal-effect regulation ...... 203

5.3.1 General considerations for models ...... 203

5.3.2 Model A: Licensing by targeting siRNAs ...... 204

5.3.3 Model B: Licensing by targeting chromatin ...... 209

5.3.4 Potential roles for modifier genes in maternal-effect regulation ...... 210

5.3.4.1 Factors involved in small-RNA pathways ...... 210

5.3.4.2 Mechanisms involving chromatin modification ...... 215

5.4 Future investigation of maternal-effect regulation ...... 216

References ...... 221

List of Tables

Table 1-1: Comparison of several types of small RNAs in C. elegans...... 16

Table 1-2: RNA-directed RNA polymerases of C. elegans...... 21

Table 1-3: Loss- and gain-of-function phenotypes of the three fem genes of C. elegans...... 30

Table 2-1: C. elegans strain names and genotypes ...... 50

Table 2-2: Plasmid names and descriptions...... 52

Table 2-3: Primers used in plasmid construction...... 53

Table 2-4: Primers used to delimit deficiency breakpoints...... 54

Table 2-5: Information about the in vitro transcription products used for the RNA injection experiment...... 59

Table 2-6: Maternal-effect lethality of fem-1 deficiencies...... 64

Table 2-7: Germ-line feminization in fem-1/+ m-z+ heterozygotes...... 67

Table 2-8: Brood sizes of fem-1(Df)/+ m-z+ hermaphrodites...... 68

Table 2-9: fem-1(Df)/+ progeny of heterozygotes rarely exhibit germ-line feminization...... 68

Table 2-10: Statistical significance of the effect of RNA injection...... 77

Table 3-1: C. elegans strains and their genotypes...... 107

Table 3-2: PCR product sizes for genotyping deletion alleles...... 111

Table 3-3: Primers used for genotyping deletion alleles...... 111

Table 3-4: Genes targeted by RNAi in a screen for modifiers of the Fog phenotype...... 113

Table 3-5: Molecular and phenotypic characterization of genes screened by RNAi...... 121

Table 3-6: Genes that could not be assessed as modifiers of the Fog phenotype...... 136 xi

Table 3-7: Colour scheme used for representing the percentage of Fog animals observed after RNAi treatment in Table 3-8...... 138

Table 3-8: Germ-line feminization in fem/+ m-z+ or fem-1(ts) animals following RNAi treatment...... 139

Table 4-1: Names and genotypes of C. elegans strains...... 174

Table 4-2: Names and sequences of primers used during cloning...... 177

Table 4-3: PCR diagnostics of transgenes integrated using MosSCI...... 180

xii

List of Figures

Figure 1-1: RNAi-mediated heterochromatin silencing in S. pombe...... 9

Figure 1-2: Ping-pong model of piRNA-mediated silencing in D. melanogaster...... 12

Figure 1-3: The two sexes of C. elegans...... 27

Figure 1-4: Formal model of the somatic sex-determination pathway in C. elegans...... 29

Figure 1-5: Formal model of the germ-line sex-determination pathway in C. elegans...... 34

Figure 1-6: Embryonic development of the germ line in C. elegans...... 37

Figure 2-1: Physical map of fem-1 alleles...... 63

Figure 2-2: Animals with wild-type or feminized germ lines...... 65

Figure 2-3: Evidence of the Fog phenotype in animals that do not inherit a fem-1(Df) allele. .... 69

Figure 2-4: Levels of fem-1 RNA production from various fem-1 alleles...... 71

Figure 2-5: Timeline for rescue of the Fog phenotype after RNA injection...... 73

Figure 2-6: Effect of RNA injection into the germ line of idDf2 females on germ-line feminization in their heterozygous progeny...... 74

Figure 2-7: fem-1 cDNA features and injection constructs...... 79

Figure 2-8: Effect of descent from a fem-1(Df) female upon fem-1 maternal rescuing activity in fem-1/+ heterozygotes...... 83

Figure 2-9: Effect of descent from a fem-1(Df) female on fem-2 maternal rescuing activity...... 85

Figure 2-10: fem-1 transcript accumulation in the progeny of fem-1 or fem-1/+ animals...... 88

Figure 2-11: Increased penetrance of germ-line feminization in fem-1(Df)/+ heterozygotes following backcrossing to fem-1(Df) females...... 89

xiii

Figure 2-12: Evidence for germ-line feminization in the self-progeny of non-Fog fem-1(Df)/+ m- z+ animals...... 91

Figure 2-13: Restoring activity to compromised alleles of fem-1(Df) progeny...... 92

Figure 3-1: Genes that enhance the Fog phenotype when their activity is reduced by RNAi. ... 142

Figure 3-2: Genes that suppress the Fog phenotype when their activity is reduced by RNAi. .. 143

Figure 3-3: Penetrance of the Fog phenotype in heterozygous cross-progeny of fem mothers when animals are subjected to RNAi targeting T12E12.2 or the empty vector L4440...... 145

Figure 3-4: Levels of T12E12.2 RNA production from various alleles...... 147

Figure 3-5: Effect of mutant alleles on the penetrance of the Fog phenotype in fem-1(Df)/+ m-z+ animals...... 149

Figure 3-6: Effect of RNA injection into the germ line of idDf2 with functional or mutated rde-1...... 153

Figure 3-7: Clades of Argonaute proteins and their behaviour in my RNAi assay...... 154

Figure 3-8: A smg-1 mutation affects the penetrance of the Fog phenotype in idDf1/+ animals...... 157

Figure 3-9: Formal models of how maternal-effect silencing and licensing may regulate fem-1...... 162

Figure 4-1: Testing a fem-2 allele for maternal-effect silencing...... 183

Figure 4-2: Testing randomly integrated full-length fem-1 transgenes for susceptibility to silencing in the offspring of fem-1 females...... 186

Figure 4-3: Small RNAs near the fem-1 locus in wild-type animals and prg-1 mutants...... 188

Figure 4-4: Testing integrated fem-1 minigenes for susceptilibity to silencing in the offspring of fem-1(Df) females...... 190

xiv

Figure 5-1: Models of maternal-effect regulation of fem-1 in the zygotic germ line...... 206

List of Abbreviations and Gene Names ago: Argonaute alg: Argonaute-like gene

ANK: Ankyrin

ARC: Argonaute chaperone complex ash: Absent small and homeotic discs bp: Basepairs capg: CAP-G condensin subunit

CBC complex: Complex containing Elongin C, Elongin B, cullin cde: Cosuppression defective cdk: Cyclin-dependent kinase

Cele1: A nonautonomous DNA transposon in C. elegans chp: Chromodomain-containing protein cid: Caffeine-induced death protein cir: CIR (transcription factor CBF1-interacting corepressor) homolog

CLRC: Clr4 methyltransferase complex csr: Chromosome-segregation and RNAi deficient cul: Cullin daf: Abnormal dauer formation

DCC: Dosage compensation complex

xvi dcr: Dicer

Df: Deficiency (deletion)

DIG: Digoxygenin dlx: Related to Distal-less dm: Dominant mutation dpy: Dumpy drh: Dicer-related helicase drp: Dynamin-related protein drsh: Drosha dsRNA: Double-stranded RNA egl: Egg-laying defective ego: Enhancer of glp-1 ekl: Enhancer of ksr-1 lethality ergo: Endogenous-RNAi-defective Argonaute eri: Enhanced RNAi fbf: fem-3 binding factor fem: Feminization fem-1(Df): Any of the three deficiency alleles affecting fem-1: idDf1, idDf2, idDf3 fog: Feminization of the germ line

Gene CATCHR: Gene cloning and tagging for C. elegans by homologous recombination

xvii gf: Gain of function mutation gfl: Human GAS41-like

GFP: Green fluorescent protein gld: Defective in germ-line development glh: Germ-line helicase glp: Abnormal germ-line proliferation hda: Histone deacetylase her: Hermaphrodization of XO animals hil: Histone-H1-like him: High incidence of males his: Histone hox: Homeotic gene

HP1: Heterochromatin protein 1 hpl: HP1-like hrr: Helicase required for RNAi-mediated heterochromatin assembly htz: Histone variant H2A.Z homolog

IES: Internal eliminated sequence isw: Yeast imitation switch homolog kle: Kleisin (abnormal closure) family ksr: Kinase suppressor of Ras

xviii let: Lethal lf: Loss of function mutation

LG: Linkage group lin: Abnormal cell lineage lon: Long m-: No maternal contribution of wild-type gene product m+: At least one copy of the wild-type gene is present in the mother

MAGO: Multiple Argonaute mutant; includes ppw-1, sago-1, sago-2, wago-4 mes: Maternal-effect sterile met: Histone methyltransferase-like mex: Muscle excess miRNA: MicroRNA

MITE: Miniature inverted-repeat transposable element mle: Maleless mof: Males absent on the first mog: Masculinization of the germ line mom: More of MS blastomere mor: Morphological – rounded nose

MosSCI: Mos1-mediated single copy insertion mrg: related to human Mortality-factor-related gene

xix msl: Male-specific lethal mut: Mutator myo: Myosin heavy chain structural gene

MYOB: Modified Youngren’s only bacto-peptone mys: MYST family histone acetyltransferase-like

MYST family: Histone acetyltransferases named for Moz, Ybf2, Sas2, and Tip60 ncRNA: Non-coding RNA

NGM: Nematode growth medium nos: Nanos-related nrde: Nuclear RNAi defective nt: Nucleotide

NURF: Nucleosome remodelling factor pal: Posterior alae in males

PAZ: Domain shared by Piwi, Argonaute, Zwille pash: Pasha

PCR: Polymerase chain reaction pgk: Phosphoglycerate kinase pgl: P-granule abnormality pha: Defective pharynx development pie: Pharynx and intestine in excess

xx pir: Phosphatase interacting with RNA/RNP piRNA: Piwi-interacting RNA piwi: P-element-induced wimpy testes ppw: Paz- and Piwi-domain-containing pqn: Prion-like-(Q/N-rich)-domain-bearing protein

PRC1: Polycomb repressive complex type 1

PRC2: Polycomb repressive complex type 2 prg: Piwi-related gene puf: PUF (Pumilio/FBF) domain-containing pup: PolyU polymerase

Pvu: Protruding vulva pyp: inorganic pyrophosphatase rab: RAB family of small GTPases

RACE: Rapid amplification of cDNA ends rasi: Repeat-associated small interfering RNAs rba: RBAp48-related rde: RNAi-defective rdp: RNA-dependent RNA polymerase

RDRC: RNA-directed RNA polymerase complex

RdRP: RNA-dependent RNA polymerase

xxi rha: RNA helicase

RISC: RNA-induced silencing complex

RITS: RNA-induced transcriptional silencing

RNAi: RNA interference

RNAi-TGS: RNAi transcriptional gene silencing rol: Roller roX: RNA on X rrf: RNA-dependent RNA polymerase family

RT-PCR: Reverse transcription polymerase chain reaction sago: Synthetic secondary siRNA-deficient Argonaute mutant scnRNA: Scan RNA sd: Semi-dominant mutation sdc: Sex determination and dosage compensation

SEM: Standard error of the mean set: SET-domain-containing

SET domain: Named for Suppressor of variegation 3-9, Enhancer of zeste, and Trithorax sin: SIN3 (yeast switch independent) histone deacetylase component homolog siRNA: Short interfering RNA smc: SMC (structural maintenance of chromosomes) family smg: Suppressor with morphological effect on genitalia

xxii sop: Suppressor of pal-1 sor: sop-2-related ssl: Yeast Swi2/Snf2-like ssRNA: Single-stranded RNA

Ste: Sterile synMuv: Synthetic multivulva

TAE: Tris-acetate EDTA tam: Tandem array expression modifier tas: Targeting complex subunit

TE: Transposable element

TIR: Terminal inverted repeats tra: Transformer (XX animals transformed into males)

TRE: Trithorax-repeat element trr: TRRAP-like (transcription/transformation domain-associated protein) ts: Temperature-sensitive mutation ubx: Ultrabithorax unc: Uncoordinated

UTR: Untranslated region wago: Worm-specific Argonaute xol: XO-lethal

xxiii

YFP: Yellow fluorescent protein z-: No wild-type copy of the gene is present in the zygote z+: Zygotic genome contains at least one wild-type copy of the gene zfp: Zinc finger protein

xxiv 1

Chapter 1 Introduction

1 Introduction 1.1 The germ line and epigenetic changes

Maintaining the distinction between the germ line and the soma is of primary importance in animal development. As the body of an animal develops, somatic cells divide by mitosis and differentiate into specific cell types. A mutation in one of these cells will affect the subsequent cells produced in that lineage, but such a mutation is not globally inherited throughout the animal. The mutation will not be inherited by the animal’s offspring and may not affect viability or fertility. Germ cells differ in that they must produce a totipotent one-cell embryo able to generate all the cells required for development. Inappropriate differentiation of germ cells may prevent an animal from reproducing altogether, thereby prohibiting contribution of its genes to the next generation. Mutations in the germ line would also be transmitted to every cell in the developing offspring and are therefore potentially more severe than corresponding somatic mutations. For these reasons, the germ line uses various protective mechanisms to promote the generation of totipotent, unmutated gametes.

Aside from alterations to the DNA sequence, there are other ways to heritably affect gene activity. These forms of regulation are called epigenetic and can be transmitted differently in the soma and the germ line. During development, groups of genes are activated in some lineages and repressed in others. In the soma, these changes must survive mitotic division in order to be maintained throughout the cell lineage. This regulation is driven by the developmental program and eventually produces terminally differentiated cells whose expression profiles at these loci need never be reset. In addition to these developmental roles, inheritance of epigenetic changes across generations has also been observed. In order for epigenetic inheritance to be transgenerational, it must produce meiotically heritable changes in gene activity that survive alterations to chromatin during gametogenesis. Such a mechanism provides means for parents to contribute additional information to their offspring aside from the genome sequence. Hypothetically, information about environmental influences or previous generations could be provided in this way.

Here, I describe a form of RNA-mediated epigenetic inheritance in the free-living, soil nematode Caenorhabditis elegans in which germ-line activity of a gene is informed by expression of that gene in the germ line of previous generations. For context, I will review

principles of epigenetic inheritance and describe previously characterized forms of RNA- mediated regulation in C. elegans and other organisms. Since the gene studied in this thesis regulates sex determination in C. elegans, an overview of that process will focus on the role of fem-1. A description of the development and regulation of the C. elegans germ line will provide background information about the environment where maternal-effect regulation of fem-1 occurs.

1.2 Epigenetic phenomena and RNA-mediated effects 1.2.1 Mechanisms of heritable change in genetic activity

The genetic information that an organism receives from its parents consists of the faithfully reproduced sequence of nucleotides constituting the DNA of the zygotic genome. In addition to the organism’s genotype, other heritable factors affect genetic activity in the zygote. This regulation is accomplished through a combination of transcriptional and post-transcriptional means. One way to transmit additional instruction is to encode other information on the chromosomes themselves. DNA is not an isolated molecule; rather, it is found in association with histones and other proteins to form chromatin. By modifying the structure of chromatin, the activity of individual genes or regions of the genome can be affected. A second way of contributing extra-genomic information is by the provision of parental RNAs or proteins. Inherited proteins can affect the expression of other genes by acting as activators or repressors. Parental RNA can affect the activity of zygotic genes by targeting zygotic DNA or RNA through basepairing for further regulation. RNA-mediated regulation and chromatin modification are not mutually exclusive, and they often inform each other.

Epigenetic inheritance is defined as a heritable change in gene activity that does not involve modification of the nucleotide sequence of a gene. Epigenetically heritable changes often depend on the activity of factors associated with alterations to chromatin structure. As a result, there is a tendency in the literature to refer to chromatin modifications themselves as modes of epigenetic regulation. However, while chromatin changes often correlate with epigenetic regulation, it is unclear whether they are causal and by what mechanism they would be heritable. I will restrict my use of the term to situations where a change in gene activity is

heritable, mitotically or meiotically, without involving a mutation. Certain chromatin modifications are associated with genetic silencing, and the term is sometimes taken to imply the presence of such modifications. However, silencing can also be achieved through other methods, as described below. I will use the term silencing to refer to situations where genetic activity is reduced without respect to the mechanism by which that reduction is achieved.

1.2.2 Overview of chromatin structure

The basic unit of chromatin in eukaryotes is the nucleosome formed by wrapping 147 basepairs of DNA around a histone octamer consisting of two copies each of histones H2A, H2B, H3 and H4. Nucleosomes are connected to each other by linker DNA. Both the spacing and components of nucleosomes can be modified in several ways to affect gene activity (reviewed by Margueron and Reinberg 2010). Chromatin modifications can be associated with gene-specific expression levels or with the regulation of broad regions of DNA.

Regions associated with active transcription are called euchromatin (reviewed by Grewal and Jia 2007). They were initially identified cytologically in Drosophila melanogaster and then correlated with active genes. Other regions of the genome are termed heterochromatic. They are gene poor and associated with transcriptional repression. These regions are cytologically distinct from euchromatin because they are associated with additional proteins such as HP1 (heterochromatin protein 1) that highly condense the heterochromatin. Chromatin condensation is associated with assembling nucleosomes into higher orders of chromatin structure. Increased compaction of nucleosomes leads to reduced activity of genes, likely because the DNA contained in the compacted region is less accessible for transcription. The position of chromatin in the nucleus and the spacing between nucleosomes both affect chromatin activity. In C. elegans, certain proteins involved in genetic regulation bear homology to components of ATP-dependent nucleosome-repositioning machinery in other organisms (Andersen et al. 2006).

Regulation of individual genes occurs through modifications that can specifically target a given locus, for instance by directly modifying the DNA (reviewed by Margueron and Reinberg 2010). DNA methylation is performed by DNA methyltransferase enzymes and typically produces 5-methylcytosine at locations where cytosine is directly followed by guanine, called

CpG sites. Stable inheritance through cell division has been demonstrated for DNA methylation. While DNA methylation is involved in many epigenetic processes in plants and mammals, including RNA-mediated effects, it has not been detected in C. elegans (Simpson et al. 1986; Bernstein and Allis 2005). Genes encoding components of a DNA methyltransferase system in related organisms have diverged in C. elegans (Gutierrez and Sommer 2004).

Regulation is also achieved through the use of histone variants. Additional conserved forms of H2A and H3 have been identified in many organisms, whereas fewer variant forms of H2B and H4 have been reported (Talbert and Henikoff 2010). Many organisms incorporate histone variants into specific nucleosomes as a way to modulate gene activity. In C. elegans, the use of htz-1 (histone variant H2A.Z homolog) promotes gene expression during pharyngeal development (Updike and Mango 2006). Additionally, at least one H3.3 variant is retained in the chromatin of mature sperm in C. elegans, allowing possible transfer of epigenetic information through the male germ line (Ooi et al. 2006).

Histones are also subject to post-translational modification of their amino-terminal tails that protrude from nucleosomes. Histones can be modified in several ways, including methylation, acetylation, phosphorylation, ubiquitination and sumoylation (reviewed by Margueron and Reinberg 2010). Multiple copies of certain modifications can be added to a given histone residue. Specific modifications tend to be associated with upregulation or downregulation of transcription, though their interpretation can also be context-specific and informed by neighbouring histone modifications. Acetylation of lysine residues on histones H3 and H4 as well as methylation of H3K4 and H3K36 are associated with transcriptionally competent chromatin. Methylation of lysines 9 and 27 on histone H3 correlates with transcriptionally repressed chromatin. Many proteins that bind chromatin do so through domains that recognize specific histone modifications, which has led to the idea that histone modifications may be read as a code that determines downstream outcomes (Strahl and Allis 2000; Jenuwein and Allis 2001). These domains include chromodomains, bromodomains, plant homeodomains, Tudor domains and malignant brain tumour domains (Margueron and Reinberg 2010). Enzymes responsible for modifying histones are found in C. elegans, including histone acetyltransferases and SET-domain-containing histone methyltransferases. The marks can be removed by histone deacetylases and histone demethylases, allowing for dynamic regulation. Several of these

histone modifications have been detected in the C. elegans germ line, including marks associated with both gene activation and repression (Kelly et al. 2002; Reuben and Lin 2002).

Because chromatin modifications can affect the expression of specific genes, chromatin remodelling is often involved in epigenetic effects. While DNA methylation is heritable during cell division, it is unclear whether other aspects of chromatin remodelling such as histone modifications can self-propagate. Instead, the reestablishment of these components of regulation may be programmed by other factors such as small RNAs.

1.2.3 Overview of RNA regulatory mechanisms

RNA molecules can have other roles, including structural and regulatory functions, in addition to serving as a messenger between DNA and protein. Structural roles for RNA include acting as a scaffold for assembly of complexes, maintaining the integrity of the cytoskeleton in the cytoplasm and organizing chromatin in the nucleus (Kloc 2009). Regulation by RNA molecules can be achieved by catalyzing biological reactions, basepairing with specific nucleic acids, or binding proteins to modulate their function (Goodrich and Kugel 2006). The roles of certain RNAs are well-established, such as the involvement of ribosomal RNAs and transfer RNAs in translation. These molecules provide examples of enzymatic, scaffold and adaptor functions of RNA and illustrate the importance of secondary and tertiary structures to the roles of some RNAs.

RNAs can affect the activity of other factors in the cell through many means. The RNA may function by itself or in a complex with additional protein factors. One way that RNAs can influence expression is by affecting the activity of the eukaryotic transcriptional apparatus, which can be accomplished through several mechanisms (reviewed by O'Neill 2005; Goodrich and Kugel 2006). Sometimes the RNA itself is not needed, for example if the act of transcription serves to occlude the promoter of a nearby locus. Certain RNAs target RNA polymerase II directly, and some RNAs influence other general factors involved in transcription elongation and termination. Other RNAs function as or affect the activity of particular activators and repressors of transcription. Specific examples of RNAs acting as coactivators will be described in the section on RNA-mediated gene activation. Generally, RNA can affect the activity of proteins

allosterically by interacting with these factors directly or by generating other signals such as chromatin modifications that affect recruitment of the transcriptional activators and repressors.

Recently, the prevalence and importance of small-RNA-mediated pathways have been increasingly recognized in diverse organisms. The primary sequence of small RNAs is critical as they often act as guides to direct larger complexes to target homologous nucleic acids. Certain small RNA pathways are associated with genome defense and act to limit the expression of potentially harmful DNA elements, but small RNAs also regulate endogenous processes. Small RNAs that control development or cellular functions may act as cues to either promote or hinder gene activity. Some, but not all, of the mechanisms used by RNA to regulate gene activity are heritable. In addition to modulating transcription levels, RNAs can also control transcript stability, regulate translation and direct DNA elimination. Examples of these forms of regulation in C. elegans and other organisms will be described in greater detail below.

1.2.4 RNA-mediated effects that heritably reduce gene activity

In several instances, the role of RNA in a silencing process is to provide specificity by basepairing with target nucleic acids. In mammals, plants and Neurospora crassa, RNA can target DNA for methylation in processes such as the imprinting of expression of an allele from one parental genome and the silencing of transposons and unpaired DNA (O'Neill 2005; Zaratiegui et al. 2007). Although DNA methylation is not detected in C. elegans, other RNA- mediated mechanisms do involve factors that are present in C. elegans. Regulatory RNAs can target DNA for chromatin modifications or target other RNAs for cleavage.

Paramutation is a process that leads to meiotically heritable change from trans- interactions between two alleles of a locus (reviewed by Chandler 2007). Initially observed in maize, the characteristics of paramutation were described decades before molecular details were identified. Paramutation involves an interaction between a naive, paramutable allele and a paramutator allele. The paramutator alters the paramutable allele to produce a new expression state that is transmitted to subsequent generations, does not involve changes to the DNA sequence, and can in turn act on newly introduced, naive homologous sequences. An RNA- directed RNA polymerase (RdRP) is required for paramutation in maize, implicating RNA as a

messenger between the two alleles and potentially across generations (Chandler and Alleman 2008). More recently, paramutator activity has been demonstrated in Mus musculus for the Kittm1Alf allele (Rassoulzadegan et al. 2006). Animals homozygous for this null allele die shortly after birth. Heterozygotes have white patches on their feet and tail, which is known as a Kit* phenotype. In crosses using heterozygous Kit* parents, a variable Kit* phenotype persists for several generations even when the original Kittm1Alf allele is not inherited. Elevated levels of abnormally sized RNAs from the locus are detected during spermatogenesis in animals carrying a Kit* allele. Microinjecting one-cell embryos with such RNA reproduces the Kit* phenotype, supporting the idea that RNA from the Kittm1Alf allele affects the wild-type allele. Although RNA is involved in paramutation in both of these organisms, the precise function of the RNAs requires further clarification.

A more detailed description is available for the role of RNA in the formation and maintenance of heterochromatin in Schizosaccharomyces pombe (Motamedi et al. 2004; Verdel et al. 2004; Buhler et al. 2006; Moazed 2009). The RNA-induced transcriptional silencing (RITS) complex associates with nascent transcripts at heterochromatic centromere repeats. RITS contains a novel protein called Tas3, a chromodomain protein Chp1 and the sole S. pombe member of the Argonaute family, Ago1. Argonaute proteins bind small RNAs and often cleave nucleic acids with an endonuclease activity commonly referred to as slicing. RITS is targeted to the nascent transcripts by small interfering RNAs (siRNAs). These RNAs are products of cleavage by the double stranded RNA (dsRNA) endonuclease Dicer. It acts on dsRNAs produced from centromeric transcripts by the RNA-directed RNA polymerase complex (RDRC) which contains an RdRP (Rdp1), a polyA polymerase (Cid12), and a helicase (Hrr1). RITS and RDRC physically interact and are responsible for two processes that contribute to silencing at the repeat loci. First, transcriptional silencing results from the spreading of H3K9 methylation by the Clr4 methyltransferase complex (CLRC). Second, there is cis-restricted, chromatin- dependent degradation of nascent heterochromatic transcripts. Dual recognition of histone marks and small RNAs contributes to this mechanism of epigenetic cis-inheritance which is called cotranscriptional gene silencing. Heterochromatin is maintained by a self-propagating loop involving these complexes and small RNAs (Figure 1-1). The dependence on RdRPs and Argonautes demonstrated here applies to many of the small-RNA-mediated pathways.

Figure 1-1: RNAi-mediated heterochromatin silencing in S. pombe.

Nascent transcripts are produced at centromeric DNA repeats. RDRC then generates dsRNA that is processed by Dicer and loaded onto RITS through the Argonaute Chaperone (ARC) complex. RITS directs both the degradation of nascent transcripts and, along with CLRC, the methylation of H3K9 at the centromeric repeats.

Reprinted by permission from Macmillan Publishers Ltd: [Nature Structural & Molecular Biology] (Buhler, M. and Moazed, D. 2007. Transcription and RNAi in heterochromatic gene silencing. Nat Struct Mol Biol 14(11): 1041-1048) copyright (2007).

In D. melanogaster, repetitive elements are silenced in the germ line by three members of the Piwi (P-element-induced wimpy testes) clade of Argonautes: Piwi, Aubergine and Ago3 (Vagin et al. 2006; Brennecke et al. 2007). Sense and antisense transcripts are initially produced from these regions. Small RNAs matching these sequences are called piRNAs for Piwi- interacting. Piwi and Aubergine form catalytic RNA-induced silencing complexes (RISCs) with antisense piRNAs targeting sense transcripts from transposons and other repetitive elements. RISC can cleave those transcripts, thereby silencing them. In so doing, it releases a fragment of sense RNA that is further processed to generate a sense piRNA. The sense piRNA is loaded into a RISC with Ago3 that targets and cleaves antisense transcripts from the repetitive elements. In turn, this step leads to the formation of another antisense RNA that can form a RISC with Piwi or Aubergine. This amplification loop is called a “ping-pong” mechanism of piRNA biogenesis and transposon silencing (Figure 1-2). If the cycle were initiated by maternally inherited complexes loaded with piRNAs that were effective in the previous generation, such a process would be another way that RNA can transmit information for epigenetic inheritance. An example of the importance of maternally inherited piRNAs can be seen in hybrid dysgenesis in D. melanogaster, a phenomenon where crosses between males from a strain harbouring transposons and females from a strain lacking those transposons can produce sterile progeny. Maternally deposited piRNAs are required for effective silencing of a paternally inherited transposon; in their absence, hybrid dysgenesis occurs (Brennecke et al. 2008).

RNA can also be used to compare two genomes and direct the deletion of DNA that is present in one genome and not the other (Lepere et al. 2008; Nowacki et al. 2008; Duharcourt et al. 2009). Developmental genome rearrangements occur in ciliates. These unicellular eukaryotes contain two types of nuclei in the same cytoplasm. Gene expression occurs from the polyploid somatic macronucleus during vegetative growth and is lost during sexual reproduction. The diploid micronucleus is transcriptionally silent and serves as the germ line by undergoing meiosis during the sexual cycle. A new macronucleus is formed in the zygote by genome amplification and programmed excision of internal eliminated sequences (IESs). To determine which sequences will be eliminated, current models suggest that an RNA copy of the entire maternal macronucleus is inherited by the zygote, as are scanRNAs (scnRNAs) produced from the germ-line micronucleus. Protective maternal macronuclear noncoding RNAs (ncRNAs) inactivate their homologous scnRNAs to ensure that DNA matching those sequences will be

retained in the new macronucleus. The remaining scnRNAs match the micronucleus-specific IESs and likely eliminate them by recruiting an endonuclease. This example of small-RNA- mediated silencing and protection illustrates that multiple kinds of small RNAs can be employed to regulate one another in a given process.

Figure 1-2: Ping-pong model of piRNA-mediated silencing in D. melanogaster.

piRNAs may be maternally inherited in complexes with Piwi and Aubergine. These complexes target sense transcripts from clusters of piRNA loci. Processing of these transcripts produces additional RNAs related to their piRNA precursors by having an A at position 10 instead of a U at the 5’ end. The new piRNAs are then are bound by Ago3 and can target antisense piRNA cluster transcripts. [Figure modified from Seila and Sharp (2008) and Brennecke et al. (2007)].

1.2.5 RNA-mediated gene activation

In addition to providing protection from elimination, some RNAs can also promote gene activity more directly. Noncoding RNAs can act in this capacity by serving as scaffolding factors or determinants of sequence specificity. An example of an RNA with a structural role is provided by the ncRNA Evf-2 which acts as a transcriptional coactivator in M. musculus (Feng et al. 2006). Evf-2 forms a complex with the homeodomain-containing protein Dlx-2 to activate Dlx-5 and Dlx-6 in neural development.

Certain small RNAs demonstrate the ability to direct sequence-specific regulation through basepairing. While small RNAs are often associated with reducing gene activity, there is also support for models where some small RNAs can promote gene expression. Li et al. (2006) and Janowski et al. (2007) reported that transfection with 21-nucleotide dsRNAs targeting promoters of certain genes induces expression of the targets in human cell culture. This activation involves an Argonaute protein and is associated with a loss of H3K9 and H3K14 methylation and increased methylation of H3K4 at the sites targeted by dsRNAs. An endogenous microRNA (miRNA), miR-373, likewise activates certain genes with target sites in their promoters (Place et al. 2008). Other small RNAs targeting promoter sequences instead lead to transcriptional silencing (Morris et al. 2004; Han et al. 2007). A satisfactory explanation of this apparent contradiction will await further characterization of promoter targeting by miRNAs. miRNAs homologous to other regions of a gene may also direct its activation. In M. musculus, injecting fertilized oocytes with a miRNA targeting the gene Cdk9 increases its expression and leads to cardiac hypertrophy (Wagner et al. 2008). In this case, the phenotype is heritably transmitted for three generations, providing an example of RNA-mediated epigenetic activation. Injection of 20-nucleotide RNA molecules homologous to Cdk9 coding sequences also induces the cardiac hypertrophy phenotype. Whether the effect is also heritable in these circumstances has not been reported. To my knowledge, examples of endogenously expressed miRNAs targeting the coding region of a gene to promote its expression have not been reported.

In several animals, dosage compensation involves RNA-mediated changes to an entire chromosome (Akhtar 2003; Bernstein and Allis 2005). In sex-determination systems where one sex inherits one copy of a sex chromosome while the other sex inherits two, expression from genes on that chromosome is generally equalized between the sexes. Mammals (XX females and

XY males) silence one of the two copies of the X chromosome in developing female embryos. This silencing requires the noncoding RNA Xist which is expressed solely from the inactive X and is subject to negative regulation by the antisense Tsix on the chromosome destined to remain active. Dosage compensation in D. melanogaster (XX females and XY males) involves two-fold upregulation of the male X chromosome. Two noncoding RNAs play a critical role in the dosage compensation complex (DCC) (reviewed by Ilik and Akhtar 2009). The two RNAs, roX1 and roX2, are very different in size and sequence, but they act redundantly in promoting dosage compensation in males. The RNAs likely function through degenerate primary or secondary structures that have yet to be identified; deletions of most sections of the RNAs do not reduce their ability to rescue the mutant phenotype of male lethality. These RNAs coat the male X chromosome, and the DCC is mislocalized to autosomes in their absence. The DCC is recruited to several sites on the X chromosome, including the roX loci, and can spread bidirectionally. Several characteristics contribute to DCC recruitment, including degenerate motifs on the X chromosome, transcriptional activity of the targeted gene, and H3K36 methylation. At the roX loci themselves, the complex associates with nascent transcripts, which serves as an example of cotranscriptional activation. The DCC also includes three Male-specific lethal (MSL) proteins, an RNA helicase, Maleless (MLE), and a histone acetyltransferase, Males absent on the first (MOF). This complex acetylates histone H4 at lysine 16, which is associated with hypertranscription of the male X chromosome. In C. elegans (XX hermaphrodites and XO males), expression of both copies of the X chromosome is reduced by half in hermaphrodites (reviewed by Meyer 2010). Recent observations by Dr. Kirsten Hagstrom and colleagues suggest that components of the RNA interference (RNAi) machinery may be involved in dosage compensation in C. elegans, implying that RNA is also involved in dosage compensation in this organism (Dr. Kirsten Hagstrom, personal communication).

A more explicit requirement for sequence homology of RNA in targeting chromatin- modifying machinery is shown for the Ultrabithorax (Ubx) gene in D. melanogaster (Sanchez- Elsner et al. 2006). Tissue-specific transcription of three trithorax-response elements (TREs) upstream of Ubx produces noncoding RNAs. The protein Ash1 (Absent small and homeotic discs) interacts with single-stranded RNA (ssRNA) through its SET domain and is recruited to the Ubx locus through association with chromatin-bound TRE transcripts. Only sense transcripts serve this role, and each TRE transcript only facilitates Ash1 recruitment to the corresponding

template TRE. Histone methylation patterns required for increased transcription are lost at the locus if Ash1 is not recruited. These sense ssRNAs are thus able to recruit chromatin-modifying machinery to a specific locus for promotion of that gene’s activity.

1.2.6 RNA-mediated regulation and heritable effects in C. elegans

1.2.6.1 MicroRNAs

Most of the RNA-mediated regulation in C. elegans involves silencing by small RNAs which can be organized into several classes (summarized in Table 1-1). MicroRNAs function in several processes including developmental timing, cell fate specification, apoptosis and metabolism (reviewed by Vella and Slack 2005). They are genomically encoded and transcribed initially as primary miRNAs. Processing by Drosha, an RNAse III endonuclease, produces shorter 60- to 70-nucleotide precursor miRNAs. These molecules form stem-loop hairpins by folding back on themselves. After their export to the cytoplasm, the action of DCR-1 (dicer), another RNAse III enzyme, produces mature miRNAs of 20 to 25 nucleotides in size. These molecules bind to imperfectly complementary sequences in the 3’ untranslated regions (UTRs) of mRNAs. Complexed together with Argonaute proteins, miRNAs lead to translational repression of their targets. In C. elegans, the Argonautes alg-1 and alg-2 (Argonaute-like gene) interact with miRNAs (Grishok et al. 2001). In some other animal systems and commonly in plants, miRNAs can also promote degradation of their targets if they have exact complementarity (Ghildiyal and Zamore 2009).

Table 1-1: Comparison of several types of small RNAs in C. elegans.

Type of RNA Characteristics Genes involved References in RNA processing or function miRNA -Mature miRNAs: 20 to 25 nt alg-1, alg-2, Reviewed by -Processed from longer endogenous dcr-1, drsh-1, Vella and Slack hairpin transcripts pash-1 (2005). -Function in miRISC (miRNA- induced silencing complex) -Translational repression by binding imperfectly complementary sequences in 3’ UTRs of target mRNAs exo-siRNA -21 to 22 nt csr-1, dcr-1, Fi98, Ke09, -Primary siRNAs are processed from drh-1, drh-2, Ta99, Gr00, exogenous sources of dsRNA drh-3, ego-1, Sm00, Pa01, -Secondary siRNAs are produced by mut-2, mut-7, Ke01, Kn01, RdRP, primarily antisense to exon mut-14, mut-15, Si01, Ta02, sequences mut-16, ppw-1, Ti02, Va03, -Function in RISC complexes rde-1, rde-2, Ch05, Ki05, -Perfectly complementary to target rde-4,rrf-1, Ma05, To05, mRNAs which are cleaved sago-1, sago-2 Du06, Le06, Va06, Yi06, Ao07, Pa07, Si07 endo-siRNA -Initially identified as 21 to 26 nt dcr-1, eri-1, Am03, Le06, RNAs mostly antisense to protein- mut-7, mut-14, Ge09, Ha09, coding genes, some from intergenic rde-2, rde-3, Ge10 regions rde-4, rrf-1, rrf- -Sub-categorized by structure and 3, ergo-1, eri-9 function, including 22G, 26G, class I and class II described below 26G: dcr-1, ergo-1, Ha09, Ge10, -26 nt, bias for 5’ G eri-1, eri-9, Va10 -5’ monoPO4, 3’ modification rde-4, rrf-3 -likely drive genesis of many 22G- RNAs -include class I and class II

Type of RNA Characteristics Genes involved References in RNA processing or function endo-siRNA 22G: dcr-1, drh-3, Cl09, Gu09, (continued) -22 nt, bias for 5’ G and some U ego-1, ekl-1, Ge10, Va10 -5’ triPO4, no 3’ modification ergo-1, mut-7, -more abundant than 26G RNAs and rde-3, rde-4, persist into later stages rrf-1, rrf-3, -some RNAs from silent regions wagos interact with WAGO-1 -RNAs from active regions interact with CSR-1 in chromosome segregation -include class I and class II Class I: sperm alg-3, alg-4, Ge09, Han09, -expressed in sperm and oocyte- dcr-1, eri-1, Pa09, Co10 producing germ lines eri-3, rrf-3, -required for spermatogenesis wagos -include 22G- and 26G-RNAs Class II: oocytes/embryos ergo-1, eri-9 Ha09, Pa09 -enriched in oocyte-producing germ line -decline after embryogenesis -include 22G- and 26G-RNAs 21U-RNA -21 nt, bias for 5’ uridine prg-1 Ru06, Ba08, -5’ monoPO4, 3’ modification Da08, Wa08 -majority map to two broad regions on chromosome IV -interact with PRG-1 which functions in the germ line -form of regulation and identity of target RNAs are unclear

Table 1-1 references:

Am03 (Ambros et al. 2003) Ao07 (Aoki et al. 2007) Ba08 (Batista et al. 2008) Ch05 (Chen et al. 2005) Cl09 (Claycomb et al. 2009) Co10 (Conine et al. 2010) Da08 (Das et al. 2008) Du06 (Duchaine et al. 2006) Fi98 (Fire et al. 1998) Ge09 (Gent et al. 2009) Ge10 (Gent et al. 2010) Gu09 (Gu et al. 2009) Ha09 (Han et al. 2009) Ke01 (Ketting et al. 2001) Ke09 (Ketting et al. 1999) Ki05 (Kim et al. 2005) Kn01 (Knight and Bass 2001) Le06 (Lee et al. 2006) Ma05 (Maine et al. 2005) Pa01 (Parrish and Fire 2001) Pa07 (Pak and Fire 2007) Pa09 (Pavelec et al. 2009) Ru06 (Ruby et al. 2006) Sm00 (Smardon et al. 2000) Si01 (Sijen et al. 2001) Si07 (Sijen et al. 2007) Ta99 (Tabara et al. 1999) Ta02 (Tabara et al. 2002) Ti02 (Tijsterman et al. 2002) To05 (Tops et al. 2005) Va03 (Vastenhouw et al. 2003) Va06 (Vastenhouw et al. 2006) Va10 (Vasale et al. 2010) Wa08 (Wang and Reinke 2008) Yi06 (Yigit et al. 2006)

1.2.6.2 Small interfering RNAs

In C. elegans, targeted mRNA degradation is performed by RISC complexes containing 21-nucleotide siRNAs. Provision of dsRNA targeting a gene decreases the activity of that gene by reducing transcript levels (Fire et al. 1998; Montgomery et al. 1998). In contrast to miRNAs, siRNAs are perfectly complementary to their targets. Exogenous dsRNA can be introduced into worms by injection, soaking or feeding (Tabara et al. 1998; Timmons et al. 2001). When exogenously provided dsRNA is introduced by injection at one site, it can be amplified and transported throughout the organism to produce systemic interference. Primary siRNAs are generated by DCR-1-mediated cleavage of the original trigger (Ketting et al. 2001; Knight and Bass 2001). More numerous, antisense, secondary siRNAs are produced by RdRPs using the target as a template. Secondary siRNAs tend to include sequences within and upstream of the trigger. These effectors can lead to transitive RNAi: spreading of silencing to sequences not included in the original trigger (Sijen et al. 2001; Alder et al. 2003; Pak and Fire 2007; Sijen et al. 2007). In RISC complexes, the secondary siRNAs serve as guide RNAs targeting the RISC cleavage apparatus to mRNA molecules for their destruction. Many loci also give rise to endogenous siRNAs. There is an RNAi pathway that responds to these endogenous siRNAs in addition to the pathway responding to foreign RNA. These mechanisms are called endo-RNAi and exo-RNAi, respectively. The RNAs involved in these processes are referred to as endo- siRNAs or exo-siRNAs. The term “RNAi” refers to exogenous RNAi unless otherwise specified. RNAi is also related to several additional pathways, some of which focus on regulation of the germ line and will be discussed in greater detail in that section.

In all these pathways, RNA helicases, RdRPs and Argonautes feature prominently as components of the RNAi machinery in C. elegans. Some of these proteins are common to many of the RNAi-related pathways, but others are process or tissue specific. For example, one way to differentiate the endogenous and exogenous RNAi pathways is by which Argonaute interacts with primary siRNAs to facilitate their amplification. In exo-RNAi, this function is performed by RDE-1 (RNAi defective), but endo-RNAi pathways use other proteins such as ERGO-1 (endogenous-RNAi-defective Argonaute) (Yigit et al. 2006). Because these pathways utilize overlapping components, loss of one gene may affect the activity of other small-RNA pathways by increasing the availability of limiting factors. This is a proposed explanation for the Eri phenotype (enhanced RNA interference) of ergo-1 mutants. These animals have increased

sensitivity to exogenous dsRNAs because the exo-RNAi pathway is more active when RDE-1 does not have to compete with ERGO-1 (Lee et al. 2006; Yigit et al. 2006). After siRNA amplification, many secondary siRNAs work with other Argonautes, members of a family that has expanded to include 24 functional genes in C. elegans (Yigit et al. 2006). They work in a variety of processes, not all of which involve degradation of target mRNA molecules. Several of these processes are described in more detail in a later section.

Four paralogous RdRPs are responsible for production of secondary siRNAs in C. elegans (Table 1-2). They differ in their tissue-specific expression. These proteins have roles in exo-RNAi and in the biogenesis of endogenously produced small RNAs required for development. EGO-1 (enhancer of glp-one) functions in the germ line and is required for proper development of that tissue. ego-1 mutants are sterile because they are defective in endogenous small-RNA pathways involved in gametogenesis, regulation of germ-line-specific organelles called P granules, and heterochromatin formation on unpaired DNA during meiosis (Smardon et al. 2000; Maine et al. 2005; Vought et al. 2005; Claycomb et al. 2009; She et al. 2009; Updike and Strome 2009). RRF-3 (RNA-dependent RNA polymerase family) is required for some endo- siRNAs in the germ line and the soma, and RRF-3 inhibits somatic exo-RNAi (Simmer et al. 2002; Lee et al. 2006; Gent et al. 2010). rrf-3 mutants exhibit temperature-sensitive sterility and a reduction in classes of endo-siRNAs associated with spermatogenesis (Gent et al. 2009; Han et al. 2009; Pavelec et al. 2009; Vasale et al. 2010). rrf-2 mutants do have altered levels of some small RNAs, but RRF-2 has not yet been implicated in any specific RNA-mediated process in the soma or the germ line (Lee et al. 2006). RRF-1 is required for exo-RNAi specifically in the soma and for transitive RNAi (Sijen et al. 2001; Aoki et al. 2007). RRF-1 is partially redundant with EGO-1 in the germ line for production of a class of endo-siRNAs. While not required for the spermatogenesis-associated endo-siRNAs produced by RRF-3, RRF-1 produces a second class of endo-siRNAs that function in the soma and are enriched in female germ lines (Gu et al. 2009; Pavelec et al. 2009; Vasale et al. 2010). The evolutionary expansion of RdRP and Argonaute families has contributed to an abundance of small-RNA-mediated pathways in C. elegans.

Table 1-2: RNA-directed RNA polymerases of C. elegans.

Protein Characteristics References EGO-1 -Required for germ-line development Sm00, Ma05, Vo05, -Produces small RNAs in involved in gametogenesis, Cl09, Sh09, Up09 regulation of P granules, heterochromatin formation on unpaired DNA RRF-1 -Required for exo-RNAi in soma and transitive RNAi Si01, Ao07, Gu09, -Contributes to class II endo-siRNAs in germ line Pa09, Va10 RRF-2 -No specific RNA-mediated process yet identified Le06 -Mutants have altered levels of some small RNAs RRF-3 -Produces endo-siRNAs in germ line and soma; inhibits Si02, Le06, Ge09, somatic exo-RNAi Ha09, Pa09, Ge10, -Contributes to class I endo-siRNAs associated with Va10 spermatogenesis

Table 1-2 references:

Ao07 = (Aoki et al. 2007) Cl09 = (Claycomb et al. 2009) Ge09 = (Gent et al. 2009) Ge10 = (Gent et al. 2010) Gu09 = (Gu et al. 2009) Ha09 = (Han et al. 2009) Le06 = (Lee et al. 2006) Ma05 = (Maine et al. 2005) Pa09 = (Pavelec et al. 2009) Sh09 = (She et al. 2009) Si02 = (Simmer et al. 2002) Si09 = (Sijen et al. 2001) Sm00 = (Smardon et al. 2000) Up09 = (Updike and Strome 2009) Va10 = (Vasale et al. 2010) Vo05 = (Vought et al. 2005)

In some cases, siRNA-mediated regulation is heritable in C. elegans. Parental provision of endo-siRNAs to the developing embryo is one way to affect gene expression in the next generation. Both the spermatogenesis-associated and somatic categories of endo-siRNAs described above are initially produced in the germ line as 26-nucleotide RNAs called 26G- RNAs. They then drive the biogenesis of 22-nucleotide RNAs called 22G-RNAs that upregulate or downregulate target mRNAs as secondary effectors of these pathways in conjunction with Argonautes. For example, the somatic 26G-RNAs associated with ERGO-1 are produced in oocytes and during embryogenesis, but their downstream 22G-RNAs likely function with

WAGO (worm-specific Argonaute) proteins in later stages of larval development (Han et al. 2009; Vasale et al. 2010). During spermatogenesis, a second class of 26G-RNAs is associated with the Argonautes ALG-3 and ALG-4. These complexes do not persist in mature sperm, but they can produce 22G-RNAs that are loaded onto WAGO-1 which is heritable (Conine et al. 2010). Parentally provided complexes of Argonautes and small RNAs may then regulate gene activity in the zygote.

Silencing by exo-RNAi is not usually inherited, but interference targeting some genes is heritable through the germ line indefinitely (Tabara et al. 1998). Why this heritability applies only to certain genes is not known. Two silencing processes may be involved. The first mechanism was characterized using the oma-1 gene and involves high-efficiency short-term silencing with a bottleneck in transmission of the heritable silencing agent after four generations (Alcazar et al. 2008). The amount of dsRNA trigger injected affects the heritability of silencing in a dose-dependent manner, and progeny that are born earlier experience stronger silencing. Silencing can be transmitted through gametes of both sexes and is not linked to the targeted locus. Instead, a diffusible agent which could be RNA is involved. Whether siRNA amplification or chromatin modifications are also implicated has not been investigated. The second process is called long-term RNAi, persists indefinitely and was characterized using a GFP reporter (Vastenhouw et al. 2006). The RNAi machinery is not required for maintenance of this silencing once it has been established. Screening of 164 candidate genes identified four that are required for inheritance of silencing by long-term RNAi. hda-4 encodes a histone deacetylase, mys-2 a histone acetyltransferase, mrg-1 a chromodomain protein, and isw-1 is homologous to a component of chromatin-remodelling complexes. If the requirement for these genes is direct, then long-term RNAi may involve transcriptional silencing.

1.2.6.3 Piwi-interacting RNAs (21U-RNAs)

In 2006, Ruby et al. identified a class of 21-nucleotide RNAs with a bias for 5’ uridine in C. elegans; hence, they are called 21U-RNAs (Ruby et al. 2006). The RNAs also have a 5’ monophosphate and a 3’ modification resistant to periodate degradation. The majority of these 21U-RNAs map to two broad regions of chromosome IV on both strands of the DNA. The synteny of these loci is conserved in the related nematode Caenorhabditis briggsae, but the

specific 21U-RNAs themselves are not conserved. Two upstream sequence motifs are associated with 21U-RNA loci; these motifs are predicted to act either as promoter elements if these are autonomously expressed loci or as signals for cleavage from larger transcripts. Biogenesis of 21U-RNAs is dcr-1 independent, but they require and physically interact with an Argonaute called PRG-1 (Piwi-related gene) (Batista et al. 2008; Das et al. 2008; Wang and Reinke 2008). prg-1 mutants exhibit germ-line defects and temperature-sensitive sterility (Cox et al. 1998; Batista et al. 2008; Wang and Reinke 2008). Expression of 21U-RNAs is restricted to the germ line. PRG-1 also colocalizes with P granules predicted to be sites of post-transcriptional regulation in the germ line (Batista et al. 2008).

21U-RNAs have been identified as the piRNAs of C. elegans since the association with Piwis and the bias for 5’ U are conserved with the piRNAs of other animals. However, piRNAs in other systems tend to be longer than 21 nucleotides and lack the same genomic organization. There are two main classes of piRNAs identified in mammals (reviewed by O'Donnell and Boeke 2007). One class is similar to the piRNAs of D. melanogaster, which were originally called repeat-associated small interfering RNAs (rasiRNAs) and are involved in silencing of transposons. The second class consists of RNAs involved in spermatogenesis that have no known targets. Whereas the main role of piRNAs in D. melanogaster is to silence repetitive elements by cleaving target RNAs after amplification of silencing RNAs using the “ping-pong” model described in a previous section, that type of model is not likely to apply in C. elegans. Only one transposon in C. elegans has been identified as a target of 21U-RNAs, and very few of the 21U-RNAs target that transposon (Batista et al. 2008; Das et al. 2008). A role for the majority of 21U-RNAs has yet to be identified, as do their targets. The RNAs may act together to produce an aggregate effect, or the importance may lie in the production of RNAs and not the sequences or RNA molecules themselves (Ruby et al. 2006). One model suggests that 21U- RNAs could act collectively through partial sequence matches to downregulate gene expression broadly, but expression of RNAs from whole animals does not greatly differ between wild-type and prg-1; prg-2 double mutants (Das et al. 2008). One group found that transcripts expressed during spermatogenesis were reduced in samples from dissected gonads of prg-1 mutant males, suggesting a role for PRG-1 in promoting expression of those genes. Since many of these spermatogenesis-associated genes are found on chromosome IV, perhaps the 21U-RNAs can target them for upregulation in cis (Wang and Reinke 2008). However, other groups observed

that fertility is only partially restored when prg-1 hermaphrodites are mated with wild-type males, indicating that there are additional germ-line phenotypes beyond defective spermatogenesis (Batista et al. 2008; Das et al. 2008). Thus the 21U-RNAs have been implicated in both promoting and inhibiting activity of certain genes, but additional clarification about the regulatory roles of these C. elegans piRNAs is still required.

1.2.6.4 Genomic imprinting

An imprinted gene exhibits parent-of-origin-specific expression (reviewed by Wolffe and Matzke 1999). For example, the gene Igf2 is only expressed from the paternally inherited allele in M. musculus. Monoallelic expression of a gene requires that the maternal and paternal alleles of a gene are marked as distinct and the imprints are maintained during somatic cell division in the offspring. Disease can result if one copy of the gene is inappropriately active or silent. Noncoding RNAs and DNA methylation are implicated in several examples of imprinting in mammals (O'Neill 2005). Imprinting is not widespread in C. elegans. Animals that receive both copies of any of the chromosomes from a single parent are viable and fertile (Haack and Hodgkin 1991). A gamete-of-origin effect has been demonstrated for certain transgenes in C. elegans (Sha and Fire 2005). The transgenes inherited through the male germ line are expressed at approximately two-fold higher levels than transgenes that pass through the female germ line. Both hermaphrodite and male sperm show this effect, and the phenotype can be seen in both somatic and germ-line expression of the gene. The effect can be enhanced by repeated passage through the oocyte or sperm lineage, while passage through the opposite germ line can at least partially reverse the imprint. Cytoplasmic contributions from the parents are not implicated, suggesting that the heritability of silencing is unlikely to involve parental products such as aberrant RNAs from the transgene. Instead, the locus itself is probably modified either by incorporation of histone variants or modifications to histone tails. Because the effect is graded rather than being a binary on/off modulation of gene expression, it demonstrates that the C. elegans germ line is competent for meiotically heritable adjustments in gene activity.

1.3 Sex determination and the genetics of fem-1 1.3.1 Genetics in C. elegans

The maternal-effect regulation described in this thesis involves a gene required for sex determination in C. elegans. C. elegans exists primarily as a self-fertilizing hermaphrodite in the wild. In adults, the hermaphrodite germ line produces only oocytes, but they can be fertilized by sperm generated during a period of larval spermatogenesis. Females are animals that are somatically identical to hermaphrodites, but do not produce sperm. They arise from mutations in genes required for spermatogenesis in XX animals. Both females and hermaphrodites can be fertilized by males. Since the animal is diploid and passes from fertilization through all four larval stages to adulthood in only three days, it is ideal for genetic studies. Cross-progeny inherit genetic material from both parents, but the bulk of the cytoplasmic contents are derived from the oocytes. Many RNAs and proteins produced in the female germ line are packaged into oocytes and provide a maternal contribution that directs development of the embryo before the zygotic genome is active (Schierenberg 2006). Paternal contributions include the centrosomes that establish polarity in the early embryo and 22G endo-siRNAs (Schierenberg 2006; Conine et al. 2010).

For certain genes, maternal, zygotic or both activities may be required for development. Nomenclature conventions help distinguish between these contributions. A mother homozygous for a given mutation is indicated by m-, whereas a mother with at least one wild-type copy of the gene is m+ (Hodgkin 1986). Similarly, the zygotic genotype is z- for mutant homozygotes and z+ for animals with at least one wild-type allele. For a gene with a maternal rescue effect, maternal products from the locus help to mask the absence of its activity in the zygote. Thus m- z- animals would exhibit a mutant phenotype, but m+z- animals would be less severely affected, if at all. In a maternal absence effect, m- animals do not develop properly because they lack maternal products from the locus. If zygotic contributions in m-z+ animals do not relieve this requirement, then it is termed a strict maternal effect.

1.3.2 Sexual dimorphism in C. elegans

Males and hermaphrodites are morphologically distinct in several ways (Figure 1-3). Sexual dimorphism is seen in all tissues including about 30% of hermaphrodite cells and 40% of male cells. The complete lineage of every cell has been characterized and is almost invariant, providing a valuable resource in the study of cell fate specification during development (Sulston and Horvitz 1977; Kimble and Hirsh 1979). In hermaphrodites, the somatic gonad has two gonad arms that connect to a central uterus. The structure of the gonad arm is important for gametogenesis and will be elaborated in the description of germ-line development. The hermaphrodite digestive tract produces yolk proteins incorporated into oocytes, a function absent from the male digestive system. Individual oocytes are fertilized as they pass through the sperm- containing spermathecae into the uterus. Hermaphrodite-specific muscles and neurons are involved in extruding embryos through the vulva during egg-laying. Males are slightly smaller than hermaphrodites and have many physical features and behaviours required for mating. The male gonad is unilobed. Spermatids are stored in the seminal vesicle, passing through the vas deferens and out the cloaca during mating. Unlike the simple hermaphrodite whip-like tail, the male tail contains several sex-specific muscles and neurons needed for mating. The male tail has a cuticular fan with sensory rays that enable the organism to locate the vulva, and there are spicules that protract to facilitate attachment during mating. Development of all these sexually dimorphic features relies on a signal transduction cascade affecting development throughout the animal.

Figure 1-3: The two sexes of C. elegans.

The somatic gonad is outlined in green with the distal end of each gonad arm indicated. After passing through the proliferative zone, transition zone and meiotic prophase, gametes are produced, depicted here in red for female cells and blue for male cells. (Adapted from Zarkower 2006.)

1.3.3 Overview of somatic sex determination

Sex determination is directed in C. elegans by the ratio of the number of X chromosomes to sets of autosomes (Nigon 1951; Madl and Herman 1979). XX animals are hermaphrodites, and XO animals are males. Males can arise from spontaneous non-disjunction of the X chromosome in self-fertilizing populations at a frequency of about 0.2%, and half of the progeny from a cross are males. The X:A ratio depends on the dose of X-linked numerator genes, including sex-1 and fox-1, to autosomal denominator loci. Many genes are involved in the signalling pathway downstream of this signal (reviewed by Zarkower 2006) (Figure 1-4). Mutations in sex determination genes can produce pseudofemales (XO animals that are phenotypically female), pseudomales (XX animals that are phenotypically male) and intersexes (animals with a combination of male and female characteristics). The X:A ratio from X-linked and autosomal signals is interpreted by xol-1 (XO-lethal). In XX animals, xol-1 is repressed, whereas in XO animals it is active and inhibits the activity of the sex determination and dosage compensation genes sdc-1, sdc-2 and sdc-3. The SDC complex reduces transcription from the X- chromosome two-fold and also represses the her-1 gene in XX animals even more dramatically. The secreted protein HER-1 would otherwise promote male development in a cell nonautonomous manner by inhibiting activity of the transmembrane protein encoded by tra-2. In XX animals, TRA-2A and TRA-3 inactivate the cytoplasmic FEM proteins, thereby promoting activity of tra-1. Its product, TRA-1A, is the terminal regulator in this global sex determination pathway. tra-1 produces a transcription factor that directs female development, primarily by repressing genes required for male-specific differentiation. The tra gene promotes female development, and XX mutants are named for their transformation to a male phenotype. The fem genes promote male development, and mutants are feminized.

Figure 1-4: Formal model of the somatic sex-determination pathway in C. elegans. Genes required for male development are shown in blue, and genes promoting female development are shown in red. indicates negative regulation.

1.3.4 Roles of the fem genes

Three fem genes in C. elegans are required for male development in the soma of XO animals and for spermatogenesis in both sexes (Nelson et al. 1978; Doniach and Hodgkin 1984; Kimble et al. 1984; Hodgkin 1986). Inactivation of any of these genes produces somatic and germ-line feminization. All three genes exhibit maternal effects (Table 1-3). For fem-1 and fem- 2, all isolated alleles are recessive, and these genes have a maternal rescue effect. fem-3 is unique among the fem genes in showing a maternal absence effect and because gain-of-function alleles of this gene produce increased masculinisation.

Table 1-3: Loss- and gain-of-function phenotypes of the three fem genes of C. elegans.

Gene Genotype fem-1 fem-2 fem-3 fem/fem m-z-a XX Female Female Female XO Female Female (25°C), Female intersex (20°C) fem/fem m+z- XX 80% Female, Hermaprodite Female 20% Hermaphrodite XO Intersex Male (sterile at 25°C) Intersex fem/+ m-z+ XX Hermaphrodite Hermaphrodite 16% Female, 84% Hermaphrodite XO Male Male Male, sometimes feminized fem(gf)/fem(gf)b N/Ac N/Ac XX 100% Mogd (25°C), 0% Mog (15°C) fem(gf)/+ XX 15% Mog (25°C)

a For loss-of-function alleles, phenotypes are reported for the strongest non-deficiency mutations. fem-1(e1965) (Doniach and Hodgkin 1984) and fem-1(e2268) fem-2(e2105) (Hodgkin 1986) fem-3(e1996) (Hodgkin 1986) b Data reported for the fem-3(q20gf,ts) allele (Barton et al. 1987). c Not applicable; no gain-of-function alleles have been reported for these genes. d Mog = masculinisation of the germ line.

fem-3 differs from the other two genes in that its activity seems to be limiting and dosage sensitive for male development. In contrast to fem-1/+ and fem-2/+, two classes of fem-3/+ heterozygotes may be feminized. fem-3/+ m-z+ animals sometimes show evidence of feminization in the soma of XO animals and in the germ line of both sexes. About 7% of XX fem-3/+ m+z+ heterozygotes also have feminized germ lines (Hodgkin 1986). Also, elevated levels of fem-3 lead to increased masculinisation. Overexpression of FEM-3 in the soma using a heat shock promoter transforms XX animals into intersexes and pseudomales (Mehra et al. 1999), and fem-3(gf) (gain-of-function) mutations in the 3’ UTR masculinise the germ line (Barton et al. 1987). fem-3 is thus limiting for male development, making it a likely target of negative regulation during sex determination. Details of fem-3 downregulation during germ-line sex determination are provided below. fem-3 encodes a 388 amino acid protein with no characterized domains (Ahringer et al. 1992).

fem-2 differs in that very little of its activity is required for male development. fem-2 null alleles are temperature-sensitive. In the absence of fem-2 activity, there is still partial male development in XO animals, but only at temperatures lower than 25°C (Hodgkin 1986; Pilgrim et al. 1995). Maternal rescue also suffices to promote spermatogenesis in all m+z- XX animals and contributes to extensive male somatic development in XO animals (Hodgkin 1986). FEM-2 is a protein serine/threonine phosphatase of type 2C whose enzymatic activity is required for male development, though a target has not yet been identified (Pilgrim et al. 1995; Chin-Sang and Spence 1996). FEM-2 and FEM-3 interact directly (Chin-Sang and Spence 1996), and both are cofactors for a FEM-1-containing ubiquitin ligase complex (Starostina et al. 2007). By participating in this complex, the FEM proteins help target TRA-1A for degradation in males.

Whereas most of the genes in the sex determination pathway evolve rapidly (de Bono and Hodgkin 1996; Haag et al. 2002), fem-1 is remarkably conserved and has homologs in several species, including humans (Ventura-Holman et al. 1998; Ventura-Holman and Maher 2000; Krakow et al. 2001; Ventura-Holman et al. 2003). Animals receiving neither maternal nor zygotic contributions of fem-1 develop as females. Maternal provision of fem-1 products in fem- 1 m+z- animals rescues spermatogenesis of about 20% of the XX animals and promotes incomplete somatic masculinisation in all the XO animals (Doniach and Hodgkin 1984). Canonical null alleles of fem-1 do not reveal a maternal requirement, but I will describe a maternal requirement for fem-1 in Chapter 2. fem-1 is expressed similarly throughout XX and

XO animals during all stages of development, indicating that post-translational regulation may be required in tissues that are somatically female (Gaudet et al. 1996). FEM-1 is a 656 amino acid protein containing a C-terminal VHL-box motif found in substrate-recognition subunits (SRSs) of CUL2-based cullin-RING ubiquitin ligase complexes and six N-terminal repeats of an ankyrin (ANK) motif associated with protein-protein interaction (Spence et al. 1990; Starostina et al. 2007).

Cullin-RING ubiquitin ligase complexes contain a scaffold protein called a cullin. In CUL2-based complexes, the cullin recruits substrates through an elongin-BC adaptor bound to an SRS. A CBC complex results when Elongin C binds to the ubiquitin-like Elongin B and the cullin (Petroski and Deshaies 2005). In C. elegans, the cullin CUL-2 physically interacts with FEM-1 to form a CBCFEM-1 complex (Starostina et al. 2007). Together with FEM-2 and FEM-3 as cofactors, the CBCFEM-1 complex promotes the proteasome-dependent degradation of full- length TRA-1A in males. TRA-1A promotes female development by repressing the transcription of genes required for male-specific fates (Conradt and Horvitz 1999; Chen and Ellis 2000; Yi et al. 2000). A smaller isoform called TRA-1100 is enriched in hermaphrodites, where it promotes female cell fates (Schvarzstein and Spence 2006). TRA-1100 is not targeted for degradation by the CBCFEM-1 complex (Starostina et al. 2007). This mechanism clarifies the molecular function of FEM-1 in promoting male somatic development.

1.3.5 Germ-line sex determination

Sex determination in the germ line includes many of the same factors involved downstream of her-1 in the somatic pathway, but also differs in several ways (Figure 1-5). Additional genes acting downstream of the somatic pathway are required for spermatogenesis in both males and hermaphrodites (Barton and Kimble 1990; Ellis and Kimble 1995). Mutations in some of these genes cause feminization of the germ line (the Fog phenotype), but they do not affect the soma. XX Fog animals accumulate unfertilized oocytes because they produce no sperm. XO Fog animals have reduced or absent spermatogenesis and produce oocyte-like cells. FOG-1 is a cytoplasmic polyadenylation-element-binding protein that likely regulates translation of mRNAs in the germ line (Luitjens et al. 2000; Jin et al. 2001). FOG-3 is required continually for spermatogenesis and may regulate transcription of genes required for the initiation of spermatogenesis (Chen et al. 2000). TRA-1 binds to the promoters of fog-1 and fog-3 to repress their transcription. TRA-1 binding generally represses genes required for male development, though certain TRA-1 binding sites are required for expression of fog-3 (Chen and Ellis 2000). tra-1 is not essential for either spermatogenesis or oogenesis, but it is implicated in both promoting and inhibiting spermatogenesis. When tra-1 activity is lost, XX and XO animals perform both spermatogenesis and oogenesis; when tra-1 activity is increased by tra-1(gf) alleles, both the soma and the germ line are feminized (Hodgkin 1987; Schedl et al. 1989). An additional complication is that the fem genes are epistatic to tra-1 in the germ line. A tra-1; fem- 1 double mutant has a male soma, but the female germ line indicates that fem-1 is required for spermatogenesis independently of its action on tra-1 (Doniach and Hodgkin 1984). Yet, with respect to regulation of fog-3 mRNA levels, the fems do not function downstream of tra-1 (Chen and Ellis 2000). fem-1 may regulate fog-3 and spermatogenesis in part through tra-1, but a tra-1- independent mechanism must also be involved.

Figure 1-5: Formal model of the germ-line sex-determination pathway in C. elegans.

The hermaphrodite germ line also has the challenge of performing both spermatogenesis and oogenesis at different stages of development. A balance between the activities of tra-2 and fem-3 facilitates this regulation. As previously mentioned, fem-3 activity is limiting for spermatogenesis. Gain-of-function mutations cause a Mog (masculinization of the germ line) phenotype. Mog animals accumulate an overabundance of sperm. The fem-3(gf) alleles causing this phenotype affect an element in the fem-3 3’ UTR that is required for post-transcriptional control of fem-3. Genes implicated in post-transcriptional regulation of fem-3 include two fbf (fem-3-binding factor) genes that encode RNA-binding proteins. Mutations in these genes or any of several mog genes and the nanos homolog nos-3 result in a Mog phenotype (Barton et al. 1987; Ahringer and Kimble 1991; Graham et al. 1993; Kraemer et al. 1999). Post- transcriptional inhibition of fem-3 is one factor that permits the transition to oogenesis. Temporal control of the switch is provided by regulation of tra-2. In hermaphrodite animals, spermatogenesis follows repression of tra-2 activity during the L3 to L4 stage (Doniach 1986). Spermatogenesis in XX, but not XO, animals depends on FOG-2 and GLD-1 (defective in germ- line development). FOG-2 contains an F-box motif associated with mediating protein-protein interactions (Clifford et al. 2000), and GLD-1 is an RNA-binding protein (Jones and Schedl 1995). Together, FOG-2 and GLD-1 translationally repress tra-2 (Schedl and Kimble 1988; Nayak et al. 2005). The germ line switches to performing oogenesis when this repression is relieved in adults. Sex determination is thus coordinated with developmental timing in the hermaphrodite germ line.

1.4 Development and regulation of the C. elegans germ line 1.4.1 Overview of germ-line development in C. elegans

As summarized by Hubbard and Greenstein (2005), the germ line in C. elegans develops from descendants of a lineage of cells in the embryo called the P lineage (Figure 1-6). During the first four rounds of cleavage, germ-line potential is segregated to the germ-line founder cell P4. It divides once to produce the primordial germ cells, Z2 and Z3. They remain quiescent through the remainder of embryogenesis and later produce the germ line. Together with the somatic gonad precursor cells, Z1 and Z4, Z2 and Z3 are surrounded by a basement membrane at hatching. The somatic gonad and germ line both resume development during the larval stages. The bulk of germ-line proliferation occurs during the fourth larval stage and is regulated along with control of meiotic entry and sex determination of germ cells. The germ line shows polarity along the distal-proximal axis of each gonad arm. The proximal position is defined by proximity to the opening of the gonad arm to the exterior, the vulva in hermaphrodites and the cloaca in males. A signal promotes mitosis at the distal end of the germ line. For the two-armed gonad of the hermaphrodite, each arm has its own distal tip cell which signals through the Notch pathway to promote mitosis in the germ line. As nuclei move proximally through the germ-line syncytium, they leave the mitotic zone near the distal tip cell and are able to enter meiosis in the transition zone. The nuclei pass through the stages of meiosis in tandem with their progress through the gonad. Hermaphrodite sperm from the L4 stage are stored in the spermathecae through which oocytes pass as they are fertilized in adult animals. In males, all the germ cells develop into spermatids that are stored in the seminal vesicle. During mating, sperm are transferred by the male to the hermaphrodite where they crawl to the spermathecae.

Figure 1-6: Embryonic development of the germ line in C. elegans.

A) During the embryonic lineage, unequal divisions of the germ-line blastomeres (Px) generate somatic blastomeres, named by letters, and the P4 cell. P4 divides to produce the two germ-line precursor cells, Z2 and Z3.

B) Gonadal primordium at L1 containing the somatic gonad precursor cells (Z1, Z4) and the germ-line precursor cells (Z2, Z3).

1.4.2 Factors required for establishment and maintenance of the germ- line

Several factors are required for establishment of the germ-line cell fate starting with the P lineage and continuing through the descendants of Z2 and Z3. Some of the factors required for germ-line development accumulate in the P lineage during cell divisions in the early embryo. Among the maternal factors segregating to the P lineage are P granules, the C. elegans germ granules. Germ granules are large ribonucleoprotein complexes that are located near the nuclei of germ cells. In C. elegans, 75% of nuclear pores in germ cells are in contact with P granules (Pitt et al. 2000). Germ granules are found both in organisms with preformed germ lines such as C. elegans and D. melanogaster as well as animals with induced germ lines such as M. musculus (Seydoux and Braun 2006). Some of the components are conserved, such as the C. elegans germ-line helicases (glh genes) related to vasa in D. melanogaster (Gruidl et al. 1996). Other components are species-specific, including pgl-1 (P granule abnormality) which serves as a P granule marker in C. elegans (Kawasaki et al. 1998). Given the prominence of post- transcriptional regulation in the germ line, P granules may be centres of RNA processing by monitoring mRNAs as they exit the nucleus, possibly helping to control translation and cytoplasmic localization (Seydoux and Braun 2006; Strome and Lehmann 2007). Some P granule components in C. elegans are also required for endo-RNAi pathways, suggesting another way in which P granules could restrict mRNAs passing from the nucleus to the cytoplasm (Spike et al. 2008; Updike and Strome 2009). Germ granules are thought to be determinants specifying germ-cell identity and permitting germ-cell-specific properties such as totipotency.

The PIE-1 protein is required for early steps in the establishment of the germ-line, and it too segregates to the P lineage. This protein is named for its loss-of-function phenotype of pharynx and intestine in excess which results from incorrect cell fate specification of P2 as a somatic blastomere and leads to death. PIE-1 is a zinc finger protein that is both segregated preferentially to the P lineage and degraded in somatic daughter cells. It functions in part in the nucleus by hindering transcriptional elongation to protect germ-line blastomeres from adopting somatic fates (Seydoux and Dunn 1997). In pie-1 mutants, mRNAs promoting somatic differentiation accumulate in all cells of the four-cell embryo (Seydoux et al. 1996). PIE-1 is degraded around the 100-cell stage when P4 divides into Z2 and Z3. At that time, global histone modifications contribute to the continued silencing of gene expression in the germ-line

precursors. The methylation of H3K4 and acetylation of H4K8 required for a permissive chromatin structure disappear in a process dependent on the nanos homologs nos-1 and nos-2; trimethylation of H3K27 associated with repression remains unchanged (Schaner et al. 2003). The marks required for zygotic transcription in the germ line are not restored until the first larval stage when Z2 and Z3 begin to proliferate. Maintaining transcriptional quiescence in the primordial germ cells is a method of regulation shared by other organisms including D. melanogaster and M. musculus (Seydoux and Braun 2006). The two mechanisms described here both affect the germ-line genome universally and function during embryogenesis, but there are also methods of restricting gene activity in a more targeted way as the germ line matures.

A screen for maternal-effect sterile (mes) mutations identified several other genes that are required for germ-line development. Animals homozygous for mes mutations produce offspring whose germ lines degenerate during larval development (Capowski et al. 1991). This phenotype is less severe in males than in hermaphrodites (Garvin et al. 1998). Three of the MES proteins form a C. elegans Polycomb group complex of the type PRC2 (Polycomb repressive complex type 2) (Xu et al. 2001). Polycomb group complexes were first discovered in D. melanogaster where they regulate the expression of homeotic (Hox) genes involved in developmental patterning (reviewed by Kiefer 2007). The antagonistic functions of repressive Polycomb group proteins and activating Trithorax group proteins remodel chromatin to produce levels of Hox gene expression that can be stably inherited during cell division. The SET-domain-containing MES-2 of C. elegans is a homolog of the D. melanogaster protein Enhancer of zeste (Holdeman et al. 1998). MES-6 contains WD-40 repeats associated with protein interactions and is homologous to another fly protein, Extra sex combs (Korf et al. 1998). The third member of the C. elegans complex, MES-3, is a protein with no recognized domains (Paulsen et al. 1995). Unlike in other organisms, regulating Hox gene expression does not seem to be the main role of this complex in C. elegans. Few examples Hox-dependent anteroposterior transformation have been detected in C. elegans PRC2 mutants (Ross and Zarkower 2003). Rather, general Hox gene repression is mediated by the RNA-binding proteins SOP-2 (suppressor of pal-1) and SOR-1 (sop-2-related). Their mechanism of action more closely resembles the PRC1 type of Polycomb group complexes (Zhang et al. 2003; Zhang et al. 2006). A different role that has been described for the MES PRC2 complex is to silence the X chromosome in the germ line (Kelly and Fire 1998). This function is achieved by trimethylation of H3K27 that silences the X chromosome in

the germ line until late pachytene (Bender et al. 2004). This regulation also helps restrict the localization of another SET-domain protein, MES-4, to the autosomes where it dimethylates H3K36 (Fong et al. 2002; Bender et al. 2006). This mark may protect the autosomes from repressors, concentrating them on the X chromosome instead. Another protein that binds to the autosomes in the germ line is MRG-1 (related to human Mortality-factor-related gene) which is hypothesized to induce a maternally inherited germ-line chromatin state contributing to primordial germ cell development and the silencing of X-linked genes (Takasaki et al. 2007).

Other forms of chromatin regulation in the C. elegans germ line also distinguish between the sexes. During spermatogenesis in the male germ line, activating histone modifications never appear on the X chromosome in the germ cells, and all assayed modifications on autosomes disappear as germ cells exit diplotene (Kelly et al. 2002). This process may involve bulk replacement of histones in sperm, a phenomenon reported in other organisms, but not well studied in C. elegans. Chu et al. (2006) have identified the first sperm nuclear basic proteins in C. elegans, including the histone H2A variant HTAS-1 and three protamine-like proteins. Despite this apparent resetting of the chromatin structure in sperm, male gametes are capable of transmitting both heritable RNAi and a gamete-of-origin imprint on some transgenes through the germ line for several generations (Sha and Fire 2005; Alcazar et al. 2008).

A difference that distinguishes between the X chromosomes produced by spermatogenesis in hermaphrodites and males is the transient accumulation of H3K9 methylation on the male X chromosome during pachytene. One group suggests that this modification correlates with sexual phenotype, not karyotype (Reuben and Lin 2002), but additional evidence from another group shows that the X chromosome is targeted due to its lack of a pairing partner in XO animals (Kelly et al. 2002; Bean et al. 2004). The targeting of unpaired DNA for silencing will be discussed further below. Additional sex-specific differences in X chromosome regulation occur after fertilization. All chromosomes in the oocyte pronucleus have histones containing activating marks including methylation of H3K4 and acetylation of H3 and H4. Although the sperm pronucleus arrives without modifications, it begins to accumulate them as the chromosomes decondense. The one chromosome delayed in accumulating these modifications is the X contributed by the sperm (Kelly et al. 2002; Reuben and Lin 2002). This delay applies to sperm generated by either the XX or XO germ lines, but it persists longer in

sperm from XO germ lines, up to the 20-nuclei stage versus the 14-nuclei stage (Bean et al. 2004).

The development of the germ line thus begins with a maternal program that acts to restrict gene expression in the primordial germ cells. This effect is initially achieved by PIE-1 followed by NOS-1 and NOS-2. As the germ line develops, maternal and zygotic contributions of the MES and MRG-1 proteins ensure fertility with appropriate chromatin modifications on both the X chromosome and the autosomes. During gametogenesis, additional chromatin marks, some of them sex-specific, appear and disappear. Any epigenetic effect that can be passed through the germ line for multiple generations must survive this dynamic regulation of chromatin structure and the monitoring of RNAs in the germ line. A restrictive environment persists in the germ line of adult animals where surveillance mechanisms act to oppose the activity of DNA not recognized as belonging to the self.

1.4.3 Surveillance processes in the C. elegans germ line

RNAi and related processes function in surveillance of nucleic acids including viruses and transposons. Some functions, such as defense against viral infection, are systemic in C. elegans, whereas others are germ-line specific. A role for RNAi in defense against viral infection was initially identified in other systems (Ratcliff et al. 1997). Many viruses produce dsRNA at some point during the replication of their genomes. Since RNAi targets dsRNA, an anti-viral role for RNAi is logical. While no natural virus of C. elegans is known, infection models have been established using RNA-genome viruses from other hosts. An antiviral role for the C. elegans RNAi machinery during viral infection has been established using these models (Lu et al. 2005; Schott et al. 2005; Wilkins et al. 2005). Genes required for RNAi are involved in the response to infection with the Flock house virus and the vesicular stomatitis virus. Levels of the virus increase in rde-1, rde-3, rde-4, dcr-1 and C04F12.1 RNAi-defective mutants, whereas virus levels are reduced in mutants with an enhanced RNAi response, such as rrf-3, eri- 1 and lin-15B. Virus-specific siRNAs are detected in infected wild-type animals, but not in Rde mutants. These results demonstrate that RNAi can function to repel viral infections in C. elegans.

Several other surveillance processes related to, but distinct from, RNAi are specific to the C. elegans germ line. They contribute to protecting the germ line from the activity of foreign genetic elements and to ensuring the production of viable gametes by monitoring for aneuploidy. In both cases, suspect sequences are recognized by specific characteristics that lead to their silencing. Many of the genome defense mechanisms involved in this regulation are mediated by small-RNA pathways and may act on both RNA and chromatin. An ongoing avenue of research is to develop models of how these processes function individually and together in the germ line.

Mobile foreign DNA sequences such as transposable elements (TEs) can be a liability to the germ line because novel transposon insertions are potentially mutagenic and the cell’s own resources are used in replicating these sequences. The C. elegans genome shows evidence of the activity of several TEs (reviewed by Bessereau 2006). About 12% of the genome sequence is derived from transposons, though the number of copies is strain dependent. The Tc1/mariner family members Tc1 and Tc3 are the most active. Consisting of a sequence encoding a transposase enzyme flanked by Terminal Inverted Repeats (TIRs), these DNA transposons move through a “cut-and-paste” mechanism. In the N2 Bristol isolate of C. elegans, transposons are only active in the soma and not the germ line. Because of the increased frequency of mutagenesis when transposons are active, mutations that desilence transposons in the C. elegans germ line are called mutators (producing a Mut phenotype). A silencing mechanism in the germ line is able to recognize transposable elements by means of dsRNAs derived from those sequences. The structure of TIRs and the multiple locations of Tc1 in the genome may contribute to the genesis of dsRNA (Vastenhouw and Plasterk 2004). At least part of the action of transposon-derived siRNAs is post-transcriptional, and some of the genes required for transposon silencing are also involved in RNAi, indicating an overlap in the mechanisms (Sijen and Plasterk 2003). Judging by the classes of genes involved in transposon silencing, the siRNAs may also affect chromatin structure (Vastenhouw et al. 2003).

Production of double-stranded or aberrant RNA is also implicated in silencing caused by repetitive transgenes in the C. elegans germ line. The most common way of generating transgenic nematodes involves injecting DNA into the germ-line syncytium and identifying progeny that carry relatively stable extrachromosomal arrays of the injected material. The relative amounts and shared homology of different sequences in the injection mixture affect their incorporation into an array (Mello et al. 1991). The repetitive nature of simple multicopy arrays

correlates with their silencing. Using more complex mixtures of DNA to produce low-copy- number transgenes sometimes results in less transgene silencing since silencing RNAs are more likely to be produced from repetitive arrays (Kelly et al. 1997). Inactive transgene arrays are marked with H3K9 methylation and lack acetylation of H3 and H4 (Kelly et al. 2002). While some transgenes are also subject to silencing in the soma, it is more prevalent in the germ line. In the germ line, transgene silencing is also sometimes accompanied by silencing of the endogenous loci corresponding to sequences included on the transgene, a phenomenon termed cosuppression. Only one example of somatic cosuppression has been identified (Fire et al. 1991); instead, this effect acts primarily on germ-line expression of genes including fem-1 (Jones and Schedl 1995; Gaudet et al. 1996). An RNA mediator is implicated by the requirement for a promoter on the cosuppression-inducing array (Gaudet et al. 1996; Dernburg et al. 2000). Chromatin-modifying factors have been implicated by a screen for a cosuppression-defective phenotype (Cde), but how directly these genes are involved has not been determined (Robert et al. 2005).

Small RNAs are also required for the meiotic silencing of unpaired chromatin in C. elegans. When homologous chromosomes align during meiosis, trans-sensing mechanisms provide the opportunity of comparing the two parental DNA complements. Differences that could be detected in this way include aneuploidy and TE insertions that disrupt pairing. Several organisms including N. crassa, plants and C. elegans have RdRP-dependent ways of silencing unpaired regions genome-wide. Seemingly RdRP-independent methods of meiotic silencing are also used by other organisms such as D. melanogaster and M. musculus to specifically target a sex chromosome for inactivation (Kelly and Aramayo 2007). In C. elegans, methylation of H3K9 on unpaired DNA occurs temporarily at the pachytene stage. Targets for this regulation include the X chromosome in XO animals, transgene arrays, free autosomal duplications, and chromosomes in him mutants, which have defects in chromosome pairing (Bean et al. 2004). The latter produce a high incidence of males because they increase the frequency of X chromosome non-disjunction. Factors required for restricting the distribution of H3K9me2 to unpaired regions include the germ-line-specific RdRP EGO-1 and several other components of an endo-siRNA pathway (She et al. 2009).

These surveillance pathways all function to regulate gene activity in the germ line through RNAs, endogenous or identified as being derived from a foreign source, that trigger

silencing of their cognate loci. My thesis describes a previously uncharacterized type of silencing in the C. elegans germ line that can be offset by maternal RNA.

1.5 Thesis objectives

In Chapter 2, I describe a novel maternal effect on the germ-line activity of fem-1 in the heterozygous cross-progeny of females carrying fem-1 deficiency alleles. I present evidence that fem-1 is heritably silenced in the germ line in the absence of a maternal contribution of fem-1 RNA. These observations suggest that fem-1 RNA from the maternal germ line of a previous generation is required in order to license fem-1 activity in the zygotic germ line.

To investigate how the maternal-effect regulation of fem-1 is accomplished at a molecular level, I performed an RNAi screen of candidate genes to assess their involvement in the silencing and licensing of germ-line fem-1 expression. Several enhancers and suppressors of the germ-line feminization phenotype are identified in Chapter 3. Small RNA pathways and chromatin regulators are implicated in maternal-effect regulation. Multiple models of maternal-effect regulation are possible based on these data.

From the initial characterization of maternal-effect regulation, it was unclear whether this type of regulation was specific to fem-1 or applied more generally in the germ line. In Chapter 4, I tested the susceptibility of another gene, fem-2, to maternal-effect silencing in the absence of maternally provided RNA. I also asked whether specific characteristics of fem-1 make it susceptible to silencing. These tests limit the possible models for maternal-effect regulation.

Chapter 2 Licensing of fem-1 in the germ line by maternal transcripts

Statement of contributions:

I performed the majority of the experiments in this chapter and generated reagents as described in the Methods. Dr. Andrew Spence performed the paternal disomy experiment, the 3’ RACE, some of the injections and measured fem-1 RNA levels.

Chapter 2 is a modified version of a submitted manuscript: Johnson, C.L. and A.M. Spence. Epigenetic licensing of germ-line gene expression by maternal RNA in C. elegans.

2 Licensing of fem-1 in the germ line by maternal transcripts 2.1 Abstract

RNA can act as an important regulator of gene expression with roles in transposon silencing, antiviral defense, and cell fate determination. I show that, in the nematode Caenorhabditis elegans, a maternal transcript of the sex-determining gene fem-1 is required in order to prevent the heritable silencing of a wild-type fem-1 allele in the zygotic germ line. Females homozygous for fem-1 deletions produced heterozygous offspring that exhibited germ- line feminization, with reduced fem-1 activity and transcript accumulation. Injection of fem-1 RNA into the maternal germ line rescued this defect in the progeny. The defect in zygotic fem-1 expression was heritable, suggesting that the gene was subject to epigenetic silencing. Maternal fem-1 transcripts counteracted this silencing to license expression of the gene in the zygotic germ line. Such a mechanism may contribute to protecting the identity and integrity of the germ line.

2.2 Introduction

Our expanding understanding of the regulatory functions of RNA has unveiled many forms of regulation and several types of RNA effecting them. RNA has been implicated in controlling transcription, transcript stability, translation and even DNA elimination (Matzke and Birchler 2005; Zaratiegui et al. 2007). Examples of epigenetic regulation by RNA usually involve gene repression and are often mediated by noncoding RNAs. Here I describe a new form of regulation in which RNA from a protein-coding gene in C. elegans is required in order to promote expression of that gene in the germ line.

It is unsurprising that the germ line should be a site of protective regulatory measures; the germ line is unique among the tissues produced during the development of most animals in that only the germ cells contribute genetically to the next generation. If proper development of the germ line fails, an organism will be unable to reproduce. Mutations in somatic cells will have varying effects depending on their location and severity, but a germ cell mutation will be present throughout the entire organism inheriting it. For these reasons, animals tend to safeguard the

germ line with measures that protect against unwanted differentiation to other cell types and genetic modifications by foreign elements such as transposons and pathogens. Proper germ-line development in C. elegans is ensured by several processes that regulate gene expression such as transcriptional repression by the zinc finger protein PIE-1 in the early embryo (Seydoux et al. 1996), which is followed by the transient loss of activating chromatin modifications in the germ- line precursor cells (Schaner et al. 2003). C. elegans also has many surveillance mechanisms operating in its germ line to restrict the expression of unwanted DNA. Transposons, repetitive transgenes and their cognate loci are all subject to negative regulation (Kelly and Fire 1998; Ketting et al. 1999; Dernburg et al. 2000). By examining the inheritance of a sex-determining gene, fem-1, I discovered a new form of silencing in the germ line.

In C. elegans, sex is determined by the X chromosome:autosome ratio, which directs diploid animals with a single X chromosome (XO) to develop as males and those with two X chromosomes (XX) to become self-fertile hermaphrodites (Madl and Herman 1979). The fem-1 gene is required for male development in both males and hermaphrodites (Doniach and Hodgkin 1984). Animals that lack both maternal and zygotic fem-1 activity develop as true females regardless of X chromosome dose. Maternal fem-1(+) activity promotes partial male development in the fem-1 m+z- progeny of heterozygous mothers, but the observation that the heterozygous offspring of females carrying point mutations in fem-1 are phenotypically wild type suggests that this maternal contribution is dispensable for male development (Doniach and Hodgkin 1984).

By examining the heterozygous progeny of females carrying any of three deficiency alleles of fem-1, as a group referred to as fem-1(Df), I uncovered an unexpected maternal requirement for a product of the fem-1 locus. In the absence of maternal fem-1 RNA, a feminization of the germ line (Fog) phenotype was observed which I have attributed to a reduction in fem-1 activity in the zygotic germ line. This silencing is mediated by an epigenetic mechanism that can be inherited and amplified in subsequent generations if maternal fem-1 RNA is unavailable. Providing in vitro-transcribed RNA in the germ line of fem-1(Df) animals, I rescued the germ-line feminization of their progeny. I demonstrate evidence for epigenetic silencing of zygotic germ-line activity of fem-1 and a requirement for maternal RNA to license activity of the locus.

2.3 Materials and Methods 2.3.1 Nematode maintenance and alleles

Nematodes were cultured as previously described (Brenner 1974). MYOB medium (Church et al. 1995) was used instead of NGM. All experiments were conducted at 20°C. When using the allele daf-7(e1372ts) as a trans-marker during strain construction, animals were sometimes cultured at 25°C. The N2 Bristol isolate served as the wild-type strain. The genetic nomenclature outlined by Horvitz et al. (1979) is followed. Additional conventions include denoting homozygous fem-1 mutants descended from homozygous mothers as fem-1(m-z-), in contrast to fem-1(m+z-) for the homozygous progeny of heterozygous mothers (Hodgkin 1986). Except as noted, the following mutations are described in Wormbase (http://www.wormbase.org/). Some of the strains used in these experiments were obtained from the Caenorhabditis Genetics Centre.

LG III: daf-7(e1372ts), dpy-1(e1), fem-2(e2105), unc-45(e286ts), unc-45(r450)

LG IV: dpy-13(e184sd), dpy-20(e1282ts), egl-23(n601dm), fem-1(e2195), fem-1(e2196), fem-1(e2267), fem-1(e2268), him-6(e1423), idDf1, idDf2, idDf3, mor-2(e1125), unc-5(e53), unc- 24(e138), unc-30(e191)

LG X: egl-36(n728dm), lon-2(e678), unc-7(e5)

The rearrangement nT1dm is nT1[let(n754) unc(dm)]IV;V. The fem-1 deficiencies idDf1 and idDf2 were previously described as fem-1 alleles e2044 and e2382, respectively. A third deficiency idDf3 was isolated as a spontaneous unc-5 allele (formerly ev447) in the mutator strain RW7097 (Dr. J. Culotti, personal communication). Each deficiency was outcrossed to wild type at least six times. The extent of each deficiency was mapped by Southern blotting and PCR, and the break points were sequenced as described below.

The fem-1 mutations e2195, e2196, e2267 and e2268 are described by Dr. Usha Vivegananthan (2004). e2195 is an E  K mutation in the sixth ANK repeat. e2196 is an ochre mutation in exon 10. e2267 is an opal mutation in exon 7. e2268 is an opal mutation in exon 4.

2.3.2 C. elegans strains

Table 2-1 lists the strains used in this chapter. Since the progeny of fem-1(Df) homozygotes are subject to germ-line feminization, I only used fem-1(Df)/+ heterozygotes for building new strains with the deficiency alleles. Strain AS76 was used to provide an unc- 24(e138) marker for the fem-1 deficiency alleles used in this study. The idDf1 allele from AS9 was marked and incorporated into AS374, AS378 and AS382. The idDf2 allele from AS34 was marked and incorporated into AS376, AS379 and AS383. Strain AS217 provided the fem- 1(e2268) allele included in AS377 and AS380. Similarly, the fem-1(e2195) from AS212 is in AS387, fem-1(e2196) from AS213 is in AS388, and fem-1(e2267) from AS217 is in AS389. The idDf3 allele in AS381 was obtained from AS238. Using strains CB4035 and DR1228, I marked fem-2(e2105) with unc-45(e286ts) to produce the strain AS461. From that strain, I generated AS462 and AS463 for use in measuring the effectiveness of fem-2 maternal rescue.

2.3.3 General molecular biological methods

Unless otherwise described, procedures for handling nucleic acids were taken from Sambrook and Russell (2001). Chemicals were reagent grade and obtained from Sigma or EMD Chemicals, unless otherwise specified. T4 DNA ligase, T4 DNA polymerase and restriction enzymes were provided by New England Biolabs. RNA polymerases were from Roche and Fermentas.

Table 2-1: C. elegans strain names and genotypes Strain name Genotype AS9 idDf1 mor-2(e1125)/dpy-13(e184) unc-5(e53)IV AS34 idDf2 mor-2(e1125)/unc-5(e53) mor-2(e1125) IV AS76 dpy-13(e184) unc-24(e138) IV AS212 fem-1(e2195) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV AS213 fem-1(e2196) unc-24(e138)/unc-5(e53) dpy-20(e1282ts IV AS216 fem-1(e2267) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV AS217 fem-1(e2268) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV AS238 idDf3 unc-24(e138)/nT1dm IV; +/nT1dm V; lon-2(e678) X AS374 unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS375 idDf1 unc-24(e138)/nT1dm IV; +/nT1dm V; lon-2(e678) X AS376 idDf2 unc-24(e138)/nT1dm IV; +/nT1dm V; lon-2(e678) X AS377 fem-1(e2268) unc-24(e138)/nT1dm IV; +/nT1dm V; lon-2(e678) X AS378 idDf1 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS379 idDf2 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS380 fem-1(e2268) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS381 idDf3 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV AS382 idDf1 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV AS383 idDf2 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV AS387 fem-1(e2195) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS388 fem-1(e2196) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS389 fem-1(e2267) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS457 dpy-1(e1) III; idDf2 unc-24(e138)/nT1dm IV, +/nT1dm V; lon-2(e678) X AS461 unc-45(e286ts) fem-2(e2105)/unc-45(e286ts) daf-7(e1372ts) dpy-1(e1) III AS462 unc-45(e286ts) fem-2(e2105)/dpy-1(e1) III AS463 unc-45(e286ts) fem-2(e2105)/dpy-1(e1) III; lon-2(e678) X CB184 dpy-13(e184) IV CB4035 fem-2(e2105)/unc-45(r450) dpy-1(e1) III DR1228 unc-45(e286ts) daf-7(e1372ts) dpy-1(e1) III MT1231 egl-23(n601) IV MT1540 egl-36(n728) X N2 Bristol strain, wild type

2.3.4 Plasmid information

Table 2-2 describes the plasmids used in this study. Their construction is explained below. The primers used for cloning are listed in Table 2-3. pAS#2009: The fem-1 insert was produced by recombinant PCR (Higuchi et al. 1988). In the first round, primers oT7 and fem1_RT_asR1 generated a 400 bp band with the fem-1 5’ UTR and exons 1 through 4 from AS#1000, and primers fem1_RT_asF2 and AUAP generated a 240 bp band from the idDf1_3RACE_clone7 template. Those templates were used with primers oT7 and AUAP for recombinant PCR. The product was digested with HindIII and SpeI to be cloned into a similarly digested pBluescript KS (+) vector. The resulting plasmid contains a fem-1 cDNA similar to the one encoded by idDf1. After the idDf1 breakpoint, this RACE product contains 78 bp of DNA from chromosome IV including 21U-9867 and a 33-nt poly(A) tract. This clone contains a PCR-induced C-T mutation at position 221 of the fem-1 coding sequence. pAS#CJ9: Using pAS#1000 plasmid DNA as a template, primers oASCJ4 and oASCJ5 generated a 2 kb PCR fragment with a mutation from ATG to TTG at the translation initiation site of the fem-1 cDNA. Digestion with BamHI and XhoI allowed replacement of the 5’ UTR and wild-type start codon in pAS#1000 with a truncated 5’ UTR and mutated start codon in pAS#CJ9. Successful mutagenesis was confirmed by sequencing the plasmid. pAS#CJ10: A fragment of DNA from 1.5 kb to the right of fem-1 on chromosome IV was amplified using primers oASCJ6 and oASCJ7 with a N2 genomic DNA template. The 1847 bp SpeI and XhoI digestion product was cloned into pAS#1000 replacing the original insert. pAS#CJ12: A fragment of DNA from 1 kb to the left of fem-1 on chromosome IV was amplified using primers oASCJ11 and oASCJ10 with a N2 genomic DNA template. The 786 bp SpeI and XhoI digestion product was cloned into pAS#1000 replacing the original insert. pAS#CJ14: A piece of fem-1’s eighth intron was amplified using primers oASCJ15 and oASCJ14. The 1274 bp SpeI and XhoI digestion product was cloned into pAS#1000 replacing the original insert. pAS#CJ49: Primers oASCJ59-2 and oASCJ60 amplified a complete fog-3 cDNA from the plasmid pRE66. Digesting this product with BamHI and EcoRI permitted its cloning into a

digested pBluescript II KS (-) vector backbone. Diagnostic PCR with oT3 and oASCJ61 followed by sequencing with M13R confirmed the insertion and its orientation.

pAS#CJ50: A 966 bp BamHI and SnaBI fragment of pAS#1000 contained the last third of the fem-1 cDNA and was cloned into BamHI- and EcoRV-digested pBluescript II KS (-) vector. Correct insertions were initially identified by PCR using oT3 and oASCJ5 primers. The plasmid was then sequenced with M13R. pAS#CJ52: A 681 bp PstI and SnaBI fragment of pAS#1000 contained the middle third of the fem-1 cDNA and was cloned into an EcoRV- and PstI-digested pBluescript II KS (-) vector. QPCR1 and oT3 served as diagnostic primers of putative insertions. The plasmid was also sequenced with M13R, confirming the presence of the whole insert.

Table 2-2: Plasmid names and descriptions. Plasmid name Description pAS#1000 Contains a full length fem-1 cDNA and fem-1 5’ and 3’ UTRs. pAS#1053 Contains a full length fem-1 gene with 5’ UTR, all exons and introns, and 3’ UTR. pAS#1285 Contains a full length fem-2 cDNA with a β-globin 5’ UTR. pAS#2009 Contains a chimeric fem-1 cDNA obtained from idDf1 animals. pAS#CJ9 Contains a full length fem-1 cDNA with a mutated translation initiation codon. pAS#CJ10 Contains 1.8kb DNA to the right of fem-1 on chromosome IV. pAS#CJ12 Contains 1kb DNA to the left of fem-1 on chromosome IV. pAS#CJ14 Contains 1.3 kb of intron 8 DNA from fem-1. pAS#CJ49 Permits in vitro transcription of a full length fog-3 cDNA. pAS#CJ50 Contains the last third of the fem-1 cDNA. pAS#CJ52 Contains the middle third of the fem-1 cDNA. pAS#CJ60-2 Contains a full length mom-5 cDNA (yk471e5) cloned into pBluescript SK minus vector with EcoRI and XhoI. Sequencing confirmed inclusion of UTRs and 3' poly(A). The 3’UTR is longer than the WormBase annotation. pRE66 Contains the fog-3 coding region from start codon to stop codon inserted into Clontech’s pAS2-1 digested with NdeI and BamHI. Provided by Dr. Ronald Ellis of University of Medicine & Dentistry of New Jersey.

Table 2-3: Primers used in plasmid construction. Primer name Primer sequence (5’ to 3’) AP GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT AUAP GGCCACGCGTCGACTAGTAC fem1_RT_asF2 ATCTGTTCGTGGTGTTGTGG fem1_RT_asF3 CGATTGCTGCAAGAAATGGACAC fem1_RT_asR1 TTCCACAACACCACGAACAG oAS_CLJ_QPCR1 TCCACTTCATGCAGATGATC oASCJ4 AATCACTCGAGTGGCGGTTTGACACCAAATG oASCJ5 AATCAGGATCCCACCGAGAAGCATTGAAGAG oASCJ14 AGATCTCGAGTTGAGCGCACTAAACTGTCG oASCJ15 AGATACTAGTACACACTCAGAGTGTCCTTG oASCJ59-2 ACTAGAATTCATGTATACCGAAGTCCGCGAGCT oASCJ60 ACCTGAGAAAGCAACCTGAC oASCJ61 GACGAGAAATGTGAGACGAGGT

2.3.5 Polymerase chain reaction conditions

Lysis for single-worm PCR (Williams et al. 1992) was performed by placing a single nematode in the lid of a PCR tube containing 2.5 µl of fresh PCR lysis solution (3 µl of 20mg/ml

Proteinase K, 1 ml of PCR lysis buffer [10mM Tris-HCl (pH 8.3), 50mM KCl, 2.5mM MgCl2, 0.45% Tween 20, 2% gelatin)]. After brief centrifugation, the tube was frozen for 15’ in a bath with dry ice and ethanol. The lysate was incubated in a thermocycler for 1h at 60ºC and 15’ at 95°C. A 25 µl PCR reaction was produced by adding 22.5 µl of PCR reaction mastermix to the worm lysate.

A typical 20 µl PCR reaction contained 12.8 μl water, 2 µl 10X buffer (0.5M KCl, 0.1M

Tris-HCl [pH 8.3], 1M MgCl2, 0.01% gelatin), 2 µl of 2mM dNTPs, 1µl of 10µM forward primer, 1 µl of 10µM reverse primer, 0.2 µl of Taq DNA polymerase (New England Biolabs), 1 µl of DNA template. PCR program: 95°C 5’, 35 cycles of (95°C 30s, 56°C 30s, 72° 1’), 72°C 5’, hold at 4°C. For amplification of fragments over 3 kb in length, ExTaq polymerase and buffer (Takara Bio Incorporated) were employed in a reaction with an extension time of 1’ per kilobase of DNA.

2.3.6 Delimiting the breakpoints of deficiency alleles

Single-worm lysates of N2, idDf1, idDf2 and idDf3 animals served as templates for PCR. Diagnostic PCR using primer pairs spanning the region on chromosome IV from unc-5 to srd-12 indicated the approximate boundaries of the deletion alleles. The sequences of these primers are provided in Table 2-4. Large PCR fragments crossing the breakpoints were amplified using primers oAS_CLJ_Df_F36588 and oAS_CLJ_Df_R57149 for idDf1, oAS_CLJ_Df_F51321 and oAS_CLJ_Df_R62719 for idDf2, and oAS_CLJ_Df_F16247 and oAS_CLJ_Df_R143099 for idDf3. The desired bands were purified using a 1% Tris-acetate EDTA (TAE) gel, and the DNA was extracted using an Ultraclean 15 DNA Purification Kit (MO Bio Laboratories). DNA sequencing across the breakpoint employed primers oAS_CLJ_Df_R54076, oAS_CLJ_Df_F51798 and oAS_CLJ_Df_R142079, respectively, for the three deficiencies. idDf1 is a deletion that removes the sequence between positions 5523662 and 5537348 on chromosome IV, leaving one copy of the GA that bordered the two end points. idDf2 keeps one copy of the top strand TAAT at 5536262 and 5543106 while removing the intervening sequence. In idDf3, a Tc1 transposon is inserted where the DNA from positions 5500884 to 5624829 is deleted.

Table 2-4: Primers used to delimit deficiency breakpoints. Primer name Primer sequence oAS_CLJ_Df_F16247 CATCCCAAGATACAGTCTCGC oAS_CLJ_Df_F36588 AAGTTAGCCTCGCCATTAAC oAS_CLJ_Df_F51321 TTCGATTTACGGGGCTCGTTCG oAS_CLJ_Df_F51798 TGGACGCTCGTTATGTGTTGC oAS_CLJ_Df_R54076 GCATCATTCTGCGTAGTTTG oAS_CLJ_Df_R57149 GGAGCATAGAGATCATACAG oAS_CLJ_Df_R62719 CCAGAGACGGTGTTTACAGTAGG oAS_CLJ_Df_R142079 TCAAGTCAGTTCCAATGAGC oAS_CLJ_Df_R143099 AGTTGTGACGAGACGATTCG

2.3.7 Quantification of maternal-effect embryonic lethality

Using the idDf2 and idDf3 alleles of strains AS383 and idDf3 unc-24/dpy-13, maternal- effect embryonic lethality was measured after mating fem-1 unc-24 females with wild-type

males. Parents were transferred to new plates every twelve hours, and the number of embryos laid was recorded. Dead embryos were counted after 24 hours, and surviving adults were counted after an additional 48 hours. Embryonic lethality for the self-progeny of fem-1(Df) unc- 24 hermaphrodites was 31 ± 16 percent for idDf2 and 46 ± 14 percent for idDf3, which indicates that no additional zygotic contribution to lethality was observed. idDf1 complements the other deficiencies for lethality, which therefore does not result from elimination of fem-1. Presumably it is a consequence of deletion of the neighbouring gene drp-1 (Labrousse et al. 1999). Embryonic lethality of the N2 strain was measured in whole broods of self-fertile hermaphrodites.

2.3.8 Characterization of fem-1 transcript from idDf1

RACE (rapid amplification of cDNA ends) (Frohman et al. 1988) was performed with Invitrogen’s 3’ RACE kit according to the manufacturer’s specifications. 1 µg of total RNA from idDf1 females, N2 hermaphrodites or fem-3 females was used for cDNA synthesis. It was denatured in 10 µl with 1 pmol of primer AP at 70°C for 10 minutes, then chilled in ice water. A 20 µl RT-PCR reaction was assembled using 20 mM Tris-HCl pH 8.4, 50 mM KCl, 2.5 mM MgCl2, 10 mM DTT, 500 µM dNTPs, 2 units RNase inhibitor. After warming the reaction to 42°C, 50 units of Superscript II reverse transcriptase (Invitrogen) were added, and the reaction proceeded for 50 minutes at 42°C. The RNA template was removed with 2 units of RNAse H (Invitrogen) at 37°C for 20 minutes. A PCR reaction performed with primers fem1_RT_asF3 and AUAP (see Table 2-3 for primer sequences) generated products specific to the idDf1 sample that produced a broad band of about 300 bp to 400 bp in size by agarose gel electrophoresis. DNA was extracted from this band and treated with T4 DNA polymerase in the presence of 100 µM each of dATP and dTTP before cloning into pBluescript II KS(+) vector digested with AccI and NotI. Inserts from 11 transformants were sequenced at The Center for Applied Genomics (The Hospital for Sick Children, Toronto, Ontario).

2.3.9 RNA isolation and quantification

Total RNA was collected from adult N2, e2268, idDf1 and idDf2 animals. RNA was isolated from 50 adult worms per sample using Trizol reagent (Invitrogen) according to the manufacturer’s specifications. 1 µg of RNA was used as a template for cDNA synthesis with a Superscript First Strand cDNA Synthesis kit (Invitrogen). 5 µl of 5-, 25-, and 125-fold dilutions of cDNA served as templates for PCR in a 50 µl reaction with 200 µM dNTPs, 0.4 µM of each primer, and 2.5 units of Taq DNA polymerase (NEB) in ThermoPol buffer (NEB). The PCR reaction consisted of 30 cycles of 95°C for 30s, 55°C for 30s, and 72°C for 1 minute, followed by a final 5 minute extension at 72°C. Half of each reaction was loaded on a 2.5% agarose TAE gel. PCR product “volumes” on images with no saturated pixels were measured using Quantity One software (BioRad) with local background substraction. The level of fem-1 transcripts in each sample was normalized to the geometric mean of the intensities of the control genes pgk-1, him-3 and mex-3. The samples were then compared with transcript levels in the wild-type sample.

2.3.10 Quantification of germ-line feminization

fem-1(y) unc-24; unc-7 females were crossed to wild type males. Adult F1 XX females (fem-1(y) unc-24/+; unc-7/+) and XO animals (fem-1(y) unc-24/+; unc-7/O) containing oocyte- like cells were scored as Fog. Occasional XX and XO animals were sterile, with germ line proliferation defects (~1% of progeny of idDf2 and idDf3 females); they were not included in

counts of Fog and non-Fog F1. The X-linked unc-7 mutation prevents XO animals from fertilizing their XX siblings. Experiments in which fem-1 was marked with mor-2 rather than unc-24 produced similar results. In some experiments, a paternally contributed egl-23 or egl-36

allele conferred a dominant egg-laying-defective phenotype in the F1 to ensure that XX hermaphrodites producing a small number of embryos were not incorrectly scored as females. Heteroallelic females were generated by crossing fem-1(y) unc-24/+ males with fem-1(z) unc- 24(e138)/nT1dm hermaphrodites. XX cross-progeny of these females were transferred to new plates as L4s to avoid fertilization by F1 males.

2.3.11 Isolating paternal disomics for chromosome IV

Chromosome IV paternal disomic animals were identified as Dpy non-Unc animals among the F1 progeny of crosses between fem-1(+) dpy-20 him-6 males and idDf2 him-6 unc-30 females. The him-6 mutation increases the frequency of aneuploid gametes (Hodgkin 1979). Paternal disomic fem-1(+) dpy-20 him-6 XX animals were distinguished from dpy-20 him- 6/idDf2 him-6 unc-30 XXX animals, which are also Dpy, by crossing to dpy-20 males and verifying that their progeny were all Dpy.

2.3.12 RNA injection

Linearized plasmid DNA served as a template for in vitro transcription. Refer to Table 2- 5 for a description of the plasmids. T3 or T7 RNA polymerase (Roche) was used according to the manufacturer’s instructions. In most experiments, template DNA was removed by treatment with DNaseI (Ambion). Transcripts were purified following electrophoresis on a non-denaturing agarose gel using Bio 101 Systems’ RNaid Spin Kit. Injection mixes contained 100 nM RNA, and in some experiments, 0.125% Lucifer Yellow dye (Sigma) to aid in monitoring the injection. At least two separate preparations of RNA were used for each type of RNA tested.

Injection into the germ line of idDf2 unc-24; unc-7 or idDf2 mor-2; unc-7 females was performed as described (Mello et al. 1991). Females were crossed to wild-type males and transferred to new plates daily. The Fog phenotype of the cross-progeny was scored when they reached adulthood. In preliminary experiments, the degree of rescue was monitored over several days and indicated that rescue was strongest in animals born 16-40 hours after injection. This period was used for the remainder of the experiments. The offspring of at least 20 injected females were scored for each RNA tested. Plates containing fewer than 15 animals were not counted. Injected animals were assigned to bins according to whether they produced ≤25%, 26- 50%, 51-75%, or >75% Fog progeny during the period scored. The bin distribution of animals injected with each type of RNA was compared to that of uninjected controls using the Mann- Whitney U test.

Injection of double-stranded fem-1 RNA results in feminization of the germ line and soma (Fire et al. 1998 and this work). If contaminating dsRNA were included in the RNA

58 preparation, its presence may induce feminization in the soma of the F1 XO progeny. These animals were examined by differential interference microscopy on a Nikon FxA MicroPhot microscope to confirm that no somatic feminization occurred.

Table 2-5: Information about the in vitro transcription products used for the RNA injection experiment.

Nucleotides of RNA included Type of RNA Enzyme RNA fem-1 fem-1 fem-1 fem-1 Other Plasmid for digest Pol. a 5' UTR exons introns 3' UTR seq. fem-1 pAS#1000 BamHI T7 74 1971 0 264 0 fem-1_xATG pAS#CJ9 BamHI T7 7 1971 0 138 0 fem-1_1 pAS#1000 PstI T7 74 591 0 0 0 fem-1_2 pAS#CJ52 HindIII T7 0 681 0 0 0 fem-1_3 pAS#CJ50 EcoRI T3 0 699 0 264 0 idDf1_RNA pAS#2009 SpeI T3 74 309 41 0 46 fem-1_genomic pAS#1053 HpaI T3 74 1971 2482 264 0 fem-1_intron8 pAS#CJ14 SpeI T7 0 0 1274 0 0 fem-1_anti pAS#1000 XhoI T3 74 1971 0 264 0 fem-1_5’flank pAS#CJ10 SpeI T7 0 0 0 0 1847 fem-1_3’flank pAS#CJ12 SpeI T7 0 0 0 0 786 dsfem-1 b pAS#1000 74 1971 0 264 0 fem-2 pAS#1285 SmaI T7 0 0 0 0 1346 fog-3 pAS#CJ49 BamHI T3 0 0 0 0 792 mom-5 pAS#CJ60-2 XhoI T3 0 0 0 0 2485 gfp pTU#65 EcoRI T3 0 0 0 0 738

a fem-1_anti produces an RNA complementary to fem-1 message. The polarity of all the other RNAs is direct with respect to fem-1 or the indicated gene.

b fem-1 (sense) and fem-1_anti RNAs were prepared separately and then annealed to produce double-stranded fem-1 RNA by incubating at 68°C for 10 minutes, then 37°C for 30 minutes.

2.3.13 Measuring fem-1 maternal rescue

lon-2 males were crossed to fem-1(y) unc-24/nT1dm; lon-2 (Fig. 2-8, Series I) and to fem- 1(y) unc-24; lon-2 (Fig. 2-8, Series II) females from strains AS238, AS374, AS375, AS376.

Non-Unc F1 XX (fem-1(y) unc-24/+; lon-2) were crossed to fem-1(e2268) unc-24/+ males. Unc,

Lon F2 XO animals (fem-1(y) unc-24/fem-1(e2268) unc-24; lon-2/O) were identified. The X- linked marker differentiates Lon XO animals from non-Lon XX animals.

Somatic masculinization of each animal was assessed using four categories. Level 1: two-armed gonad, vulva, truncated hermaphrodite tail. Level 2: two-armed gonad, partial vulva, rudimentary fan, crumpled spicules, < 4 rays. Level 3: abnormal gonad, partial vulva, small fan, short spicules, 4 to 8 rays. Level 4: one-armed gonad, no vulva, near-normal fan, normal spicules, > 8 rays.

2.3.14 Measuring fem-2 maternal rescue

unc-45 fem-2/dpy-1; lon-2 males from strain AS463 were crossed to dpy-1; idDf2 unc-

24; lon-2 females from strain AS457 (Fig. 2-9, Series III). Non-Dpy F1 XX (dpy-1/unc-45 fem-2;

idDf2 unc-24/+; lon-2) were crossed to unc-45 fem-2/+ males. Unc, Lon F2 XO animals (unc-45 fem-2; +/+; lon-2/O or unc-45 fem-2; +/idDf2 unc-24; lon-2/O) were scored. To demonstrate the degree of feminization shown by fem-2 animals in the absence of a maternal contribution of fem- 2(+), m-z- animals were produced by crossing unc-45 fem-2; lon-2 females to unc-45 fem-2/+ males (Fig. 2-9, Series IV). Unc, Lon XO progeny (unc-45 fem-2; lon-2/O) were scored. The full extent of maternal rescue provided by uncompromised fem-2(+) alleles was measure by crossing unc-45 fem-2/ dpy-1; lon-2 hermaphrodites to unc-45 fem-2/+ males (Fig. 2-9, series V) and scoring their Unc, Lon XO progeny (unc-45 fem-2; lon-2/O). Somatic masculinization was assessed using the same criteria described for fem-1 maternal rescue.

2.3.15 RNA in situ hybridization

fem-1 RNA levels were measured in fem-1(y) unc-24(e138) animals and the non-Unc cross-progeny of fem-1(y) unc-24 females or fem-1 unc-24/nT1dm; lon-2 hermaphrodites crossed

to wild-type males. Hybridization to XX and XO cross-progeny was carried out in separate tubes and each hybridization tube also contained wild-type animals of the opposite sex as a control to ensure that the hybridization reactions were equally effective. Gonad dissection, fixation and RNA in situ hybridization were performed as described (Iwasaki et al. 1996). EDTA (0.1mM) and 1mM aurintricarboxylic acid (Sigma) were also included during dissection. Sense and antisense fem-1 DNA probes were synthesized with DIG-dUTP using a PCR DIG Probe Synthesis Kit (Roche) to produce 300 µl of probe. SnaBI-digested AS#1000 served as a template. 25 µl of probe diluted with 75 µl of hybridization buffer was used for the hybridization. T7 RNA polymerase produced a sense probe which gave no signal, and T3 RNA polymerase generated a 1 kb antisense probe to the 3’ end of the gene that detects full-length, but not idDf1, RNA. If idDf2 produced a fem-1 RNA, the probe would be expected to detect it. An alkaline phosphatase-conjugated anti-DIG antibody (Roche) was used at 1:2500.

A 2x2 contingency chi-square test was used to compare the frequencies of fem-1 RNA staining in different samples. Expected values were calculated using the null hypothesis that the proportion of stained gonads for each genotype is not different. For m-z+ fem-1(e2268)/+ and m-z+ idDf2/+ gonads (n=280), a chi-square value of 93 was calculated. A chi-square value of 56.5 was obtained when comparing m-z+ and m+z+ idDf2/+ samples (n=327). Given one degree of freedom, I reject the null hypothesis at p<0.001 in both cases.

2.3.16 Heritable effects on germ-line feminization

The penetrance of the Fog phenotype over successive generations was measured by performing backcrosses. A wild-type fem-1 allele was marked with the semi-dominant allele

dpy-13(e184). dpy-13/+ males were crossed to fem-1(y) unc-24 females. Semi-Dpy F1 males (dpy-13/fem-1(y) unc-24) from each series were mated with fem-1(y) unc-24; unc-7 females.

Germ line feminization of their F2 semi-Dpy progeny was scored. To continue the experiment over several generations, semi-Dpy males were crossed to fem-1(y) unc-24 females. Recombinant progeny were identified by their Unc, semi-Dpy or non-Unc, non-Dpy phenotypes and excluded from the analysis.

Heritable germ-line feminization of non-Fog dpy-13/fem-1(y) unc-24 of Figure 2-12 animals was also assessed. Semi-Dpy XX animals were cloned during the L4 larval stage. The

Dpy, Unc and Fog phenotypes were scored for all the self-progeny of each F1 hermaphrodite. Semi-Dpy, Unc and non-Dpy, non-Unc recombinants were not analyzed. The brood sizes of

these F1 hermaphrodites and of N2 animals were recorded after transferring animals daily until no more embryos were laid.

2.3.17 Restoring activity to compromised alleles

Paternally contributed fem-1(+) alleles marked with dpy-13 were crossed to fem-1(y) unc-

24 females for two generations. F2 semi-Dpy males were then crossed to fem-1(e2268) unc-24; unc-7 females, and the Fog phenotype of their semi-Dpy progeny was assessed.

2.4 Results 2.4.1 Germ-line feminization of fem-1(Df)/+ m-z+ animals

fem-1 is the only gene deleted in whole or in part by each of three deficiency alleles, as illustrated in Figure 2-1. Two of the deficiencies, idDf2 and idDf3, produced maternal-effect embryonic lethality (Table 2-6) which is likely caused by deletion of the neighbouring gene, drp- 1, encoding a dynamin-related protein (Labrousse et al. 1999). I observed that three deficiency alleles of fem-1 behaved differently from all other characterized fem-1 alleles: upon crossing to wild-type males, females homozygous for any of the three fem-1(Df) alleles produced heterozygous offspring that exhibited feminization of the germ line (the Fog phenotype, Figure 2-2). This phenotype was not observed in progeny of mothers carrying other fem-1 alleles. In the affected offspring, spermatogenesis was reduced or absent. XX Fog animals developed as females: they were somatically identical to hermaphrodites, but did not produce their own sperm. Females were identified by the absence of embryos and were cross-fertile when sperm was provided by a male. XO Fog animals had normal male bodies, but contained oocyte-like cells in their germ lines. Since the affected XO animals were Fog rather than female, I knew that the feminization of the progeny of fem-1(Df) females was restricted to the germ line.

Figure 2-1: Physical map of fem-1 alleles.

The extent of each of the three deficiencies, idDf1, idDf2, and idDf3 is indicated by a heavy barred line beneath a map of the corresponding region of chromosome IV. Boxes represent genes on this map. The region between the dashed lines is enlarged in the lower part of the diagram to indicate the extent of overlap between idDf1 and idDf2 with respect to fem-1. Boxes represent exons. Bent arrows indicate the direction of transcription of fem-1 and the neighbouring operon. The position of the nonsense mutation e2268 is also indicated.

Table 2-6: Maternal-effect lethality of fem-1 deficiencies.

Maternal fem-1 genotypea % Embryonic lethality (n) fem-1(+) 1 (410) idDf2 36 (887) idDf3 62 (701) idDf1/idDf2 0.2 (554) idDf1/e2268 1.8 (490) idDf2/e2268 1.8 (428) a See Methods for complete genotypes.

Figure 2-2: Animals with wild-type or feminized germ lines.

Ventral is towards the bottom of the page and anterior is left for the XX animals. Ventral is towards the bottom of the page and anterior right for the top XO animal, and the opposite is true of the bottom XO animal. The outline of the gonad is shown by a dashed line. Scale bar is 50 µm.

A) XX hermaphrodite. Closed triangles indicate developing embryos.

B) XX female. Stacks of unfertilized oocytes are marked by open triangles.

C) Fog (top) and wild-type (bottom) XO animals. Oocyte-like cells are indicated by arrows.

The penetrance of the Fog phenotype depended on the fem-1 allele tested (Table 2-7). All the animals produced from females carrying non-deficiency null alleles such as the nonsense mutation fem-1(e2268) were phenotypically wild type. Homozygous idDf1 mothers produced about 15% Fog progeny. In contrast, about 80% of the descendants of idDf2 and idDf3 mothers were Fog. Even those XX progeny that were self-fertile showed evidence of germ-line feminization: brood size in C. elegans hermaphrodites is limited by the number of sperm produced, and the hermaphrodite offspring of fem-1(Df) females had smaller brood sizes than wild type, suggesting decreased spermatogenesis (Table 2-8). Heteroallelic mothers carrying fem-1(e2268) in trans to one of the deficiencies never generated Fog progeny, but the deficiencies did not complement one another for the Fog phenotype (Table 2-7). These results suggested that the wild-type and e2268 alleles produce something that is reduced or eliminated by the deficiency alleles and is maternally required for spermatogenesis, or that inheritance of the deficiency chromosome itself interferes with spermatogenesis. Heterozygous strains carrying fem-1(Df) could be propagated for many generations without ever producing Fog heterozygotes (Table 2-9). Since I only observed the Fog phenotype among the descendants of homozygous fem-1(Df) females, this observation implied that the Fog phenotype arose from a maternal absence effect rather than a dominant effect of the fem-1(Df) chromosome.

To test whether the Fog phenotype would still arise in the absence of an inherited copy of the fem-1(Df) chromosome, we repeated the cross between fem-1(+) males and fem-1(Df) females in the background of a mutation causing chromosomal nondisjunction (Haack and

Hodgkin 1991); we identified F1 progeny that were paternally disomic for the fem-1(+) chromosome. Despite not inheriting a copy of the deficiency chromosome, 8/11 of these animals exhibited the Fog phenotype (Figure 2-3). Explanations that invoke either an interaction between the fem1-(Df) chromosome and its wild-type homologue or the failure of such an interaction were excluded since they would require that fem-1(Df) be present in the affected animals. Instead, these results suggested that the deficiencies eliminate a maternally provided product that is required for spermatogenesis.

Table 2-7: Germ-line feminization in fem-1/+ m-z+ heterozygotes.

Frequency of germ-line feminization among the heterozygous progeny of various fem-1 females is reported as the mean ± standard deviation for the descendants of ‘n’ independent crosses. The total number of animals scored for each genotype ranged from 100 to 1000. Complete genotypes are described in Methods. Other fem-1 alleles tested included e1965 and e1991: both gave the same result as fem-1(e2268).

Percent Fog F1 Heterozygotes Maternal fem-1 genotype XX (n) XO (n) fem-1(e2195) 0 ± 0 (3) 0 ± 0 (3) fem-1(e2196) 0 ± 0 (3) 0 ± 0 (3) fem-1(e2267) 0 ± 0 (3) 0 ± 0 (3) fem-1(e2268) 0 ± 0 (11) 0 ± 0 (9) idDf1 15 ± 7 (10) 14 ± 13 (6) idDf2 77 ± 15 (10) 85 ± 11 (6) idDf3 91 ± 2 (6) 86 ± 6 (6) idDf1/idDf2 10 ± 4 (5) 13 ± 8 (5) fem-1(e2268)/idDf1 0 ± 0 (3) 0 ± 0 (5) fem-1(e2268)/idDf2 0 ± 0 (3) 0 ± 0 (6)

Table 2-8: Brood sizes of fem-1(Df)/+ m-z+ hermaphrodites.

Maternal genotype Median brood size Range n

N2 control 294 256-303 4

idDf1 182 104-267 4

idDf2 66 6-98 10

idDf3 84 34-169 10

Table 2-9: fem-1(Df)/+ progeny of heterozygotes rarely exhibit germ-line feminization. Maternal Percent Fog fem-1(Df)/+ F b genotypea 1 XX nc XO nc

idDf1/+ 0 10 0 10

idDf2/+ 0.1 ± 0.3 9 0 9

idDf3/+ 0.3 ± 0.6 6 n.d.

a See Methods for complete genotypes.

b Mean ± standard deviation.

c Number of crosses. Total number of animals scored for each genotype was 450 to 1800.

Figure 2-3: Evidence of the Fog phenotype in animals that do not inherit a fem-1(Df) allele.

Animals inheriting two paternal fem-1(+) alleles can still be Fog if their mother was a fem-1(Df) homozygote. In the schematic diagrams of chromosome IV, filled boxes represent wild-type alleles, and open boxes represent mutant alleles. Each gene is represented by a box of a different colour. Rare paternal disomics are identified by their Dpy, non-Unc phenotype.

2.4.2 RNA production by fem-1 alleles

fem-1 RNA is the likely candidate for the maternal product that promotes spermatogenesis since fem-1 is the only gene that is uncovered in the overlap of all three deletion alleles (Figure 2-1). All of the tested alleles likely eliminate the activity of the FEM-1 protein. FEM-1 is not detectable by Western blotting of lysates from fem-1(e2268) females (Vivegananthan 2004), one of the alleles that did not produce a maternally derived Fog phenotype, making it unlikely that effect of the deficiency alleles arose from a lack of maternal FEM-1. Instead, I hypothesized that maternal fem-1 RNA might be required for spermatogenesis independently of its protein-coding potential, and that the maternal effect of the deficiencies results from elimination of maternal fem-1 RNA.

Since the idDf1 allele retains the fem-1 promoter, it may be the only one of the three deficiency alleles able to produce any fem-1 RNA. Perhaps a fem-1 RNA produced from this allele partially promotes spermatogenesis when maternally contributed, which could explain why the penetrance of the Fog phenotype was lower using idDf1 females than the other two deficiencies. The lower penetrance of the Fog phenotype was also observed among the progeny of trans-heterozygous idDf1/idDf2 mothers (Table 2-7), a result consistent with the idea that a maternal fem-1 transcript from idDf1 reduces the extent of germ-line feminization.

Using RT-PCR, the fem-1 RNAs produced from each of these alleles were characterized (Figure 2-4). idDf2 and idDf3 do not make a fem-1 transcript; however, the fem-1 promoter is intact in idDf1, and a chimeric transcript is made. The cloning of 3’ RACE products from idDf1 showed that the chimeric transcripts include fem-1 exons 1 to 4, extend through intron 4 to the deficiency breakpoint, and then have 40 to 86 basepairs of sequence downstream of the breakpoint. All 11 sequenced RACE products ended at or near the 21U-9867 locus identified as matching a 21U-RNA (Batista et al. 2008). The majority of these products were polyadenylated at a site encoding the 5’ end of 21U-9867 on the opposite strand. The idDf1 fem-1 transcript was present at higher levels than the wild-type transcript. The allele fem-1(e2268) produced less abundant RNA than the wild-type allele, likely because fem-1(e2268) may be targeted by the nonsense-mediated decay system (Hodgkin et al. 1989; Pulak and Anderson 1993). Since idDf1 caused maternal-effect germ-line feminization and e2268 did not, other characteristics of the RNA such as the presence of 21U sequences may be relevant as well as the quantity of RNA.

Figure 2-4: Levels of fem-1 RNA production from various fem-1 alleles.

A) Representative picture of a gel showing PCR products amplified from cDNA templates of animals carrying various fem-1 alleles. fem-1 PCR products are compared with germ-line-expressed genes as controls.

B) Quantification of relative amounts of fem-1 RNA detected in wild-type animals, fem- 1(e2268) females and idDf1 females. The level of fem-1 transcripts in each sample was normalized to the geometric mean of the three control genes. Samples of each genotype were then normalized relative to wild type. Error bars represent standard deviations.

2.4.3 Injection of fem-1 RNA into the germ line of fem-1(Df) females rescues germ-line feminization of their progeny

Based on this information, I decided to test whether maternally provided fem-1 RNA does promote spermatogenesis. If this hypothesis were correct, then injection of fem-1 RNA into the germ line of fem-1(Df) females might be expected to rescue spermatogenesis in their progeny. I tested this prediction by injecting homozygous idDf2 females with in vitro-transcribed RNA and determining the frequency of germ-line feminization among the cross-progeny of each injected animal.

To characterize the timeline for rescue using this assay, injected animals were initially transferred to new plates every morning for four days. Rescue of the Fog phenotype in the adult progeny was strongest and most consistent in animals laid 16 to 40 hours after injection (Figure 2-5). This timeframe was selected to test for rescue thereafter. This initial characterization also confirmed that rescue was stronger if RNA was injected into both gonad arms than a single arm. Most of the reported data are from animals where both arms were injected, but sometimes the second arm was inaccessible and only one side of the gonad was successfully injected with RNA. For the experiment, injected animals were assigned to bins according to the frequency of the Fog phenotype among their F1 progeny. The bin distribution of animals injected with each kind of RNA was then compared to the distribution of uninjected controls and that of animals receiving full length fem-1 RNA.

Most females injected with the transcript of a full-length fem-1 cDNA produced fewer Fog progeny than did uninjected females (Figure 2-6 A, B and Table 2-10). Injection of RNA transcripts from other genes did not change the distribution of the feminized animals, as indicated by the mom-5 and gfp injections (Figure 2-6 P, Q). Injected transcripts of fem-2 or fog- 3, two sex-determining genes that also have roles in promoting spermatogenesis (Kimble et al. 1984; Hodgkin 1986; Ellis and Kimble 1995), also did not affect the frequency of germ-line feminization (Figure 2-6 N, O). Thus, fem-1 RNA specifically rescued spermatogenesis in the heterozygous progeny of fem-1(Df) females. This effect of single-stranded fem-1 RNA in promoting spermatogenesis is opposite to the phenotype of complete germ-line feminization caused by RNA interference when double-stranded fem-1 RNA is injected (Fire et al. 1998) (Figure 2-6, compare B, C, M).

Figure 2-5: Timeline for rescue of the Fog phenotype after RNA injection.

The germ lines of idDf2 females crossed to wild-type males were injected with RNA made from a full length fem-1 cDNA template. At the indicated times after injection, individual injected animals were transferred to new plates. The Fog phenotype of the progeny on each plate was scored when the animals reached adulthood. The results for an uninjected animal and two representative injected females are shown.

Figure 2-6: Effect of RNA injection into the germ line of idDf2 females on germ-line feminization in their heterozygous progeny.

A) Percentage of uninjected idDf2 females producing the indicated fractions of Fog F1 progeny upon crossing to wild-type males.

B-Q) Frequency of Fog progeny produced by females injected with RNA transcribed from the indicated templates. Templates for in vitro transcription are drawn with coding regions shown as filled boxes, untranslated regions as unfilled boxes, and introns and flanking DNA as lines. Bent arrows indicate the direction of in vitro transcription. The progeny of at least 20 females injected with RNA from each of the indicated templates were scored. The results are plotted as in A. Asterisks indicate distributions significantly different from that of the uninjected control females: * 10-4 < p < 10-2; *** p < 2 x 10-6 (Mann-Whitney U test; see Table 2-10)

(Figure 2-6 continues on the next page.)

Table 2-10: Statistical significance of the effect of RNA injection.

p-valuea Number of Animals Compared with Compared with Template Injected Uninjected fem-1 cDNA Uninjected 50 N/A 3 x 10-11

fem-1 cDNA 80 3 x 10-11 N/A

fem-1_xATG 20 2 x 10-6 0.5

fem-1_1 20 1 x 10-6 0.9

fem-1_2 36 4 x 10-10 0.9

fem-1_3 24 6 x 10-9 0.5

idDf1_RNA 16 8 x 10-3 0.01

fem-1_genomic 20 4 x 10-7 0.3

fem-1_intron8 22 1 x 10-3 1 x 10-3

fem-1_anti 47 4 x 10-3 3 x 10-4

fem-1_5’flank 24 3 x 10-4 2 x 10-3

fem-1_3’flank 28 2 x 10-4 8 x 10-4

ds_fem-1 16 4 x 10-7 4 x 10-10

fem-2 cDNA 39 0.3 4 x 10-11

fog-3 cDNA 24 0.1 2 x 10-5

mom-5 24 0.2 5 x 10-6

gfp 27 0.6 1 x 10-6 a p = probability that the observed distribution does not differ from uninjected controls or injections from a full-length fem-1 cDNA template. Mann-Whitney U test.

I characterized the aspects of fem-1 RNA that promote its rescuing activity by injecting several modified fem-1 transcripts (Figures 2-6 and 2-7). By demonstrating that fem-1 RNA lacking the FEM-1 initiation codon still rescued, I confirmed that this activity of the RNA did not depend on its ability to encode FEM-1 protein (Figure 2-6 C). To determine whether particular sequences within the fem-1 transcript were responsible for its rescuing activity, I injected RNA transcribed from three adjacent cDNA fragments. Each of these truncated transcripts rescued spermatogenesis with similar efficiency to the full-length fem-1 transcript (Figure 2-6 D, E, F). Transcripts of a fem-1 genomic clone were likewise effective, indicating that the presence of introns did not disrupt the activity of the injected RNA. In contrast, a transcript containing only fem-1 intron sequence showed markedly reduced rescuing activity compared to transcripts with exons. Antisense transcripts of fem-1 cDNA and transcripts of the sequences immediately flanking the fem-1 locus were similarly low in activity (Figure 2-6 I to L). Together, these results suggested that rescue of the fem-1(Df) maternal effect requires sequences homologous to fem-1 mRNA with sense strand polarity and that no specific sequence from the mRNA is essential for its maternal function.

Figure 2-7: fem-1 cDNA features and injection constructs.

The scale bar on top represents the number of nucleotides from the 5’ end of the mRNA. The fem-1 mRNA is drawn with the 5’ end to the left. Empty boxes at either end of the mRNA are the untranslated regions. The coloured box represents the open reading frame with vertical lines marking exon boundaries. The region encoding ANK repeats is shown in yellow. The 3- frame translation shows the start and stop codons for each reading frame. ATG codons are represented by red arrows, and stop codons are shown as vertical green lines. Regions deleted by the deficiency alleles are shown with black boxes in the next track. The red boxes of the last track show the RNA included in fragments of fem-1 message used for the RNA injection experiment. The idDf1_fem-1 fragment also includes a horizontal line representing chromosome IV sequence included after the idDf1 breakpoint. Of the other three fragments of fem-1 RNA, only fem-1_1 would produce a piece of FEM-1 protein if translation began at the first ATG.

A transcript resembling the chimeric fem-1 RNA produced from idDf1 had limited rescuing activity (Figure 2-6 G). I previously suggested that the production of a partial fem-1 transcript in idDf1 females may explain the reduced penetrance of the Fog phenotype in their offspring. The injection result showed that this transcript does partially promote spermatogenesis when compared to the levels of the Fog phenotype observed if fem-1 RNA is entirely absent. This observation supported the suggestion that maternal provision of this transcript could have an impact on the amount of germ-line feminization in idDf1/+ m-z+ animals. However, the injection experiment also demonstrated that this transcript is less effective at rescuing the Fog phenotype than are other fem-1 RNAs. This result was expected since idDf1 mothers do produce some Fog offspring, whereas wild-type and fem-1(e2268) mothers never do. Since the amount of detected fem-1 RNA was higher in idDf1 animals than in e2268 animals, perhaps there is something qualitatively different about this transcript that affects its activity in the rescue assay and when endogenously produced. Characteristic(s) of the chimeric fem-1 transcript produced by idDf1 could compromise its ability to promote spermatogenesis compared with transcripts provided by wild-type and fem-1(e2268) mothers, a possibility further considered in the discussion. The ineffectiveness of this RNA at rescuing the Fog phenotype supports our contention that the absence of appropriate maternal fem-1 RNA is what causes germ-line feminization in descendants of females carrying any of the fem-1(Df) alleles.

Injection of the chimeric transcript did not reduce the proportion of Fog animals produced by idDf2 to the levels observed using idDf1. The injection assay may not properly replicate the conditions of endogenous germ-line fem-1 RNA production, resulting in inadequate quantity, processing or localization of maternal RNA required to promote zygotic spermatogenesis. Alternatively, other factors may also contribute to the degree of germ-line feminization observed in idDf1 and idDf2. For example, in addition to the production of a chimeric fem-1 transcript by idDf1, another difference between the deficiency alleles is that idDf2 and idDf3 remove additional genes to right of fem-1 on chromosome IV, whereas fem-1 is the only gene deleted by idDf1 (Figure 2-1). These genes may contribute to the severity of the phenotype in idDf2 and idDf3, a possibility that is addressed in Chapter 3.

2.4.4 Germ-line fem-1 levels are reduced in fem-1(Df)/+ m-z+ animals

The activity of fem-1 RNA in the maternal injection assay supported the hypothesis that maternal RNA has a role in promoting spermatogenesis independent of its capacity to encode FEM-1 protein. Since zygotic fem-1 activity is required for spermatogenesis, the role played by maternal fem-1 RNA might involve regulating zygotic fem-1 activity in the germ line. This hypothesis predicted that the fem-1(Df)/+ progeny of fem-1(Df) females should have lower germ- line fem-1 activity than do other fem-1/+ heterozygotes, which never exhibited the Fog phenotype. I tested this prediction in two ways: I used a genetic test of germ-line fem-1 activity, and I detected fem-1 transcripts in the germ line using in situ hybridization.

The rescue of male development in the fem-1 progeny of a fem-1/+ mother depends entirely upon fem-1(+) activity in the germ line of the mother (Doniach and Hodgkin 1984). I

reasoned that the extent of rescue of somatic male development in the F1 progeny of a heterozygous mother would provide an assay for the level of germ-line fem-1(+) activity in that mother. Heterozygotes descended from fem-1(Df) females (Figure 2-8, Series I cross) produced less extensively masculinised fem-1 m+z- XO progeny than did heterozygotes descended from either fem-1(Df)/+ hermaphrodites (Figure 2-8, Series II cross) or fem-1(e2268) females (Figure 2-8, Series I cross). This observation suggested that, as predicted, germ-line fem-1(+) activity is lower in the heterozygous descendants of fem-1(Df) females than in other fem-1/+ heterozygotes. To test whether heterozygotes descended from fem-1(Df) females were also deficient in the germ-line activity of other genes, I tested the effect of the fem-1 allele idDf2 on the maternal rescuing activity of another sex-determining gene, fem-2. I found that descent from a fem-1(Df) female had no effect on the extent to which a heterozygote could rescue male development in its fem-2 mutant progeny (Figure 2-9). Heterozygotes descended from fem-1(Df) females were therefore specifically deficient in germ-line fem-1(+) activity.

Figure 2-8: Effect of descent from a fem-1(Df) female upon fem-1 maternal rescuing activity in fem-1/+ heterozygotes.

A) Crosses measuring germ-line fem-1 activity in F1 fem-1/+ heterozygotes as the ability to promote male somatic development of F2 fem-1 XO progeny. fem-1(y) is e2268, idDf1, idDf2 or idDf3. Series I F1 fem-1/+ XX animals descended from fem-1(y) females were compared with Series II control F1 fem-1/+ XX heterozygotes that themselves descended from heterozygotes.

B) Quantification of somatic sexual phenotype of F2 fem-1 XO animals produced by Series I and II crosses involving fem-1(e2268) and each fem-1 deficiency (n = 20 to 70). F2 fem-1 XO animals were assigned to one of four categories according to their somatic sexual phenotype. Level 4 represents the most masculinized animals, level 1 the least. (See Methods for a description.)

C-E) Representative F2 fem-1 XO animals. Anterior is left, and ventral is towards the bottom of the page. Scale bar = 50 μm. Dashed lines outline the gonad, and a filled triangle indicates the position of the distal tip of each gonad arm. (c) XO fem-1(e2268)/idDf3 F2, level 1 masculinization, produced by a Series I F1 idDf3/+ heterozygote. An open triangle indicates the vulva, and an arrow indicates the feminized tail. (d) XO fem-1(e2268)/idDf3 F2, level 4 masculinization, produced by a Series II F1 idDf3/+ heterozygote. (e) XO fem-1(e2268) F2, level 4 masculinization, produced by a Series I F1 fem-1(e2268)/+ heterozygote.

Figure 2-9: Effect of descent from a fem-1(Df) female on fem-2 maternal rescuing activity.

fem-2(+) maternal rescuing activity is not reduced in descendants of fem-1(Df) homozygotes. The criteria for scoring somatic masculinization are described in the Methods. The results of B and C are consistent with previous reports (Hodgkin 1986).

A) Similarly to Series I F1 XX animals (Fig. 2-8), the Series III F1 XX are descended from idDf2 homozygotes; however, the Series III F2 XO animals scored are fem-2(-); fem-1(+) rather than fem-2(+); fem-1(-).

B) Control: in the absence of maternal fem-2(+), fem-2 m-z- XO animals show strong feminization.

C) Control: maternal fem-2(+) activity completely rescues male development in fem-2 m+z- XO animals.

Germ-line RNA in situ hybridization provided a second, independent measure of fem- 1(+) activity in the germ line of heterozygotes descended from fem-1(Df) females. Comparison of wild-type animals and females homozygous for fem-1 mutant alleles revealed clear differences in fem-1 transcript accumulation (Figure 2-10). fem-1 RNA was readily detectable in wild-type animals of either sex, but not in fem-1(Df) females, and hybridization to the germ line of fem- 1(e2268) females was weak and infrequent, as expected based on the reduced RNA levels detected by RT-PCR for this nonsense allele (Figure 2-4). These observations affirmed the usefulness of this assay in comparing the output of wild-type fem-1 alleles in fem-1 heterozyotes carrying each of these mutations. I then compared hybridization to the germ lines of fem-1/+ heterozygotes descended from either fem-1(Df) females or fem-1(e2268) females. Hybridization was less frequently detectable and was much less intense in the progeny of fem-1(Df) females than in the offspring of fem-1(e2268) females (Figure 2-10). Heterozygotes descended from fem- 1(Df)/+ hermaphrodites showed no such reduction in the frequency of hybridization. Assays of fem-1(+) maternal rescuing activity and germ-line transcript accumulation were thus concordant in suggesting that a paternally contributed fem-1(+) allele was less active in the heterozygous progeny of a fem-1(Df) female than the same allele in the other fem-1/+ heterozygotes. I concluded that the reduced zygotic germ-line fem-1(+) activity explained the Fog phenotype of heterozygotes descended from fem-1(Df) females.

Figure 2-10: fem-1 transcript accumulation in the progeny of fem-1 or fem-1/+ animals.

A-C) in situ hybridization of an antisense fem-1 RNA probe to dissected gonads. Dashed lines outline the germ line. The dark blue colour is the signal. Scale bar = 100 μm. (a) XX fem- 1(e2268)/+ m-z+. (b) XO N2 (wild type). (c) XX idDf2/+ m-z+.

D) Mean percentages of gonads showing fem-1 RNA staining (± standard deviation) using data from at least two samples of at least 40 gonads each. An asterisk indicates that these samples differ significantly from each other, p<0.001.

2.4.5 Evidence of a heritable change in genetic activity in fem-1(Df)/+ m- z+ animals

Evidence presented above suggested that the Fog phenotype of heterozygotes descended from fem-1(Df) females resulted from a reduction in the activity of fem-1(+) in the zygotic germ line. Further genetic analysis led to the surprising observation that this reduction could be propagated from one generation to the next. Repeated backcrossing of fem-1(Df)/+ heterozygotes to fem-1(Df) females resulted in an increase in the frequency of the Fog phenotype among the heterozygous progeny in each successive generation (Figure 2-11). Taken together with our other observations, these data suggested a progressively more severe reduction in activity of the paternally inherited fem-1(+) with each backcross. Within three generations, even the idDf1 allele, which originally had the weakest effect, generated offspring with almost fully penetrant germ-line feminization.

Figure 2-11: Increased penetrance of germ-line feminization in fem-1(Df)/+ heterozygotes following backcrossing to fem-1(Df) females.

The frequency of germ-line feminization is reported as the mean ± standard deviation observed among F1, F2 and F3 heterozygotes produced in at least two series of crosses for each allele. Over 300 animals were scored for each genotype.

Further indications that there is a heritable change in the descendants of fem-1(Df)

females came from the examination of the non-Fog F1 animals and their offspring. As previously noted, even the self-fertile XX fem-1(Df)/+ m-z+ animals showed evidence of reduced spermatogenesis. The heritability of this reduction in gene activity was indicated by the evidence of germ-line feminization in animals of the F2 generation (Figure 2-12). Even F2 animals carrying two wild-type copies of fem-1 were occasionally Fog.

Two observations indicated that the affected animals retained wild-type fem-1 sequence: first, somatic male development was unaffected; second, a cross between affected heterozygotes and fem-1(e2268) females produced wild-type heterozygous progeny (Figure 2-13). Therefore, the decrease in germ-line fem-1 activity could not be explained by mutation. Instead, fem-1(+) appeared to have undergone a heritable, but reversible, epigenetic change that reduced its activity in the germ line.

Figure 2-12: Evidence for germ-line feminization in the self-progeny of non-Fog fem- 1(Df)/+ m-z+ animals.

A) Crossing scheme to examine self-progeny of non-Fog descendants of deficiency homozygotes.

B) Heritably reduced fem-1(+) activity in F1 is suggested by reduced F1 brood size, occurrence of the Fog phenotype in F2 Dpy [fem-1(+)/fem-1(+)] and semi-Dpy [fem-1(+)/fem- 1(y)] animals, and failure of maternal rescue of F2 Unc [fem-1(y)/fem-1(y)] animals.

Figure 2-13: Restoring activity to compromised alleles of fem-1(Df) progeny.

Activity of a compromised allele can be restored by crossing it to a fem-1(e2268) female. Mean ± standard deviation is calculated using the frequency of the Fog phenotype in at least four crosses. Over 450 F3 animals of each genotype were scored.

2.5 Discussion 2.5.1 Heritable silencing of fem-1 in the absence of maternal RNA

These results led me to propose that, in the absence of an adequate maternal contribution of fem-1 RNA, a paternally contributed fem-1(+) allele underwent silencing in the zygotic germ line, which in turn resulted in reduced spermatogenesis and a Fog phenotype. Both sexes were susceptible to this regulation. Most animals showed evidence of silencing, though the strength of the effect varied. Even when spermatogenesis occured in the affected animals, an epigenetic memory of the reduced-activity state of fem-1 persisted in the mature gamete. If it fertilized an oocyte with insufficient fem-1 RNA content, the already-compromised paternal fem-1 allele was further silenced, with a consequent increase in the penetrance of the Fog phenotype.

Maternal fem-1 RNA both prevented the silencing of paternal fem-1(+) and allowed the reactivation, usually within a single generation, of a previously silenced allele. I refer to this role, which is independent of the coding capacity of the RNA, as licensing the germ-line expression of fem-1. The term “licensing” refers to the function of the RNA rather than any specific model of a mechanism by which licensing could be accomplished. Since the injection of in vitro-transcribed RNA into the germ line of fem-1(Df) females did rescue germ-line feminization of their progeny, the licensing function of fem-1 RNA must not require the act of transcription itself.

The injection rescue experiment also indicated several characteristics of licensing RNAs by assessing how well various transcripts were able to rescue the Fog phenotype. The resolution of the assay limits direct comparison of the efficiency with which different RNAs rescue the Fog phenotype, but there do seem to be strongly rescuing and weakly rescuing RNAs. Perhaps multiple mechanisms associated with different degrees of rescue are involved. Characteristics of strongly rescuing maternal RNAs can also be discerned. RNA from regions flanking fem-1 rescued poorly, suggesting that licensing may be targeted to a specific gene or its products by homologous RNAs without allowing spreading to neighbouring regions. Intronic RNAs had limited rescuing ability, implying that licensing RNAs may require sequences that are present in the fem-1 message. Since all three fragments of fem-1 cDNA were able to generate rescuing RNAs, the licensing is likely due to sequence matching fem-1 exons rather than to a particular sequence or secondary structure formed by the RNA. Additionally, the RNAs that rescue most

effectively have a sense polarity. This constraint could imply that the RNA recruits a complex in a particular orientation or that a negative signal opposed by the licensing RNA also has a specific polarity. Because both the fem-1 “genomic” RNA and the transcript made from fem-1 cDNA were active, the RNA need not be contiguous with either the genomic DNA or the mRNA over their entire length. It will be informative to learn whether the injected RNAs are processed before acquiring licensing function. If the active agents are small RNAs matching exon sequences, then such molecules could be obtained from the larger transcripts. The ineffectiveness of the chimeric transcript resembling idDf1 RNA illustrates that not all RNAs containing fem-1 exon sequences rescue well. This RNA was exceptional in that it was chimeric, had the shortest region of homology to fem-1, and contained non-fem-1 sequence, notably sequence matching a 21U-RNA. 21U-RNAs have been associated with gene regulation in the C. elegans germ line, but little is known about this process (Batista et al. 2008; Das et al. 2008; Wang and Reinke 2008). In order to ascertain why the idDf1-like RNA did not rescue well, it will be necessary to test other transcripts with these qualities. An idDf1-like RNA lacking the 21U sequence could also be tested.

Based on this description of fem-1 silencing and the characteristics associated with licensing fem-1 RNAs, I developed models of how maternal RNA fulfils its licensing function. These models must include an explanation of the mechanism leading to gene silencing and the means of transmission through gametogenesis of the silenced state. Below I consider two general forms that such a model might take. Specific predictions of these models are discussed in Chapter 5.

2.5.2 Models for licensing of zygotic germ-line gene expression by fem-1 RNA

Epigenetic regulation during the development of an animal often involves the regulation of transcription by means of chromatin structure. One model for fem-1 silencing is that, in the absence of maternal RNA, the fem-1 locus is vulnerable to repressive chromatin modification. Such an effect could be the consequence of a general mechanism acting to silence gene expression in the germ line or could be targeted to fem-1 by a specific feature of that gene. This modification could introduce a mark that persists through spermatogenesis, and the degree of

95 fem-1 silencing could depend on the distribution or density of the mark across the locus. In this kind of model, the licensing role of maternal fem-1 RNA would consist of targeting to the fem-1 locus factors that block or reverse repressive chromatin modification.

Histone modifications and variant histones have often been proposed as carriers of epigenetic information. At least one histone variant, H3.3, occurs in the chromatin of mature C. elegans sperm and could convey heritable information through the male germ line (Ooi et al. 2006). There are also many histone modifications associated with gene regulation in the C. elegans germ line (Kelly et al. 2002; Reuben and Lin 2002; Schaner et al. 2003; Bean et al. 2004; Bender et al. 2004; Walstrom et al. 2005; Bender et al. 2006). Such modifications could be read as a code indicating the level of expression permitted to fem-1, or they could lead to higher order mechanisms of silencing (Strahl and Allis 2000). While histone modifications are often associated with epigenetic inheritance, self-propagation of histone modifications from one generation to the next has rarely been demonstrated (Ptashne 2007; Katz et al. 2009). Even in a case where histone modifications are not directly heritable, they could influence production of a heritable agent or act as secondary effectors of regulation downstream of the epigenetic information. In other organisms such as plants and mammals, DNA methylation is another means of silencing gene expression (Feil and Berger 2007; Matzke et al. 2009), but attempts to detect methylated DNA in C. elegans have failed to detect this form of regulation (Simpson et al. 1986). A model involving licensing through an effect on chromatin yields predictions that can be tested by looking for evidence of chromatin modification at the fem-1 locus and by investigating the involvement of genes with roles in the regulation of chromatin structure.

The maternally inherited RNAs could be incorporated into licensing complexes containing chromatin-modifying enzymes in the zygote, or pre-assembled complexes could be maternally inherited (Brennecke et al. 2007). RNAs that recruit chromatin modifiers are most often associated with repressive activities (Matzke and Birchler 2005; Zaratiegui et al. 2007). Nevertheless, several studies have demonstrated that RNA can target chromatin modifications leading to the activation of gene expression. In the example of D. melanogaster dosage compensation, noncoding RNAs produced from two loci, roX1 and roX2, are incorporated into the MSL complex which effects transcriptional upregulation of the X chromosome in males through acetylation of lysine 16 of histone H4; in the absence of both RNAs, the complex is mistargeted (Kelley et al. 1999; Meller and Rattner 2002; Kelley et al. 2008). Recruitment of

the SET-domain-containing protein Ash1 to the gene Ultrabithorax (Ubx) more closely resembles the situation for fem-1 in that it is gene-specific (Sanchez-Elsner et al. 2006). RNAs from trithorax response elements (TREs) upstream of Ubx bind chromatin at the sites where they are produced, then recruit Ash1. In contrast to both of these examples which involve noncoding RNAs, the licensing role of fem-1 RNA is the first example of a protein-coding RNA that serves a translation-independent role in promoting gene expression.

In an alternative model for licensing by maternal RNA, I postulate that the silencing which occurs in the absence of maternal RNA is itself an RNA-mediated process. Small RNA molecules play central roles in a variety of gene silencing phenomena (Murchison et al. 2007; Zaratiegui et al. 2007; Girard and Hannon 2008; Matzke et al. 2009) . Perhaps the C. elegans germ line accumulates silencing RNAs derived from the fem-1 locus or elsewhere which are capable of targeting fem-1 for silencing. This model neither excludes nor requires the possibility that silencing involves chromatin modification, because small RNAs can silence gene expression at the transcriptional or post-transcriptional levels. In this type of model, maternal fem-1 RNA might fulfill its role in licensing fem-1 activity by bringing about the inactivation or elimination of silencing RNAs in the developing germ line.

The C. elegans germ line accumulates siRNAs capable of targeting many genes, including fem-1 (Ambros et al. 2003; Ruby et al. 2006; Batista et al. 2008). Perhaps these siRNAs are responsible for silencing in the absence of maternal RNA. A need to inactivate siRNAs, which derive primarily from the antisense strand of exon sequences (Ambros et al. 2003; Ruby et al. 2006), could readily explain why sense strand transcripts of fem-1 exons most effectively prevented fem-1 silencing in the RNA injection assay. The silencing RNAs themselves could serve as vehicles for transmitting the silenced state through spermatogenesis (Rassoulzadegan et al. 2006; Alcazar et al. 2008), and their accumulation could explain why silencing becomes more severe upon repeated backcrossing of fem-1(+) to fem-1(Df). That scenario would require ensuring that the siRNAs are not diluted by cell divisions in the developing animal, but are rather present in the germ line in a form that can be amplified and inherited in every generation. Cytoplasmic and nucleus-associated P granules provide precedents as factors that contain RNAs and whose inheritance is restricted to germ cells (Seydoux and Braun 2006).

2.5.3 Potential benefits of licensing gene expression in the C. elegans germ line

It seems unlikely that a form of regulation by licensing RNAs would arise simply to control a single gene. Whether other genes are also targeted for silencing in the absence of maternal RNA is further explored in Chapter 4. Chapter 4 also investigates the possibility that specific characteristics of fem-1 that make it susceptible to silencing, potentially by leading to its misrecognition as a foreign genetic element. An alternative possibility is that genes may be generally silenced in the germ line if no record of their expression in previous generations is provided by maternally deposited RNA. This kind of mechanism would protect not only against foreign genetic elements, but also against misexpression of determinants that could alter the fate of the germ line during development. In either scenario, the organism requires protection from silencing for genes such as fem-1 whose expression in the germ line is appropriate and necessary.

Licensing by maternal RNA must function alongside the other mechanisms of gene regulation in the germ line. There are complementary systems in the germ line both to regulate germ cell fate and to provide surveillance against foreign genetic elements. In the early embryo, PIE-1 provides transcriptional repression in the germ line (Seydoux et al. 1996). When this repression is lifted, at least two other chromatin-based forms of regulation act to repress transcription in the germ line. First, there is a nanos-regulated, germ-cell specific chromatin organization leading to genome-wide repression (Schaner et al. 2003). Second, the MES-2, -3, -6 complex creates repressive chromatin domains on the X chromosome, while MES-4 ensures that the autosomes can be transcriptionally active (Bender et al. 2004; Bender et al. 2006). Translational regulators also help ensure totipotency of the germ line (Ciosk et al. 2006). In order to place maternal-effect silencing in context with these other forms of regulation in the germ line, it will be useful to determine when in development silencing of fem-1 occurs. Experiments to address this point are proposed in Chapter 5.

Several related silencing mechanisms regulate unusual DNA in the germ line. The components required for these processes overlap. Transposons (Ketting et al. 1999), unpaired DNA (Bean et al. 2004) and transgenes (Kelly and Fire 1998) are all subject to repression in the germ line. Highly repetitive transgenes also lead to silencing of their endogenous loci in a phenomenon called cosuppression, which is likely mediated by RNAs (Dernburg et al. 2000; Robert et al. 2005). With respect to the repression of fem-1, we have noted that the degree of

silencing increases in successive generations when maternal RNA is absent. Perhaps the presence of these other silencing mechanisms helps explain why this maternal-effect silencing need not be a binary mechanism completely shutting off gene expression in a single generation. Identifying the genetic requirements for this new form of regulation will further clarify the distinctions between previously described mechanisms of silencing and maternal-effect silencing and licensing.

The diverse roles played by noncoding RNA in regulating gene expression are gaining widespread recognition, and increasing evidence suggests that at least some mRNAs serve translation-independent functions that are important for cell structure and development (Jenny et al. 2006; Kloc et al. 2008). Our results suggest that a maternal mRNA in C. elegans has an unprecedented translation-independent role in the epigenetic regulation of its cognate gene in the zygotic germ line. The generality of this phenomenon remains to be investigated, but an interesting implication is that genes with no history of germ-line expression, as assessed by comparison against the pool of maternally deposited RNA, could be targeted for silencing. This mechanism, along with previously described mechanisms of repression and silencing in the germ line, may contribute to protecting the germ line against factors that direct somatic differentiation or against foreign genetic elements.

Chapter 3 Genetic factors influencing maternal-effect germ-line feminization

Statement of contributions:

I performed the majority of the experiments in Chapter 3 and produced reagents as described in the Materials and Methods. Caroline Fernandes participated in screening the Argonaute genes by RNAi. Dr. Andrew Spence scored some of the crosses with rde-1, rde-2 and mut-7 mutant animals and measured T12E12.2 RNA levels.

100

3 Genetic factors influencing maternal-effect germ-line feminization 3.1 Abstract

The genetic content and cellular phenotype of germ cells is protected by several processes that regulate gene expression in the germ line. Most of these mechanisms act to restrict expression of factors that resemble foreign genetic material or could alter germ line identity. To my knowledge, the maternal-effect regulation of the Caenorhabditis elegans sex- determining gene fem-1 provides the first example where RNA from a protein-coding gene is required for promotion of its own expression. In Chapter 2, I showed that a maternal transcript of fem-1 is required in order to prevent the heritable silencing of a wild-type fem-1 allele in the zygotic germ line, thereby licensing its expression. To discover genes that are required for the maternal-effect silencing and licensing of fem-1 in the germ line, I performed an RNAi screen of candidate genes. Several enhancers and suppressors of the germ-line feminization phenotype caused by loss of fem-1 activity were identified and confirmed using mutant alleles. The genetic requirements for this form of regulation overlap with those of previously described silencing processes in the germ line, but are also distinct from them all. The role of an active machinery promoting silencing in the absence of licensing RNA is affirmed. Small RNA pathways are implicated in both the silencing and licensing aspects of fem-1 regulation, and chromatin regulation may also play a role. This screen provides a foundation for testing models of possible mechanisms mediating the maternal-effect regulation of fem-1.

3.2 Introduction

The germ line is subject to unique forms of regulation because of distinctive characteristics of this tissue. During development, the germ line must be protected from adopting inappropriate cell fates to ensure that germ cells differentiate properly into gametes that can produce a totipotent cell upon fertilization. The germ line also contains many surveillance mechanisms which monitor for mutations or foreign genetic material. Mutations that may be tolerated in other tissues could be more severe in a germ cell since its DNA will be incorporated into every cell of a developing organism in the next generation. Most of the forms of regulation

101

specific to the germ line are restrictive. I have described a licensing process that allows the germ line expression of a gene only if that gene was expressed in the germ line of the previous generation.

fem-1 is a sex-determining gene in C. elegans whose expression is required for all aspects of male development (Doniach and Hodgkin 1984). Animals with no fem-1 activity develop as females. A zygotic contribution of fem-1 is sufficient for somatic male development in m-z+ XO heterozygotes (Doniach and Hodgkin 1984), but I have identified a maternal requirement for fem-1 RNA in spermatogenesis (Chapter 2). When females carrying an RNA-producing, but protein-null, allele of fem-1 such as the nonsense mutation fem-1(e2268) are crossed to wild-type males, their heterozygous progeny develop normally. In contrast, crosses with females homozygous for any of three deficiency alleles of fem-1, collectively termed fem-1(Df), produce m-z+ heterozygotes that show a feminization of the germ line (Fog) phenotype. The proportion of Fog animals produced is characteristic for each deficiency allele, and it can be reduced by providing in vitro-transcribed fem-1 RNA in the maternal germ line through microinjection. I proposed that it is the absence of maternal RNA in the germ line of fem-1(Df) homozygotes that leads to germ-line feminization in their progeny. Fog F1 animals have reduced fem-1 activity and decreased fem-1 transcript levels in the germ line, which could explain their feminization. Backcrossing affected m-z+ animals to fem-1(Df) females leads to an increased penetrance of the Fog phenotype with each generation of backcrossing, demonstrating that the reduction in fem-1 activity is heritable. From these observations, I concluded that fem-1 is heritably silenced in the zygotic germ line when there is no evidence of its maternal expression in the previous generation and that provision of maternal fem-1 RNA serves to promote zygotic expression of fem-1 by licensing its activity in the germ line.

The molecular mechanism of this form of regulation is of interest since it is unique as an example of RNA from a protein-coding gene being required to license its own expression. I suggested two kinds of possible models that are not mutually exclusive. Since the silencing of fem-1 is meiotically heritable, one model postulates that the fem-1 locus is targeted for chromatin modification that reduces its expression in the absence of maternal RNA; the licensing function of the RNA would serve to remove or counter these repressive marks. A second scenario envisions the production of silencing molecules such as small RNAs that interfere with fem-1 function and accumulate with each cross to a fem-1(Df) mother. Maternally provided fem-1

102

RNA could license fem-1 expression by inactivating these silencing molecules. Identification of genes that are involved in this maternal-effect regulation will help assess the validity of these models.

As an initial step in identifying genes that are required for the maternal-effect silencing and licensing of fem-1, I performed an RNAi screen to detect genes that modify the proportion of Fog animals produced in crosses to fem-1(Df) females. The models described above predict characteristics of genes that could be involved. Since maternal RNA is implicated, I tested a subset of genes encoding proteins that bind to, process or interact with RNA. Several of these genes are also involved in the regulation of small RNAs implicated in other germ-line silencing processes described below. To address the possibility of chromatin remodelling, I included genes encoding proteins that bind chromatin or are implicated in modifying histone tails or nucleosomes. Two of the complexes whose components were tested are the Nucleosome Remodeling Factor (NURF) complex and the NuA4/Tip60 complex. ISW-1 and NURF-1 suppress the synthetic multivulva phenotype of synMuv mutants, likely by contributing to formation of a NURF complex in C. elegans. By homology to ISW1 in D. melanogaster and Swi/Snf systems in Saccharomyces cerevisiae, the C. elegans NURF complex is predicted to regulate its targets through an ATP-dependent chromatin-remodelling activity (Andersen et al. 2006). C. elegans also contains homologs of components that have been biochemically copurified in the yeast NuA4 and mammalian Tip60 complexes. Mutations in these genes lead to a synMuv phenotype, probably by transcriptional activation through a MYST family histone acetyltransferase, though possibly through repression (Ceol and Horvitz 2004; Poulin et al. 2005). Several NuA4/Tip60 complex orthologs also behave as maternally required enhancers of ksr-1 lethality (the Ekl phenotype). ksr-1 is a kinase suppressor of Ras, and the NuA4/Tip60 Ekl genes probably regulate regulators of Ras signalling, possibly in conjunction with other Ekl genes involved in small RNA biogenesis or function (Rocheleau et al. 2008).

Since many other germ-line silencing mechanisms use overlapping components, I tested the requirement for genes involved in several forms of genetic regulation in the germ line. One silencing mechanism active in both the soma and the germ line is RNA interference. Double- stranded RNA acts as the trigger that leads to destruction of homologous mRNA molecules (Fire et al. 1998; Montgomery et al. 1998). The dsRNA trigger is cleaved by the nuclease DCR-1 to produce primary small interfering RNAs (siRNAs) that interact with Argonautes RDE-1 in the

103

exogenous RNAi pathway and ERGO-1 in the ERI (enhanced RNA interference) endogenous RNAi pathway (Ketting et al. 2001; Knight and Bass 2001; Yigit et al. 2006). Amplification by the action of RNA-directed RNA polymerases (RdRPs) produces abundant antisense secondary siRNAs targeting the mRNA (Aoki et al. 2007; Pak and Fire 2007; Sijen et al. 2007). The secondary siRNAs interact with other Argonaute proteins including SAGO-1 and SAGO-2. Members of the Argonaute family are characterized by a PAZ (Piwi, Argonaute, Zwille) domain that facilitates interactions with RNA and a PIWI domain that has slicing activity in many cases. In C. elegans, the family has expanded to include 24 functional members, several of which have been implicated in diverse small-RNA-mediated pathways. Members of the worm-specific expansion of the family carry mutations in the PIWI domain that are predicted to destroy its catalytic activity (Carmell et al. 2002; Yigit et al. 2006).

Several of the Argonautes have been associated with specific classes of small RNAs. ALG-1 and ALG-2 are required for the processing of microRNAs (miRNAs) that serve as translational regulators (Grishok et al. 2001). ALG-3 and ALG-4 are required for a subset of 26G-RNAs that are implicated in downregulation of mRNAs expressed in spermatogenesis (Han et al. 2009; Conine et al. 2010). The Piwi-related gene PRG-1 is essential for gametogenesis and accumulation of 21U-RNAs. Its paralog PRG-2 is dispensable for 21U-RNAs, but may play a partially redundant role with PRG-1 in fertility (Cox et al. 1998; Batista et al. 2008; Das et al. 2008; Wang and Reinke 2008). WAGO-1 associates with a subset of 22G-RNAs that target silenced regions of the genome, while CSR-1 works with other 22G-RNA cofactors from germ- line-expressed genes to facilitate chromosome segregation (Claycomb et al. 2009; Gu et al. 2009; van Wolfswinkel et al. 2009). Many of these processes are still poorly understood, and other Argonautes have yet to be associated with a particular process or phenotype. With my screen, I demonstrate a role for several Argonautes in the maternal-effect silencing or licensing of fem-1.

Several of the proteins required for RNAi are also involved in other forms of silencing in C. elegans, though each process also requires distinct additional genes. Several classes of transposons, including the abundant Tc1, are active in the soma, but not the germ line of the N2 Bristol isolate of C. elegans. The transposon silencing mechanism in the germ line involves transposon-derived dsRNAs. The siRNAs of Tc1 act at least partially post-transcriptionally, though a role for chromatin structure is suggested by a genome-wide screen for genes required

104

for transposon silencing (Sijen and Plasterk 2003; Vastenhouw et al. 2003). Mutations in genes required for this process often activate many kinds of transposons and lead to an increased rate of mutations (the Mut phenotype) because of transposon-induced mutagenesis (Ketting et al. 1999). (Note that a transposon-independent Mut phenotype can also be caused by defects in other genes guarding the genome against mutations, such as DNA repair genes (Pothof et al. 2003).) I tested genes involved in transposon silencing and other germ-line silencing processes to determine whether they are also involved in the maternal-effect regulation of fem-1.

RNAi genes are also implicated in the silencing of repetitive transgenic arrays in the C. elegans germ line. When transgenes are made by injecting DNA into the germ-line syncytium, they tend to form multicopy extrachromosomal arrays. A lower copy number of the transgene can be obtained by including more complex DNA, such as genomic DNA, in the injection mixture. The repetitive multicopy arrays are more susceptible to silencing in the germ line, possibly becaused of production of dsRNAs from transcriptional read-through on the array (Kelly et al. 1997). Chromatin regulation is also implicated in this case because mutations of the Polycomb-group-related maternal effect sterile (mes) genes required for X chromosome regulation also lead to desilencing of transgenes in the germ line (Kelly and Fire 1998). Some genes, including fem-1 and gld-1, are subject to an additional effect called cosuppression where a repetitive array leads to silencing not only of the transgene itself, but also of the corresponding endogenous locus (Jones and Schedl 1995; Gaudet et al. 1996). As with the other germ-line silencing processes involving repetitive DNA, both an RNA mediator and chromatin factors have been implicated in cosuppression (Dernburg et al. 2000; Robert et al. 2005). Condensin complexes required in regulating chromosome structure have also recently been implicated in RNAi and transgene silencing, and they coimmunoprecipitate with proteins that influence small RNA pathways, nucleosome positioning and histone tail modification (Dr. Kirsten Hagstrom, personal communication).

More direct evidence of transcriptional regulation is available for other gene silencing processes in C. elegans. With respect to RNAi, whereas silencing in C. elegans is not usually transmitted to progeny over several generations, long-term RNAi has been demonstrated for a subset of genes (Grishok et al. 2000; Vastenhouw et al. 2006; Alcazar et al. 2008). The original trigger molecules and RNAi components such as RDE-1 and RDE-4 are dispensable for the inheritance, but chromatin-related and histone-modifying proteins are required (Vastenhouw et

105

al. 2006). Another phenomenon was discovered when feeding an animal dsRNA with sequence from a commonly used vector led to transcriptional silencing of a somatic transgene with homology to that vector. The RNA-induced transcriptional gene silencing (RNAi-TGS) involves a decrease in acetylation of histones associated with the transgene and reduces pre-mRNA levels (Grishok et al. 2005). Several mechanisms of regulation specific to the germ line also involve transcriptional silencing. In the early embryo, PIE-1 functions to repress efficient transcription in the lineage that will produce the germ line (Seydoux et al. 1996). After degradation of PIE-1 in the germ cell precursors Z2 and Z3, repression is maintained by a global loss of activating nucleosomal histone modifications. Although nanos is usually associated with translational regulation, two of its C. elegans homologs, nos-1 and nos-2, are required for this germ-line- specific chromatin organization (Schaner et al. 2003). In addition to the regulation of repetitive DNA in the germ line, unpaired DNA is also targeted for silencing in C. elegans and other organisms (Kelly and Aramayo 2007). The male X chromosome lacking a pairing partner during meiosis in C. elegans is subject to H3K9 methylation (Bean et al. 2004), and a small RNA pathway is required for H3K9me2 accumulation on unpaired DNA in the germ line (She et al. 2009).

The involvement of germ-line-specific structures was also tested. The germ lines of many organisms contain large, nonmembranous ribonucleoprotein structures collectively termed germ granules. In C. elegans, these structures are called P granules. As reviewed by Seydoux and Braun (2006), these maternally inherited organelles exhibit similarities to germ granules in other organisms, though little is known about their function. Some of the P granules have a perinuclear organization and are predicted to sort or process mRNAs as they exit the nuclear membrane through pores; other P granules have a more dispersed localization. The P granules contain many RNAs and proteins involved in early development. Many of their components are predicted to act on RNA, including germ-line helicases (glh genes) related to the RNA helicase vasa (Gruidl et al. 1996). Another P granule constituent is PGL-1, a protein required for fertility and correct formation of P granules (Kawasaki et al. 1998).

My screen helps discern which of the genes involved in the processes and structures described above are also required for maternal-effect regulation of fem-1. The results inform the models of how this regulation may be mediated molecularly.

106

3.3 Materials and Methods 3.3.1 Nematode maintenance and alleles

Nematodes were cultured as described by Brenner (1974). Except for the RNAi screen, MYOB medium was used instead of NGM (Church et al. 1995). All experiments were conducted at 20°C, unless otherwise specified. The temperature-sensitive strain AS81 was maintained at 15°C. The N2 Bristol isolate served as the wild-type strain. Except as noted, the following mutations are described in Wormbase (http://www.wormbase.org/).

LG I: ppw-1(tm914), ppw-2(pk1673), prg-1(tm872), rde-2(ne221), sago-2(tm894), smg- 1(e1228), wago-1(ok1074), wago-2(ok1078)

LG II: C06A1.4(tm887), rha-1(tm329ts), wago-4(tm1019), wago-5(tm1113)

LG III: mut-7(pk204)

LG IV: dpy-20(e1282ts), fem-1(e1988ts) fem-1(e2268), fem-1(hc17ts), idDf1, idDf2, idDf3, mor-2(e1125), prg-2(tm1094), unc-5(e53), unc-24(e138)

LG V: him-5(e1490), rde-1(ne219), sago-1(tm1195) V

LG X: lon-2(e678), unc-7(e5)

3.3.2 C. elegans strains used

The C. elegans strains used for the experiments in this chapter are listed in Table 3-1. Mutant alleles are available for a subset of the genes that acted as modifiers of the Fog phenotype in the RNAi screen. I obtained the following strains from the Caenorhabditis Genetics Centre: NL2557 ppw-1(pk1425) I, NL5117 ppw-2(pk1673) I, RB1096 wago-1(ok1074) I, RB1099 wago-2(ok1078) I, VC799 prg-2(ok1328) IV, WM126 sago-2(tm894) ppw-1(tm914) I; C06A1.4(tm887) wago-4(tm1019) II; M03D4.6(tm1144) IV; sago-1(tm1195) V, WM161 prg- 1(tm872) I, WM162 prg-2(tm1094) IV. The allele wago-5(tm1113) in strain FX1113 (provided by Dr. S. Mitani) was outcrossed to N2 six times to produce strain AS571 from which the strains

107

used in this study were generated. Using strain AS63, I incorporated the smg-1(e1228) mutation into AS375 to make AS468 with idDf1 and into AS377 to make AS469 with fem-1(e2268).

For each gene, I built strains that carried balanced fem-1(e2268), idDf1 or idDf2 alleles and were homozygous for the mutation to be tested (AS533 to AS589). For example, AS566 is rha-1(tm329ts) II; fem-1(e2268) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X. The deletion alleles were tracked using PCR genotyping as described below. There were two cases of double mutations: the strains with ppw-1(tm914) likely also contain sago-2(tm894), and some of the strains with wago-4(tm1019) also have a deletion of the predicted pseudogene, C06A1.4(tm887). Dr. Andrew Spence recombined the prg-2 alleles onto chromosomes with fem- 1 mutations, and he built the prg-1, prg-2, rde-2 and mut-7 mutation-containing strains. Homozygous mutant stocks with males were produced by heat-shocking L4 XX animals at 30°C for six hours to increase the frequency of X-chromosome non-disjunction and backcrossing the generated males to homozygous hermaphrodites.

Table 3-1: C. elegans strains and their genotypes. Strain name Genotype AS63 smg-1(e1228) I AS81 fem-1(e1988ts) mor-2(e1125) IV AS375 idDf1 unc-24(e138)/nT1dm IV; + / nT1dm V; lon-2(e678) X AS377 fem-1(e2268) unc-24(e138)/nT1dm IV; + / nT1dm V; lon-2(e678) X AS378 idDf1 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS379 idDf2 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS380 fem-1(e2268) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS468 smg-1(e1228) I; idDf1 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc- 7(e5) X AS469 smg-1(e1228) I; fem-1(e2268) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS507 unc-24(e138) fem-3(e1996)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS518 fem-1(hc17ts) IV; him-5(e1490) V AS532 idDf2 mor-2(e1125)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS533 idDf2 mor-2(e1125)/unc-5(e53) dpy-20(e1282ts) IV; rde-1(ne219) V; unc- 7(e5) X

(Table 3-1 continues on the next page.)

108

Strain name Genotype AS534 fem-1(e2268) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; rde-1(ne219) V; unc-7(e5) X AS535 unc-5(e53) dpy-20(e1282ts) IV; rde-1(ne219) V AS538 rde-2(ne221) I; idDf2 mor-2(e1125)/unc-5(e53) dpy-20(e1282ts) IV; unc- 7(e5) X AS539 mut-7(pk204) III; idDf2 mor-2(e1125)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS540 rde-2(ne221) I; fem-1(e2268) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS541 mut-7(pk204) III; fem-1(e2268) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS542 rde-2(ne221) I; idDf1 mor-2(e1125) unc-24(e138)/unc-5(e53) dpy- 20(e1282ts) IV; unc-7(e5) X AS543 mut-7(pk204) III; idDf1 mor-2(e1125) unc-24(e138)/unc-5(e53) dpy- 20(e1282ts) IV; unc-7(e5) X AS545 prg-1(tm872) I; idDf1 mor-2(e1125) unc-24(e138)/unc-5(e53) dpy- 20(e1282ts) IV; unc-7(e5) X AS546 prg-1(tm872) I; idDf2 mor-2(e1125)/unc-5(e53) dpy-20(e1282ts) IV; unc- 7(e5) X AS547 unc-5(e53) prg-2(tm1094) IV AS548 unc-5(e53) prg-2(ok1328) IV AS550 sago-2(tm894) ppw-1(tm914) I; fem-1(e2268) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS551 sago-2(tm894) ppw-1(tm914) I; idDf1 unc-24(e138)/unc-5(e53) dpy- 20(e1282ts) IV; unc-7(e5) X AS552 sago-2(tm894) ppw-1(tm914) I; idDf2 unc-24(e138)/unc-5(e53) dpy- 20(e1282ts) IV; unc-7(e5) X AS553 wago-4(tm1019) II; fem-1(e2268) unc-24(e138)/unc-5(e53) dpy- 20(e1282ts) IV; unc-7(e5) X AS554 C06A1.4(tm887) wago-4(tm1019) II; idDf1 unc-24(e138)/unc-5(e53) dpy- 20(e1282ts) IV; unc-7(e5) X AS555 wago-4(tm1019) II; idDf2 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS560 ppw-2(pk1673) I; idDf2 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS561 ppw-2(pk1673) I; idDf1 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS562 ppw-2(pk1673) I; fem-1(e2268) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS566 rha-1(tm329ts) II; fem-1(e2268) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS567 rha-1(tm329ts) II; idDf1 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X

(Table 3-1 continues on the next page.)

109

Strain name Genotype AS568 rha-1(tm329ts) II; idDf2 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS571 wago-5(tm1113) II AS572 prg-1(tm872) I; fem-1(e2268) unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS576 C06A1.4(tm887) wago-4(tm1019) II; unc-24(e138) fem-3(e1996)/unc- 5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS577 wago-5(tm1113) II; unc-5(e53) dpy-20(e1282ts) IV AS578 wago-5(tm1113) II; fem-1(e2268) unc-24(e138)/unc-5(e53) dpy- 20(e1282ts) IV; unc-7(e5) X AS579 wago-5(tm1113) II; idDf1 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS580 wago-5(tm1113) II; idDf2 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS582 wago-2(ok1078) I; fem-1(e2268) unc-24(e138)/unc-5(e53) dpy- 20(e1282ts) IV; unc-7(e5) X AS583 wago-2(ok1078) I; idDf1 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS584 wago-2(ok1078) I; idDf2 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS586 wago-1(ok1074) I; fem-1(e2268) unc-24(e138)/unc-5(e53) dpy- 20(e1282ts) IV; unc-7(e5) X AS587 wago-1(ok1074) I; idDf1 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS588 wago-1(ok1074) I; idDf2 unc-24(e138)/unc-5(e53) dpy-20(e1282ts) IV; unc-7(e5) X AS571 wago-5(tm1113) [outcrossed to N2 six times] FX1113 wago-5(tm1113) [not outcrossed] N2 Bristol strain Wild type NL2557 ppw-1(pk1425) I NL5117 ppw-2(pk1673) I RB1096 wago-1(ok1074) I RB1099 wago-2(ok1078) I VC799 prg-2(ok1328) IV WM126 sago-2(tm894) ppw-1(tm914) I; C06A1.4(tm887) wago-4(tm1019) II; M03D4.6(tm1144) IV; sago-1(tm1195) V WM161 prg-1(tm872) I WM162 prg-2(tm1094) IV

110

3.3.3 Genotyping of strains carrying deletion alleles

During strain building with certain deletion alleles, it was sometimes necessary to genotype cloned animals using single-worm PCR. Using a molecular assay was possible because the alleles were deletions and was necessary in cases where the deletion did not produce an overt phenotype. I designed primer sets that could detect both the deletion and wild-type alleles in the same reaction. The 20 µl PCR reactions contained 10.3 μl water, 2 µl 10X buffer

(0.5M KCl, 0.1M Tris-HCl [pH 8.3], 1M MgCl2, 0.01% gelatin), 2 µl of 2mM dNTPs, 1 µl of 10µM external forward primer, 1 µl of 10µM external reverse primer, 1 µl of 10µM internal forward primer, 0.2 µl of Taq DNA polymerase (New England Biolabs), 2.5 µl of single-worm lysate. PCR program: 95°C 5’, 40 cycles of (95°C 30s, 64°C 45s, 72° 1’), 72°C 5’, hold at 4°C. The expected product sizes are listed in Table 3-2, and the primer sequences are provided in Table 3-3.

In cases where the mutant allele also produces a phenotype, alternative methods for detecting homozygotes were sometimes employed. For instance, the Rde phenotype of ppw- 1(tm914) permits selection of mutant homozygotes by virtue of their resistance to RNAi. When subjected to RNAi targeting pop-1, animals with a wild-type ppw-1 allele will die, but ppw- 1(tm914) homozygotes will survive.

Before diagnostic primers could be designed for wago-1(ok1074) and wago-2(ok1078), I first sequenced these alleles since the breakpoint information was not available on Wormbase. Using lysates from individual females, I amplified several PCR products using a combination of the in_f, in_b, ex_f, ex_b primers for ok1074 and ok1078. The PCR fragments were purified using a Qiaquick PCR purification kit (Qiagen) and sent for sequencing at The Centre for Applied Genomics at the Hospital for Sick Children in Toronto, Ontario. The primers in_f, in_b, InR2 and InF2 primers for ok1074 and ok1078 were used for sequencing. ok1074 is a 1671bp deletion between positions 7236159 and 7237831 on chromosome I. ok1078 is a 1008bp deletion between positions 5368540 and 5369548 on chromosome I accompanied by an insertion of ACTCTGCACAAAAGTGTCACTGCA.

111

Table 3-2: PCR product sizes for genotyping deletion alleles. Size of PCR product (bp) Deletion Wild type Wild type Gene Allele Chromosome ExF-ExB InF-ExB ExF-ExB a C06A1.4 tm887 II 173 159 770 drh-3 tm1217 I 344 398 826 ergo-1 tm1860 V 1088 675 2246 fem-1 idDf1 IV 599 366 14472 fem-1 idDf2 IV 497 558 7345 mys-2 ok2429 I 611 544 2779 ppw-1 tm914 I 438 322 842 ppw-2 pk1673 I 323 422 3464 prg-1 tm872 I 346 493 986 prg-2 tm1094 IV 259 686 1297 rha-1 tm329 II 407 563 1466 wago-1 ok1074 I 340 529 2012 wago-2 ok1078 I 595 443 1558 wago-4 tm1019 II 307 571 875 wago-5 tm1113 II 416 384 1006

a This larger product is often not detected since it is outcompeted by the smaller wild-type band for the InF to ExB product.

Table 3-3: Primers used for genotyping deletion alleles. Primer name Primer sequence (5’ to 3’) idDf1_ExF GAGGATGAAGCAGCAGATTG idDf1_ExR CGGTATGACACCAAATGGAC idDf1_InR GTATCTTGGACTGAAGTCTGAC idDf2_ExF CAACTGACACATCCTGTTCAG idDf2_ExR TCAAGTGGAACCGTCTCATC idDf2_InR AGCTCAGAGAATGCAGGTTC ok247_Ex_B_CJ CGCTTATTCTGTGTGTCCATAG ok247_Ex_F_CJ GTCGATCAACGGTACATTGCA ok247_In_F_CJ CTGCTCTTACTACTTCCAATGC ok1074_ex_f GCTCCACCAGGAGCTATGAC ok1074_ex_b AAATCGAACAAAATTCCCCC ok1074_in_f TGTACATGAAGCCAACCGAA ok1074_In_F3_CJ CCAAGGGACAACTCTATCAC ok1074_In_F4_CJ AGAGATTGACGTTGGAGAAC ok1074_in_b CGGTTTGTTTGTAGCCGATT ok1074_In_R2_CJ GGTAACTGTGCTCCTTAGTG

(Table 3-3 continues on the next page.)

112

Primer name Primer sequence (5’ to 3’) ok1078_ex_f GAAAGCCAATAACTCGAGCG ok1078_ex_b ACGAACATCAGGAAGAACCG ok1078_in_f GGCAGACTTGCATCCATTTT ok1078_In_F2_CJ CATTCATCCAAATCCACCCTAC ok1078_in_b AATTGTTGTTGCCTCGATCC ok1078_In_R3_CJ TGGCATCCAGTTCTGAGAAC ok1078_In_R4_CJ TCTCAACCTGCAAATAGGAC ok1328_b [prg-2] GGCTCGATAACGAAATCACC ok2429_Ex_B_CJ AGCGCCTATCGTTATTTGTGGT ok2429_Ex_F_CJ CGCACCAAAGATGCAAACTGTC ok2429_In_F_CJ GTAGTGTATAGCCTCAACCAAC pk1673_Ex_B_CJ TGCACGTAGGATGAGCCAGAAC pk1673_Ex_F_CJ TTCCGGTTCCGACTCTTCCTGT pk1673_In_F_CJ TCGATTCCAACGCCACTGTATG tm329_Ex_B_CJ TCCGCATGTTTCTCCAACTTC tm329_Ex_F_CJ CGTGCTACTTGGGAAATCAGT tm329_In_F_CJ TCAACGAAACGAGTGCAACTC tm872_f AAGTTGTGGACAGCGAAGC tm872_b CTCTGAAGGAAAGCCAAAGC tm872_2del AGCCTCCTCTGGAAAAATGG tm887_Ex_B_CJ GGCATAACAGCACTTTCTTTAGTG tm887_Ex_F_CJ AGACGTAGCAAGACGAGCTTCT tm887_In_F_CJ TTCGCTACCCAGGCGCAAAC tm914_Ex_B_CJ TGTGCTGAAACCTCTGAACGT tm914_Ex_F_CJ TGAGGCGATCAAGCGTTACGA tm914_In_F_CJ ACCTCATCGACCCAACTGTAGT tm1019_Ex_B_CJ AACATAGTTGGAACCTCCCAAC tm1019_Ex_F_CJ CACTCTTCGCTATCCAGACA tm1019_In_F_CJ TTGGCAAACGCTGAAATTGGAG tm1094_f TTGAAGTGTCCTACCAAGATTACG tm1094_b GCGACAACCAAGCGTTACC tm1113_Ex_B_CJ TGGGATGTTCATCTCTGTCGCT tm1113_Ex_F_CJ ATTCTCCGTTAGTGACCTGAG tm1113_In_F_CJ CCTTCAGGACAGGATGTAAGAA tm1217_Ex_B_CJ CACGTTCTTTCTCTCGTTCT tm1217_Ex_F_CJ TGTTCGATGAGAAGGGACTCA tm1217_In_F_CJ GCTGTGAAGAAATGGAGTCTTC tm1860_iF ACCCGAGCTTCCGGATGTGT tm1860_iR TCTCGGTGGATCATGAGTAA tm1860_delF CTCAGAGCATGTAATGTTTCC

113

3.3.4 Preparing strains from the RNAi feeding library

For each of the genes to be tested, bacteria containing a plasmid with DNA from the candidate gene were streaked out from the Medical Research Council (MRC) Geneservice RNAi feeding library on LB plates with 50µg/ml tetracycline and 50µg/ml ampicillin (Fraser et al. 2000; Kamath et al. 2003). Individual colonies were patched to new plates and tested for the presence of the desired plasmid using a diagnostic PCR assay with the Research Genetics GenePairs primers, which can be found on Wormbase. If no positive colonies were obtained from the library, a new strain was produced by amplifying N2 genomic DNA with the Research Genetics GenePair primers. The resulting PCR product was ligated into a T-tailed version of the L4440 vector digested with EcoRV and transformed into HT115(DE3) cells (Timmons et al. 2001) as described by Fraser and colleagues (2000). The primers were given systematic names corresponding to the gene in question (e.g. oAS_RNAi_drp-1_F for sjj_T12E12.4_f). If Research Genetics GenePair primers did not exist for a desired gene, then the Cenix BioScience primers (Sonnichsen et al. 2005) were used. Information about the reagent used to target each gene is reported in Table 3-4. Stephanie Renihan helped build some of the RNAi constructs.

Table 3-4: Genes targeted by RNAi in a screen for modifiers of the Fog phenotype. Gene name Sequence name RNAi reagenta Predicted secondary targetb (alternates)

Argonautes alg-1 F48F7.1 X-6D15 None alg-2 T07D3.7 II-1F05 alg-1 alg-3 T22B3.2 IV-6A22 ZK757.3 alg-4 ZK757.3 III-5E16 T22B3.2 C04F12.1 C04F12.1 pAS#CJ62 None C06A1.4 C06A1.4 II-7K08 wago-4 C14B1.7 C14B1.7 n.d. (III-1J04)c -see wago-9 csr-1 F20D12.1 IV-4E01 None ergo-1 R09A1.1 V-1F11 None F55C9.3 F55C9.3 V-12L07 None M03D4.6 M03D4.6 IV-3I13 None nrde-3 (wago-12) R04A9.2 X-1A17 None

(Table 3-4 continues on the next page.)

114

Gene name Sequence name RNAi reagenta Predicted secondary targetb (alternates)

Argonautes (continued) ppw-1 (wago-7) C18E3.7 I-1H24 F56A6.1 ppw-2 (wago-3) Y110A7A.18 I-2C14 None prg-1 D2030.6 I-3B24 prg-2 prg-2 C01G5.2 IV-3O11 prg-1 rde-1 K08H10.7 V-6P22 None sago-1 (wago-8) K12B6.1 V-4L13 None sago-2 (wago-6) F56A6.1 n.d. (I-1G11)c -see ppw-1 T23D8.7 T23D8.7 I-5C01 None ZK218.8 ZK218.8 V-11O20 None wago-1 R06C7.1 I-3F21 wago-2, wago-5 wago-2 F55A12.1 I-2K14 wago-1, wago-5 wago-4 F58G1.1 n.d. (II-8D07)c -see C06A1.4 wago-5 ZK1248.7 pAS#CJ18 wago-2, wago-1 wago-9 C16C10.3 III-2E11 C14B1.7 wago-10 T22H9.3 pAS#CJ22 None wago-11 Y49F6A.1 pAS#CJ23 None

RNAi and small RNA-related cde-1 (cid-1, pup-1) K10D2.3 III-2P05 None dcr-1 K12H4.8 III-4C08 None drh-1 F15B10.2 IV-3C14 drh-2 drh-2 C01B10.1 IV-3C18 drh-1 drh-3 (ekl-3) D2005.5 I-3H24 None ego-1 (ego-6) F26A3.3 I-3D18 None ekl-1 F22D6.6 I-3B03 None eri-1 T07A9.5 IV-1I21 None mut-2 (rde-3) K04F10.6 I-3E07 None mut-7 ZK1098.8 pAS#CJ17 None mut-14 C14C11.6 V-4I12 ZC317.1 mut-15 T01C3.8 V-9F02 None mut-16 (rde-6, pqn-3) B0379.3 I-5E09 None pir-1 T23G7.5 II-6H21 None pup-2 K10D2.2 III-2P03 T08B2.2, R07H5.11, B0391.8 rde-2 (mut-8) F21C3.4 I-3H23 None rde-4 T20G5.11 III-5B15 None rde-8 ZC477.5 IV-3B19 None rha-1 T07D4.3 II-6M24 None rrf-1 F26A3.8 I-6C23 rrf-2 rrf-2 M01G12.12 pAS#CJ61 rrf-1

(Table 3-4 continues on the next page.)

115

Gene name Sequence name RNAi reagenta Predicted secondary targetb (alternates)

NuA4/Tip60 complex ekl-4 Y105E8A.17 I-7O05 None epc-1 Y111B2A.11 III-6I14 None gfl-1 M04B2.3 IV-6K13 None mrg-1 Y37D8A.9 III-6M24 None mys-1 VC5.4 V-5I09 None ssl-1 (pqn-81) Y111B2A.22 pAS#CJ21 None trr-1 C47D12.1 II-7N20 None

NURF complex isw-1 F37A4.8 III-3F15 None nurf-1 F26H11.2 II-9K09 None pyp-1 C47E12.4 IV-5M21 None rba-1 K07A1.11 I-4D12 None

Other chromatin-related factors cir-1 F55F8.4 I-2H23 None egl-27 C04A2.3 II-5A24 None hda-1 (gon-10) C53A5.3 V-9F11 None hda-2 C08B11.2 II-5N08 None hda-3 R06C1.1 I-6A01 None hda-4 (hda-7) C10E2.3 pAS#CJ15 None hil-4 C18G1.5 V-3H12 None his-24 (HH1) M163.3 X-6B12 None hpl-1 K08H2.6 X-6O19 None hpl-2 K01G5.2 III-5B02 Y46G5A.17, Y49C4A.6 lin-35 C32F10.2 I-2N15 None mes-3 F54C1.3 I-2A04 None mes-6 C09G4.5 IV-4I12 None met-2 R05D3.11 III-4O24 None mys-2 K03D10.3 pAS#CJ19 None set-1 T26A5.7 III-3O08 None set-2 C26E6.9 III-2H09 None sin-3 (pqn-28) F02E9.4 I-4K03 None sop-2 C50E10.4 II-8A20 None T09A5.8 T09A5.8 II-5J06 None tam-1 F26G5.9 V-4A07 None zfp-1 (zpf-1) F54F2.2 III-4P17 F02E9.8, W09C3.8

(Table 3-4 continues on the next page.)

116

Gene name Sequence name RNAi reagenta Predicted secondary targetb (alternates)

Germ line nos-1 R03D7.7 II-7H23 None pgl-1 ZK381.4 IV-3M20 None puf-5 F54C9.8 II-6A20 None puf-6 F18A11.1 II-8F21 None puf-7 B0273.2 IV-2J22 puf-6, puf-10 drp-1 operon drp-1 T12E12.4 IV-2L12 None T12E12.1 T12E12.1 IV-2L06 None T12E12.2 T12E12.2 IV-2L08 None T12E12.3 T12E12.3 IV-2L10 R06A4.2

Other C35D6.3 C35D6.3 IV-7N06 None capg-2 F55C5.4 V-8A10 None dpy-27 R13G10.1 III-1L16 None kle-2 C29E4.2 III-4M11 None pqn-29 F10F2.9 III-2G20 None smc-4 F35G12.8 III-2E18 None smg-1 (mab-1) F28B3.7 I-3K02 None smg-2 (mab-11) Y48G8AL.6 pAS#CJ20 None smg-5 (mab-15) W02D3.8 I-3E08 None T05E8.3 T05E8.3 I-2B09 None a MRC Geneservice ID code or Spence laboratory plasmid name b Secondary targets as predicted on Wormbase (http://www.wormbase.org) c n.d. (RNAi reagent) indicates that the gene was not targeted using the Geneservice reagent shown in brackets. Instead, RNAi against a closely related gene was predicted to target both genes.

117

3.3.5 RNAi screening of fem-1/+ m-z+ animals

Bacteria from an overnight liquid culture were seeded onto NGM plates with carbenicillin and IPTG for induction to produce double-stranded RNA. This was done in accordance with the optimal protocol reported by Kamath et al. (2000) with the modification that closer to 200µl of bacteria were seeded rather than 50µl. Rather than rinsing the animals with M9 buffer, they were initially transferred to unseeded plates for about 5 minutes before transfer to RNAi plates. Putative females (non-Dpy XX animals from fem-1(t) unc-24/unc-5 dpy-20; unc- 7, where t = e2268, idDf1, idDf2; or non-Dpy XX animals from unc-24 fem-3/unc-5 dpy-20; unc- 7) were transferred as L4s to the RNAi plates on day 1. After 36 hours, a cross was set up on fresh RNAi plates using one (for e2268 and idDf1) or two (for idDf2) females and six N2 males. The parents were removed on day 4, and the progeny were scored for the Fog phenotype on days 6 and 7. Only XX animals were scored after preliminary screening suggested that some effects were detectable in XX animals, but not in XO animals. Males tend to be more resistant to RNAi treatment (Timmons et al. 2001). In parallel, the progeny of N2 L4 XX animals exposed to the same RNAi treatment were monitored for germ-line feminization or phenotypes impairing the ability to assess the sex of the germ line. To confirm the effectiveness of RNAi induction, death of animals growing on pop-1 RNAi was observed during each round of screening.

3.3.6 Statistics for the RNAi screen

For each cross, the percentage of Fog XX progeny was calculated from the day 6 and 7 data. In some cases, ‘N’ (normal) was recorded if visual inspection detected no difference between the RNAi-treated animals and a control cross on bacteria carrying the empty L4440 vector. In each round of screening, at least two crosses were performed for a given RNAi treatment and allele. The average percentage of Fog progeny from these crosses was recorded as a data point. Data were gathered from at least two rounds of screening for all ‘N’ treatments and at least three rounds where statistics are reported. The mean percentage of Fog animals produced from test and control RNAi treatments were compared using a Student’s t-test that did not assume equal variances. I considered significant only those treatments statistically different from the control at a p-value < 0.05 using the Student’s t-test and where the means of the control and treatment differed by one or more standard deviations (see Table 3-7).

118

3.3.7 RNAi screening of temperature-sensitive fem-1 alleles

As described above, bacteria were seeded on NGM plates with carbenicillin and IPTG which induces transcription from a plasmid containing the gene from which double-stranded RNA will be produced. The next day, L4 animals from fem-1(hc17ts) or fem-1(e1988ts) strains were rinsed with M9, and two L4s were transferred to each RNAi plate. Progeny were scored for signs of feminization four to six days later. The sex of the germ line was recorded for XX animals. Using Nomarski microscopy on a Nikon FxA MicroPhot microscope, male development of the germ line was assessed. During each round of RNAi, at least two plates per gene were scored, and the average of the percentage of Fog XX animals was recorded. The mean value and standard error for each gene was calculated from at least three separate rounds of RNAi. Each RNAi treatment was compared to the empty vector control by using a Student’s t- test.

3.3.8 Measuring the effect of candidate gene mutations on inheritance of the Fog phenotype

As described above, I built strains AS533 to AS589 each carrying a balanced fem- 1(e2268), idDf1 or idDf2 allele and homozygous for one of the mutations to be tested. Males mutant (Series VI in Figure 3-5) or wild-type (Series VII in Figure 3-5) for the tested gene were crossed to females homozygous for one of the fem-1 alleles and the gene of interest. The Fog phenotype of at least 50 progeny was scored over two to three days, and the average percentage of Fog animals was calculated for each cross. The mean and standard error from at least three crosses are reported. For prg-1 crosses, sometimes there were only 25 animals whose germ-line sex could be scored because of sterility and lethality associated with the mutation, and it altogether prevented the scoring of idDf2/+ m-z+ progeny.

3.3.9 Testing the effect of a smg-1 mutation on inheritance of the Fog phenotype

I built strains with the genotype smg-1 I; fem-1(y) unc-24/unc-5 dpy-20 IV; unc-7 X, where y = e2268 or idDf1. The fem-1 genotype of the idDf1-containing animals was confirmed

119

by PCR. Individual females from these strains were crossed to N2 males. The parents were

removed after three days, and the Fog phenotype of the F1 animals (smg-1/+; fem-1 unc-24/+; unc-7/[+ or O]) was scored. For the crosses involving idDf1, individual Unc, female self-

progeny ([smg-1 or +]/[smg-1 or +]; idDf1; unc-7) of the F1 XX animals were crossed to N2

males. After the Fog phenotype of the F3 animals was assessed, eight hermaphrodites per cross were cloned to new plates. By progeny testing these F3 animals for the protruding vulva (Pvu)

phenotype associated with smg-1 homozygotes, the smg-1 genotype of their F2 progenitors was determined.

3.3.10 RNA injection of rde-1 animals

AS#1000 plasmid DNA linearized with BamHI was in vitro transcribed using T7 RNA polymerase (Roche) according to the manufacturer’s instructions to produce sense fem-1 RNA. Template DNA was removed by treatment with DNaseI (Ambion). Transcripts were purified following electrophoresis on a non-denaturing agarose gel using Bio 101 Systems’ RNaid Spin Kit. At least two separate RNA preparations were used for injection. Injection mixes contained 100 nM RNA and 0.125% Lucifer Yellow dye to permit monitoring of the injection.

RNA injection into the germ line of idDf2 unc-24; unc-7 or idDf2 mor-2; unc-7 or idDf2 mor-2; rde-1; unc-7 females was performed as previously described. Females were crossed to wild-type or rde-1 males and transferred to new plates daily. Cross-progeny born 16-40 hours after injection were scored for the Fog phenotype when they reached adulthood. The offspring of at least 20 injected females were scored for each genotype. Plates containing fewer than 15 animals were omitted. Injected animals were assigned to bins according to whether they produced ≤25%, 26-50%, 51-75%, or >75% Fog progeny during the period scored. The bin distribution of injected and uninjected animals of each genotype was compared using the Mann- Whitney U test. These animals were also compared with the progeny of uninjected fem-1(e2268) unc-24; rde-1; unc-7 females crossed to rde-1 or wild-type males. The average and standard error for the percentage of Fog progeny produced from three crosses are reported.

120

3.3.11 RNA isolation and quantification

Total RNA was collected from adult N2, e2268, idDf1 and idDf2 animals. RNA was isolated from 50 adult worms per sample using Trizol reagent according to the manufacturer’s specifications. 1 µg of RNA was used as a template for cDNA synthesis with a Superscript First Strand cDNA Synthesis kit (Invitrogen). 5 µl of 5-, 25-, and 125-fold dilutions of cDNA served as a template for PCR in a 50 µl reaction with 200 µM dNTPs, 0.4 µM of each primer, and 2.5 units of Taq DNA polymerase (NEB) in ThermoPol buffer (NEB). The PCR reaction consisted of 30 cycles of 95°C for 30s, 55°C for 30s, and 72°C for 1 minute, followed by a final 5 minute extension at 72°C. Half of each reaction was loaded on a 2.5% agarose TAE gel. PCR product “volumes” on images with no saturated pixels were measured using Quantity One software (BioRad) with local background substraction. The level of T12E12.2 transcripts in each sample was normalized to the geometric mean of the intensities of the control genes pgk-1, him-3 and mex-3. The samples were then compared with transcript levels in the wild-type sample.

3.4 Results 3.4.1 RNAi screen of candidate genes as modifiers of the Fog phenotype

To investigate the molecular mechanism of the licensing function of maternal fem-1 RNA and the silencing of fem-1 activity in the absence of that RNA, I used an RNAi screen to assess the involvement of candidate genes in these processes. Because of the nature of the screen and scoring, a genome-wide RNAi screen is not feasible. Many of the genes were selected for the screen because their involvement was suggested by our models, as described above. Table 3-5 illustrates the categories of candidates included such as the Argonaute proteins, those with chromodomains or histone modification activities, and proteins that bind and process RNAs involved in several pathways mediated by small RNAs in C. elegans. Also indicated is the involvement of the candidate genes in known silencing processes including RNAi, RNAi- induced transcriptional gene silencing, transposon silencing, transgene silencing and cosuppression. Although some of these genes are required for a functional germ line, I reasoned that it may nevertheless be possible to test their effect in this type of assay since RNAi often only partially reduces gene function.

121

Table 3-5: Molecular and phenotypic characterization of genes screened by RNAi. Gene Function and domains RNAi Trans- Cosup- Transgene Other References poson pression silencing phenotypes silencing Argonautes alg-1 Intact catalytic residues in PIWI G01, G05, + + RNAi-TGS domain; miRNA processing R05, V06, Y06 alg-2 Intact catalytic residues in PIWI G01, G05, + + domain; miRNA processing R05, V06, Y06 alg-3 Associated with 26G-RNAs which may G05, R05, downregulate spermatogenesis- + + V06, Y06, associated mRNAs Co10 alg-4 Associated with 26G-RNAs which may V05, G06, downregulate spermatogenesis- + Y06, Co10 associated mRNAs C04F12.1 Intact catalytic residues in PIWI Soma Soma K05, V06, Y06 domain, no PAZ domain C06A1.4 Pseudogene Y06 See related wago-4 C14B1.7 PIWI catalytic residues mutated G05, R05, + + - V06, Y06 csr-1 Interacts with 22G-RNAs to regulate Ekl, R05, V06, holocentric chromosome formation and disrupts P Y06, R08, Germ line + - H3K9me2 during meiosis granules, C09, S09, Him, Ste VW09, Wa09

122

Gene Function and domains RNAi Trans- Cosup- Transgene Other References poson pression silencing phenotypes silencing Argonautes (continued) ergo-1 Analogous to RDE-1 for endo-RNAi; R05, V06, required for class II 26G-RNAs Eri (Class Y06, H09, + II) Pa09, Ge10, Va10 F55C9.3 PAZ domain; Argonaute-related nrde-3 Binds cytoplasmic siRNAs; R05, V06, redistributes for nuclear RNAi + + Y06, G08, Ge09 ppw-1 PIWI catalytic residues mutated, ~Germ T02, G05, + MAGO line R05, V06, Y06 ppw-2 PIWI catalytic residues mutated V03?, R05, + - - V06, Y06 prg-1 Required for 21U-RNAs involved in C98, G05, germ line; may regulate Reduced R05, V06, + + + spermatogenesis and Tc3 transposon fertility Y06, B08, D08, W08 prg-2 May be partially redundant with prg-1 C98, G05, for fertility; not required for 21U-RNAs R05, V06, + + Y06, B08, D08, W08 rde-1 Interacts with trigger-derived primary T99, G05, siRNAs in production of secondary Soma, + + Soma RNAi-TGS K05, R05, siRNAs; interacts with DCR-1 , RDE-4, Germ line D06, V06, Y06 helicases

(Table 3-5 continued)

123

Gene Function and domains RNAi Trans- Cosup- Transgene Other References poson pression silencing phenotypes silencing Argonautes (continued) sago-1 PIWI catalytic residues mutated, Soma Soma K05, V06, Y06 interacts with secondary siRNA sago-2 PIWI catalytic residues mutated, Soma, V06, Y06 interacts with secondary siRNA Germ line T23D8.7 PIWI catalytic residues mutated G05, R05, + + V06, Y06 wago-1 Interacts with germ-line 22G-RNAs G05, R05, associated with gene silencing + + RNAi-TGS V06, Y06, G09, Co10 wago-2 PIWI catalytic residues mutated G05, R05, + V06, Y06 wago-4 PIWI catalytic residues mutated, Soma, + R05, V06, Y06 MAGO Germ line wago-5 PIWI catalytic residues mutated, no G05, R05, + + PAZ domain V06, Y06 wago-9 PIWI catalytic residues mutated + + R05, V06, Y06 wago-10 PIWI catalytic residues mutated + + R05, V06, Y06 wago-11 PIWI catalytic residues mutated + V06, Y06 ZK218.8 Argonaute-related, no PAZ domain + R05, V06, Y06

(Table 3-5 continued)

124

Gene Function and domains RNAi Trans- Cosup- Transgene Other References poson pression silencing phenotypes silencing RNAi and small RNA-related cde-1 Germ-line-specific ~Germ R05, V06, nucleotidyltransferase required for - - Him line K07, C09, V09 uridylation of siRNAs sorted to CSR-1 dcr-1 dsRNA endonuclease involved in G01, Ke01, RNAi, miRNA and some endo-siRNA Kn01, G05, Soma, RNAi-TGS; processing and germ-line development Soma K05, R05, Rare Eri ~ some alleles Germ line L06, V06, allele ts-Ste, Him Y06, Pa09, Ge10, Va10 drh-1 Dicer-related RNA helicase; interacts T02, K05, Soma, Soma with DCR-1, RDE-1, RDE-4 + R05, D06, Germ line Germ line V06, E07 drh-2 Dicer-related RNA helicase Soma, + T02, R05 Germ line drh-3 Dicer-related RNA helicase required for T02, D06, germ-line development, CSR-1 22G- ~Soma, Ekl, ts-Ste, E07, N07, - RNAs and H3K9me2 in meiosis Germ line Him R08, C09, G09, S09 ego-1 Germ-line-specific RdRP required for S00, G05, RNAi, P granules and H3K9me2 on M05, R05, unpaired DNA during meiosis Germ line + Ekl, Ste V05, V06, R08, C09, S09, V09 ekl-1 Contains tudor domain; involved in K05, R05, Soma, Soma biogenesis of 22G-RNAs and possibly + - Ekl, Ste V06, R08, Germ line Germ line others G09, C09, S09

(Table 3-5 continued)

125

Gene Function and domains RNAi Trans- Cosup- Transgene Other References poson pression silencing Phenotypes silencing RNAi and small RNA-related (continued) eri-1 Contains exonuclease nucleic-acid- K04, D06, binding domains; required for endo- Eri (Class L06, H09, ts-Ste, Him siRNAs, particularly 26G-RNAs I) Ge09, Pa09, Ge10 mut-2 Homologous to polynucleotide C87, K99, polymerases; required for endo- and T99, C05, Germ line - and+ - Him, ts-Ste exo-siRNA accumulation R05, L06, V06, K07, S07 mut-7 RNAseD-related; required for endo-, K99, T99, exo- siRNA accumulation and 22G- D00, G00, RNAs; complexes with RDE-2 in Soma K00,T02 G05, Germ line - - Him, ts-Ste cytoplasm; also present in nucleus Germ line K05, T05, L06, V06, G08, G09 mut-14 RNA helicase; required for transposon K99, T02, S03, Germ line, siRNA formation, possibly endo- - + R05, L06, Soma siRNAs V06, E07 mut-15 Required for secondary siRNAs Germ line, Soma K05, V06, S07 Soma Germ line mut-16 Q/N-rich domain predicted to associate K99, S03, with chromatin; required for siRNAs for Germ line, Soma V03, G05, - - RNAi-TGS transposons and RNAi Soma Germ line K05, R05, V06, S07

(Table 3-5 continued)

126

Gene Function and domains RNAi Trans- Cosup- Transgene Other References poson pression silencing phenotypes silencing RNAi and small RNA-related (continued) pir-1 Phosphatase; required for RNA Soma D06 processing by DCR-1 pup-2 Poly(U) polymerase + R05, K07 rde-2 Interacts with MUT-7 in the cytoplasm; K00?, T99, Germ line, required for siRNA accumulation - - ~Germ line Him G00, R05, Soma T05, L06, V06 rde-4 dsRNA binding domain; likely required T99, P01, for endo-siRNAs and Ta02, Ti02, Germ line, recognition/cleavage of long dsRNA + + Soma RNAi-TGS G05, K05, Soma molecules into exo-siRNAs; also R05, L06, required for 26G-RNAs V06, Va10 rde-8 Required for accumulation of exo- - Ch06 siRNAs and endo-siRNAs rha-1 RNA helicase with roles in germ-line R05, W05, chromatin regulation; homologous to Germ line + - Germ line V06, E07 Drosophila Maleless rrf-1 RdRP; required for transitive exo-RNAi S02, G05, L06, and some 22G-RNAs Soma RNAi-TGS A07, G09, Ge10, Va10 rrf-2 RdRP; not known to be required for S02, L06, G09,

endo- or exo-siRNAs H09

(Table 3-5 continued)

127

Gene Function and domains RNAi Trans- Cosup- Transgene Other References poson pression silencing phenotypes silencing NuA4/Tip60 complex ekl-4 SynMuv gene suppressor Ekl Cu06, R08 epc-1 Homologous to Enhancer of Polycomb; Ekl C04, R08 synMuv C gene gfl-1 SynMuv gene suppressor; homologous D02, G05, to GAS41-like Germ line, RNAi-TGS, K05, W05, - Soma Soma Ekl Cu06, V06, R08 mrg-1 Chromodomain-containing protein; RNAi-TGS, G05, R05, synMuv gene suppressor; required for + - Germ line Long-term Cu06, V06, germ-line development RNAi T07 mys-1 MYST family histone acetyltransferase; C04, P05, R05, + Ekl synMuv C gene R08 ssl-1 Yeast Swi2/Snf2-like; Q/N-rich domain; C04, P05, E07 helicase; synMuv C gene trr-1 TRAAP subfamily of histone Ekl C04, P05, R08 acetyltransferases; synMuv C gene

(Table 3-5 continued)

128

Gene Function and domains RNAi Trans- Cosup- Transgene Other References poson pression silencing phenotypes silencing NURF complex isw-1 Homolog of Imitation Switch R05, A06, (chromatin remodelling ATPase); Long-term + Cu06, E07, Swi2/Snf2 helicase; SynMuv gene RNAi V06 suppressor nurf-1 Homologous to nucleosome remodelling factor complex component; A06 zinc finger; works with isw-1 in suppression pyp-1 Inorganic phosphatase orthologous to A06 NURF complex component rba-1 RBAp48-related Soma Soma K05, A06

Other chromatin-related cir-1 Related to RITS component Tas3 - RNAi-TGS G05 egl-27 Human homolog involved in nucleosome remodelling and histone RNAi-TGS S99, G05, C07 deacetylation; involved in C. elegans development hda-1 Histone deacetylase; required for S98, D02, P03, + + Mutator embryogenesis and gonadogenesis R05 hda-2 Histone deacetylase; involved in RNAi-TGS; S98, P03, G05, + maintaining genome stability Mutator R05, V06

(Table 3-5 continued)

129

Gene Function and domains RNAi Trans- Cosup- Transgene Other References poson pression silencing phenotypes silencing Other chromatin-related (continued) hda-3 Histone deacetylase; involved in Soma S98, P03, G05, Soma + + maintaining genome stability Germ line K05, R05, V06 hda-4 Histone deacetylase; interacts with Long-term C02, G05, V06 MEF-2 transcription factor RNAi hil-4 Histone H1-like + R05 his-24 Linker histone H1.1; influences H3 + Germ line J01, R05, J07 methylation hpl-1 HP1 homolog; partially redundant with RNAi-TGS C02, G05, R05 hpl-2; + hpl-2 HP1 homolog; synMuv B gene also Germ line, Germline C02, G05, + - RNAi-TGS required for fertility Eri R05, W05 lin-35 Retinoblastoma protein ortholog; L98, C04, synMuv B gene; may regulate Eri W05, L06, chromatin with endo-siRNAs G08 mes-3 Represses X chromosome in complex T99, Xu01, with PcG homologs through H3K27 Maternal- D02, B04, Germ line Germ line methylation effect sterile G05, P05, V06, K08 mes-6 WD repeats; orthologous to Extra sex K98, T99, Maternal- combs; represses X chromosome with Germ line Germ line B04, D02, effect sterile H3K27 methylation G05, V06, K08 met-2 Required for trimethylation of H3K9 + G05, R05, A07 and H3K36; works with HP1 homologs

(Table 3-5 continued)

130

Gene Function and domains RNAi Trans- Cosup- Transgene Other References poson pression silencing phenotypes silencing Other chromatin-related (continued) mys-2 MYST histone acetyltransferase family Long-term + R05, V06 member RNAi set-1 SET domain Te02, G05, + RNAi-TGS R05 set-2 SET domain; enhances sterility of mes-3 Xu01, G05, + RNAi-TGS R05 sin-3 Homolog of histone deactylase P03, K05, Mutator complex component; synMuv W05, C06, Soma + Soma (transposon- suppressor; regulates H3K9me in V06, C07, independent) meiosis S09 sop-2 SAM domain; related to PRC1 Z03, Z04, components; required for Hox gene RNAi-TGS G05, V06 repression T09A5.8 Chromodomain + - RNAi-TGS G05, R05 tam-1 Zinc finger domain; synMuv gene Soma H99 zfp-1 Zinc finger domain; synMuv gene D02, G05, Germ line, suppressor Soma RNAi-TGS K05, Cu06, Soma L06, V06

(Table 3-5 continued)

131

Gene Function and domains RNAi Trans- Cosup- Transgene Other References poson pression silencing phenotypes silencing Germ line nos-1 Nanos-related; putative RNA-binding protein with zinc-finger motif; involved S99, S03, G05 in germ-line chromatin architecture regulation pgl-1 RNA-binding protein required for P Disrupts P K98, G05, granules in germ line + - granules, ts- R05, V06, Ste Sp08, Wa09 puf-5 Pumilio family RNA-binding protein; L07, G05 regulates mRNAs in germ line puf-6 Pumilio family RNA-binding protein; RNAi-TGS L07, G05 regulates mRNAs in germ line puf-7 Pumilio family RNA-binding protein; RNAi-TGS L07, G05 regulates mRNAs in germ line drp-1 operon drp-1 Dynamin-related protein involved in L99 fission of mitochondrial membrane T12E12.1 Putative E3 uqibuitin ligase

T12E12.2 Chromodomain + - G05, R05 T12E12.3

(Table 3-5 continued)

132

Gene Function and domains RNAi Trans- Cosup- Transgene Other References poson pression silencing phenotypes silencing Other C35D6.3 capg-2 Condensin complex subunit Cs09 dpy-27 Condensin complex subunit + Cs09, R05 kle-2 Condensin complex subunit Cs09 pqn-29 Q/N-rich domain smc-4 Condensin complex subunit Cs09 smg-1 Nonsense-mediated mRNA decay; phosphatidylinositol kinase-related + D00; G04 protein kinase smg-2 Nonsense-mediated mRNA decay; RNA Rde P99, D00, + + helicase domain delayed K05, R05 smg-5 Nonsense-mediated mRNA decay; Rde P99, D00, + RNAi-TGS regulates SMG-2 phosphorylation delayed G05, R05 T05E8.3 RNA helicase - - RNAi-TGS G05, R05

(Table 3-5 continued)

133

Legend of phenotypes for Table 3-5:

Cosuppression = silencing of endogenous loci corresponding to transgene Eri = enhanced RNAi Ekl = enhancer of ksr-1 lethality Him = high incidence of males (caused by increased frequency of X chromosome non-disjunction) MAGO = Multiple Argonaute mutant Mutator = increased rate of mutations Long-term RNAi = RNAi effect that lasts for multiple generations after initial exposure to dsRNA Rde delayed = Mutants are initially competent for RNAi, but they become Rde over time (RNAi does not persist) RNAi-TGS = RNAi-induced transcriptional gene silencing (somatic) Ste = sterile (ts = temperature-sensitive) Transgene silencing = silencing of simple repetitive transgenic arrays in the germ line Transposon silencing = silencing of transposable elements in the germ line

+ = wild type - = defective ~ = weak phenotype Soma = phenotype seen in soma Germ line = phenotype seen in germ line Blank = not tested

134

Table 3-5: references J07 (Jedrusik and Schulze 2007) T99 (Tabara et al. 1999) K98 (Kawasaki et al. 1998) T07 (Takasaki et al. 2007) A07 (Aoki et al. 2007) K04 (Kennedy et al. 2004) Te02 (Terranova et al. 2002) B08 (Batista et al. 2008) K99 (Ketting et al. 1999) T02 (Tijsterman et al. 2002) B04 (Bender et al. 2004) K00 (Ketting and Plasterk 2000) T05 (Tops et al. 2005) C04 (Ceol and Horvitz 2004) Ke01 (Ketting et al. 2001) Va10 (Vasale et al. 2010) C05 (Chen et al. 2005) K05 (Kim et al. 2005) V03 (Vastenhouw et al. 2003) Ch06 (Chen 2006) K08 (Kloc et al. 2008) V06 (Vastenhouw et al. 2006) C02 (Choi et al. 2002) Kn01 (Knight and Bass 2001) VW09 (van Wolfswinkel et al. 2009) C07 (Choy et al. 2007) K07 (Kwak and Wickens 2007) V05 (Vought et al. 2005) C09 (Claycomb et al. 2009) L99 (Labrousse et al. 1999) W05 (Walstrom et al. 2005) C87 (Collins et al. 1987) L06 (Lee et al. 2006) W09 (Wang et al. 2009) Co10 (Conine et al. 2010) L98 (Lu and Horvitz 1998) W08 (Wang and Reinke 2008) C98 (Cox et al. 1998) L07 (Lublin and Evans 2007) Xu01 (Xu et al. 2001) Cs09 (Csankovszki et al. 2009) M05 (Maine et al. 2005) Y06 (Yigit et al. 2006) Cu06 (Cui et al. 2006) N07 (Nakamura et al. 2007) Z03 (Zhang et al. 2003) D08 (Das et al. 2008) P99 (Page et al. 1999) Z04 (Zhang et al. 2004) D00 (Dernburg et al. 2000) P01 (Parrish and Fire 2001) Do00 (Domeier et al. 2000) Pa09 (Pavelec et al. 2009) D06 (Duchaine et al. 2006) P03 (Pothof et al. 2003) D02 (Dufourcq et al. 2002) P05 (Poulin et al. 2005) E07 (Eki et al. 2007) R05 (Robert et al. 2005) Ge09 (Gent et al. 2009) R08 (Rocheleau et al. 2008) Ge10 (Gent et al. 2010) Sc03 (Schaner et al. 2003) G04 (Grimson et al. 2004) S09 (She et al. 2009) G00 (Grishok et al. 2000) S98 (Shi and Mello 1998) G01 (Grishok et al. 2001) S03 (Sijen and Plasterk 2003) G05 (Grishok et al. 2005) S07 (Sijen et al. 2007) G09 (Gu et al. 2009) S02 (Simmer et al. 2002) G08 (Guang et al. 2008) S00 (Smardon et al. 2000) H09 (Han et al. 2009) S99 (Solari et al. 1999) H99 (Hsieh et al. 1999) Sp08 (Spike et al. 2008) J01 (Jedrusik and Schulze 2001) Su99 (Subramaniam and Seydoux 1999)

135

The screen was performed by exposing fem-1(Df) females to RNAi during the L4 stage, then crossing them to wild-type males. Progeny from these crosses were raised under continued exposure to RNAi and scored for germ-line feminization as adults. Since males tend to have reduced sensitivity to RNAi (Timmons et al. 2001), only XX m-z+ animals were scored. Using idDf1 mothers, which normally produce 18% Fog offspring, I sought to identify enhancers of the Fog phenotype. If reducing a gene’s activity by RNAi were to lead to an increase in the proportion of Fog animals, it would suggest that the normal function of that gene is to support spermatogenesis. In our model, such genes may include factors required for licensing zygotic fem-1 expression in the germ line when maternal fem-1 RNA is present. To identify suppressors of the Fog phenotype, I screened using idDf2, an allele that normally generates 82% m-z+ Fog animals. Such genes, whose wild-type activity is required for the Fog phenotype, may be involved in silencing fem-1 expression in the absence of licensing RNA.

Several genes proved unsuitable for the screen because their inhibition caused phenotypes that interfered with scoring the germ-line sex (Table 3-6). Phenotypes that did not affect viability or the ability to assess the sex of the germ line are not reported here. If RNAi treatment led to death or severe sickness in N2 animals, the crosses were not performed. RNAi against several genes led to sterility or other germ-line phenotypes. In some cases, the severity of the effect was more pronounced in situations where the sex determination pathway was already compromised, such as in fem-1 and fem-3 loss-of-function mutants. It is still possible that some of these omitted genes are involved in maternal-effect silencing and licensing; if those processes are important to the development of the germ line, compromising them may indeed cause severe germ-line phenotypes.

136

Table 3-6: Genes that could not be assessed as modifiers of the Fog phenotype.

Gene name Relevant phenotypes observeda Argonautes alg-1 Sick, germ line sex difficult to score csr-1 Sterility, germ line sex difficult to score

RNAi and small RNA-related ego-1 Sterility, germ line sex difficult to score

Chromatin-related hda-1 Lethality lin-35 Germ line sex difficult to score, more severe in fem-3(e1996) mes-3 Sterility mes-6 Sterility set-1 Sterility, females, germ line sex difficult to score sin-3 Germ line sex difficult to score, more severe in fem-1(hc17) and fem-3(e1996)

NuA4/Tip60 complex ekl-4 Lethality, sterility, females mrg-1 Sterility, germ line sex difficult to score mys-1 Sterility, germ line sex difficult to score, more severe in fem-1(hc17) and fem- 3(e1996) ssl-1 Females, germ line sex difficult to score trr-1 Females, sick

NURF complex isw-1 Sterility pyp-1 Lethality rba-1 Lethality

Other capg-2 Lethality cir-1 Lethality kle-2 Lethality smc-4 Lethality T05E8.3 Sick, germ line sex difficult to score a Unless otherwise indicated, results refer to the effects of RNAi in the wild-type strain, N2.

137

Results for the genes that could be scored are reported in Table 3-8 (refer to legend in Table 3-7). In addition to examining the effects on the progeny of fem-1(Df) animals, several other feminizing alleles were also tested. Strong fem-3 alleles such as e1996 also produce a maternal absence effect (Hodgkin 1986), though this is a classic maternal effect and not the kind of heritable epigenetic effect described for fem-1(Df) alleles. 10% of the m-z+ animals produced by crossing fem-3(e1996) females to wild-type males have the Fog phenotype. By determining whether the screened genes affect the Fog phenotype caused by both types of maternal absence effect, I can focus on genes specifically involved in regulating maternal-effect silencing due to absence of licensing rather than factors whose roles in germ-line sex determination might be revealed when the germ line is sensitized to feminizing activities. Similarly, the temperature- sensitive loss-of-function alleles fem-1(hc17) and fem-1(e1998) were used to assess the effect of RNAi in a situation where fem-1 activity is already reduced. It is possible that some of the tested genes showed a phenotype in fem-1(Df)/+ m-z+ animals and not wild-type animals because the gene’s moderate effect on germ-line sex is only detected when fem-1 activity is already below a certain threshold. Wild-type animals would have fem-1 levels above that threshold, but fem- 1(hc17) and fem-1(e1998) have reduced levels of fem-1 and could serve as a comparison for the fem-1(Df)/+ m-z+ situation. At 20°C, 4% (SEM = 2%) of fem-1(hc17) homozygotes are Fog, compared to 100% (SEM = 0%) at 25°C. I tested whether the genes identified as putative enhancers would also act on fem-1(hc17) to increase the proportion of Fog animals at 20°C. For fem-1(e1988) homozygotes, 99% (SEM = 1%) are Fog at 20°C versus 9% (SEM = 2%) at 15°C. I checked whether the putative suppressors would affect fem-1(e1988) animals at 20°C. Genes that were initially identified as enhancers of the Fog phenotype, but were subsequently observed to raise the frequency of feminization above 22% in fem-3/+ m-z+ animals or above 12% in fem- 1(hc17) animals included T23D8.7 and nos-1 (Table 3-8). These genes may have subtle effects on germ-line feminization that are unrelated to the processes of maternal-effect silencing and licensing. ekl-1 is an example of a gene that suppressed the Fog phenotype of fem-1(Df)/+ m-z+ animals, but also lowered the penetrance of the Fog phenotype below 4% in fem-3/+ m-z+ animals and below 90% in fem-1(e1988) animals. Knockdown of this gene may simply be potentiating fem-1 activity in situations where it is limiting. After examining these controls, several genes were still classified as modifiers of the Fog phenotype in fem-1(Df)/+ m-z+ heterozygotes (Table 3-8). Enhancers and suppressors are shown in Figure 3-1 and Figure 3-2, respectively. Among the genes of the worm-specific clade

138

of Argonautes, wago-1, wago-2, wago-5 and ppw-2 were all enhancers using idDf1 and, in some cases, idDf2. A separate group of Argonautes behaved as suppressors: the Piwi-related genes prg-1 and prg-2, and the gene wago-4. Knockdown of pgl-1, a gene required for P granule formation (Kawasaki et al. 1998), strongly enhanced the Fog phenotype. Genes involved in RNA-related processes were also identified (mut-7, rde-2 and rha-1), as were the chromatin- related factors epc-1 and mys-2. The enhancers did not induce the Fog phenotype in fem- 1(e2268)/+ m-z+ heterozygotes. Additional suppressors included nucleotidyltransferases (cde-1 and mut-2), other small RNA-related genes (drh-3, mut-2 and mut-16), and members of the PUF family of RNA-binding proteins (puf-5 and puf-6). Paradoxically, gfl-1 enhanced the Fog phenotype of idDf1/+ m-z+ animals and fem-1(e1988) homozygotes, but suppressed the phenotype in descendants of idDf2 females. Since several of these genes are closely related to one another at the sequence level and may be secondary targets during RNAi, further analysis using mutant alleles was later performed. Using mutant alleles may also address some of the complicating factors involved in using RNAi to knockdown genes with a role in RNAi.

Table 3-7: Colour scheme used for representing the percentage of Fog animals observed after RNAi treatment in Table 3-8. Column in Table 3-8 idDf1a idDf2a fem-3a e2268 hc17 e1988 Average Fog ± s.d.b (%) on empty vector control 18 ± 6 82 ± 9 10 ± 6 0 ± 0 4 ± 4 99 ± 1 ≤ 12 ≤ 28 ≤ 4 0 to 1 0 to 11 ≤ 90 Colour representing 12 to 29 29 to 46 5 to 21 ≥ 1 ≥ 12 90 to 100 average Fog animals (%) 30 to 41 47 to 63 ≥ 22 in Table 3-8 42 to 54 64 to 90 ≥ 55 ≥ 91

a Treatments represented by coloured boxes in Table 3-8 produce an average percentage of Fog animals in the range indicated for the corresponding shade in this table, and they must differ significantly from the empty vector control (p < 0.05 using a Student’s t-test). The number of standard deviations away from the control mean is used to bin the percentages of Fog progeny in the ranges shown here. For all alleles, white represents values similar to the empty vector control, red indicates enhancement of the Fog phenotype, and blue indicates suppression.

b s.d. = standard deviation

139

Table 3-8: Germ-line feminization in fem/+ m-z+ or fem-1(ts) animals following RNAi treatment. Group Gene name Female parent for crosses a,b fem-1 alleles a

idDf1 idDf2 fem-3 e2268 hc17c e1988d

Control Nonee Argonautes alg-2 alg-3 alg-4 C04F12.1 ergo-1 F55C9.3 M03D4.6 nrde-3 ppw-1 ppw-2 prg-1 prg-2 rde-1 sago-1 T23D8.7 wago-1 wago-2 wago-4 wago-5 wago-9 wago-10 wago-11 ZK218.8 RNAi and small cde-1 RNA-related dcr-1 drh-1 drh-2 drh-3 ekl-1 eri-1 mut-2 mut-7 mut-14 mut-15 mut-16

(Table 3-8 continues on the next page.)

140

Group Gene name Female parent for crosses a,b fem-1 alleles a

idDf1 idDf2 fem-3 e2268 hc17c e1988d

RNAi and small pir-1 RNA-related pup-2 (continued) rde-2 rde-4 rde-8 rha-1 rrf-1 rrf-2 NuA4/Tip60 epc-1 complex gfl-1 NURF complex nurf-1 Other chromatin- egl-27 related hda-2 hda-3 hda-4 hil-4 his-24 hpl-1 hpl-2 met-2 mys-2 set-2 sop-2 T09A5.8 tam-1 zfp-1 Germ line nos-1 pgl-1 puf-5 puf-6 puf-7 drp-1 operon drp-1 T12E12.1 T12E12.2 T12E12.3

(Table 3-8 continues on the next page.)

141

Group Gene name Female parent for crosses a,b fem-1 alleles a

idDf1 idDf2 fem-3 e2268 hc17c e1988d

Other C35D6.3 dpy-27 pqn-29 smg-1 smg-2 smg-5 a Refer to Table 3-7 for a legend of the colour scheme. Grey box = not done. b Scored germ-line feminization of fem/+ progeny of fem-1 or fem-3 mothers crossed to wild- type males. c fem-1(hc17lf,ts) animals grown at the semi-permissive temperature of 20ºC. d fem-1(e1988lf,ts) animals grown at the restrictive temperature of 20ºC. e Worms grown on bacteria carrying the empty vector L4440 which does not target a gene for RNAi.

142

Figure 3-1: Genes that enhance the Fog phenotype when their activity is reduced by RNAi. Data are shown for genes that were statistically significant enhancers of the Fog phenotype of idDf1/+ m-z+ animals, as measured by a Students t-test using a p-value threshold of 0.05. Bar height represents the average of at least three RNAi experiments. Error bars show standard error.

143

Figure 3-2: Genes that suppress the Fog phenotype when their activity is reduced by RNAi. Data are shown for genes that were statistically significant suppressors of the Fog phenotype of idDf2/+ m-z+ animals, as measured by a Students t-test using a p-value threshold of 0.05. Bar height represents the average of at least three RNAi experiments. Error bars show standard error.

144

3.4.2 Addressing differences between the three fem-1(Df) alleles

The RNAi screen provided the opportunity to investigate potential differences between idDf1 and the other deficiency alleles, which normally produce ~18% or ~85% Fog animals, respectively. idDf1 produces a partial, chimeric fem-1 transcript that has limited rescuing activity (Chapter 2). The presence of this transcript may contribute to the lower rates of germ- line feminization in the progeny of idDf1 animals compared to idDf2 and idDf3. In that case, increasing the levels of this transcript may further reduce the penetrance of the Fog phenotype in idDf1 progeny. If this transcript were targeted by the nonsense-mediated decay pathway, then mutations in the smg genes required for nonsense-mediated decay may increase the levels of the idDf1 fem-1 transcript. I asked whether smg mutations in idDf1 mothers affected the penetrance of the Fog phenotype among their progeny. Surprisingly, I observed that reducing the activity of smg-1 actually increased the proportion of Fog animals. I tested two of the other the smg genes, smg-2 and smg-5, that are required for persistence of RNAi. Reduction of smg-5 did not increase the penetrance of the Fog phenotype (Table 3-8). For idDf1/+ m-z+ animals, an increase in the penetrance of the Fog phenotype was caused by reduction of smg-1 or smg-2, but RNAi against these genes also enhanced the Fog phenotype of fem-3/+ m-z+ heterozygotes, though the result was only statistically significant for one smg gene with either genotype. Since these genes seem to affect the feminization of both fem-3/+ and fem-1(Df)/+ m-z+ animals, the smg genes are not likely acting in a pathway specific to the feminization observed in descendants of fem-1(Df) animals. Nonetheless, this behaviour precluded addressing the effect of stabilizing the fem-1 transcript produced by idDf1.

Another difference between the three deficiency alleles is that idDf2 and idDf3 affect a divergently transcribed operon containing four genes upstream of fem-1 (Figure 2-1). idDf3 deletes the entire operon, and idDf2 removes the promoter, presumably affecting expression of all genes in the operon. To ask whether any of these genes affects the penetrance of the Fog phenotype, I reduced their activity by RNAi in idDf1 animals to simulate the situation in idDf2 and idDf3. Females exposed to RNAi were crossed to wild-type males, and the Fog phenotype of their progeny was scored. Three of the genes had no effect, but targeting T12E12.2 increased the proportion of Fog animals produced by idDf1 females. T12E12.2 encodes a chromodomain- containing protein. RNAi targeting this gene increased the percentage of idDf1/+ m-z+ Fog animals to 82%, a value equivalent to the proportion seen for idDf2/+ and idDf3/+ m-z+ animals

145

(Table 3-8). Knockdown of T12E12.2 only affects descendants of idDf1 homozygotes, not females carrying other fem alleles (Figure 3-3). Since the penetrance of the Fog phenotype in idDf2 and idDf3 animals is not further increased by RNAi against T12E12.2, the Fog phenotype produced from these alleles is already a composite effect of the absence of fem-1 RNA and of the loss of T12E12.2 activity.

Figure 3-3: Penetrance of the Fog phenotype in heterozygous cross-progeny of fem mothers when animals are subjected to RNAi targeting T12E12.2 or the empty vector L4440.

Bars indicate the mean percentage of Fog animals produced from the averages of each round of RNAi. Error bars show the standard deviation.

146

To rule out the possibility that the Fog phenotype produced by all three deficiencies originates from compromising T12E12.2 activity, I used semi-quantitative RT-PCR to measure transcript levels of this gene in females carrying each of the alleles. As expected, T12E12.2 mRNA was not produced from idDf2 or idDf3; however, T12E12.2 RNA was present at wild- type levels in idDf1 animals (Figure 3-4). Since this gene was not detectably affected in idDf1 animals, but their progeny were subject to maternal-effect germ-line feminization, I concluded that the primary cause of the Fog phenotype is the absence of maternal fem-1 RNA. Enhancement of the Fog phenotype by knockdown of T12E12.2 implied that this gene functions as a modifier of the underlying level of germ-line feminization caused by the absence of maternal fem-1 RNA. This idea was further supported by the observation that T12E12.2 knockdown did not cause germ-line feminization in the offspring of e2268 females, nor did it enhance maternal-effect feminization in the progeny of fem-3 mothers (Figure 3-3). These observations were consistent with the interpretation that T12E12.2 did not cause feminization on its own, but rather affected the phenotype caused by fem-1(Df) alleles. T12E12.2 could have a direct role in promoting licensing of fem-1 or an indirect role by regulating the activity of other genes involved in the process.

147

Figure 3-4: Levels of T12E12.2 RNA production from various alleles.

A) Representative picture of a gel showing PCR products amplified from cDNA templates of animals carrying various fem-1 alleles. Levels of drp-1 and T12E12.2 PCR products are compared with germ-line-expressed genes as controls.

B) Quantification of relative amounts of RNA detected from drp-1 operon genes in wild- type animals, fem-1(e2268) females and idDf1 females. Error bars represent standard deviations.

148

3.4.3 Validation of the RNAi screen using mutant alleles of candidate modifiers After identifying several candidate genes as modifiers of the Fog phenotype of fem- 1(Df)/+ m-z+ animals using an RNAi-based screen, I further investigated the role of several of these genes using mutant alleles. Where available, I used null alleles. rha-1(tm329ts) is a temperature-sensitive sterile mutation and was tested at the semi-permissive temperature of 20°C. I took females homozygous for one of three fem-1 alleles (idDf1, idDf2 or e2268) and the mutation to be tested, crossed them to wild-type or mutant males, and scored the Fog phenotype of their offspring. Building the strains required for this type of analysis is too time-consuming to be performed on a large scale, but there are several advantages to using mutant alleles. For a family such as the Argonautes, I could resolve the contribution of specific family members, whereas RNAi may simultaneously target more than one gene. Since several of the tested genes are themselves involved in the RNAi process, using another method to reduce their activity may give a stronger loss of function than can be achieved through RNAi. As outlined in Figure 3-5, I assessed the requirement for maternal and zygotic contributions of each tested gene by determining whether the penetrance of the Fog phenotype was modified in two kinds of crosses. In Series VI of Figure 3-5A, the genotype of the candidate modifier is m-z-, which allows me to ask whether there is a requirement for the gene, either zygotic or maternal. If the modified penetrance is also observed in Series VII animals, which are m-z+ for the candidate gene, then the requirement is strictly maternal. In only one case was an effect detected in Series VII but not Series VI animals, a surprising observation that will be explored in the Discussion section.

149

Figure 3-5: Effect of mutant alleles on the penetrance of the Fog phenotype in fem-1(Df)/+ m-z+ animals.

A) Series VI and VII crosses used to examine the effect of putative modifiers on fem- 1(Df/+) m-z+ animals. rha-1 is used as an example. fem-1(y) = idDf1, idDf2 or e2268

B) Bars indicate the mean percentage of Fog animals produced from each cross. Error bars indicate the standard error of the mean. Control animals are m+z+ for each gene tested. The results are taken from at least three crosses. A minimum of 300 animals were assessed except for the prg-1 and mut-7 results where high levels of sterility or lethality reduced the number of animals available for scoring. n.d. = not done.

150

A Series VI: m-z- for tested gene

rha-1 II ; fem-1(y) IV X rha-1 ; +

rha-1 ; fem-1(y) rha-1 +

Series VII: m-z+ for tested gene

rha-1 II ; fem-1(y) IV X + ; +

rha-1 ; fem-1(y) + +

151

152

I tested the effect of mutations in several Argonautes that are required for RNAi and did not produce an effect in my RNAi screen. ppw-1 is involved in RNAi (Tijsterman et al. 2002), but the penetrance of the Fog phenotype remained unchanged when the ppw-1 mutation was included in crosses to fem-1(Df) females (Figure 3-5B). This result indicates that maternal-effect silencing and licensing do not have a definite requirement for functional RNAi; such a condition could have been missed during the RNAi screen since the RNAi pathway was probably at least partially active throughout the course of that experiment. Two additional, better characterized Argonautes are also required for different RNAi pathways and dispensable for maternal-effect regulation. rde-1 is required for exogenous RNAi in C. elegans, and ergo-1 is similarly required in some endogenous RNAi pathways. Both genes are associated with primary siRNAs and allow the RNA-directed RNA polymerase amplification that generates secondary siRNAs (Yigit et al. 2006). Neither gene was required for the Fog phenotype of fem-1(Df)/+ m-z+ animals (Figure 3- 5B).

Since rde-1 is required for processing externally provided RNAs in RNAi, I also asked whether this gene was necessary for the RNA injection experiment I performed in Chapter 2. In that assay, in vitro-transcribed RNA was injected into the germ line of a gravid idDf2 female to determine whether the RNA was able to rescue the Fog phenotype in the heterozygous offspring of the injected animal. Using this assay, I demonstrated that RNA containing fem-1 exon sequences exhibited the strongest rescuing ability, which I interpreted to mean that it was capable of licensing the activity of zygotic fem-1 in the germ line. Although the injected RNAs were usually full-length transcripts, it is possible that the RNA was processed in vivo to produce an active, licensing form. Injections of RNA from a full length fem-1 cDNA were able to rescue the offspring of idDf2; rde-1 females as effectively as the progeny of idDf2; + females (Figure 3-6). If processing of the injected RNA occurred, it did not require RDE-1.

153

Figure 3-6: Effect of RNA injection into the germ line of idDf2 with functional or mutated rde-1.

A, C) Percentage of uninjected (A) or injected (C) idDf2 females producing the indicated fractions of Fog F1 progeny upon crossing to wild-type males (from Figure 2-6).

B, D) Frequency of Fog progeny produced by uninjected (B) or injected (D) idDf2; rde-1 females crossed to rde-1 males.

The template for in vitro transcription of a full length fem-1 cDNA is drawn with coding regions shown as filled boxes and untranslated regions as unfilled boxes. The bent arrow indicates the direction of in vitro transcription. n indicates the number of females whose progeny were scored. Asterisks indicate distributions significantly different from that of the uninjected control females: * 10-4 < p < 10-2; *** p < 2 x 10-6

154

Although mutations in ppw-1, rde-1 and ergo-1 did not affect the penetrance of the Fog phenotype in fem-1(Df)/+ m-z+ animals, other Argonautes were implicated as modifiers of germ-line feminization both by RNAi and by mutant analysis. For example, ppw-2, an Argonaute required for transposon silencing and cosuppression (Vastenhouw et al. 2003; Robert et al. 2005), was affirmed as an enhancer of the Fog phenotype with a strict maternal requirement (Figure 3-5B). The behaviour of the Argonautes in the RNAi screen and mutant allele analysis correlated with their position in the phylogenetic tree of this family (Figure 3-7). In C. elegans, there are three clades of Argonautes that are approximately equally distant from one another (Yigit et al. 2006).

Figure 3-7: Clades of Argonaute proteins and their behaviour in my RNAi assay.

The three clades of Argonaute proteins are shown as classified in the phylogenetic analysis of Yigit et al. (2006) and Gu et al. (2009). The first two letters indicate species, where At is A. thaliana, Ce is C. elegans, Dm is D. melanogaster, Hs is Homo sapiens, and Sp is S. pombe. All the C. elegans family members were tested in my RNAi screen except for those proteins indicated by an asterisk. The colour of the C. elegans proteins indicates the behaviour of those genes in the RNAi screen and subsequent mutant allele analysis. Black denotes proteins that were not implicated in modifying the Fog phenotype when their activity was reduced, blue designates suppressors, and red indicates enhancers. If a gene only behaved as an enhancer when reduced by RNAi and not by a mutant allele, a light red colour is used. Dark red indicates that the gene was an enhancer under both conditions.

155

Three closely related Argonaute genes were identified as enhancers by RNAi. Of the three genes, only wago-1 remained an enhancer when the gene’s activity was reduced using a mutant allele instead of RNAi. wago-2 and wago-5 were predicted to be secondary targets of wago-1 RNAi. If wago-2 or wago-5 does play a role in the process, it must be redundant. The result for wago-1 was unusual in that it behaved as an enhancer only when the father contributed a wago-1(+) allele (Figure 3-5, Series VII) and not when both the maternally- and paternally- inherited alleles were mutated (Series VI). This observation applies to descendants of both idDf1 and idDf2 females. While detection of a phenotype only in Series VI could be explained as a strict maternal effect, observing a phenotype only in Series VII was unexpected and only occurred for wago-1. wago-1 is required for RNAi-induced transcriptional gene silencing in the soma (Grishok et al. 2005) and has been implicated in small-RNA mediated silencing processes in the germ line (Claycomb et al. 2009; Gu et al. 2009; Conine et al. 2010).

I confirmed that the Piwi-related Argonautes prg-1 and prg-2 both act as suppressors of the Fog phenotype. Because of the high rates of sterility in prg-1 animals, they were only tested with the idDf1 allele. While assessing loss of prg-1 using Series VI animals was not possible, prg-1 mutants did suppress the Fog phenotype of Series VII animals with idDf1. I was able to examine all three fem-1 alleles with prg-2 mutants, and the Fog phenotype was suppressed in XX and XO animals for both Series VI and Series VII animals. These results confirmed that this gene is not fully redundant with prg-1 in its role in silencing fem-1. A mutant allele of wago-4 established that this Argonaute, implicated in RNAi in both the soma and the germ line (Yigit et al. 2006), is also a strong suppressor of the Fog phenotype in descendants of idDf1 and idDf2 females. In contrast, by RNAi against wago-4 increased the Fog effect in fem-3/+ m-z+ animals to 42% (Table 3-8). This effect was less pronounced using mutant alleles where 25% (SEM = 6%) of Series VI and 31% (SEM = 0.3%) of Series VII XX animals were Fog. The opposite effect was seen for fem-3/+ XO animals where 0.7% (SEM = 0.7%) of Series VI and 0.4% (SEM = 0.4%) of Series VII animals were Fog.

RHA-1 is an RNA helicase required for cosuppression, silencing of the unpaired X chromosome, transgene silencing and RNAi in the germ line (Robert et al. 2005; Walstrom et al. 2005). Partially reducing the activity of this gene with a temperature-sensitive mutation at the permissive temperature recapitulated the increased penetrance of the Fog phenotype detected using RNAi. The enhancing effect was stronger for Series VI animals with a reduction in both

156

maternal and zygotic rha-1 activity than for Series VII animals with a zygotic rha-1(+) (Figure 3-5), suggesting that the zygotic activity can partially rescue maternal requirements for rha-1.

rde-2 and mut-7 are required for germ-line RNAi, transposon silencing, transgene silencing and cosuppression (Tabara et al. 1999; Dernburg et al. 2000; Ketting and Plasterk 2000; Tijsterman et al. 2002). Although the proteins are predicted to function together in a complex (Tops et al. 2005) and both behaved as enhancers in the RNAi screen (Table 3-8), the results using mutant alleles indicated a more complicated relationship. rde-2 behaved as a suppressor in both Series VI and Series VII animals. All the XO mut-7 animals also showed suppression of the Fog phenotype in both series. The mut-7 mutation also behaved as a suppressor in the Series VII XX animals, but there were two exceptions among the Series VI XX animals: Series VI XX animals showed an increased penetrance of the Fog phenotype with the idDf1 allele, and a Fog phenotype was introduced in Series VI XX animals descended from e2268 females. This mut-7 allele also led to maternal-effect lethality that reduced the number of animals available for scoring. Homozygous mut-7 hermaphrodites produced 26% (SEM = 6%) dead embryos.

The nonsense-mediated decay gene smg-1 had unexpectedly enhanced the Fog phenotype of idDf1/+ m-z+ animals in the RNAi screen. With mutant alleles, Figure 3-8 shows that the smg-1 mutation enhanced the Fog phenotype in idDf1 descendants, but did not cause a Fog phenotype in e2268 progeny. Since the XX animals showing increased penetrance of the Fog phenotype in the F1 generation were m-z+ for smg-1, the smg-1 mutation produced a maternal effect. In the F3 generation, XX and XO descendants of smg-1/+ mothers have an enhanced phenotype, which indicates that the maternal effect from the smg-1 mutation is dominant. Unlike smg-2 and smg-5, smg-1 has not been reported to be required for RNAi or the production of WAGO-1-associated small RNAs (Domeier et al. 2000; Gu et al. 2009).

157

Figure 3-8: A smg-1 mutation affects the penetrance of the Fog phenotype in idDf1/+ animals.

A) The average percentage of Fog animals plus or minus standard deviation is reported for each category. At least 100 animals from two to twelve crosses were examined.

B) No germ-line feminization is detected in 832 animals from eight crosses using the fem-1(e2268) allele.

158

3.5 Discussion 3.5.1 Maternal-effect regulation of fem-1 has distinct genetic requirements

Previously, I established that the Fog phenotype of fem-1(Df)/+ m-z+ heterozygotes results from reduced fem-1 activity in the germ line of those animals and that is in turn caused by a lack of maternal fem-1 RNA. I proposed two types of model to explain this requirement for maternal RNA. In the first kind of model, the fem-1 locus could accumulate heritable chromatin modifications that reduce its activity in the absence of maternal RNA; the role of licensing RNA in this model would be to promote fem-1 activity by counteracting these modifications. A second type of model posits the existence of inhibitory molecules such as RNAs that impair fem- 1 activity; maternal RNA could provide a licensing function in this case by opposing these molecules. In performing a screen to identify modifiers of the Fog phenotype, I hoped to find factors that mediate the regulation of fem-1 activity relevant to licensing of fem-1 by maternal RNA or fem-1 silencing. Several tests were carried out in an effort to distinguish modifiers that affect germ-line fem-1 activity through other means. When a gene targeted by RNAi also affected the penetrance of Fog animals carrying fem-1(lf, ts) alleles or descended from fem-3 mothers, it suggested that the gene’s actions were not mediated through maternal-effect silencing and licensing. Based on the information currently available, I interpreted the Fog phenotype of the modifiers whose effects were specific to fem-1(Df)/+ m-z+ animals as being related to the maternal-effect regulation of fem-1, though additional experiments will be required to confirm this connection.

The nature of this screen and the genes that were tested affect the interpretation of the results. Many of the screened genes are themselves required for the mechanism of RNAi. While there is precedent for using RNAi to screen for genes involved in RNAi and related processes (Dudley et al. 2002; Kim et al. 2005), there remains a danger of false negatives with this approach. Inefficient knockdown of a gene’s activity may fail to reveal a phenotype that could be seen using mutant alleles of the gene. In previous studies of RNAi-related processes like cosuppression, the RNAi approach failed to detect some factors whose involvement had previously been demonstrated by other means (Robert et al. 2005). If any of the screened genes function redundantly in pathways affecting maternal-effect regulation of fem-1, their role would similarly be overlooked by this screen. In addition to screening the genes with RNAi, I also used

159

mutant alleles to test several of the identified modifiers. By scoring both XX and XO animals in this experiment, I detected differences between the sexes that were not suggested by my pilot screen with RNAi.

The hits from this screen provide a starting point in investigating the mechanism of maternal-effect silencing and licensing, but the identified modifiers may include genes that affect these processes indirectly. Additionally, many of the genes included in this screen have previously established roles in other forms of regulation that have overlapping requirements for limiting factors. For example, ERGO-1 is required for endogenous RNAi, and it competes with RDE-1 for components that are also required for exogenous RNAi. As a result, ergo-1 mutants have an enhanced RNAi (Eri) phenotype with respect to exogenous RNAi, not because ERGO-1 is involved in that process, but because RDE-1 has greater access to the shared components in ergo-1 mutants (Lee et al. 2006; Yigit et al. 2006). Similarly, some of the candidate modifiers that I have detected may upset the balance between other pathways in the germ line, resulting in an indirect effect on the regulation of germ-line feminization.

Initially, I desired to know whether functional RNAi is required for maternal-effect silencing and licensing both because the screen was performed using RNAi and because RNAi is an important form of regulation involving RNA. Since rde-1, ergo-1 and ppw-1 mutations did not affect the proportion of Fog animals produced from crosses between wild-type males and fem-1(Df) females, no absolute requirement for the exogenous or Eri endogenous RNAi pathways in silencing fem-1 was observed. RDE-1 was similarly dispensable for the licensing activity of exogenously provided fem-1 RNA injected into idDf2 females to rescue the Fog phenotype of their progeny. If the injected or endogenous maternal RNAs are processed during licensing, additional experiments will be needed to detect that requirement.

Maternal-effect silencing and licensing are also distinct from the other germ-line regulation processes tested: transposon silencing, transgene silencing and cosuppression. Some but not all of the genes required for each of these phenomena were implicated as modifiers of germ-line feminization in my screen. In all cases, these genes included both enhancers and suppressors of the Fog phenotype. The mechanism of gene regulation affecting the descendants of fem-1(Df) females is thus related to, but distinct from, all these previously described forms of regulation in the germ line.

160

3.5.2 T12E12.2 contributes to the penetrance of germ-line feminization detected in descendants of fem-1(Df) females

One of the genes known to be required for cosuppression, T12E12.2, encodes a chromodomain-containing protein, and its knockdown enhanced the Fog phenotype of the descendants of idDf1 females. idDf1 normally produces fewer heterozygous Fog progeny than do idDf2 and idDf3. Previously, I thought that the production of a chimeric fem-1 transcript in idDf1 might suffice to explain the difference in the penetrance of the phenotype. When a similar transcript is injected into the idDf2 germ line, provision of this RNA can partially rescue the Fog phenotype of idDf2/+ m-z+ animals (Chapter 2). I attributed the higher penetrance of the Fog phenotype from idDf2 and idDf3 mothers to the total absence of fem-1 RNA in those maternal germ lines. Here, I have shown that there is an additional reason why idDf2 and idDf3 produce more Fog progeny than does idDf1. The former alleles abrogate the expression of T12E12.2, which is located in the drp-1 operon immediately upstream of fem-1 on chromosome IV. When activity of T12E12.2 was reduced in idDf1 females using RNAi, the Fog phenotype was seen in a similar fraction of the cross-progeny of those animals as in descendants of idDf2 females. Since knockdown of T12E12.2 did not affect germ-line sex when females other than fem-1(Df) were used in the cross, T12E12.2 was not required directly for spermatogenesis, and inhibiting activity of T12E12.2 was not a general enhancer of weak feminization. Instead, it probably enhanced a base-line level of germ-line feminization caused by the absence of licensing fem-1 RNA in the germ line of fem-1(Df) females. The absence of this gene in idDf2 may help explain why some of the screened genes had different effects on idDf1/+ and idDf2/+ m-z+ animals.

The amount of feminization solely attributable to the absence of fem-1 RNA is not currently known. To address this question, I would need an allele that entirely removes germ line fem-1 RNA without affecting neighbouring genes. idDf1 is the only one of the fem-1(Df) alleles that is not compounded by loss of T12E12.2, but idDf1 does produce a chimeric fem-1 transcript. The production of a targeted deletion is theoretically possible using a modification of the MosSCI system to create a deletion rather than integrating a transgene (Frokjaer-Jensen et al. 2008; Frokjaer-Jensen et al. 2010), but will rely on the availability of an appropriate Mos1 transposon insertion to the left of fem-1 on chromosome IV. If a targeted fem-1 deletion were created using that method, it would be possible observe the penetrance of the Fog phenotype in animals whose mothers have wild-type levels of T12E12.2 in the germ line, but provide no

161

maternal fem-1 RNA. This approach could be complemented by introducing a germ-line expressed T12E12.2(+) transgene in the idDf2 background and asking whether the penetrance of the Fog phenotype decreases accordingly. Since transgenes made using conventional methods have limited expression in the germ line, the MosSCI system should be used to introduce a single-copy integrant, and expression levels of the transgene should be assessed. It should also be noted that the ultimate impact of maternal-effect silencing will depend not only on the amount of silencing produced by a single exposure to a mother lacking licensing RNA, but also on the permanence of the effect. Although fem-1 is not completely silenced after one cross to a fem- 1(Df) mother, the penetrance of the Fog phenotype increases to 95% within three generations, even using idDf1 (Chapter 2).

3.5.3 Germ-line silencing of fem-1 likely involves RNA

When reducing the activity of a gene by RNAi decreased the penetrance of the Fog phenotype, I inferred that the wild-type activity of that gene probably contributes to silencing fem-1 in the absence of maternal fem-1 RNA. Many of these suppressors were required for the Fog phenotype in descendants of idDf2 females. Previously, it was possible that the reduced activity of fem-1(+) observed in fem-1(Df)/+ m-z+ animals was entirely due to the lack of a positive function provided by maternal RNA without the presence of an additional inhibitory mechanism (Figure 3-7A). If silencing were merely a byproduct of the absence of licensing RNA, then the Fog phenotype should always be detected at a high penetrance in descendants of mothers with an allele like idDf2, which produces no fem-1 RNA. In contrast, the results of the screen showed that specific factors were required for silencing. These genes likely function in a silencing machinery that reduces the activity of fem-1 in the germ line. Its position with respect to licensing in the regulation of fem-1 could be either downstream or in parallel, but not upstream (Figure 3-9).

162

Figure 3-9: Formal models of how maternal-effect silencing and licensing may regulate fem-1.

Silencing refers to the mechanism by which fem-1 activity is heritably reduced in the germ line without regard to the means by which this regulation occurs. Licensing is a means of promoting fem-1 activity; depending on the model, fem-1 activity could be licensed by promoting the activity of positive factors targeting fem-1 or by interfering with silencing processes.

The identities of the suppressors provided further insight into how fem-1 might be silenced. The involvement of inhibitory RNAs targeting fem-1 seems increasingly likely since many of the suppressors are implicated in processes involving small RNAs. Three of the strongest suppressors are members of the Argonaute family. wago-4 is one of the worm-specific Argonautes. Like other members of this clade, it lacks key catalytic residues in the PIWI domain, but it is still required for RNAi in the germ line (Yigit et al. 2006). prg-1 and prg-2 are the Piwi orthologs in C. elegans. While PRG-1 is required for fertility and the presence of 21U- RNAs in the germ line, a role for prg-2 alone has not previously been demonstrated (Batista et al. 2008; Das et al. 2008; Wang and Reinke 2008). I showed here that both of these genes are required for the silencing of fem-1. The penetrance of the Fog phenotype was suppressed by a single mutation in either gene. 21U-RNAs have been identified as the piRNAs of C. elegans. In other organisms, piRNAs have been implicated in silencing transposable elements (Brennecke et al. 2007; O'Donnell and Boeke 2007). In C. elegans, the role for 21U-RNAs in transposon silencing seems limited, suggesting that they may serve additional functions in this organism.

163

The majority of the 21U-RNAs are expressed from two large clusters on chromosome IV, the same linkage group that contains fem-1 (Ruby et al. 2006; Kato et al. 2009). Perhaps the silencing of fem-1 involves its proximity to these 21U regions, a possibility that is tested in Chapter 4, though no reported 21U is a perfect match to fem-1.

Two nucleotidyltransferases were identified as suppressors. CDE-1 is active as a polyU polymerase in vitro (Kwak and Wickens 2007). This protein uridylates certain siRNAs, which seems to sort them into specific biological pathways (Claycomb et al. 2009; van Wolfswinkel et al. 2009). MUT-2 does not have in vitro polyU or polyA polymerase activity (Kwak and Wickens 2007), but it contains an aspartic acid triad and glycine-serine motif that are conserved in members of the nucleotidyltransferase family to which mut-2 belongs. The Rde and Mut phenotypes of animals with mutations in those residues of MUT-2 suggest that the polymerase activity is biologically relevant (Chen et al. 2005). siRNAs and tiny ncRNAs are reduced in mut-2 animals (Lee et al. 2006). Since this protein lacks a recognizable RNA-binding motif, it likely functions in conjunction with other factors.

Diverse additional proteins are involved in pathways regulating the production and function of small RNAs in C. elegans, including three other suppressors from my screen. DRH- 3 is a helicase required for germ-line development. It is necessary for accumulation of small RNAs involved in several different pathways (Duchaine et al. 2006; Aoki et al. 2007). DRH-3 and the Tudor domain protein EKL-1 function along with RNA-directed RNA polymerases in the biogenesis of 22G-RNAs associated with silencing in the germ line (Claycomb et al. 2009; Gu et al. 2009). These two proteins are also required for the meiotic silencing of unpaired DNA in the germ line, which involves deposition of the mark H3K9me2 (She et al. 2009). MUT-16 is required for the accumulation of siRNAs from transposons and during RNAi (Sijen and Plasterk 2003; Sijen et al. 2007). The glutamine/asparagine-rich domain and involvement of this gene in additional processes such as RNAi-TGS and cosuppression suggest that it may associate with chromatin (Grishok et al. 2005; Robert et al. 2005). Also required for RNAi-TGS are some of the PUF proteins identified as suppressors of the Fog phenotype. These RNA-binding proteins function redundantly in the regulation of maternal mRNAs during development (Lublin and Evans 2007).

164

The known functions of these suppressor genes (Figure 3-2) strongly indicate that RNA is involved in the zygotic silencing of fem-1 in the progeny of fem-1(Df) mothers, but further work will be needed before the mode of action is understood. The suppressors may produce RNAs that directly antagonize fem-1, an attractive possibility since it implies a role for licensing maternal fem-1 RNA in inactivating these inhibitory RNAs. Both transcriptional and post- transcriptional methods of regulation are possible based on the activities of the suppressors. Characterization of any RNAs targeting fem-1 or chromatin marks at the locus will help clarify the mechanism of action of these proteins. Models of their involvement should account for the heritability of the Fog phenotype and the ability of maternally provided fem-1 RNA to counteract this silencing (see Chapter 5 for more detailed models). Alternatively, these suppressors may act indirectly; perhaps targets of the endo-siRNAs produced by these genes actually silence fem-1.

3.5.4 Licensing of fem-1 expression by maternal RNA

Maternal provision of exon-containing fem-1 RNA effectively licenses the activity of fem-1 in the germ line by opposing the action of the silencing process described above, an effect achievable either by interfering with the silencing machinery or by promoting fem-1 expression independently of silencing (Figure 3-7 B, C). Promoting fem-1 expression could involve directly activating the gene, targeting other factors to fem-1 or positively regulating other activating factors. If a gene were required for licensing, then reducing the gene’s activity using RNAi could lead to an increase in the penetrance of the Fog phenotype among the progeny of fem-1(Df) animals. Several enhancers identified by my screen are candidates for involvement in licensing.

While a subset of the Argonaute family behaved as suppressors in the screen, other members were enhancers (Figure 3-7). Previously, the characterized members of this family have only been associated with processes that interfere with gene activity. It is plausible, however, that some of the genes could have acquired roles in promoting gene activity or that a given gene could be involved in both positive and negative regulation when acting with different cofactors. The Argonautes identified as enhancers are from the worm-specific branch of the family. They have intact PAZ domains for siRNA binding, but the catalytic residues of the RNA-slicing PIWI domain are mutated (Yigit et al. 2006). One of these genes, ppw-2, is required for transposon silencing and cosuppression (Vastenhouw et al. 2003; Robert et al.

165

2005). Three other closely related genes, wago-1, wago-2 and wago-5 all enhanced the Fog phenotype when tested by RNAi, but only the wago-1 gene showed the same effect when tested using mutant alleles. While the phenotypes of most genes were consistent when their activity was compromised with RNAi or mutations, this example affirms the usefulness of using mutant alleles to assess the possibility of off-target effects in RNAi. WAGO-1 interacts with a subset of 22G-RNAs in the C. elegans germ line, and many of its targets are subject to downregulation (Gu et al. 2009). Perhaps some of these targets are required for silencing fem-1. If so, the wago- 1 phenotype may be due to upregulation of those targets rather than enhancing the Fog phenotype through a fem-1-RNA-dependent mechanism. Alternatively, WAGO-1 could have additional, undocumented roles in the germ line. The unanticipated observation that a wago-1 mutation only behaved as an enhancer when the mother was homozygous for the mutation and the father provided a wild-type copy of wago-1(+) suggests that zygotic expression of fem-1 may involve opposing WAGO-1 inputs from the two parental germ lines. See Chapter 5 for a more detailed model involving multiple parental inputs.

Additional genes involved in small RNA regulation were also enhancers in my RNAi screen, but the results using mutant alleles differed. RDE-2 is a novel protein that physically interacts with the exonuclease-domain-containing MUT-7 in the cytoplasm (Tops et al. 2005). Both proteins act in a variety of processes in the germ line including transposon silencing, cosuppression, transgene silencing, and RNAi, and they may be required for secondary siRNA amplification (Ketting et al. 1999; Tabara et al. 1999; Robert et al. 2005; Tops et al. 2005; Lee et al. 2006). MUT-7 is also present in the nucleus and plays additional roles in processes involving endo-siRNAs (Gu et al. 2009). In my screen, rde-2 was an enhancer by RNAi, but a suppressor as a mutant. This inconsistency could be due to a difference in the degree of gene knockdown achieved by the two methods or the fact that the exo-RNAi machinery was active in one case. Since this gene contributes to multiple pathways including exo-RNAi, disrupting one of these pathways may affect the function of RDE-2 in the other processes. Similarly, mut-7 generally behaved as a suppressor using mutant alleles, although there were two exceptions: mut-7 m-z- XX animals descended from idDf1 or fem-1(e2268) females showed an increase in germ-line feminization. Perhaps there is a sex-specific role for mut-7 in some of the small-RNA-mediated processes.

166

As the phenotypes caused by these two mutations may be due to their impact on interconnected small-RNA pathways, so too the involvement of the smg genes may stem from a disruption in the balance of assorted RNAs in the germ line. All three smg genes tested in my screen are involved in the nonsense-mediated decay pathway (Hodgkin et al. 1989; Pulak and Anderson 1993), and smg-2 and smg-5 are required for sustainability of the RNAi response and accumulation of some 22G-RNAs (Domeier et al. 2000; Gu et al. 2009). smg genes could affect the silencing and licensing of fem-1 by altering the availability of different classes of RNAs in the germ line or by acting as cofactors with other involved proteins, as has been suggested for WAGO-1 in the 22G-RNA pathway (Gu et al. 2009).

In addition to discovering enhancers predicted to interact with RNA, the screen also yielded genes with potential roles in chromatin remodelling. RHA-1 is an RNA helicase required for development of the germ line. It is required for cosuppression (Robert et al. 2005) and for the methylation of H3K9 necessary for transgene silencing and X chromosome silencing in the germ line (Walstrom et al. 2005). Loss of rha-1 leads to desilencing in those processes versus the increased silencing of fem-1 in my assay. The rha-1 mutant may desilence a gene that promotes the silencing of fem-1, or perhaps RHA-1 can function to promote expression when paired with different cofactors. An example of such a role is provided by the D. melanogaster RHA-1 homologue, Maleless, a component of the dosage compensation complex that upregulates expression from the single X chromosome in male flies. The complex contains a histone acetyltransferase with a Tudor domain (Males-absent-on-the-first) that is homologous to mys-2, one of the other enhancers from my screen. The dosage compensation complex is targeted to the X chromosome using roX RNAs (Ilik and Akhtar 2009). If licensing of fem-1 activity involves chromatin marks that promote transcription, perhaps a similar complex is recruited to the fem-1 locus by the maternally provided fem-1 RNA.

Other enhancers that may affect chromatin either at fem-1 or at another gene that regulates fem-1 are the previously mentioned chromodomain-containing gene T12E12.2 and epc- 1. EPC-1 is homologous to Enhancer of Polycomb in D. melanogaster and similarly named components of the yeast NuA4 and mammalian Tip60 histone acetyltransferase complexes. Together with genes homologous to the other members of those complexes, epc-1 is involved in regulating a signalling pathway in C. elegans, possibly at the chromatin level (Ceol and Horvitz 2004; Poulin et al. 2005). Unfortunately, the other members of the putative C. elegans version

167

of this complex could not be tested in my screen (Table 3-6). It is also possible that epc-1 acts as an enhancer of the Fog phenotype because of a slight feminizing phenotype reported in other systems, though I did not detect feminization in my controls for this screen (Grote and Conradt 2006).

Germ-line-specific P granules are implicated in licensing by the detection of pgl-1 as an enhancer in my screen. pgl-1 encodes a predicted RNA-binding protein required for the formation of P granules (Kawasaki et al. 1998). Perhaps P granules store, process or stabilize maternal RNAs including the fem-1 transcripts required for licensing. Since P granules are predicted to regulate mRNAs post-transcriptionally as they exit the nucleus, perhaps these organelles also contain maternally inherited licensing complexes that monitor zygotic transcription products and compare them to the maternal germ-line transcriptome. Through the nuclear pores, there could be additional levels of communication between the P granule and the DNA that permit transmission of heritable molecules or marks for this epigenetic regulation in future generations. Another possibility is that disrupting P granules increases the efficiency of factors involved in maternal-effect silencing.

Combining the information about both classes of modifiers in my screen, it seems that RNA is involved in both the maternal-effect silencing of fem-1 and the opposing licensing activity of maternal fem-1 RNA. The different RNAs involved in these and other forms of regulation in the germ line may be differentiated by factors such as their size, modifications, localization and cofactors. Additional experiments will be required in order to assess whether licensing RNAs are uridylated or localized to P granules, as may be suggested by the identification of CDE-1 and PGL-1 as enhancers in my screen. The enhancers identified here may serve as cofactors with fem-1 RNA in a process that actively antagonizes the silencing machinery or works in parallel to oppose it, meaning that I cannot yet distinguish between the two remaining formal models in Figure 3-9. The identities of the enhancers are consistent with models where the licensing RNA counteracts a silencing RNA and/or where a licensing complex produces changes in the chromatin at the fem-1 locus (see Chapter 5).

168

Chapter 4 Investigating the targeting of fem-1 for silencing

Statement of contributions:

I performed all the experiments in Chapter 4. Alignment of small RNA sequence reads was done by Dr. Andrew Spence. The Gene CATCHR fem-1 construct was provided by Holly Sassi and Dr. Ramona Cooperstock. Michael Schertzberg generated the original transgenic lines carrying the integrated sequences idIs15, idIs17 and idIs18.

169

4 Investigating the targeting of fem-1 for silencing 4.1 Abstract

Many silencing processes promote genome surveillance in the germ line to reduce the likelihood of harmful, heritable mutations. In C. elegans, many of these mechanisms involve recognition of unusual characteristics of a section of the genome, either based on the DNA itself or RNAs that are produced from the region. Previously, I described a new form of genetic regulation in the C. elegans germ line where maternal RNA from the gene fem-1 is required in order for that locus to be expressed in the zygotic germ line. In the absence of maternal fem-1 RNA, germ-line feminization resulting from reduced fem-1 activity is observed. The results of my RNAi screen for suppressors of maternal-effect silencing in Chapter 3 suggested that this process is related to other mechanisms of genetic surveillance in the germ line. Previously, I showed that provision of maternal RNA opposed germ-line feminization in the descendants of fem-1(Df) homozygotes; here, I asked whether maternal RNA could counteract another form of regulation, the silencing of a multicopy transgene. I also tested a second gene, fem-2, for this maternal-effect silencing and showed that the activity of fem-2 is not detectably reduced in the same way as fem-1. I then assessed two features of the fem-1 locus to ask whether a specific characteristic of the gene makes it susceptible to maternal-effect silencing in the absence of maternal RNA. Neither the genomic location of the locus nor the presence of an intronic repeat element was required for fem-1 to be silenced. The maternal-effect silencing I have described remains unique in that it can be opposed by provision of maternal RNA, though the mechanism by which fem-1 activity is reduced in the absence of this RNA requires further clarification.

4.2 Introduction

The germ line is a tissue in which gene expression tends to be negatively regulated. Since functional gametes must produce a totipotent single-cell embryo, expression of the wrong cell fate determinants could affect the ability of an organism to reproduce. Germ cells are also unique in that mutations in their nuclei will be transmitted to every cell of the developing animal produced upon fertilization. In C. elegans, several mechanisms work together to promote a

170

restrictive environment in the germ line, which may provide protection against unwanted gene expression.

Many of these forms of regulation involve recognizing unusual sequences that may indicate a foreign DNA element. In the Bristol isolate of C. elegans, transposons including Tc1 are active in the soma, but not the germ line. Mutations in mutator genes such as mut-2 and mut- 7 indicate that the germ line would be permissive for transposition were it not for a defense mechanism preventing it (Collins et al. 1987; Ketting et al. 1999). Small RNAs produced from the scattered copies of Tc1 are associated with the silencing (Sijen and Plasterk 2003). Because of a related process, the same transgene that rescues a mutant phenotype in the soma can be targeted for silencing in the germ line (Gaudet et al. 1996; Kelly et al. 1997). In a process termed cosuppression, this silencing sometimes extends to the cognate loci of the genes included on the transgene (Jones and Schedl 1995; Gaudet et al. 1996; Dernburg et al. 2000). Each of these processes requires an overlapping but distinct set of genes, and components of the RNAi machinery are often involved (Dernburg et al. 2000; Sijen and Plasterk 2003; Vastenhouw et al. 2003; Robert et al. 2005). Another small-RNA-mediated process, the meiotic silencing of unpaired DNA in the germ line, also involves the introduction of a histone modification associated with heterochromatin and transcriptional repression (Bean et al. 2004; She et al. 2009).

In Chapter 2, I described a previously unknown form of regulation affecting the activity of the fem-1 gene in the germ line. Earlier work showed that the sex-determining gene fem-1 is required for all aspects of male development in C. elegans, including the promotion of spermatogenesis in both XO males and XX hermaphrodites (Doniach and Hodgkin 1984). Chapter 2 demonstrated that when females carrying any of three deficiency alleles, together termed fem-1(Df), are crossed to wild-type males, many of their heterozygous progeny have feminized germ lines (the Fog phenotype). The germ line is feminized because of a reduction in zygotic fem-1 activity in that tissue, and this phenotype can be rescued by providing in vitro- transcribed fem-1 RNA in the germ line of the fem-1(Df) mother. I suggested that maternal provision of fem-1 RNA is required to license fem-1 activity in the zygotic germ line and that fem-1 is subject to silencing in the germ line when maternal fem-1 RNA is not provided.

171

Modifiers of the fem-1(Df) maternal effect were identified using an RNAi screen as outlined in Chapter 3. The screen detected both enhancers and suppressors of the Fog phenotype seen in fem-1(Df)/+ m-z+ heterozygotes. When reducing the activity of a gene led to an increase in the proportion of Fog animals, it suggested that the normal function of that gene is to promote the licensing of fem-1. Conversely, genes detected as suppressors in the RNAi screen are likely required for the silencing of fem-1. Since RNAi targeting these genes could suppress the Fog phenotype even under conditions where there is no licensing RNA present, there is an active silencing process affecting fem-1; the Fog phenotype cannot be attributed solely to the absence of the positive function of maternal RNA in promoting fem-1 activity. This silencing could involve inhibiting factors required for fem-1 RNA accumulation or direct repression of fem-1 by transcriptional and/or post-transcriptional means. Many of these suppressor genes were initially tested because they are also involved in the other silencing processes in the germ line. Here, I investigated the possibility of a link between maternal-effect silencing and one of the other phenomena: transgene silencing. I asked whether provision of maternal RNAs could desilence a repetitive transgenic array in the germ line in the same way that the maternal-effect silencing of fem-1 is relieved.

I am interested in further examining the mechanism leading to the Fog phenotype in fem- 1(Df) m-z+ animals. One possibility is that all genes are subject to silencing in the germ-line in the absence of maternally provided RNA. Using an appropriate allele of another gene, I examined the generality of this effect. Alternatively, it is also plausible that the silencing process targets fem-1 because of specific features of the locus that may be shared with foreign DNA elements and only a subset of other genes. In that case, the licensing by maternal RNA may be a means of permitting the expression of genes required in the germ line in order to ensure that they are not inappropriately silenced by this surveillance mechanism.

Possible candidates for characteristics of fem-1 that may contribute to its silencing are its position on chromosome IV or specific sequence elements associated with this gene. The identities of the suppressor genes provide hints about factors that may be involved in silencing fem-1. Several of the genes are involved in the biogenesis of small RNAs or other aspects of RNA processing. The suppressors include members of the Argonaute family, a group of proteins implicated in binding small RNAs. PRG-1 is a Piwi-related Argonaute required for germ-line development that is involved in the biogenesis of 21U-RNAs found in the germ line of C.

172

elegans (Batista et al. 2008; Das et al. 2008; Wang and Reinke 2008). These RNAs resemble piRNAs (Piwi-interacting RNAs) that are involved in the silencing of transposons in other organisms (Brennecke et al. 2007; Houwing et al. 2007), and one transposon has been identified as a target of certain 21U-RNAs in C. elegans (Batista et al. 2008; Das et al. 2008). Other suppressors implicated in RNA-mediated regulation include the Argonaute WAGO-4, the Dicer- related helicase DRH-3, the Tudor domain protein EKL-1, the nucleotidyltransferases CDE-1 and MUT-2, and members of the PUF family of proteins (Collins et al. 1987; Ketting and Plasterk 2000; Chen et al. 2005; Lee et al. 2006; Yigit et al. 2006; Lublin and Evans 2007; Gu et al. 2009; She et al. 2009; van Wolfswinkel et al. 2009). The identities of these suppressor genes suggested that at least two kinds of RNA are involved in the maternal-effect regulation of fem-1: maternal fem-1 RNA is required to license fem-1 activity, and other RNAs are probably involved in silencing fem-1. By examining small RNAs present at or near the fem-1 locus, I identified candidate molecules that may effect fem-1 silencing. I tested whether certain DNA elements in fem-1 were responsible for the silencing of fem-1, possibly by producing antagonizing RNAs.

4.3 Materials and Methods 4.3.1 Nematode maintenance and alleles

Nematodes were cultured as described (Brenner 1974) using MYOB agar (Church et al. 1995) instead of NGM. All experiments were conducted at 20°C. The wild-type strain is the N2 Bristol isolate. Except as noted, the following mutations are described in Wormbase (http://www.wormbase.org/).

LG II: idSi1[Cbr-unc-119(+) fem-1(AS#CJ55)], idSi2[Cbr-unc-119(+) fem- 1(AS#CJ55)], idSi3[Cbr-unc-119(+) fem-1(AS#CJ55)], idSi5[Cbr-unc-119(+) fem- 1(AS#CJ56)], idSi6[Cbr-unc-119(+) fem-1(AS#CJ56)], ttTi5605, trIs41[him-4p::unc-40::yfp rol-6(su1006dm)]

LG III: dpy-1(e1), fem-2(tm337), pha-1(e2123ts), unc-119(ed3)

LG IV: dpy-20(e1282ts), fem-1(e2268), idDf2, mor-2(e1125), ttTi13792, unc-5(e53), unc- 24(e138)

173

LG X: unc-7(e5)

The following transgenes are unlinked to chromosome IV, but they have not been further mapped.

Integrated arrays: idIs15[3xFlag::fem-1(+) unc-119(+)], idIs17[3xFlag::fem-1(+) unc- 119(+)], idIs18[3xFlag::fem-1(+) unc-119(+)]

Extrachromosomal array: ccEx7271[pha-1(+) let-858::gfp]

4.3.2 C. elegans strain information

The names and genotypes of strains used in this chapter are provided in Table 4-1. Strain-building was performed as described below. Strain RP1446 was provided by Dr. Peter Roy. IE13792 is from the NemaGeneTag Consortium. EG4322 was provided by Dr. Erik Jorgensen through AddGene.

AS600: The trIs41 transgene from RP1446 and the unc-5(e53) dpy-20(e1282ts) chromosome from CB2223 were incorporated into a strain with fem-1(e2268) from CB4260.

AS606: The strain IE13792 contains a Mos1 insertion, ttTi13792, at position 30477 in clone B0273 from chromosome IV. To generate a strain that can be used for MosSCI, an unc-119 mutation from strain DP38 was incorporated along with ttTi13792. The Mos1 insertion can be followed by PCR using primers oASCJ82 to R13792bis to detect the 551 bp N2 band and oJL102 to oJL103 to detect the 355 bp insertion band.

AS528, AS530, AS531: Dr. Ramona Cooperstock and Holly Sassi generated a plasmid containing genomic sequence of C. elegans fem-1 including 5 kb of DNA upstream of the gene and 2 kb downstream (see Figure 4-2) using the Gene CATCHR system (Sassi et al. 2005). Michael Schertzberg used ballistic transformation (Wilm et al. 1999) to generate several lines of C. elegans harbouring randomly integrated, possibly multicopy transgenes with this plasmid. The transgene can be detected using PCR with primers unc-119 CB.F and CENARS.R. In

174

building strains AS528, AS530 and AS531, I incorporated three of these transgenes (idIs15, idIs17, idIs18) into lines carrying the fem-1(e2268) mutation from CB4260. The mutation unc- 119(ed3) was not followed in making these strains, but it may still be present. The integration sites of the transgenes have not been mapped, but I showed that they are not linked to the fem-1 locus as I made the double mutants.

Table 4-1: Names and genotypes of C. elegans strains. Strain name Genotype AS379 idDf2 unc-24(e138)/unc-5(e53) dpy-20(e1282) IV; unc-7(e5) X AS380 e2268 unc-24(e138)/unc-5(e53) dpy-20(e1282) IV; unc-7(e5) X AS528 idIs15[3xFlag::fem-1(+) unc-119(+)]; fem-1(e2268) IV AS530 idIs17[3xFlag::fem-1(+) unc-119(+)]; fem-1(e2268) IV AS531 idIs18[3xFlag::fem-1(+) unc-119(+)]; fem-1(e2268) IV AS592 idSi1[Cbr-unc-119(+) fem-1(AS#CJ55)] II; unc-119(ed3) III AS593 idSi2[Cbr-unc-119(+) fem-1(AS#CJ55)] II; unc-119(ed3) III AS594 idSi3[Cbr-unc-119(+) fem-1(AS#CJ55)] II; unc-119(ed3) III AS596 idSi5[Cbr-unc-119(+) fem-1(AS#CJ56)] II; unc-119(ed3) III AS597 idSi6[Cbr-unc-119(+) fem-1(AS#CJ56)] II; unc-119(ed3) III RP1446 trIs41[him-4p::unc-40::yfp rol-6(su1006dm)] II AS600 trIs41[him-4p::unc-40::yfp rol-6(su1006dm)] II; fem-1(e2268)/unc-5(e53) dpy- 20(e1282) IV AS601 idSi1[Cbr-unc-119(+) fem-1(AS#CJ55)] II; fem-1(e2268) IV AS602 idSi2[Cbr-unc-119(+) fem-1(AS#CJ55)] II; fem-1(e2268) IV AS603 idSi3[Cbr-unc-119(+) fem-1(AS#CJ55)] II; fem-1(e2268) IV AS604 idSi5[Cbr-unc-119(+) fem-1(AS#CJ56)] II; fem-1(e2268) IV AS605 idSi6[Cbr-unc-119(+) fem-1(AS#CJ56)] II; fem-1(e2268) IV AS606 unc-119(ed3) III; ttTi13792 IV CB2223 unc-5(e53) dpy-20(e1282ts) IV CB4260 fem-1(e2268)/unc-5(e53) IV DP38 unc-119(ed3) III EG4322 ttTi5605 II; unc-119(ed3) III IE13792 ttTi13792 IV FX337 fem-2(tm337)/dpy-1(e1) III PD7271 pha-1(e2123ts) III; ccEx7271[pha-1(+) let-858::gfp]

175

4.3.3 Plasmids used

Plasmids for MosSCI protocol (Frokjaer-Jensen et al. 2008)

pCFJ90: myo-2 promoter (pharyngeal muscle) driving worm mCherry with unc-54 3’UTR

pCFJ104: myo-3 promoter (body wall muscle) driving worm mCherry with unc-54 3’UTR

pCFJ151_p5605: C. briggsae unc-119 gene flanked by 1.5 kb sequence to either side of the Mos1 insertion at ttTi5605

pGH8: rab-3 promoter (neuronal) driving worm mCherry with unc-54 3’UTR pJL43-1: glh-2 promoter (germ line) driving Mos1 transposase with intron and glh-2 3’UTR

Plasmids for MosSCI with fem-1

pAS#CJ55: MosSCI-compatible plasmid carrying a fem-1 minigene with introns 1, 7, 8, 9

pAS#CJ56: MosSCI-compatible plasmid carrying a fem-1 minigene with introns 2, 3, 4, 5, 6

pAS#CJ65: C. briggsae unc-119 flanked by a region to the left of ttTi13792 and to the right of fem-1.

Template for in vitro transcription

pTU#65: Made from pBluescript II KS (+) and a gfp cDNA reported by Prasher et al. (1992). Includes a CAG-->CGG mutation at codon 80.

Plasmids for used for cloning

pAS#1212: Contains a fem-1 minigene with introns 1, 7, 8, 9 (Gaudet et al. 1996)

pAS#1235: Contains a fem-1 minigene with introns 2 to 6, inclusive (Gaudet et al. 1996)

176

pAS#CJ63: Intermediate construct for cloning AS#CJ65

pMM571: Contains the C. briggsae unc-119 gene with promoter

4.3.4 Plasmids constructed

Descriptions of plasmid construction are provided below. The sequences of primers used in cloning are given in Table 4-2.

pAS#CJ53: The C. briggsae unc-119 gene was amplified in a 2386 bp fragment with primers oASCJ62 and oASCJ63. After digestion with NotI and BamHI, this fragment was incorporated into the doubly digested 7282 bp pAS#1212 containing a fem-1 minigene with introns 1, 7, 8 and 9. pAS#CJ55: A 4404 bp XhoI-SpeI fragment of plasmid pAS#CJ53 (fem-1 minigene with introns 1, 7, 8, 9) was cloned into a similarly digested 7368 bp fragment of the MosSCI-compatible plasmid pCFJ151_p5605. pAS#CJ56: A 3010 bp XhoI-SpeI fragment of plasmid AS#1235 (fem-1 minigene with introns 2 through 6, inclusive) was cloned into a 7368 bp fragment of the MosSCI-compatible plasmid pCFJ151_p5605. pAS#CJ63: Using a wild-type genomic DNA template, PCR with primers oASCJ72 and oASCJ73 amplified a 1406 bp fragment of DNA immediately to the right of fem-1 on chromosome IV. After digestion with PmlI and SpeI, this fragment was cloned into a 5966 bp piece of plasmid pCFJ151_p5605 to replace the right-hand flanking sequence of ttTi5605. pAS#CJ65: Primers oASCJ80 and oASCJ81 generated a 1.5 kb PCR product to the left of ttTi13792 using a genomic DNA template. This fragment was digested with ApaI and SmaI to be cloned into the 5989 bp fragment of ApaI- and HpaI-digested pAS#CJ63. This construct lacks 29 bp of the unc-119 promoter and replaces it with a 5’ flanking sequence of CCC, but the unc-119 gene is still functional.

177

Table 4-2: Names and sequences of primers used during cloning. Primer name DNA sequence (5’ to 3’) oAS_CLJ_F_fem-2 TATCTGGTGCTCCTGGCTTG oAS_CLJ_R_fem-2 ATCGGAATCTTCATCGTCTG oAS_CLJ_QPCR3 TGTTCCAACCATTCAGCATG oAS_CLJ_QPCR4 CCACTTCTGATCCGACACA oAS_CLJ_QPCR8 TGCTCCGCCGAGTATTCGCTCT oAS_CLJ_QPCR16F GAGCACACACAGATGTTCAC oASCJ62 TATTAGCGGCCGCAGGAAGCAACCTGGCTTATC oASCJ63 TTTCCCAGTCACGACGTTGT oASCJ64 TTTCGCTGTCCTGTCACACT oASCJ65 GCTCAGAGCATTGCTTATCTC oASCJ66 GAAATCATCCCTTGTTGGGAGT oASCJ67 GCCCAGGAGAACACGTTAGT oASCJ72 GGTACTAGTACTCCTCGTGATTTGTCGTC oASCJ73 GGTCACGTGCTCATCTTTCACTGCATCCA oASCJ76 CAATGCTTCTCGGTGCTTAAC oASCJ77 AATCGGGAGGCGAACCTAAC oASCJ82 CACAGCTTCACCTCCAACTG oCF418 TCTGGCTCTGCTTCTTCGTT oJL102 CAACCTTGACTGTCGAACCACCATAG oJL103 TCTGCGAGTTGTTTTTGCGTTTGAG R13792bis AAGGGACCCGATGAGTAAGC

4.3.5 Measuring fem-2(tm337) RNA production

Two batches of fifteen fem-2(tm337) young adult gonad arms were dissected as described for in situ hybridization in Chapter 2. RNA was extracted using Qiagen’s RNeasy kit and eluted twice with 30 μl of RNAse-free water. 7.7 μl of RNA was reverse transcribed using a TaqMan

reverse transcriptase reaction with oligo d(T)16 primers according to the manufacturer’s instructions. In parallel, a control reaction including RNA, but lacking the reverse transcriptase enzyme, was performed. cDNA was purified using Qiagen Qiaquick PCR purification columns and eluting twice with 30 μl of water. To detect pgk-1 and fem-2 cDNAs, oAS_CLJ_QPCR3 and oAS_CLJ_QPCR4 or oAS_CLJ_F_fem-2 and oAS_CLJ_R_fem-2 primers were used in reactions with 3 μl of cDNA template.

178

4.3.6 Testing fem-2(tm337) for a maternal effect

Six crosses were performed using N2 males and females from strain FX337. At least

sixty F1 animals per cross were scored for the Fog phenotype over two to three days. Heterozygous males backcrossed to fem-2(tm337) females for seven generations also did not show evidence of germ-line feminization. +/tm337 XO animals were identified by their male soma for use in backcrossing, whereas tm337/tm337 XO animals were feminized.

4.3.7 Small RNA analysis

Small RNA sequencing data of wild-type and prg-1 mutant animals was reported by Batista et al. (2008) using a cloning protocol that did not require the RNAs to have a 5’ monophosphate. Our analysis used RNA sequences from series GSE11734, GSE11735 and GSE11736 of the GEO database. The raw data were transformed into FASTA format using a Perl script. Sequences were aligned to the fem-1 regions using the Bowtie program (Langmead et al. 2009). A Perl script grouped sequences that were on the same strand and shared the same 5’ end, noting the number of reads represented by each group. A list of these groups and their positions along the chromosome was then displayed in the WormBase genome browser.

4.3.8 Randomly integrated transgenes with full length fem-1(+)

Strains AS528, AS530 and AS531 are all homozygous for the allele fem-1(e2268), and each strain contains an independent integrated transgene carrying a full-length genomic fem-1 construct (see Figure 4-2) as the sole source of fem-1(+). Using heat shock and backcrossing, I produced males from the idIs# ; fem-1(e2268) IV lines. The transgenes provided sufficient fem- 1(+) activity to yield fertile males; however, the transgenes were also subject to cosuppression as evidenced by the occurrence of feminization in the progeny of crosses between transgenic males and fem-1(e2268) females. The Po males were crossed to fem-1(y) unc-24 IV; unc-7 X females, where y = e2268 or idDf2. The Fog phenotype of at least 50 XX animals was scored over two days. The mean and its standard error were calculated from at least three crosses for each line.

179

The germ-line sex of XO animals is not reported because they could not be quantified accurately; these animals were often also somatically feminized and would burst when placed on slides.

4.3.9 Single-copy fem-1 minigenes The MosSCI system can be used to generate single-copy transgenes at a specified locus (Frokjaer-Jensen et al. 2008). I used the previously characterized Mos1 insertion site ttTi5605 on chromosome II since it is competent for expression in the germ line. Unlike the fem-1 locus, there was no evidence of prg-1-dependent small RNAs near ttTi5605 based on sequence data from Ruby et al. (2006) and Batista et al. (2008). I injected strain EG4322 (ttTi5605 II; unc-119 III) with 50 ng/μl of plasmid AS#CJ55 or AS#CJ56 along with the other markers as described in the direct insertion protocol by Frokjaer-Jensen and colleagues (2008). I screened F3 animals for wild-type movement and lack of mCherry expression to identify putative carriers of integrated transgenes. Correct integration and intactness of the transgene were verified by PCR in strains AS592 to AS597 as described below. For pAS#CJ55, six transgenic lines were obtained from 29 injected animals, and three of the transgenes were properly integrated. Injecting 58 animals with pAS#CJ56 produced three transgenic lines, two of which contained correctly integrated transgenes. The transgenes were outcrossed twice in building strains AS601 to AS605, which are homozygous for fem-1(e2268) and the integrated transgene. For example, AS601 is idSi1[Cbr-unc-119(+) fem-1(AS#CJ55)] II; fem-1(e2268) IV. AS600 was used to build these strains. AS600 contains a yfp marker on chromosome II which can be followed in trans to the integrated transgenes during strain-building. Homozygosity of the transgene was confirmed by PCR in the final strain. A multiplexed PCR reaction with primers oASCJ65, oASCJ67 and oAS_CLJ_QPCR16F can detect both the 332 bp N2 band and the 1.5 kb insertion band.

Complete rescue of the fem-1(e2268) mutant phenotype in AS601 to AS605 demonstrated the function of the transgenes and suggested that integrants generated by MosSCI are not susceptible to cosuppression, unlike transgenes introduced by other methods. Males were produced from these lines using heat shock and backcrosses. These males were crossed to fem- 1(y) unc-24 IV; unc-7 X females, where y = e2268 or idDf2. The Fog phenotype was scored for both XX and XO progeny. The percentage of Fog animals was recorded from a sample of at least

180

50 animals over three days for each cross. The average and standard error from at least three such crosses are reported for every transgenic line.

4.3.10 Verifying transgene integration in MosSCI-generated lines

Using the MosSCI protocol, I injected ttTi5605 II; unc-119 III animals and identified non-Unc F3 progeny lacking mCherry expression which should contain a properly integrated transgene. Occasionally, such animals contain a transgene that has small internal deletions or that has been integrated into another site (Frokjaer-Jensen et al. 2008). The PCR assays outlined in Table 4-3 distinguish these possibilities from the desired integrants, ensuring that both integration sites are correct, the Mos1 transposon is no longer present, and the fem-1 minigene is intact.

Table 4-3: PCR diagnostics of transgenes integrated using MosSCI. Region to be tested Primers Size of product Integration boundary: left oCF418 1.7 kb oASCJ66 Integration boundary: right oASCJ76 1.8 kb oASCJ77 Mos1 transposon oJL102 355 bp oJL103 Intact fem-1 minigene: 5’ end oASCJ64 3.3 kb (AS#CJ55) oAS_CLJ_QPCR8 2 kb (AS#CJ56) Intact fem-1 minigene: 3’ end oASCJ67 1.6 kb (AS#CJ55) oAS_CLJ_QPCR16F 1.5 kb (AS#CJ56)

4.3.11 Attempting to delete fem-1 using MosSCI

The MosSCI-compatible strain AS606 contains the Mos1 insertion allele ttTi13792 19 kb away from fem-1. The plasmid pAS#CJ65 contains sequence from the right of fem-1 and the left of ttTi13792 flanking unc-119(+). If the MosSCI protocol were to integrate unc-119(+) from the plasmid into chromosome IV, it would delete the entire fem-1 gene without removing any part of the drp-1 operon. I injected over fifty animals with this plasmid at 50 ng/µl along with the other constructs required for MosSCI. Although many plates produced non-Unc F1 animals, they did not generate any lines with non-Unc animals that lacked mCherry expression.

181

4.3.12 RNA injection into animals with a silenced transgene

pTU#65 plasmid DNA was linearized with EcoRI to serve as a template for in vitro transcription. Roche T3 RNA polymerase was used according to the manufacturer’s instructions to produce sense gfp RNA. Template DNA was removed by treatment with DNaseI (Ambion). Transcripts were purified following electrophoresis on a non-denaturing agarose gel using Bio 101 Systems’ RNaid Spin Kit. Two separate RNA preparations were used for injection. Injection mixes contained 100 nM RNA and 0.125% Lucifer Yellow dye to permit monitoring of the injection. Young adult PD7271 animals were injected as described (Mello et al. 1991). This strain carries an extrachromosomal array with a let-858::gfp transgene that is expressed in somatic nuclei, but is susceptible to silencing in the germ line (Kelly et al. 1997). I used fluorescence microscopy to detect GFP expression in the self-progeny of injected animals. 15 to 50 progeny of 35 injected animals were examined for evidence of GFP expression in the germ line.

4.4 Results 4.4.1 Testing the ability of RNA injection to desilence a transgene

In C. elegans, transgenes generated by microinjection are often subject to silencing in the germ line (Kelly et al. 1997). Silenced transgenes in the germ line accumulate methylation of H3K9 and lack activating histone modifications (Kelly et al. 2002). The same transgene that rescues mutant phenotypes in the soma can be silenced in the germ line where it can also target its cognate locus for silencing in a process termed cosuppression (Jones and Schedl 1995; Gaudet et al. 1996; Dernburg et al. 2000). Given that multicopy transgenes are more susceptible to silencing and an intact promoter is required for cosuppression, it has been suggested that an RNA mediator is involved in the process (Kelly et al. 1997; Dernburg et al. 2000). One of the reporter genes used in the study of transgene silencing is let-858::gfp. When expressed from a repetitive array, let-858::gfp is not expressed in the germ line, but increasing the sequence complexity of the array by coinjection of additional plasmid and genomic DNA sometimes increases germ-line expression (Kelly et al. 1997).

182

Given that let-858::gfp includes gfp sequence that would not be present in the maternal germ line, I wondered if the absence of maternal gfp RNA might also contribute to the transgene’s silencing in the germ line. I made gfp RNA by in vitro transcription and injected it into the germ line of animals carrying the let-858::gfp transgene. Examining the self-progeny of injected animals, I saw no evidence of GFP expression in the germ line of these animals. Injected N2 animals likewise produced no offspring with fluorescent germ lines. If the absence of maternal gfp RNA does contribute to silencing, it is redundant with other silencing processes that target this transgene in the germ line.

4.4.2 Examining another gene for susceptibility to silencing

Previously, I characterized the germ-line feminization of fem-1(Df)/+ m-z+ animals. I concluded that the Fog phenotype results from the reduced activity of the fem-1 locus in these heterozygotes and that provision of maternal fem-1 RNA is required in order to promote germ- line expression of the gene. If silencing in the absence of maternal RNA were a form of regulation that extended to other genes in addition to fem-1, we might be able to detect evidence of their silencing given appropriate alleles. However, it is not trivial to obtain such alleles. A candidate gene must be expressed in the germ line, but must not be essential for development of the germ line; otherwise, XX animals homozygous for the mutant alleles would be infertile. The mutant allele must disrupt not only activity of the protein, but also RNA production. In order to permit detection of a maternal effect upon elimination of RNA, there should not be a requirement for maternal protein production.

One such allele was identified in Wormbase: fem-2(tm337). fem-2 is required for male development in the germ line of both sexes and the XO soma. The position of the fem-2(tm337) deletion suggested that it may abolish transcription (Figure 4-1A). Using RT-PCR, I confirmed that no fem-2 RNA was produced by this allele (Figure 4-1B). I then performed a cross analogous to the experiments with fem-1(Df) alleles. fem-2(tm337) females were crossed to wild-type males, and the germ-line sex of their progeny was scored. Of 446 animals scored, only one was Fog. Even backcrossing the paternally-inherited fem-2(+) allele to fem-2(tm337) females for seven generations failed to produce evidence of germ-line feminization. If activity of the fem-2 allele was reduced, its levels remained sufficient to promote spermatogenesis.

183

Figure 4-1: Testing a fem-2 allele for maternal-effect silencing.

A) The deleted region of fem-2 DNA in the tm337 allele is depicted by a bar. Exons are filled boxes, introns are intervening lines, and UTRs are empty boxes. The orientation is indicated by an arrow pointing in the 3’ direction. (Adapted from Wormbase.)

B) Diagnostic PCR of pgk-1 and fem-2 cDNAs in reverse transcription products of wild- type and fem-2(tm337) RNA from dissected germ lines. The gel shown is representative of results obtained with two separate samples of RNA.

C) Cross used to test for germ-line feminization in the progeny of fem-2(tm337) females and wild-type males.

D) Percentage of Fog animals observed among the F1 progeny of six crosses.

184

185

4.4.3 Testing cis sequence requirements for silencing

Since fem-2 does not seem to be subject to the same maternal-effect silencing as fem-1, I wondered if a specific feature of fem-1 or its chromosomal location targeted the gene for silencing. The silenced locus is located on chromosome IV. The genomic context of this position includes the presence of several 21U-RNA loci immediately downstream of fem-1. Although their role is poorly understood, 21U-RNAs have been associated with silencing in the C. elegans germ line (Batista et al. 2008; Das et al. 2008). Additionally, processing of these RNAs requires the activity of prg-1, and I showed in Chapter 3 that reducing the activity of this gene by RNAi suppresses the Fog phenotype in fem-1(Df)/+ m-z+ animals. Perhaps these RNAs or another feature of that region contribute to the susceptibility of fem-1 to maternal-effect silencing. One way to address this possibility is to ask whether fem-1(+) integrated into other areas of the genome is also silenced in fem-1(Df)/+ m-z+ animals. To test this prospect, I generated males carrying the null mutation fem-1(e2268) at the locus on chromosome IV and a fem-1(+) transgene (Figure 4-2A) integrated on another chromosome. When these males were crossed to fem-1(e2268) or idDf2 females, the only source of fem-1(+) in the offspring was the paternally inherited transgene (Figure 4-2B). I scored the Fog phenotype in these animals to determine whether fem-1(+) integrated in other regions is also subject to silencing.

The transgene contained a genomic construct of fem-1(+) with 5 kb upstream and 2 kb downstream sequence (Figure 4-2A) and was designed before 21U-RNAs were characterized. Six 21U-RNA loci were still present in this construct though many more are found near fem-1 in wild-type animals. A baseline level of feminization was present in these animals because multicopy fem-1 transgenes have reduced activity, a limitation that does not affect the MosSCI contructs used later. This feminization affected the germ line of both sexes and the soma of XO animals; male somatic feminization was more severe in animals carrying one copy of the transgene instead of two. The strength of this baseline feminization could be assessed by looking at the proportion of Fog animals produced after crossing to fem-1(e2268) females, a situation where fem-1(+) in N2 wild-type animals is fully functional (Figure 4-2C). For each transgene, I compared the percentage of Fog animals produced from the fem-1(e2268) and idDf2 crosses. In all cases, in the penetrance of germ-line feminization increased dramatically when the mother was homozygous for the deficiency. I concluded that fem-1(+) was subject to silencing when inserted at other regions of the genome in addition to its normal position on chromosome IV.

186

Figure 4-2: Testing randomly integrated full-length fem-1 transgenes for susceptibility to silencing in the offspring of fem-1 females.

A) Sequence included in Gene CATCHR construct used for generating transgenic lines. Exons are depicted as filled boxes, introns as the intervening bars, and untranslated regions as open boxes. The position and direction of 21U-RNAs are indicated by lines and arrows.

B) Crossing scheme for testing the function of paternally derived fem-1 transgenes after crossing to fem-1(y) females (y = e2268 or idDf2).

C) The percentage of Fog XX animals generated by each paternally inherited transgene. Error bars indicate standard error of the mean. At least 150 animals from two to four crosses were scored.

187

A second way that fem-1 could be targeted for silencing would be if the gene itself contained a feature that activates a surveillance mechanism. Small RNA sequences expressed in wild-type and prg-1 mutants are available (Ruby et al. 2006; Batista et al. 2008). The former animals are susceptible to maternal-effect silencing, but this phenotype is suppressed in the mutants. Dr. Andrew Spence examined the alignment of small RNAs near the fem-1 locus in these samples. Two regions in fem-1 appear to be sources of RNAs that were more abundant in wild-type than in prg-1 mutants (Figure 4-3). One region corresponds to intron 2. The second contains RNAs that match to a miniature inverted-repeat transposable element (MITE), Cele1, found in intron 8 of fem-1. Perhaps fem-1 is targeted for silencing because it contains this element. Such a silencing mechanism could be generally useful for the organism since it would protect the germ line from the spread of transposable elements, but it would be harmful in cases where a C. elegans gene is silenced despite its expression being required for germ-line development. Perhaps licensing by maternal RNA provides a way to protect germ-line expressed genes from inappropriate silencing.

I chose to ask whether the presence of the Cele1 or intron 2 is required for silencing of fem-1. Two fem-1 minigenes were constructed; one contained introns 2 though 6, inclusive, and the other contained introns 1, 7, 8, 9 (Figure 4-4A). Single copies of these transgenes were integrated into chromosome II using the targeted integration method MosSCI (Frokjaer-Jensen et al. 2008). When combined with a fem-1(e2268) mutation on chromosome IV, these transgenes were able to fully support male development in the soma and germ line of transgenic animals. Crossing males carrying these transgenes to fem-1(Df) females (Figure 4-4B), I asked whether silencing of fem-1 in the zygote depended on the introns included in the minigene. No germ-line feminization was detected when the mother was a fem-1(e2268) homozygote, confirming the function of these minigenes. Both minigenes behaved similarly to fem-1(+) from N2 animals when crossed to idDf1 or idDf2 homozygotes; there was no difference in the proportion of Fog animals produced by the minigenes containing different subsets of fem-1 introns. Neither intron 2 nor intron 8 was necessary for silencing, but it remains possible that both minigene constructs contained sequences that were sufficient to target them for silencing.

188

Figure 4-3: Small RNAs near the fem-1 locus in wild-type animals and prg-1 mutants.

A) Small RNAs matching a fem-1 intron that contains a MITE, Cele1. Each box represents a group of RNAs that begin with the same 5’ nucleotide and match loci on the same strand. The colour of the box and direction of the arrow indicate whether the group matches the top strand (light blue, arrow to the right, antisense to fem-1) or the bottom strand (dark blue, arrow to the left). Numbers indicate the number of reads in the group.

B) Small RNAs near the 5’ end of fem-1. A collection of RNAs present near intron 2 in wild-type animals, but underrepresented in prg-1 mutants is indicated by an orange oval.

189

190

Figure 4-4: Testing integrated fem-1 minigenes for susceptilibity to silencing in the offspring of fem-1(Df) females.

A) fem-1 sequence included in the minigenes for plasmids pAS#CJ55 and pAS#CJ56. Exons are depicted as filled boxes, introns as the intervening bars, untranslated regions as open boxes and the promoter as a bent arrow.

B) Crossing scheme for testing the function of paternally-inherited fem-1 minigenes. fem- 1(y) = e2268, idDf1 or idDf2

C) Graph showing the average percentage of Fog animals produced after crossing integrated fem-1 minigenes to fem-1(y) females. Error bars show the standard error of the mean. At least 300 animals from three to six crosses were scored.

191

192

4.5 Discussion 4.5.1 Maternal RNA does not desilence a germ-line transgene

Providing maternal RNA does not necessarily promote germ-line expression of a gene if other silencing processes are also in effect. Germ-line expression of the let-858::gfp transgene was not desilenced when gfp RNA was externally provided in the maternal germ line. Other factors, possibly in addition to the absence of maternal RNA, are responsible for the silencing of this transgene. Due to the repetitive nature of this multicopy array, it is likely that RNAs produced from this transgene lead to its silencing through a pathway that is separate from the maternal-effect silencing associated with fem-1(Df) alleles (Kelly et al. 1997; Dernburg et al. 2000; Robert et al. 2005).

Having multiple mechanisms that recognize different attributes of a foreign DNA element such as newly derived unusual RNAs and the absence of expression in previous generations may lead to a more effective overall silencing response than any one mechanism would achieve alone. It would be informative to know the strength of the silencing effect produced in the complete absence of maternal fem-1 RNA, but this value cannot be definitively measured using the currently available fem-1(Df) alleles. The heterozygous descendants of idDf2 and idDf3 females are subject to the enhancing effect of the deletion of T12E12.2 in addition to the absence of fem-1 RNA (Chapter 3). The progeny of idDf1 females receive the maternally provided chimeric fem-1 RNA whose licensing activity, though less effective than wild-type fem-1 RNA (Chapter 2), may still have an impact on the penetrance of the Fog phenotype in those animals. Ideally, I would evaluate the extent of germ-line feminization in the descendants of an animal carrying a perfect fem-1 deletion that would entirely remove fem-1 RNA without affecting neighbouring genes. I attempted to produce such a fem-1 allele using the MosSCI system, but I was unsuccessful (see Methods). If new Mos1 insertions in the vicinity of fem-1 become available, this protocol could be attempted again with a greater likelihood of success.

193

4.5.2 fem-2(tm337) does not produce a maternal absence effect

Reasons why fem-1 might be targeted specifically for silencing in the germ line remain elusive. Thinking that maternal-effect regulation may apply to other germ-line expressed genes, I tested a deletion allele of fem-2 that prevents fem-2 mRNA accumulation. I checked whether females homozygous for that allele would produce offspring with reduced fem-2 activity in the germ line. I detected no germ-line feminization in these animals. One interpretation is that fem- 2 does not require licensing as fem-1 does. Additional germ-line genes should be investigated in order to determine whether they behave like fem-1 or fem-2. An alternative explanation is that fem-2 levels were reduced, but not to a degree sufficient to produce Fog animals. fem m-z- XO animals are female for fem-1, but intersex for fem-2 and, using canonical alleles to examine fem m+z- animals, it has been demonstrated that the phenotypes are more severe in fem-1 than fem-2 (Doniach and Hodgkin 1984; Kimble et al. 1984; Hodgkin 1986). While fem-1 XX animals are predominantly female and XO animals are sterile intersexes, fem-2 XX animals are hermaphroditic and XO animals are fertile at 20°C, indicating that feminization is more extensive with limited amounts of fem-1 than in a similar situation with fem-2. It is possible that fem-2(+) was compromised in the current experiment, but that another method of detection would be required in order to detect this reduction. In that case, I might have expected to detect progressive accumulation in fem-2 silencing since my experiments with idDf1 indicated that the degree of silencing of fem-1 increased in severity over several generations. Even after backcrossing heterozygotes to fem-2(tm337) females for seven generations, no evidence of germ- line feminization is apparent, undermining the idea that small reductions in fem-2 activity might accrue to detectable levels over time.

4.5.3 Silencing of fem-1 does not require intron 8 or the gene’s position on chromosome IV

The result with fem-2(tm337) suggests that not all genes need licensing as fem-1 does. A requirement for licensing may still apply to some, but not all, additional genes in the germ line. Perhaps one or more characteristics of fem-1 make it susceptible to silencing in the absence of maternal RNA. Two potential features distinguishing fem-1 and fem-2 may be the position of fem-1 on chromosome IV or specific sequences of DNA in or near the gene. fem-1(+) transgenes

194

integrated at four different genomic regions on other chromosomes were also subject to maternal-effect silencing, making it unlikely that the fem-1 locus is in a special domain on chromosome IV where germ-line gene expression is restricted. By comparing fem-1 minigenes containing or excluding intron 8, I also showed that the Cele1 element contained in that intron is not necessary for silencing. If the PRG-1-dependent RNAs associated with intron 8 or intron 2 are involved in silencing fem-1, they must be redundant with other factors. It remains possible that other, as yet untested features of fem-1 are implicated in its silencing. Further experiments could be performed removing other sequences in combination with one another or expressing fem-1 from a different promoter.

Based on the experiments performed in this chapter, the precise mechanism of regulating germ-line fem-1 activity in fem-1(Df)/+ m-z+ heterozygotes remains unclear. Further investigation into the means by which maternal transcripts serve to license fem-1 activity should be informative in explaining how the expression of fem-1 is normally promoted in the germ line. Additional experiments are also required to address the role of a silencing machinery suggested by the requirement of several genes for efficient silencing. In addition to prg-1, several other suppressors from my RNAi screen have also been shown or suggested to play roles in the regulation of small RNAs (Chapter 3). As more information becomes available about the functions of these genes and the presence of small RNAs near fem-1, their roles in the silencing of fem-1 may become clearer. The question of whether this maternal-effect regulation is a more general phenomenon remains of interest. The advent of a technology to make targeted deletions in C. elegans (Frokjaer-Jensen et al. 2008; Frokjaer-Jensen et al. 2010) may facilitate the screening of additional candidate genes to test for a requirement of maternal RNA for proper zygotic germ-line expression of genes other than fem-1. In combination, testing these candidate genes and investigating the mode-of-action of the Fog suppressors should help clarify the means by which fem-1 activity is compromised in fem-1(Df)/+ m-z+ animals.

195

Chapter 5 General Discussion

196

5 General Discussion 5.1 Characterization of maternal-effect silencing and licensing in the C. elegans germ line

My thesis provides an account of an unprecedented form of RNA-mediated genetic regulation. In Chapter 2, I characterized the way in which zygotic activity of the C. elegans sex- determining gene fem-1 is influenced by a record of the gene’s activity in the maternal germ line. Mothers that provide fem-1 RNA through the maternal germ line produce offspring whose fem- 1(+) loci are active to promote both male somatic development of XO animals and spermatogenesis in both sexes. Using females with any of three deficiency alleles that produce no fem-1 RNA or a truncated, chimeric transcript, I showed that the heterozygous offspring of such females are often subject to germ-line feminization. Since the Fog phenotype can be rescued by providing exon-containing fem-1 RNA in the germ line of idDf2 mothers, I concluded that fem-1 RNA is maternally required for zygotic spermatogenesis. Further investigation demonstrated that the Fog phenotype is attributable to decreased germ-line activity of fem-1 as shown by a reduction in fem-1 transcript levels in the germ line of fem-1(Df)/+ m-z+ animals and their compromised ability to promote male somatic development of their own fem-1 g-m+z- XO progeny through provision of germ-line fem-1 products. Moreover, this reduced genetic activity is heritable through meiosis since repeated backcrossing to fem-1(Df) females leads to a continued increase in the penetrance of the Fog phenotype among heterozygotes. Full silencing is never detected in a single generation, and there is variability in the degree of silencing experienced by identical descendants from the same fem-1(Df) female. Based on these observations, I concluded that fem-1 is heritably silenced in the absence of maternal fem-1 RNA and that maternal transcripts are able to promote zygotic fem-1 activity. By providing evidence that the gene was expressed in the germ line of previous generations, maternal transcripts would thus license expression of the gene in the zygotic germ line.

In order to begin investigating the mechanisms mediating this maternal-effect regulation of fem-1, in Chapter 3 I used RNAi and mutant alleles to reduce the activity of candidate genes and ask whether this intervention affected the proportion of Fog animals produced by crosses of wild-type males to fem-1(Df) females. This approach confirmed the distinctiveness of licensing with respect to other phenomena and proved informative both in ruling out the involvement of

197

certain processes and in highlighting the contribution of specific genes to maternal-effect regulation. It remains unclear how broadly maternal-effect regulation is used in the germ line. Currently, fem-1 is the only gene for which a maternal RNA requirement for licensing has been demonstrated. It seems unlikely that such a regulatory system would have evolved simply to regulate one gene. Maternal-effect regulation may apply more broadly in the germ line, but additional evidence will be required to support that idea. There may also be characteristics of the fem-1 locus that target it for silencing. Based on the RNAi screen results, I developed hypotheses about aspects of fem-1 that may contribute to its silencing in the absence of maternal fem-1 transcripts. Several of these possibilities were tested in Chapter 4 where I demonstrated that neither the position of the locus on chromosome IV nor the presence of certain repeat- element-containing introns is necessary for the silencing of fem-1. The data presented in this thesis provide additional testable models of how maternal-effect regulation of fem-1 might be mediated. They also illustrate that, while there are some resemblances between this process and previously described mechanisms, this maternal-effect regulation is also unique in several ways, not least of which is the use of RNA from a protein-coding gene to promote its own expression.

5.2 Comparison with previously known forms of regulation

Most of the RNA-mediated epigenetic effects reported to date involve gene repression (Matzke and Birchler 2005). Since RNAs may also be involved in the heritable, silencing portion of fem-1 maternal-effect regulation, a comparison with these other processes could provide insight into the mechanism of fem-1 regulation and will serve to illustrate some of the ways in which maternal-effect silencing differs from other RNA-mediated phenomena. One such example is the formation of heterochromatin at centromeres in fission yeast. Heterochromatin assembly in S. pombe provides an example of how RNA can target a complex to a specific region for regulation involving a combination of transcriptional and post- transcriptional gene silencing (Motamedi et al. 2004; Verdel et al. 2004; Buhler et al. 2006; Buhler et al. 2007). At centromeres, the Argonaute-containing RITS complex associates both with nascent RNA transcripts through pairing interactions involving siRNAs and with nucleosomes by binding methylated H3K9. Recruitment of the RDRC complex by RITS leads to production of more siRNAs required for H3K9 methylation by the CLRC complex, providing

198

a self-propagating loop required for heterochromatin maintenance (Figure 1-1). No specific RNAs have yet been implicated in the maternal-effect silencing of fem-1. The wago-1 result that germ-line feminization is enhanced when a paternal wago-1(+) is inherited by fem-1(Df) m-z+ animals could suggest that paternal siRNAs are involved in silencing. If zygotic fem-1 siRNAs were involved, a cotranscriptional silencing complex involving nascent fem-1 transcripts may be possible. In such a system, the licensing function of maternal fem-1 RNA would be to titrate antisense, silencing RNAs away from the fem-1 locus or nascent transcripts.

In other examples, antagonizing RNAs also affect inheritance. Production of an aberrant RNA is one means of affecting genes in a heritable way. Mice harbouring a specific allele of the Kit gene accumulate high levels of abnormal RNAs from that gene, particularly during spermatogenesis (Rassoulzadegan et al. 2006). These RNAs can be paternally inherited, leading to a variable reduction in the expression of the wild-type Kit allele in heterozygotes. No changes in DNA or histone methylation are observed, but levels of polyadenylated Kit RNA are reduced. Aside from specific alleles producing aberrant RNAs, there are also examples where heritable RNAs are derived from regions of the genome that show evidence of a history of activity by transposable elements. In D. melanogaster, primary piRNAs are produced from discrete genomic loci generally encoding defective transposon sequences (Brennecke et al. 2007). An amplification loop involving Piwi, Aubergine and Ago3 generates piRNAs that silence transposons. Brennecke and colleagues suggest that maternally inherited complexes with piRNAs could initiate the amplification cycle in each generation and serve as a genetic memory of the transposons to which the population has been exposed (Brennecke et al. 2008).

There is no evidence of an abnormal parental fem-1 RNA leading to fem-1 silencing in the progeny of fem-1(Df) females. The fem-1 locus is entirely deleted in idDf3 animals, removing the possibility that they could generate maternal fem-1 products. Although idDf1 does produce an abnormal fem-1 RNA, maternal provision of such a transcript alleviates rather than exacerbates germ-line feminization in the progeny of idDf2 females (Chapter 2). If RNAs are involved in silencing fem-1, which seems likely based on the suppressor genes identified by my screen, then such RNAs could be maternally provided if they are from another region of the genome, but would likely be zygotically or paternally produced if they originate from fem-1 itself. The contribution of maternal fem-1 RNA is instead involved in the licensing rather than the silencing component of maternal-effect regulation.

199

Another way that RNA from previous generations could affect inheritance is suggested in a controversial paper by Lolle and colleagues (2005). Studying Arabidopsis thaliana, they report non-Mendelian inheritance of extra-genomic sequence information. Specifically, they find phenotypically wild-type plants segregating from a homozygous mutant. The wild-type plants are heterozygotes. They contain DNA sequences from alleles that were present in the plants’ ancestors preceding the parents, implying a template-directed rather than random mutagenesis. Lolle et al. suggest that a stable RNA cache of genetic diversity is transmitted over several generations and provides a store of variation that can be incorporated into the genome under certain circumstances. Alternative explanations of the data presented in this paper have also been offered. A gene conversion model proposes that the templates used for mutagenesis are inherited DNA fragments rather than RNA molecules from previous generations (Ray 2005). A distributed genome model suggests that short, perfectly homologous stretches of DNA present in the genome itself could be used to correct the mutations instead of requiring an inherited template (Chaudhury 2005). Additionally, the hothead mutants used in this analysis have a tendency to outcross, which could explain the unusual inheritance patterns observed, particularly since Peng and colleagues found that the genetic behaviour of hothead plants grown in isolation was completely stable (Peng et al. 2006). These alternative explanations notwithstanding, I will compare our model of maternal-effect regulation with the Lolle et al. model for non-Mendelian inheritance in A. thaliana. In both cases, inherited ancestral RNA is proposed to affect genetic regulation. In A. thaliana, the RNA is suggested to be a template for genomic mutagenesis, whereas I have demonstrated that mutagenesis is unlikely to cause the maternal-effect silencing of fem-1. Instead, I propose that maternal RNA in C. elegans serves as a standard against which a gene or its transcripts are measured before their full zygotic activity is permitted in the germ line.

An example of comprehensive genetic comparison between two generations is provided by ciliates. Paramecium tetraurelia and Oxytricha trifallax contain two kinds of nuclei: the polyploid somatic macronucleus responsible for gene expression and the transcriptionally silent diploid micronucleus of the germ line. Extensive rearrangement occurs during formation of a new macronucleus as chromosomes are fragmented and internal eliminated sequences (IESs) are excised. Current models propose that rearrangement of the zygotic macronucleus involves an RNA-mediated comparison between the maternal macronucleus and the micronucleus (Lepere et

200 al. 2008; Nowacki et al. 2008). Nongenic transcription during vegetative growth produces an RNA copy of the maternal macronucleus. During meiosis, scnRNAs are produced from the micronuclear genome. ScnRNAs scan the macronuclear RNA, and any homologous pairs that form are destroyed. The remaining scnRNAs are micronucleus-specific and direct excision of their corresponding IESs during development of the zygotic macronucleus. While DNA is not deleted during C. elegans development, the logic of using maternal RNA to direct zygotic genetic events provides a parallel between macronuclear organization in ciliates and maternal- effect licensing in C. elegans. The former process requires a maternal RNA copy of the entire macronuclear genome, and provision of that RNA is a protective mechanism signalling inclusion of those sequences in the zygotic macronuclear genome. I suggest that the maternal germ-line transcriptome of C. elegans likewise produces a protective effect, at least for fem-1, by promoting zygotic activity of that gene in opposition to a mechanism that would generate silencing if the RNA were absent. In both cases, two opposing RNA-mediated processes are postulated: one restricts zygotic usage of specific genes, and the other uses maternal information to indicate which genes should escape this silencing.

Small RNAs are generally associated with transcriptional and post-transcriptional silencing, but the role of small RNAs in targeting promoter regions is less clear. One group showed that siRNAs targeting gene promoters in human cells lead to gene silencing and DNA methylation (Morris et al. 2004; Han et al. 2007), but other studies found that small dsRNAs and miRNAs targeting promoter regions can promote gene expression and are associated with activating changes in histone methylation and acetylation (Li et al. 2006; Janowski et al. 2007; Place et al. 2008). Licensing RNAs able to rescue the Fog phenotype in my injection assay were targeted to the coding region, not the fem-1 promoter; promoter requirements in maternal-effect regulation have not yet been tested. In rare cases, miRNAs have also been associated with activation of their targets. In M. musculus, microinjection of a miRNA into fertilized oocytes leads to increased expression of one of its targets, Cdk9, resulting in a cardiac phenotype that is heritably transmitted for three generations (Wagner et al. 2008). A similar phenotype of cardiac hypertrophy is observed when 20-nucleotide RNA molecules homologous to Cdk9 coding sequences are injected, but no evidence was presented as to whether these RNAs similarly induce an epigenetic effect. If these homologous RNAs do promote Cdk9 expression in a heritable way, then they would serve as an example of coding RNA from a gene being able to

201

promote expression of its cognate locus. This example would still differ from fem-1 maternal- effect regulation in at least two ways: expression of Cdk9 is increased in somatic cells, and it produces a pathological reaction to artificially high levels of embryonic RNA, whereas licensing functions in the germ line and serves to provide a record of endogenous levels of germ-line- specific RNAs.

RNAs can also promote gene expression by targeting chromatin-modifying factors to specific regions. In D. melanogaster, dosage compensation of X chromosome gene expression between the two sexes is achieved by hyperactivating the single male X chromosome. The complex responsible for this regulation includes Male-Specific Lethal (MSL) proteins, the RNA helicase Maleless, the histone acetyltransferase Males-absent-on-the-first and two redundant non-coding RNAs, roX1 and roX2. The roX RNAs and the rest of the complex coat the male X chromosome and lead to acetylation of specific residues of histone H4. The precise way that the roX RNAs target the complex to the X chromosome is not yet understood, but characteristics include multiple entry sites (including the X-linked roX loci themselves), spreading from initial nucleation sites, and a requirement for cotranscriptional recruitment to at least certain loci (Kelley et al. 1999; Meller and Rattner 2002; Kind and Akhtar 2007). If licensing fem-1 RNA targets a complex to the fem-1 locus, the resolution of this targeting is more specific than the chromosome-wide regulation by roX RNAs. Spreading of licensing seems unlikely since injection of RNAs from fem-1 introns or regions flanking the gene did not effectively rescue the Fog phenotype. Because the licensing RNAs act in the zygote but are maternally provided, transcription of the licensing RNAs must be uncoupled from their function; however, the transcriptional state of the target locus could affect its accessibility to licensing RNAs.

The RNA-dependent recruitment of Ash1 to Ubx trithorax-response element (TRE) sequences in D. melanogaster more closely resembles a possible mechanism for the licensing process in that each of three TRE sequences near Ubx produces a transcript that specifically draws Ash1 to the corresponding TRE (Sanchez-Elsner et al. 2006). As with fem-1 licensing RNAs, only sense TRE transcripts lead to Ubx activation. A difference between Ubx regulation and the epigenetic regulation of fem-1 is that the fem-1 licensing RNAs are maternally inherited and must find their way to their zygotic target, whether that is the fem-1 locus itself or silencing RNAs targeting fem-1. The localization of licensing RNAs must ensure that at least some of them segregate with the germ line. There may be additional requirements for subcellular

202 localization to particular regions such as the P granules or the nucleus, depending on where licensing activity is required. In contrast, the TRE transcripts are retained at the Ubx TRE sites, and coimmunoprecipitation with Ash1 only occurs in extracts where the TRE transcripts are chromatin-bound. The SET domain of Ash1 interacts with the TRE transcripts without the aid of other factors, whereas a larger complex is involved in the case of D. melanogaster dosage compensation. It is unclear whether additional proteins bind licensing RNAs, possibly involving inheritance of preassembled ribonucleoprotein complexes. If such a complex does exist in C. elegans, the proteins interacting with licensing RNA must still be identified.

Another way that RNA can promote gene activity is the role of some noncoding RNAs in promoting the activity of other enhancers required for expression of a gene. Noncoding RNAs can act cooperatively as transcriptional coactivators, in a way that does not involve basepairing, by serving as cofactors to increase the activity of other proteins required for transcription (Feng et al. 2006). Since fem-1 coding sequence is required for licensing activity, it seems more likely that the role of fem-1 RNA is to provide basepairing to other fem-1 sequences (either the fem-1 locus or putative silencing fem-1 RNAs), but it is formally possible that fem-1 RNA could act as a scaffold or increase the activity of other licensing factors rather than serving as a targeting mechanism.

While maternal-effect regulation of fem-1 shares characteristics with these previously described forms of regulation, it is also clearly unique among all the currently known processes of RNA-mediated genetic regulation. Models of maternal-effect silencing and licensing will be informed by comparison with these other mechanisms and by the modifier genes implicated through my RNAi screen.

203

5.3 Models for the mechanisms of maternal-effect regulation 5.3.1 General considerations for models

Understanding the mechanism of maternal-effect regulation will require a description of the factors involved in mediating maternal-effect silencing and licensing as well as the relationship between those two processes. By demonstrating that specific factors are required for the silencing of fem-1 even in the absence of maternal fem-1 RNA, I showed that there is an active silencing process distinct from the absence of licensing. This silencing functions downstream of or in parallel to licensing in the regulation of zygotic fem-1 activity. Thus maternal fem-1 RNA may promote fem-1 activity either by directly interfering with silencing or by outcompeting silencing through other means.

By using RNAi to screen candidate genes for modification of the penetrance of the Fog phenotype in fem-1(Df)/+ m-z+ animals, I sought to identify genes involved in maternal-effect silencing as suppressors of the Fog phenotype and genes required for maternal-effect licensing as enhancers. While I did not directly show that the effect on the Fog phenotype was due to modulation of the amount of maternal-effect regulation, I included several controls to help identify genes that were exerting general effects on maternal inheritance or affected fem-1 activity in other situations. While genes that did not modify the proportion of Fog animals in this screen may still be involved in the mechanisms of silencing and licensing if they function redundantly with other genes or if they resist knock-down by RNAi, I will discuss these genes as though they are true negatives when presenting the following models. For genes that did modify the Fog phenotype when their activity was reduced, whether or not this effect is direct has yet to be assessed. For example, since many of these genes are involved in several related pathways in the C. elegans germ line, it is possible that impairing the activity of one pathway produces an imbalance that causes an indirect effect through another pathway. After describing models of how the modifiers may act if they participate directly in maternal-effect regulation, I will also suggest experiments that could be used to test direct involvement of these genes.

In addition to the role of maternal RNA in licensing the activity of fem-1, the involvement of a second kind of RNA for fem-1 silencing is implied by many of the genes identified as suppressors of the Fog phenotype. The suppressors include genes encoding RNA- binding proteins such as PUF family members and the Argonautes prg-1, prg-2 and wago-4.

204

Several other suppressors are also implicated in small-RNA-mediated pathways, including cde-1, drh-3, ekl-1, mut-2 and mut-16. One possibility for the role of a second kind of RNA is that antagonizing fem-1 RNAs are involved in silencing fem-1. Maternally provided silencing RNAs could be produced from another part of the genome, but it is unclear how such RNAs would promote silencing of fem-1. A cis-acting mechanism for silencing RNAs is unlikely since fem-1 transgenes are subject to silencing when integrated in other parts of the genome (Chapter 4). If the silencing RNAs are generated from fem-1 itself, then they must be zygotically or paternally derived since idDf2 and idDf3 mothers do not produce any fem-1 RNA. Evidence of small RNAs antisense to fem-1 and many other genes in the germ line exists (Ambros et al. 2003; Ruby et al. 2006). If RNAs antisense to fem-1 coding sequence were involved, then they could provide specificity in targeting fem-1 for silencing; other genes might only be subject to silencing if they too produce specific RNAs in the germ line. If the silencing RNAs are derived from repetitive sequences in or near fem-1, perhaps it would indicate a more general mechanism by which certain loci are targeted for silencing because they share characteristics with potentially dangerous, foreign DNA. While I showed that the MITE in intron 8 of fem-1 is not necessary for fem-1 silencing, it remains possible one or more RNAs from non-coding sequences in fem-1 are involved in silencing. Based on the type of silencing RNA envisioned and its mode of action, different models of maternal-effect regulation are possible. Here I will focus on detailed models where the role of the maternally supplied, licensing RNA is to provide specificity through basepairing (see Chapter 3 for a discussion of other possible roles for the RNA). The models I favour focus on regulation of zygotic fem-1 RNA levels since in situ hybridization shows that fem-1 RNA is reduced in the germ line of fem-1(Df)/+ m-z+ animals.

5.3.2 Model A: Licensing by targeting siRNAs

In one model, silencing RNAs antisense to fem-1 coding sequence could target zygotic fem-1 mRNAs for degradation in the absence of licensing (Figure 5-1). This process could occur in the cytoplasm or in the P granules, structures whose contents and localization near nuclear pores have suggested an involvement in surveillance through post-transcriptional regulation in the germ line (Seydoux and Braun 2006). The role of maternally provided licensing fem-1 RNA in this model would be to inactivate or outcompete the silencing RNAs. Since licensing is most

205

effective with sense RNAs including fem-1 exon sequence, it would be logical if these RNAs were required to oppose antisense fem-1 RNAs directed against fem-1 mRNA. Currently, the form of licensing RNA is unknown: it could be full length fem-1 mRNA or processed into smaller, active pieces. Licensing RNA could act in the nucleus to neutralize silencing RNAs as they are produced, or it could act in the P granules or cytoplasm to oppose the action of silencing RNAs.

In addition to being effectors of fem-1 silencing, antisense RNAs could also serve as the heritable agents accumulating in successive backcrosses to fem-1(Df) females. If so, the silencing RNAs must be meiotically heritable, at least through spermatogenesis. The severity of silencing might be related to the number of silencing RNAs, which would help explain why the penetrance of the Fog phenotype increases with each generation of backcrossing. In that case, the RNAs must accumulate with each cross, not being diluted as the germ line proliferates. While the bulk of cytoplasm is provided through the oocyte, sperm also contribute RNAs to the embryo (Ward et al. 1981), validating the idea of paternally contributed silencing RNAs. Transmission of heritable RNAi in C. elegans involves a diffusible epigenetic element that could be RNA and is more effective when passed through the paternal germ line than through maternal gametes (Alcazar et al. 2008). In the case of maternal-effect silencing of fem-1, after fertilization the silencing RNAs would need to segregate with the lineage designated to form germ cells, as do the P granules. If there were a gap between the number of RNAs initially provided and the amount required for effective surveillance, the silencing RNAs could be amplified through the action of RNA-dependent RNA polymerases (RdRPs) in the germ line. To explain the restoration of activity when a fem-1(+) allele is crossed to a fem-1(e2268) female after several crosses to fem-1(Df) females in Chapter 2, this model would suggest that sufficient licensing RNAs are able to inactivate accumulated silencing RNAs in one generation.

206

Figure 5-1: Models of maternal-effect regulation of fem-1 in the zygotic germ line.

Model A: Licensing by targeting siRNAs. fem-1 mRNAs (long green arrows) are targeted for degradation by heritable silencing RNAs (here depicted as red arrows pointing in a direction antisense to fem-1 message). Licensing RNAs are shown here as maternally inherited pieces of fem-1 transcripts (short green arrows). Licensing RNAs function by inactivating the silencing RNAs. This regulation could occur in the nucleus, cytoplasm or P granules near nuclear pores.

Model B: Licensing by targeting chromatin. Chromatin remodelling complexes affect the modifications of histone tails and/or histone variants incorporated into nucleosomes at the fem-1 locus. The fem-1 gene is outlined in yellow. Marks introduced by the silencing complex are shown in red and reduce the expression of fem-1. The blue licensing complex could either oppose the restrictive marks or produce its own marks promoting fem-1 expression. These models represent two general types of processes that could regulate fem-1, but other mechanisms including a combination of type A and type B are possible.

207

208

209

5.3.3 Model B: Licensing by targeting chromatin

A second type of model speculates that silencing RNAs could also act in the nucleus by targeting machinery to the fem-1 locus causing chromatin modifications that reduce transcription (Figure 5-1). This repression of fem-1 expression would be opposed by licensing RNAs that could act in the nucleus by directly inactivating the silencing RNAs, by associating with fem-1 DNA to protect it from being a target of silencing RNAs or by recruiting a different complex that makes activating marks on the fem-1 locus to oppose the work of the silencing machinery. In the latter case, the polarity requirement of licensing RNAs could reflect directionality in the ability of sense RNAs to recruit licensing machinery to the target locus rather than a need for sense RNAs to inactivate antisense RNAs. It is unclear why sense RNA from exons would function for licensing more effectively than intronic RNA in this kind of targeting system. The recruitment of silencing machinery at the fem-1 locus may likewise have a specific orientation based on the identity of the silencing RNAs. If silencing RNAs were antisense to fem-1, then they could either act cotranscriptionally by recognizing nascent fem-1 transcripts or transcriptionally by targeting one strand of DNA in opposition to the licensing complex. If silencing is driven by RNAs from non-homologous sequences such as the 21U-RNAs, they may have other means of targeting fem-1.

In this model, the fem-1 locus would accumulate increasingly numerous or severe restrictive marks with each cross to a fem-1(Df) female. The marked locus could bear a memory of its inheritance, potentially relieving the necessity for the silencing RNAs to be heritable. The initial mark deposited by the silencing machinery may also induce other changes by recruiting additional marks or providing feedback to make more silencing RNAs, but either the initial mark or one of its downstream consequences must be maintained through spermatogenesis. In C. elegans, candidates for such a mark include histone variants or histone tail modifications. A gamete-of-origin imprint maintained for several generations through one gamete lineage (more strongly through sperm) has been described for C. elegans (Sha and Fire 2005). The imprint is not a binary on/off system, and it can be reset by passage through the opposite germ line, sometimes requiring several crosses for full resetting. Differential histone modifications in the male and female germ line are hypothesized to establish and maintain the imprint in a model similar to what I have proposed for fem-1 regulation. Licensing RNAs would oppose this inhibitory modification either by removing it or by reducing its impact through providing an

210

increase in marks promoting fem-1 expression. Since maternal fem-1 RNA can restore activity to a gene that has been silenced for several generations, the role of licensing must be restorative as well as protective.

These two general categories of model are not mutually exclusive. Even if heritability were achieved through silencing RNAs rather than marked chromatin, those RNAs could still effect silencing in the zygotic germ line in part through directing the reestablishment of chromatin modifications that were not themselves heritable. Zygotic silencing could also occur in both the nucleus and the cytoplasm through a combination of transcriptional and post- transcriptional methods. Indeed, there could be communication between these processes. For example, RdRP action in the cytoplasm produces siRNAs that are actively transported to the nucleus in an Argonaute-dependent process for nuclear RNAi (Guang et al. 2008). Similar mechanisms may allow communication between the cytoplasm and the nucleus during maternal- effect regulation, possibly through P granules located at nuclear pores.

5.3.4 Potential roles for modifier genes in maternal-effect regulation 5.3.4.1 Factors involved in small-RNA pathways

If the modifier genes identified in my RNAi screen were directly involved in the maternal-effect regulation of fem-1, they could participate in the models outlined above. I tested the requirement for many genes found in C. elegans small-RNA pathways (overview provided in Table 1-1) in both the silencing and licensing aspects of this phenomenon. MicroRNAs associated with translational regulation may not be involved since RNAi against alg-2 produced no effect, but I could not test alg-1 due to its severe phenotypes. The C. elegans piRNAs may be involved since Piwi-related genes acted as suppressors in my screen. A maternal requirement for PRG-1 and PRG-2 could indicate that these proteins are involved in producing silencing RNAs in the maternal germ line that affect fem-1 in the zygotic germ line. PRG-1 is associated with P granules and is parentally loaded into embryos. 21U-RNAs are the main class of RNAs whose abundance is reduced in prg-1 mutants. I showed that the position of fem-1 near 21U-RNA clusters on chromosome IV is not required for its silencing, but these RNAs could affect fem-1 through other methods. It has been suggested that 21U-RNAs may regulate gene expression

211

collectively through partial sequence matches (Batista et al. 2008; Das et al. 2008); in that case, the 21U-RNAs could potentially target fem-1 as well as other genes in the germ line. At least two 21U-RNAs act upstream of a secondary siRNA pathway in silencing transposon Tc3 (Batista et al. 2008; Das et al. 2008); perhaps other 21U-RNAs work with additional secondary pathways to produce more types of gene regulation such as maternal-effect silencing. Experiments by Wang and Reinke did not reproduce all the results of the other groups studying prg function. Instead, Wang and Reinke used microarrays with samples of dissected germ lines and found that loss of prg-1 leads to a downregulation of certain mRNAs expressed during spermatogenesis (2008). This result implies that the wild-type function of PRG-1 is to promote rather than silence gene activity. If this conclusion were correct, it would be unclear how reducing the activity of a protein required for spermatogenesis suppresses the germ-line feminization phenotype in my assay. As an Argonaute, PRG-2 is also expected to mediate its effects on fertility through a small RNA pathway, though such a role has not yet been demonstrated, and PRG-2 was previously thought to be largely redundant with PRG-1. Further investigation of small RNAs that associate with these proteins or depend upon them could provide additional candidates for silencing RNAs involved in maternal-effect regulation.

Many of the other endogenously expressed small RNAs in C. elegans are classified as primary or secondary endo-siRNAs. Recent work from several groups has begun to indicate relationships between these two kinds of siRNA and the biological functions served by the assorted classes of mRNAs that they target. Primary endo-siRNAs are called 26G-RNAs to indicate their predominant characteristics of being 26 nucleotides long and having a guanosine as their terminal, monophosphorylated 5’ residue. Two main classes of 26G-RNAs have been identified, both of which are enriched in the germ line and share a requirement for the exoribonuclease ERI-1, the RdRP RRF-3 and the dsRNA-endonuclease DCR-1 (Han et al. 2009). Class I 26G-RNAs further require the Argonautes ALG-3 and ALG-4 as well as ERI-3 and ERI-5 for their biogenesis and/or stability (Han et al. 2009; Pavelec et al. 2009; Conine et al. 2010). Many of these RNAs are antisense to mRNAs from loci involved in spermatogenesis (Gent et al. 2009). Class II 26G-RNAs are enriched in oocytes and embryos, and they decline after embryogenesis. Additional genetic requirements for these RNAs include the Argonaute ERGO-1 and RDE-4, a protein with a dsRNA-binding domain (Han et al. 2009; Conine et al. 2010; Gent et al. 2010; Vasale et al. 2010). Most of these genes were tested in my RNAi screen,

212

and none of them affected the proportion of Fog animals, indicating that 26G-RNAs are probably not involved in maternal-effect regulation.

Almost all 26G-RNAs are related to 22G-RNAs. Members of the latter class are termed secondary endo-siRNAs because they are likely produced through the action of an RdRP with the 26G primary endo-siRNAs serving to direct production of 22G-RNAs. 22G-RNAs retain the triphosphorylation associated with production by RdRPs, whereas 26G-RNAs have the monophosphorylation characteristic of Dicer action. An example of the functional connection between 22G- and 26G-RNAs is provided by the class II endo-siRNAs which are required for action in a somatic pathway. The sequences of the two sets of RNAs are related to each other, but the class II 26G-RNAs are ERGO-1-dependent, whereas the 22G-RNAs are RRF-1- dependent (Gent et al. 2010; Vasale et al. 2010). Predictably, these RdRPs are not required for the germ-line-based regulation of fem-1 by maternal transcripts. The second category of RNAs produced by the ERI/Dicer complex are the class I 26G-RNAs that are involved in spermatogenesis. These 26G-RNAs do not persist in spermatids, but their related 22G-RNAs do (Conine et al. 2010). The 22G-RNAs are likely the agents responsible for the downregulation of many transcripts involved in spermatogenesis, which provides robust thermotolerant sperm when gametogenesis is completed. These 22G-RNAs require several additional proteins, many of which were implicated in the maternal-effect regulation of fem-1 by my RNAi screen. Given the neutrality of 26G-RNAs in maternal-effect silencing and licensing, is it surprising to consider that their downstream 22G-RNAs may play a role. I deem it more likely that any 22G-RNAs involved in maternal-effect regulation of fem-1 are among those produced apart from 26G-RNA templates.

22G-RNAs are implicated in more biological processes than are currently described for 26G-RNAs. Many 22G-RNAs are antisense to protein-coding genes (including over 50% of known genes in C. elegans), while others target transposable elements and pseudogenes (Gu et al. 2009). A core complex required for 22G-RNA biogenesis includes the RNA helicase DRH-3, the Tudor-domain protein EKL-1 and RdRPs. Both drh-3 and ekl-1 behaved as suppressors in my RNAi screen, supporting the notion that RNAs produced by this complex may function in the maternal-effect silencing of fem-1. Involvement of an RdRP in silencing seems likely, but will require further investigation. There are four RdRPs in the C. elegans genome (Table 1-2 and references therein). Neither of the two RdRPs that I tested produced a phenotype. rrf-1 is

213

generally associated with somatic functions, and its role in the germ line is partially redundant with other RdRPs. A biological role for rrf-2 has not yet been shown, though it does affect levels of some small RNAs (Lee et al. 2006). The other two C. elegans RdRPs, rrf-3 and ego-1 both function in the germ line, but testing their involvement in maternal-effect regulation using mutations would not be straightforward since they produce pleiotropic effects including severe germ-line defects. Other genes involved in the production of 22G-RNAs were also detected by my screen. The nucleotidyltransferases mut-2 and cde-1 were both suppressors, consistent with a model including 22G-RNAs as effectors of fem-1 silencing. mut-7 is also required for the production or stability of 22G-RNAs, but its behaviour in my RNAi and mutation assays is inconsistent and less clearly explained (see Chapter 3). Perhaps it is involved in multiple small RNA pathways with different effects on the regulation of fem-1.

The two main roles described to date for germ-line 22G-RNAs involve regulation of chromosome structure and genetic surveillance of certain genes and intergenic regions, but additional roles for this class of RNA may also exist. 22G-RNAs associated with the Argonaute CSR-1 are antisense to many expressed genes in the germ line. CSR-1, DRH-3 and EGO-1 are all detected in P granules. CSR-1 is also bound to chromatin at 22G-RNA loci on mitotic chromosomes where DRH-3, EGO-1 and EKL-1 are found as well (Claycomb et al. 2009). The chromatin segregation function of this complex is unlikely related to maternal-effect regulation of fem-1, but disruption of one 22G-RNA pathway may indirectly affect other processes. Keeping these pathways separate requires the function of factors such as CDE-1. Many CSR-1- interacting siRNAs are uridylated by CDE-1 whose role may be to sort siRNAs into particular pathways (Claycomb et al. 2009; van Wolfswinkel et al. 2009). Two of the three nucleotidyltransferases that I tested in my screen were suppressors of the Fog phenotype. Since this phenotype was not shared uniformly by all proteins of this family, it supports the specific involvement of CDE-1 and MUT-2. They may help distinguish siRNAs involved in maternal- effect silencing from siRNAs used in other pathways. Homologous nucleotidyltransferases Cid12 and Cid14 serve a similar function in S. pombe by determining whether transcripts are recognized by the RdRP complex or the TRAMP/exosome complex (Buhler et al. 2007). In C. elegans, this sorting could be achieved by directing the association of given RNAs with specific Argonautes. Many of the worm-specific Argonautes are not yet characterized. Among them is

214

wago-4, a suppressor of the Fog phenotype and candidate for involvement with potential silencing RNAs targeting fem-1.

WAGO-1 is the primary Argonaute associated with 22G-RNA-mediated genetic surveillance. It is expressed in the germ line and localizes to perinuclear foci that resemble P granules. The RNAs bound by WAGO-1 include 22G-RNAs matching class I 26G-RNAs; these 22G-RNAs are inherited in WAGO-1 complexes in mature spermatids (Conine et al. 2010). WAGO-1 coimmunoprecipitates are enriched for 22G-RNAs targeting certain coding genes, nonannotated loci and repeat elements. Many, but not all, siRNAs associated with WAGO-1 downregulate their target mRNAs (Gu et al. 2009).

RNAi targeting wago-1 enhanced the Fog phenotype in my screen, suggesting that the gene normally has a positive role in promoting fem-1 activity in the germ line. This idea presents an apparent conflict with the previous categorization of WAGO-1 as being involved in silencing rather than promoting gene activity, particularly since other factors involved with 22G-RNAs did behave as suppressors in my screen. Perhaps the small RNAs associated with those suppressors act through another Argonaute, such as WAGO-4. The enhancer phenotype of WAGO-1 may rather be informed by a notable observation made using a mutant allele of wago-1 rather than RNAi. The wago-1 mutation only enhances the Fog phenotype in crosses where the father is wago-1(+) and the mother is wago-1, not when both parents are depleted of WAGO-1. This result raises the possibility that WAGO-1 complexes may be inherited through both parental gametes and then compared in the zygote. A paternal contribution of WAGO-1-associated siRNAs from a given gene may trigger silencing of that gene if the contribution is not matched by licensing WAGO-1-associated siRNAs from the maternal germ line.

The localization of WAGO-1 also suggests possible functions whose disruption could enhance the Fog phenotype. WAGO-1 is localized to P granules, as are the products of many of the suppressors from my screen. Perhaps WAGO-1 normally competes with these factors for common components, thus reducing the efficiency of silencing. When wago-1 is depleted by RNAi, the silencing machinery may function more effectively. Disruption of P granules by RNAi targeting pgl-1 also enhances the Fog phenotype, an end that could be achieved either if the silencing machinery were more active when freed from these organelles or if the P granules also promoted maternal-effect licensing. In this way, WAGO-1 or another Argonaute could

215

function with maternally provided fem-1 RNA in licensing zygotic fem-1 activity in a P-granule- dependent manner. Perhaps licensing RNAs are processed and modified in such a way as to be recognized by WAGO-1 as functioning to promote activity of their targets. This regulation could be achieved by interfering with the silencing apparatus or by recruiting other factors that encourage activity of the genes. The other Argonaute that behaved as an enhancer in my screen and may serve with maternal fem-1 RNA in a licensing complex is PPW-2, another worm- specific Argonaute whose interacting RNAs have yet to be characterized.

5.3.4.2 Mechanisms involving chromatin modification

The identities of other modifier genes from my screen suggest the possible involvement of chromatin modifications in maternal-effect regulation. In addition to the role in chromosome segregation described above, CSR-1, EKL-1, DRH-3 and EGO-1 also regulate heterochromatin assembly on unpaired chromosomes during meiosis. These proteins are required for restricting H3K9me2 accumulation to unpaired chromatin through a small-RNA-mediated pathway (She et al. 2009). Whether these proteins act directly by targeting chromatin-modifying machinery to unpaired regions or by influencing the activity of other genes involved in the mechanism is not yet known. An analogous role for this or another small RNA pathway in targeting the fem-1 locus for silencing modification remains possible, though it too must be further investigated. mut-16, also identified as a suppressor of fem-1 silencing, is involved in other small-RNA- mediated pathways and is predicted to associate with chromatin (Grishok et al. 2005; Kim et al. 2005; Sijen et al. 2007).

The enhancers also include genes potentially involved in chromatin remodelling such as gfl-1, which is homologous to YEATS-domain-containing proteins that function in chromatin modification, and the chromodomain-containing T12E12.2 required for cosuppression. These enhancers may regulate other factors or serve in an RNA-directed complex that acts on fem-1. By analogy to the dosage compensation complex in D. melanogaster, the MYST family histone acetyltransferase MYS-2 orthologous to Males-absent-on-the-first and the RNA helicase RHA-1 orthologous to Maleless are candidates for members of a C. elegans complex that could modify histones at loci where it is targeted by RNA. To date, rha-1 has been only associated with repressive modifications in the C. elegans germ line. It is required for RNAi, cosuppression and

216

the methylation of H3K9 involved in transgene silencing and X chromosome silencing (Robert et al. 2005; Walstrom et al. 2005). Perhaps rha-1 acts in several different pathways where its role in activating or hindering gene activity is dependent on the context of other factors with which it interacts. If RHA-1 and MYS-2 interact in C .elegans as they do in D. melanogaster, then a complex including these two factors may promote gene expression by acetylating histone tails. None of the histone deacetylases or histone methyltransferases that I successfully tested in my screen affect maternal-effect regulation, but other genes that could not be assessed may be involved. I did test the involvement of genes from other chromatin-remodeling complexes such as sop-2 (PRC1-related) and the putative C. elegans NURF and NuA4/Tip60 complexes, but the pleiotropic effects of these genes prevented their assessment by the RNAi screen.

5.4 Future investigation of maternal-effect regulation

Many questions about maternal-effect regulation remain outstanding. fem-1 is the only gene for which this form of regulation has been described. As more reagents become available, it should be possible to test other germ-line expressed genes and determine whether loss-of- function phenotypes are obtained in the cross-progeny of females homozygous for alleles that exclude RNA production. Using a recently developed method to create targeted deletions with the Mos1 insertion library (Frokjaer-Jensen et al. 2010), it may be possible to create deletion alleles for candidate genes. Genes to be assayed should be expressed in the germ line, but not required for fertility or viability. Given that the silencing of fem-1 may arise from Argonaute- associated small RNAs, I would begin by testing other genes for which antisense siRNAs have been identified.

Finding another gene that exhibits this effect would be helpful in practical ways. It may be easier to study a gene whose function can be assessed either by a visible phenotype or with molecular markers even when gametogenesis is disrupted; having to assess the sex of the germ line can be time-consuming and restricting. Identification of a gene expressed or required at specific times in development could help address when silencing occurs in the absence of maternal RNA. Being able to score more than one phenotype would also help indicate whether the modifier genes identified in my screen are exerting their effects through modulation of maternal-effect regulation or because of unrelated roles in sex determination. More generally,

217

knowing whether this type of regulation applies more widely will be informative. If only certain genes are susceptible to silencing, having a list of such genes may unveil common characteristics required for their targeting. If there were a common motif found in many of these genes, its sufficiency for generating silencing could be tested by creating chimeric versions of other genes that seem to escape silencing, such as fem-2. If maternal-effect silencing and licensing are found to be more common in C. elegans, it will be worthwhile to determine whether these processes exist in related nematodes and other organisms.

Similarly, our understanding of the biological importance of this form of regulation would be increased if there were a deletion allele that removed fem-1 entirely without affecting neighbouring genes. Generation of such an allele would provide an indication of how much germ-line feminization is caused in the complete absence of fem-1 RNA without enhancing effects from T12E12.2. While we know that the silencing effect increases to near complete penetrance of the Fog phenotype over several generations of crossing to fem-1(Df) females, it would be helpful to know the baseline level of reduction in the germ-line activity of an allele the first time it is exposed to maternal-effect silencing in the absence of any licensing RNA. If a new deletion allele cannot be produced, an alternative way of addressing this question would be to create transgenic idDf2 females expressing T12E12.2(+) or the complete drp-1 operon in the germ line. If the transgene rescues well, then these females would mimic the situation where no fem-1 RNA is produced in the germ line without introducing complicating enhancement from the loss of T12E12.2. RNA and protein levels from the transgene could be monitored to assess its expression levels, but there is no reported phenotype that can be assayed to test the function of a T12E12.2(+) transgene.

Characterization of maternal-effect licensing can also be improved now that it is possible to generate transgenes that are reliably expressed in the germ line. Previously, I used the RNA injection assay to provide evidence that external sources of RNA can rescue the Fog phenotype of the progeny of fem-1(Df) females. Now, one can use MosSCI to generate integrated single- copy fem-1 transgenes that express well in the germ line. In Chapter 4, I used this system to measure the requirement of particular sequences for the susceptibility of fem-1 to silencing. Similarly, one could use this assay to test whether endogenously produced fem-1 RNAs from the transgene are able to rescue like the injected RNAs. If rescue were also provided by a transgene

218

expressing germ-line fem-1 RNA that cannot produce functional FEM-1 protein, that result would corroborate the licensing ability of maternal RNA.

If this system works, then providing various RNAs from an endogenous source rather than through injection is preferable for future studies for several reasons. The quality of injections including both the amount of disruption to the worm and the quantity of RNA provided is likely more variable than the amount of RNA produced by several constructs provided as single-copy integrants driven by the same promoter. Injecting individual idDf2 animals is also time-consuming, particularly since many of them do not produce enough progeny to give a reliable value for the proportion of Fog animals obtained. Germ-line transgenes provide the additional benefit of producing RNA through transcription in the nuclei of the maternal germ line. If processing, modification and localization of the licensing RNAs are important, these processes are more likely to be intact and subject to analysis using transgenic RNA than in vitro-transcribed RNA injected into the germ-line syncytium. Unresolved questions that could be tested in such a system include whether the idDf1-like transcript’s ability to rescue the Fog phenotype is compromised because of specific factors such as its chimeric nature or the presence of a 21U-RNA sequence at its 3’ end. Promoter requirements could be assessed by comparing transgenes driven by the fem-1 promoter or other promoters known for germ-line expression. Other unknowns about this process include how much RNA is required for effective licensing, the form and size of the RNA, whether it forms a complex with other factors, and where and when it acts in the zygote.

Avenues for addressing some of these questions about the molecular mechanisms of maternal-effect regulation are suggested by the modifier genes from my RNAi screen. Some of the proteins are predicted to interact with silencing or licensing RNAs. Combined analysis of RNAs that coimmunoprecipitate with these proteins and RNAs that are depleted in mutants will be informative in determining whether fem-1 RNAs or RNAs from other sources are associated with these proteins. For some of these genes such as wago-1, such data are already available, but it is often from whole worm samples; samples from dissected gonads may be more informative for a germ-line-specific process though obtaining sufficient material for such experiments may be difficult. A comparison with mutants lacking a germ line, such as glp-4 animals, may be more feasible. It would be particularly informative to know which RNAs are associated with the other Argonautes that produced a phenotype in my screen such as the suppressors PRG-2 and

219

WAGO-4, and the enhancer PPW-2. Many of the other modifiers are potentially involved in chromatin remodelling, but their effect on zygotic fem-1 is not yet known. Using chromatin immunoprecipitation, one could determine whether these proteins are bound to fem-1 DNA, a result that would suggest direct involvement of chromatin remodelling at that locus. The suppressor MUT-16 and the enhancers MYS-2 and T12E12.2 are all candidates for binding the fem-1 locus. In cases where several of the modifiers may function together in a complex, such as RHA-1 and MYS-2, testing for an interaction between those proteins using coimmunoprecipitation would be informative.

If maternal fem-1 RNA is in fact bundled into a complex with additional proteins, it may be possible to isolate the RNA along with those interactors. It would be difficult to obtain sufficient material for a pull-down experiment by injecting biotinylated RNA, but using an in vivo approach to label the RNA might be possible. If RNA from germ-line-expressed transgenes were able to rescue the Fog phenotype, then a fem-1 transgene with multiple MS2 hairpins in the RNA (Zhou and Reed 2003) could be produced. If the hairpins are not removed by processing of the licensing RNAs, then the RNAs and their associated proteins could be captured using MS2 coat proteins that bind the hairpin loops. Identification of additional proteins in this way may also suggest new candidates for extending the RNAi screen.

In addition to identifying trans-acting molecules that regulate fem-1 activity, investigating possible modifications at the fem-1 locus itself would be instructive, particularly in assessing the validity of the two general types of models described above. A comparison of marks at the fem-1 locus in Fog animals and control animals descended from non-fem-1(Df) mothers may indicate whether there is a transcriptional and possibly heritable component to maternal-effect regulation on the fem-1(+) allele itself. Inhibitory marks that may be present include various degrees of methylation of H3K9 and H3K27. Activating marks could include methylation of H3K4 or H3K36 and acetylation of H4K16. Chromatin immunoprecipitation using antibodies that recognize these histone modifications will indicate whether they are found differentially at the fem-1 locus in animals subject to germ-line feminization. Occupancy by RNA polymerase II could be assessed in a similar way.

Information gleaned from these experiments will be informative in developing more detailed molecular models of how maternal-effect regulation of zygotic fem-1 activity is

220

achieved. It will be exciting to investigate the possibility that this form of regulation may provide a more general mechanism for comparing the maternal and zygotic germ-line transcriptomes. Further analysis of this phenomenon will provide an expanded perspective on this new, positive role of a transcript from a protein-coding gene in promoting its own expression. Knowledge of this process broadens our understanding of the regulatory roles of RNA and increases our appreciation of methods used to regulate development and gene expression in the germ line.

221

References

Ahringer, J. and Kimble, J. 1991. Control of the sperm-oocyte switch in Caenorhabditis elegans hermaphrodites by the fem-3 3' untranslated region. Nature 349(6307): 346-348.

Ahringer, J., Rosenquist, T.A., Lawson, D.N., and Kimble, J. 1992. The Caenorhabditis elegans sex determining gene fem-3 is regulated post-transcriptionally. Embo J 11(6): 2303-2310.

Akhtar, A. 2003. Dosage compensation: an intertwined world of RNA and chromatin remodelling. Curr Opin Genet Dev 13(2): 161-169.

Alcazar, R.M., Lin, R., and Fire, A.Z. 2008. Transmission dynamics of heritable silencing induced by double-stranded RNA in Caenorhabditis elegans. Genetics 180(3): 1275- 1288.

Alder, M.N., Dames, S., Gaudet, J., and Mango, S.E. 2003. Gene silencing in Caenorhabditis elegans by transitive RNA interference. Rna 9(1): 25-32.

Ambros, V., Lee, R.C., Lavanway, A., Williams, P.T., and Jewell, D. 2003. MicroRNAs and other tiny endogenous RNAs in C. elegans. Curr Biol 13(10): 807-818.

Andersen, E.C., Lu, X., and Horvitz, H.R. 2006. C. elegans ISWI and NURF301 antagonize an Rb-like pathway in the determination of multiple cell fates. Development 133(14): 2695- 2704.

Aoki, K., Moriguchi, H., Yoshioka, T., Okawa, K., and Tabara, H. 2007. In vitro analyses of the production and activity of secondary small interfering RNAs in C. elegans. Embo J 26(24): 5007-5019.

Barton, M.K. and Kimble, J. 1990. fog-1, a regulatory gene required for specification of spermatogenesis in the germ line of Caenorhabditis elegans. Genetics 125(1): 29-39.

Barton, M.K., Schedl, T.B., and Kimble, J. 1987. Gain-of-function mutations of fem-3, a sex- determination gene in Caenorhabditis elegans. Genetics 115(1): 107-119.

Batista, P.J., Ruby, J.G., Claycomb, J.M., Chiang, R., Fahlgren, N., Kasschau, K.D., Chaves, D.A., Gu, W., Vasale, J.J., Duan, S. et al. 2008. PRG-1 and 21U-RNAs interact to form the piRNA complex required for fertility in C. elegans. Mol Cell 31(1): 67-78.

Bean, C.J., Schaner, C.E., and Kelly, W.G. 2004. Meiotic pairing and imprinted X chromatin assembly in Caenorhabditis elegans. Nat Genet 36(1): 100-105.

Bender, L.B., Cao, R., Zhang, Y., and Strome, S. 2004. The MES-2/MES-3/MES-6 complex and regulation of histone H3 methylation in C. elegans. Curr Biol 14(18): 1639-1643.

Bender, L.B., Suh, J., Carroll, C.R., Fong, Y., Fingerman, I.M., Briggs, S.D., Cao, R., Zhang, Y., Reinke, V., and Strome, S. 2006. MES-4: an autosome-associated histone

222

methyltransferase that participates in silencing the X chromosomes in the C. elegans germ line. Development 133(19): 3907-3917.

Bernstein, E. and Allis, C.D. 2005. RNA meets chromatin. Genes Dev 19(14): 1635-1655.

Bessereau, J.-L. Transposons in C. elegans (January 18, 2006), WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.70.1, http://www.wormbook.org.

Brennecke, J., Aravin, A.A., Stark, A., Dus, M., Kellis, M., Sachidanandam, R., and Hannon, G.J. 2007. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell 128(6): 1089-1103.

Brennecke, J., Malone, C.D., Aravin, A.A., Sachidanandam, R., Stark, A., and Hannon, G.J. 2008. An epigenetic role for maternally inherited piRNAs in transposon silencing. Science 322(5906): 1387-1392.

Brenner, S. 1974. The genetics of Caenorhabditis elegans. Genetics 77(1): 71-94.

Buhler, M., Haas, W., Gygi, S.P., and Moazed, D. 2007. RNAi-dependent and -independent RNA turnover mechanisms contribute to heterochromatic gene silencing. Cell 129(4): 707-721.

Buhler, M., Verdel, A., and Moazed, D. 2006. Tethering RITS to a nascent transcript initiates RNAi- and heterochromatin-dependent gene silencing. Cell 125(5): 873-886.

Capowski, E.E., Martin, P., Garvin, C., and Strome, S. 1991. Identification of grandchildless loci whose products are required for normal germ-line development in the nematode Caenorhabditis elegans. Genetics 129(4): 1061-1072.

Carmell, M.A., Xuan, Z., Zhang, M.Q., and Hannon, G.J. 2002. The Argonaute family: tentacles that reach into RNAi, developmental control, stem cell maintenance, and tumorigenesis. Genes Dev 16(21): 2733-2742.

Ceol, C.J. and Horvitz, H.R. 2004. A new class of C. elegans synMuv genes implicates a Tip60/NuA4-like HAT complex as a negative regulator of Ras signaling. Dev Cell 6(4): 563-576.

Chandler, V. and Alleman, M. 2008. Paramutation: epigenetic instructions passed across generations. Genetics 178(4): 1839-1844.

Chandler, V.L. 2007. Paramutation: from maize to mice. Cell 128(4): 641-645.

Chaudhury, A. 2005. Plant genetics: hothead healer and extragenomic information. Nature 437(7055): E1; discussion E2.

Chen, C.C. 2006. Identification of Novel (RNAi Deficient) Genes in C. elegans. Ph.D. Thesis, 154 pp., University of Massachsetts Medical School, Worcester.

223

Chen, C.C., Simard, M.J., Tabara, H., Brownell, D.R., McCollough, J.A., and Mello, C.C. 2005. A member of the polymerase beta nucleotidyltransferase superfamily is required for RNA interference in C. elegans. Curr Biol 15(4): 378-383.

Chen, P. and Ellis, R.E. 2000. TRA-1A regulates transcription of fog-3, which controls germ cell fate in C. elegans. Development 127(14): 3119-3129.

Chen, P.J., Singal, A., Kimble, J., and Ellis, R.E. 2000. A novel member of the tob family of proteins controls sexual fate in Caenorhabditis elegans germ cells. Dev Biol 217(1): 77- 90.

Chin-Sang, I.D. and Spence, A.M. 1996. Caenorhabditis elegans sex-determining protein FEM- 2 is a protein phosphatase that promotes male development and interacts directly with FEM-3. Genes Dev 10(18): 2314-2325.

Choi, K.Y., Ji, Y.J., Jee, C., Kim, D.H., and Ahnn, J. 2002. Characterization of CeHDA-7, a class II histone deacetylase interacting with MEF-2 in Caenorhabditis elegans. Biochem Biophys Res Commun 293(4): 1295-1300.

Choy, S.W., Wong, Y.M., Ho, S.H., and Chow, K.L. 2007. C. elegans SIN-3 and its associated HDAC corepressor complex act as mediators of male sensory ray development. Biochem Biophys Res Commun 358(3): 802-807.

Chu, D.S., Liu, H., Nix, P., Wu, T.F., Ralston, E.J., Yates, J.R., 3rd, and Meyer, B.J. 2006. Sperm chromatin proteomics identifies evolutionarily conserved fertility factors. Nature 443(7107): 101-105.

Church, D.L., Guan, K.L., and Lambie, E.J. 1995. Three genes of the MAP kinase cascade, mek- 2, mpk-1/sur-1 and let-60 ras, are required for meiotic cell cycle progression in Caenorhabditis elegans. Development 121(8): 2525-2535.

Ciosk, R., DePalma, M., and Priess, J.R. 2006. Translational regulators maintain totipotency in the Caenorhabditis elegans germline. Science 311(5762): 851-853.

Claycomb, J.M., Batista, P.J., Pang, K.M., Gu, W., Vasale, J.J., van Wolfswinkel, J.C., Chaves, D.A., Shirayama, M., Mitani, S., Ketting, R.F. et al. 2009. The Argonaute CSR-1 and its 22G-RNA cofactors are required for holocentric chromosome segregation. Cell 139(1): 123-134.

Clifford, R., Lee, M.H., Nayak, S., Ohmachi, M., Giorgini, F., and Schedl, T. 2000. FOG-2, a novel F-box containing protein, associates with the GLD-1 RNA binding protein and directs male sex determination in the C. elegans hermaphrodite germline. Development 127(24): 5265-5276.

Collins, J., Saari, B., and Anderson, P. 1987. Activation of a transposable element in the germ line but not the soma of Caenorhabditis elegans. Nature 328(6132): 726-728.

Conine, C.C., Batista, P.J., Gu, W., Claycomb, J.M., Chaves, D.A., Shirayama, M., and Mello, C.C. 2010. Argonautes ALG-3 and ALG-4 are required for spermatogenesis-specific

224

26G-RNAs and thermotolerant sperm in Caenorhabditis elegans. Proc Natl Acad Sci U S A 107(8): 3588-3593.

Conradt, B. and Horvitz, H.R. 1999. The TRA-1A sex determination protein of C. elegans regulates sexually dimorphic cell deaths by repressing the egl-1 cell death activator gene. Cell 98(3): 317-327.

Cox, D.N., Chao, A., Baker, J., Chang, L., Qiao, D., and Lin, H. 1998. A novel class of evolutionarily conserved genes defined by piwi are essential for stem cell self-renewal. Genes Dev 12(23): 3715-3727.

Csankovszki, G., Collette, K., Spahl, K., Carey, J., Snyder, M., Petty, E., Patel, U., Tabuchi, T., Liu, H., McLeod, I. et al. 2009. Three distinct condensin complexes control C. elegans chromosome dynamics. Curr Biol 19(1): 9-19.

Cui, M., Kim, E.B., and Han, M. 2006. Diverse chromatin remodeling genes antagonize the Rb- involved SynMuv pathways in C. elegans. PLoS Genet 2(5): e74.

Das, P.P., Bagijn, M.P., Goldstein, L.D., Woolford, J.R., Lehrbach, N.J., Sapetschnig, A., Buhecha, H.R., Gilchrist, M.J., Howe, K.L., Stark, R. et al. 2008. Piwi and piRNAs act upstream of an endogenous siRNA pathway to suppress Tc3 transposon mobility in the Caenorhabditis elegans germline. Mol Cell 31(1): 79-90. de Bono, M. and Hodgkin, J. 1996. Evolution of sex determination in caenorhabditis: unusually high divergence of tra-1 and its functional consequences. Genetics 144(2): 587-595.

Dernburg, A.F., Zalevsky, J., Colaiacovo, M.P., and Villeneuve, A.M. 2000. Transgene- mediated cosuppression in the C. elegans germ line. Genes Dev 14(13): 1578-1583.

Domeier, M.E., Morse, D.P., Knight, S.W., Portereiko, M., Bass, B.L., and Mango, S.E. 2000. A link between RNA interference and nonsense-mediated decay in Caenorhabditis elegans. Science 289(5486): 1928-1931.

Doniach, T. 1986. Activity of the sex-determining gene tra-2 is modulated to allow spermatogenesis in the C. elegans hermaphrodite. Genetics 114(1): 53-76.

Doniach, T. and Hodgkin, J. 1984. A sex-determining gene, fem-1, required for both male and hermaphrodite development in Caenorhabditis elegans. Dev Biol 106(1): 223-235.

Duchaine, T.F., Wohlschlegel, J.A., Kennedy, S., Bei, Y., Conte, D., Jr., Pang, K., Brownell, D.R., Harding, S., Mitani, S., Ruvkun, G. et al. 2006. Functional proteomics reveals the biochemical niche of C. elegans DCR-1 in multiple small-RNA-mediated pathways. Cell 124(2): 343-354.

Dudley, N.R., Labbe, J.C., and Goldstein, B. 2002. Using RNA interference to identify genes required for RNA interference. Proc Natl Acad Sci U S A 99(7): 4191-4196.

225

Dufourcq, P., Victor, M., Gay, F., Calvo, D., Hodgkin, J., and Shi, Y. 2002. Functional requirement for histone deacetylase 1 in Caenorhabditis elegans gonadogenesis. Mol Cell Biol 22(9): 3024-3034.

Duharcourt, S., Lepere, G., and Meyer, E. 2009. Developmental genome rearrangements in ciliates: a natural genomic subtraction mediated by non-coding transcripts. Trends Genet 25(8): 344-350.

Eki, T., Ishihara, T., Katsura, I., and Hanaoka, F. 2007. A genome-wide survey and systematic RNAi-based characterization of helicase-like genes in Caenorhabditis elegans. DNA Res 14(4): 183-199.

Ellis, R.E. and Kimble, J. 1995. The fog-3 gene and regulation of cell fate in the germ line of Caenorhabditis elegans. Genetics 139(2): 561-577.

Feil, R. and Berger, F. 2007. Convergent evolution of genomic imprinting in plants and mammals. Trends Genet 23(4): 192-199.

Feng, J., Bi, C., Clark, B.S., Mady, R., Shah, P., and Kohtz, J.D. 2006. The Evf-2 noncoding RNA is transcribed from the Dlx-5/6 ultraconserved region and functions as a Dlx-2 transcriptional coactivator. Genes Dev 20(11): 1470-1484.

Fire, A., Albertson, D., Harrison, S.W., and Moerman, D.G. 1991. Production of antisense RNA leads to effective and specific inhibition of gene expression in C. elegans muscle. Development 113(2): 503-514.

Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C.C. 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391(6669): 806-811.

Fong, Y., Bender, L., Wang, W., and Strome, S. 2002. Regulation of the different chromatin states of autosomes and X chromosomes in the germ line of C. elegans. Science 296(5576): 2235-2238.

Fraser, A.G., Kamath, R.S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M., and Ahringer, J. 2000. Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408(6810): 325-330.

Frohman, M.A., Dush, M.K., and Martin, G.R. 1988. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc Natl Acad Sci U S A 85(23): 8998-9002.

Frokjaer-Jensen, C., Davis, M.W., Hollopeter, G., Taylor, J., Harris, T.W., Nix, P., Lofgren, R., Prestgard-Duke, M., Bastiani, M., Moerman, D.G. et al. 2010. Targeted gene deletions in C. elegans using transposon excision. Nature methods 7(6): 451-453.

Frokjaer-Jensen, C., Davis, M.W., Hopkins, C.E., Newman, B.J., Thummel, J.M., Olesen, S.P., Grunnet, M., and Jorgensen, E.M. 2008. Single-copy insertion of transgenes in Caenorhabditis elegans. Nat Genet 40(11): 1375-1383.

226

Garvin, C., Holdeman, R., and Strome, S. 1998. The phenotype of mes-2, mes-3, mes-4 and mes- 6, maternal-effect genes required for survival of the germline in Caenorhabditis elegans, is sensitive to chromosome dosage. Genetics 148(1): 167-185.

Gaudet, J., VanderElst, I., and Spence, A.M. 1996. Post-transcriptional regulation of sex determination in Caenorhabditis elegans: widespread expression of the sex-determining gene fem-1 in both sexes. Mol Biol Cell 7(7): 1107-1121.

Gent, J.I., Lamm, A.T., Pavelec, D.M., Maniar, J.M., Parameswaran, P., Tao, L., Kennedy, S., and Fire, A.Z. 2010. Distinct phases of siRNA synthesis in an endogenous RNAi pathway in C. elegans soma. Mol Cell 37(5): 679-689.

Gent, J.I., Schvarzstein, M., Villeneuve, A.M., Gu, S.G., Jantsch, V., Fire, A.Z., and Baudrimont, A. 2009. A Caenorhabditis elegans RNA-directed RNA polymerase in sperm development and endogenous RNA interference. Genetics 183(4): 1297-1314.

Ghildiyal, M. and Zamore, P.D. 2009. Small silencing RNAs: an expanding universe. Nat Rev Genet 10(2): 94-108.

Girard, A. and Hannon, G.J. 2008. Conserved themes in small-RNA-mediated transposon control. Trends Cell Biol 18(3): 136-148.

Goodrich, J.A. and Kugel, J.F. 2006. Non-coding-RNA regulators of RNA polymerase II transcription. Nat Rev Mol Cell Biol 7(8): 612-616.

Graham, P.L., Schedl, T., and Kimble, J. 1993. More mog genes that influence the switch from spermatogenesis to oogenesis in the hermaphrodite germ line of Caenorhabditis elegans. Dev Genet 14(6): 471-484.

Grewal, S.I. and Jia, S. 2007. Heterochromatin revisited. Nat Rev Genet 8(1): 35-46.

Grimson, A., O'Connor, S., Newman, C.L., and Anderson, P. 2004. SMG-1 is a phosphatidylinositol kinase-related protein kinase required for nonsense-mediated mRNA Decay in Caenorhabditis elegans. Mol Cell Biol 24(17): 7483-7490.

Grishok, A., Pasquinelli, A.E., Conte, D., Li, N., Parrish, S., Ha, I., Baillie, D.L., Fire, A., Ruvkun, G., and Mello, C.C. 2001. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 106(1): 23-34.

Grishok, A., Sinskey, J.L., and Sharp, P.A. 2005. Transcriptional silencing of a transgene by RNAi in the soma of C. elegans. Genes Dev 19(6): 683-696.

Grishok, A., Tabara, H., and Mello, C.C. 2000. Genetic requirements for inheritance of RNAi in C. elegans. Science 287(5462): 2494-2497.

Grote, P. and Conradt, B. 2006. The PLZF-like protein TRA-4 cooperates with the Gli-like transcription factor TRA-1 to promote female development in C. elegans. Dev Cell 11(4): 561-573.

227

Gruidl, M.E., Smith, P.A., Kuznicki, K.A., McCrone, J.S., Kirchner, J., Roussell, D.L., Strome, S., and Bennett, K.L. 1996. Multiple potential germ-line helicases are components of the germ-line-specific P granules of Caenorhabditis elegans. Proc Natl Acad Sci U S A 93(24): 13837-13842.

Gu, W., Shirayama, M., Conte, D., Jr., Vasale, J., Batista, P.J., Claycomb, J.M., Moresco, J.J., Youngman, E.M., Keys, J., Stoltz, M.J. et al. 2009. Distinct argonaute-mediated 22G- RNA pathways direct genome surveillance in the C. elegans germline. Mol Cell 36(2): 231-244.

Guang, S., Bochner, A.F., Pavelec, D.M., Burkhart, K.B., Harding, S., Lachowiec, J., and Kennedy, S. 2008. An Argonaute transports siRNAs from the cytoplasm to the nucleus. Science 321(5888): 537-541.

Gutierrez, A. and Sommer, R.J. 2004. Evolution of dnmt-2 and mbd-2-like genes in the free- living nematodes Pristionchus pacificus, Caenorhabditis elegans and Caenorhabditis briggsae. Nucleic Acids Res 32(21): 6388-6396.

Haack, H. and Hodgkin, J. 1991. Tests for parental imprinting in the nematode Caenorhabditis elegans. Mol Gen Genet 228(3): 482-485.

Haag, E.S., Wang, S., and Kimble, J. 2002. Rapid coevolution of the nematode sex-determining genes fem-3 and tra-2. Curr Biol 12(23): 2035-2041.

Han, J., Kim, D., and Morris, K.V. 2007. Promoter-associated RNA is required for RNA- directed transcriptional gene silencing in human cells. Proc Natl Acad Sci U S A 104(30): 12422-12427.

Han, T., Manoharan, A.P., Harkins, T.T., Bouffard, P., Fitzpatrick, C., Chu, D.S., Thierry-Mieg, D., Thierry-Mieg, J., and Kim, J.K. 2009. 26G endo-siRNAs regulate spermatogenic and zygotic gene expression in Caenorhabditis elegans. Proc Natl Acad Sci U S A 106(44): 18674-18679.

Higuchi, R., Krummel, B., and Saiki, R.K. 1988. A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res 16(15): 7351-7367.

Hodgkin, J. 1986. Sex determination in the nematode C. elegans: analysis of tra-3 suppressors and characterization of fem genes. Genetics 114(1): 15-52.

-. 1987. A genetic analysis of the sex-determining gene, tra-1, in the nematode Caenorhabditis elegans. Genes Dev 1(7): 731-745.

Hodgkin, J., Horvitz, H.R., Brenner, S. 1979. Nondisjunction mutatns of the nematode Caenorhabditis elegans. Genetics 91: 67-94.

Hodgkin, J., Papp, A., Pulak, R., Ambros, V., and Anderson, P. 1989. A new kind of informational suppression in the nematode Caenorhabditis elegans. Genetics 123(2): 301-313.

228

Holdeman, R., Nehrt, S., and Strome, S. 1998. MES-2, a maternal protein essential for viability of the germline in Caenorhabditis elegans, is homologous to a Drosophila Polycomb group protein. Development 125(13): 2457-2467.

Horvitz, H.R., Brenner, S., Hodgkin, J., and Herman, R.K. 1979. A uniform genetic nomenclature for the nematode Caenorhabditis elegans. Mol Gen Genet 175(2): 129-133.

Houwing, S., Kamminga, L.M., Berezikov, E., Cronembold, D., Girard, A., van den Elst, H., Filippov, D.V., Blaser, H., Raz, E., Moens, C.B. et al. 2007. A role for Piwi and piRNAs in germ cell maintenance and transposon silencing in Zebrafish. Cell 129(1): 69-82.

Hsieh, J., Liu, J., Kostas, S.A., Chang, C., Sternberg, P.W., and Fire, A. 1999. The RING finger/B-box factor TAM-1 and a retinoblastoma-like protein LIN-35 modulate context- dependent gene silencing in Caenorhabditis elegans. Genes Dev 13(22): 2958-2970.

Hubbard, E.J.A. and Greenstein, D. Introduction to the germ line (September 1, 2005), WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.18.1, http://www.wormbook.org.

Ilik, I. and Akhtar, A. 2009. roX RNAs: non-coding regulators of the male X chromosome in flies. RNA biology 6(2): 113-121.

Iwasaki, K., McCarter, J., Francis, R., and Schedl, T. 1996. emo-1, a Caenorhabditis elegans Sec61p gamma homologue, is required for oocyte development and ovulation. J Cell Biol 134(3): 699-714.

Janowski, B.A., Younger, S.T., Hardy, D.B., Ram, R., Huffman, K.E., and Corey, D.R. 2007. Activating gene expression in mammalian cells with promoter-targeted duplex RNAs. Nat Chem Biol 3(3): 166-173.

Jedrusik, M.A. and Schulze, E. 2001. A single histone H1 isoform (H1.1) is essential for chromatin silencing and germline development in Caenorhabditis elegans. Development 128(7): 1069-1080.

-. 2007. Linker histone HIS-24 (H1.1) cytoplasmic retention promotes germ line development and influences histone H3 methylation in Caenorhabditis elegans. Mol Cell Biol 27(6): 2229-2239.

Jenny, A., Hachet, O., Zavorszky, P., Cyrklaff, A., Weston, M.D., Johnston, D.S., Erdelyi, M., and Ephrussi, A. 2006. A translation-independent role of oskar RNA in early Drosophila oogenesis. Development 133(15): 2827-2833.

Jenuwein, T. and Allis, C.D. 2001. Translating the histone code. Science 293(5532): 1074-1080.

Jin, S.W., Kimble, J., and Ellis, R.E. 2001. Regulation of cell fate in Caenorhabditis elegans by a novel cytoplasmic polyadenylation element binding protein. Dev Biol 229(2): 537-553.

229

Jones, A.R. and Schedl, T. 1995. Mutations in gld-1, a female germ cell-specific tumor suppressor gene in Caenorhabditis elegans, affect a conserved domain also found in Src- associated protein Sam68. Genes Dev 9(12): 1491-1504.

Kamath, R.S., Fraser, A.G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., Le Bot, N., Moreno, S., Sohrmann, M. et al. 2003. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421(6920): 231-237.

Kamath, R.S., Martinez-Campos, M., Zipperlen, P., Fraser, A.G., and Ahringer, J. 2000. Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans. Genome Biol 2(1): RESEARCH0002.

Kato, M., de Lencastre, A., Pincus, Z., and Slack, F.J. 2009. Dynamic expression of small noncoding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development. Genome Biol 10(5): R54.

Katz, D.J., Edwards, T.M., Reinke, V., and Kelly, W.G. 2009. A C. elegans LSD1 demethylase contributes to germline immortality by reprogramming epigenetic memory. Cell 137(2): 308-320.

Kawasaki, I., Shim, Y.H., Kirchner, J., Kaminker, J., Wood, W.B., and Strome, S. 1998. PGL-1, a predicted RNA-binding component of germ granules, is essential for fertility in C. elegans. Cell 94(5): 635-645.

Kelley, R.L., Lee, O.K., and Shim, Y.K. 2008. Transcription rate of noncoding roX1 RNA controls local spreading of the Drosophila MSL chromatin remodeling complex. Mech Dev 125(11-12): 1009-1019.

Kelley, R.L., Meller, V.H., Gordadze, P.R., Roman, G., Davis, R.L., and Kuroda, M.I. 1999. Epigenetic spreading of the Drosophila dosage compensation complex from roX RNA genes into flanking chromatin. Cell 98(4): 513-522.

Kelly, W.G. and Aramayo, R. 2007. Meiotic silencing and the epigenetics of sex. Chromosome Res 15(5): 633-651.

Kelly, W.G. and Fire, A. 1998. Chromatin silencing and the maintenance of a functional germline in Caenorhabditis elegans. Development 125(13): 2451-2456.

Kelly, W.G., Schaner, C.E., Dernburg, A.F., Lee, M.H., Kim, S.K., Villeneuve, A.M., and Reinke, V. 2002. X-chromosome silencing in the germline of C. elegans. Development 129(2): 479-492.

Kelly, W.G., Xu, S., Montgomery, M.K., and Fire, A. 1997. Distinct requirements for somatic and germline expression of a generally expressed Caernorhabditis elegans gene. Genetics 146(1): 227-238.

Kennedy, S., Wang, D., and Ruvkun, G. 2004. A conserved siRNA-degrading RNase negatively regulates RNA interference in C. elegans. Nature 427(6975): 645-649.

230

Ketting, R.F., Fischer, S.E., Bernstein, E., Sijen, T., Hannon, G.J., and Plasterk, R.H. 2001. Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans. Genes Dev 15(20): 2654-2659.

Ketting, R.F., Haverkamp, T.H., van Luenen, H.G., and Plasterk, R.H. 1999. Mut-7 of C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner syndrome helicase and RNaseD. Cell 99(2): 133-141.

Ketting, R.F. and Plasterk, R.H. 2000. A genetic link between co-suppression and RNA interference in C. elegans. Nature 404(6775): 296-298.

Kiefer, J.C. 2007. Epigenetics in development. Dev Dyn 236(4): 1144-1156.

Kim, J.K., Gabel, H.W., Kamath, R.S., Tewari, M., Pasquinelli, A., Rual, J.F., Kennedy, S., Dybbs, M., Bertin, N., Kaplan, J.M. et al. 2005. Functional genomic analysis of RNA interference in C. elegans. Science 308(5725): 1164-1167.

Kimble, J., Edgar, L., and Hirsh, D. 1984. Specification of male development in Caenorhabditis elegans: the fem genes. Dev Biol 105(1): 234-239.

Kimble, J. and Hirsh, D. 1979. The postembryonic cell lineages of the hermaphrodite and male gonads in Caenorhabditis elegans. Dev Biol 70(2): 396-417.

Kind, J. and Akhtar, A. 2007. Cotranscriptional recruitment of the dosage compensation complex to X-linked target genes. Genes Dev 21(16): 2030-2040.

Kloc, A., Zaratiegui, M., Nora, E., and Martienssen, R. 2008. RNA interference guides histone modification during the S phase of chromosomal replication. Curr Biol 18(7): 490-495.

Kloc, M. 2009. Teachings from the egg: new and unexpected functions of RNAs. Molecular reproduction and development 76(10): 922-932.

Knight, S.W. and Bass, B.L. 2001. A role for the RNase III enzyme DCR-1 in RNA interference and germ line development in Caenorhabditis elegans. Science 293(5538): 2269-2271.

Korf, I., Fan, Y., and Strome, S. 1998. The Polycomb group in Caenorhabditis elegans and maternal control of germline development. Development 125(13): 2469-2478.

Kraemer, B., Crittenden, S., Gallegos, M., Moulder, G., Barstead, R., Kimble, J., and Wickens, M. 1999. NANOS-3 and FBF proteins physically interact to control the sperm-oocyte switch in Caenorhabditis elegans. Curr Biol 9(18): 1009-1018.

Krakow, D., Sebald, E., King, L.M., and Cohn, D.H. 2001. Identification of human FEM1A, the ortholog of a C. elegans sex-differentiation gene. Gene 279(2): 213-219.

Kwak, J.E. and Wickens, M. 2007. A family of poly(U) polymerases. Rna 13(6): 860-867.

231

Labrousse, A.M., Zappaterra, M.D., Rube, D.A., and van der Bliek, A.M. 1999. C. elegans dynamin-related protein DRP-1 controls severing of the mitochondrial outer membrane. Mol Cell 4(5): 815-826.

Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. 2009. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10(3): R25.

Lee, R.C., Hammell, C.M., and Ambros, V. 2006. Interacting endogenous and exogenous RNAi pathways in Caenorhabditis elegans. Rna 12(4): 589-597.

Lepere, G., Betermier, M., Meyer, E., and Duharcourt, S. 2008. Maternal noncoding transcripts antagonize the targeting of DNA elimination by scanRNAs in Paramecium tetraurelia. Genes Dev 22(11): 1501-1512.

Li, L.C., Okino, S.T., Zhao, H., Pookot, D., Place, R.F., Urakami, S., Enokida, H., and Dahiya, R. 2006. Small dsRNAs induce transcriptional activation in human cells. Proc Natl Acad Sci U S A 103(46): 17337-17342.

Lolle, S.J., Victor, J.L., Young, J.M., and Pruitt, R.E. 2005. Genome-wide non-mendelian inheritance of extra-genomic information in Arabidopsis. Nature 434(7032): 505-509.

Lu, R., Maduro, M., Li, F., Li, H.W., Broitman-Maduro, G., Li, W.X., and Ding, S.W. 2005. Animal virus replication and RNAi-mediated antiviral silencing in Caenorhabditis elegans. Nature 436(7053): 1040-1043.

Lu, X. and Horvitz, H.R. 1998. lin-35 and lin-53, two genes that antagonize a C. elegans Ras pathway, encode proteins similar to Rb and its binding protein RbAp48. Cell 95(7): 981- 991.

Lublin, A.L. and Evans, T.C. 2007. The RNA-binding proteins PUF-5, PUF-6, and PUF-7 reveal multiple systems for maternal mRNA regulation during C. elegans oogenesis. Dev Biol 303(2): 635-649.

Luitjens, C., Gallegos, M., Kraemer, B., Kimble, J., and Wickens, M. 2000. CPEB proteins control two key steps in spermatogenesis in C. elegans. Genes Dev 14(20): 2596-2609.

Madl, J.E. and Herman, R.K. 1979. Polyploids and sex determination in Caenorhabditis elegans. Genetics 93(2): 393-402.

Maine, E.M., Hauth, J., Ratliff, T., Vought, V.E., She, X., and Kelly, W.G. 2005. EGO-1, a putative RNA-dependent RNA polymerase, is required for heterochromatin assembly on unpaired dna during C. elegans meiosis. Curr Biol 15(21): 1972-1978.

Margueron, R. and Reinberg, D. 2010. Chromatin structure and the inheritance of epigenetic information. Nat Rev Genet 11(4): 285-296.

Matzke, M., Kanno, T., Daxinger, L., Huettel, B., and Matzke, A.J. 2009. RNA-mediated chromatin-based silencing in plants. Curr Opin Cell Biol 21(3): 367-376.

232

Matzke, M.A. and Birchler, J.A. 2005. RNAi-mediated pathways in the nucleus. Nat Rev Genet 6(1): 24-35.

Mehra, A., Gaudet, J., Heck, L., Kuwabara, P.E., and Spence, A.M. 1999. Negative regulation of male development in Caenorhabditis elegans by a protein-protein interaction between TRA-2A and FEM-3. Genes Dev 13: 1453-1463.

Meller, V.H. and Rattner, B.P. 2002. The roX genes encode redundant male-specific lethal transcripts required for targeting of the MSL complex. Embo J 21(5): 1084-1091.

Mello, C.C., Kramer, J.M., Stinchcomb, D., and Ambros, V. 1991. Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. Embo J 10(12): 3959-3970.

Meyer, B.J. 2010. Targeting X chromosomes for repression. Curr Opin Genet Dev 20(2): 179- 189.

Moazed, D. 2009. Small RNAs in transcriptional gene silencing and genome defence. Nature 457(7228): 413-420.

Montgomery, M.K., Xu, S., and Fire, A. 1998. RNA as a target of double-stranded RNA- mediated genetic interference in Caenorhabditis elegans. Proc Natl Acad Sci U S A 95(26): 15502-15507.

Morris, K.V., Chan, S.W., Jacobsen, S.E., and Looney, D.J. 2004. Small interfering RNA- induced transcriptional gene silencing in human cells. Science 305(5688): 1289-1292.

Motamedi, M.R., Verdel, A., Colmenares, S.U., Gerber, S.A., Gygi, S.P., and Moazed, D. 2004. Two RNAi complexes, RITS and RDRC, physically interact and localize to noncoding centromeric RNAs. Cell 119(6): 789-802.

Murchison, E.P., Stein, P., Xuan, Z., Pan, H., Zhang, M.Q., Schultz, R.M., and Hannon, G.J. 2007. Critical roles for Dicer in the female germline. Genes Dev 21(6): 682-693.

Nakamura, M., Ando, R., Nakazawa, T., Yudazono, T., Tsutsumi, N., Hatanaka, N., Ohgake, T., Hanaoka, F., and Eki, T. 2007. Dicer-related drh-3 gene functions in germ-line development by maintenance of chromosomal integrity in Caenorhabditis elegans. Genes Cells 12(9): 997-1010.

Nayak, S., Goree, J., and Schedl, T. 2005. fog-2 and the evolution of self-fertile hermaphroditism in Caenorhabditis. PLoS Biol 3(1): e6.

Nelson, G.A., Lew, K.K., and Ward, S. 1978. Intersex, a temperature-sensitive mutant of the nematode Caenorhabditis elegans. Dev Biol 66(2): 386-409.

Nigon, V. 1951. Polyploidie expérimentale chez un Nématode libre, Rhabditis elegans

Maupas. Bulletin Biologique de la France et de la Belgique 85: 187-225.

233

Nowacki, M., Vijayan, V., Zhou, Y., Schotanus, K., Doak, T.G., and Landweber, L.F. 2008. RNA-mediated epigenetic programming of a genome-rearrangement pathway. Nature 451(7175): 153-158.

O'Donnell, K.A. and Boeke, J.D. 2007. Mighty Piwis defend the germline against genome intruders. Cell 129(1): 37-44.

O'Neill, M.J. 2005. The influence of non-coding RNAs on allele-specific gene expression in mammals. Hum Mol Genet 14 Spec No 1: R113-120.

Ooi, S.L., Priess, J.R., and Henikoff, S. 2006. Histone H3.3 variant dynamics in the germline of Caenorhabditis elegans. PLoS Genet 2(6): e97.

Page, M.F., Carr, B., Anders, K.R., Grimson, A., and Anderson, P. 1999. SMG-2 is a phosphorylated protein required for mRNA surveillance in Caenorhabditis elegans and related to Upf1p of yeast. Mol Cell Biol 19(9): 5943-5951.

Pak, J. and Fire, A. 2007. Distinct populations of primary and secondary effectors during RNAi in C. elegans. Science 315(5809): 241-244.

Parrish, S. and Fire, A. 2001. Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans. RNA 7(10): 1397-1402.

Paulsen, J.E., Capowski, E.E., and Strome, S. 1995. Phenotypic and molecular analysis of mes-3, a maternal-effect gene required for proliferation and viability of the germ line in C. elegans. Genetics 141(4): 1383-1398.

Pavelec, D.M., Lachowiec, J., Duchaine, T.F., Smith, H.E., and Kennedy, S. 2009. Requirement for the ERI/DICER complex in endogenous RNA interference and sperm development in Caenorhabditis elegans. Genetics 183(4): 1283-1295.

Peng, P., Chan, S.W., Shah, G.A., and Jacobsen, S.E. 2006. Plant genetics: increased outcrossing in hothead mutants. Nature 443(7110): E8; discussion E8-9.

Petroski, M.D. and Deshaies, R.J. 2005. Function and regulation of cullin-RING ubiquitin ligases. Nat Rev Mol Cell Biol 6(1): 9-20.

Pilgrim, D., McGregor, A., Jackle, P., Johnson, T., and Hansen, D. 1995. The C. elegans sex- determining gene fem-2 encodes a putative protein phosphatase. Mol Biol Cell 6(9): 1159-1171.

Pitt, J.N., Schisa, J.A., and Priess, J.R. 2000. P granules in the germ cells of Caenorhabditis elegans adults are associated with clusters of nuclear pores and contain RNA. Dev Biol 219(2): 315-333.

Place, R.F., Li, L.C., Pookot, D., Noonan, E.J., and Dahiya, R. 2008. MicroRNA-373 induces expression of genes with complementary promoter sequences. Proc Natl Acad Sci U S A 105(5): 1608-1613.

234

Pothof, J., van Haaften, G., Thijssen, K., Kamath, R.S., Fraser, A.G., Ahringer, J., Plasterk, R.H., and Tijsterman, M. 2003. Identification of genes that protect the C. elegans genome against mutations by genome-wide RNAi. Genes Dev 17(4): 443-448.

Poulin, G., Dong, Y., Fraser, A.G., Hopper, N.A., and Ahringer, J. 2005. Chromatin regulation and sumoylation in the inhibition of Ras-induced vulval development in Caenorhabditis elegans. Embo J 24(14): 2613-2623.

Prasher, D.C., Eckenrode, V.K., Ward, W.W., Prendergast, F.G., and Cormier, M.J. 1992. Primary structure of the Aequorea victoria green-fluorescent protein. Gene 111(2): 229- 233.

Ptashne, M. 2007. On the use of the word 'epigenetic'. Curr Biol 17(7): R233-236.

Pulak, R. and Anderson, P. 1993. mRNA surveillance by the Caenorhabditis elegans smg genes. Genes Dev 7(10): 1885-1897.

Rassoulzadegan, M., Grandjean, V., Gounon, P., Vincent, S., Gillot, I., and Cuzin, F. 2006. RNA-mediated non-mendelian inheritance of an epigenetic change in the mouse. Nature 441(7092): 469-474.

Ratcliff, F., Harrison, B.D., and Baulcombe, D.C. 1997. A similarity between viral defense and gene silencing in plants. Science 276(5318): 1558-1560.

Ray, A. 2005. Plant genetics: RNA cache or genome trash? Nature 437(7055): E1-2; discussion E2.

Reuben, M. and Lin, R. 2002. Germline X chromosomes exhibit contrasting patterns of histone H3 methylation in Caenorhabditis elegans. Dev Biol 245(1): 71-82.

Robert, V.J., Sijen, T., van Wolfswinkel, J., and Plasterk, R.H. 2005. Chromatin and RNAi factors protect the C. elegans germline against repetitive sequences. Genes Dev 19(7): 782-787.

Rocheleau, C.E., Cullison, K., Huang, K., Bernstein, Y., Spilker, A.C., and Sundaram, M.V. 2008. The Caenorhabditis elegans ekl (enhancer of ksr-1 lethality) genes include putative components of a germline small RNA pathway. Genetics 178(3): 1431-1443.

Ross, J.M. and Zarkower, D. 2003. Polycomb group regulation of Hox gene expression in C. elegans. Dev Cell 4(6): 891-901.

Ruby, J.G., Jan, C., Player, C., Axtell, M.J., Lee, W., Nusbaum, C., Ge, H., and Bartel, D.P. 2006. Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans. Cell 127(6): 1193-1207.

Sambrook, J. and Russell, D.W. 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

235

Sanchez-Elsner, T., Gou, D., Kremmer, E., and Sauer, F. 2006. Noncoding RNAs of trithorax response elements recruit Drosophila Ash1 to Ultrabithorax. Science 311(5764): 1118- 1123.

Sassi, H.E., Renihan, S., Spence, A.M., and Cooperstock, R.L. 2005. Gene CATCHR--gene cloning and tagging for Caenorhabditis elegans using yeast homologous recombination: a novel approach for the analysis of gene expression. Nucleic Acids Res 33(18): e163.

Schaner, C.E., Deshpande, G., Schedl, P.D., and Kelly, W.G. 2003. A conserved chromatin architecture marks and maintains the restricted germ cell lineage in worms and flies. Dev Cell 5(5): 747-757.

Schedl, T., Graham, P.L., Barton, M.K., and Kimble, J. 1989. Analysis of the role of tra-1 in germline sex determination in the nematode Caenorhabditis elegans. Genetics 123(4): 755-769.

Schedl, T. and Kimble, J. 1988. fog-2, a germ-line-specific sex determination gene required for hermaphrodite spermatogenesis in Caenorhabditis elegans. Genetics 119(1): 43-61.

Schierenberg, E. Embryological variation during nematode development (January 02, 2006), WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.55.1, http://www.wormbook.org.

Schott, D.H., Cureton, D.K., Whelan, S.P., and Hunter, C.P. 2005. An antiviral role for the RNA interference machinery in Caenorhabditis elegans. Proc Natl Acad Sci U S A 102(51): 18420-18424.

Schvarzstein, M. and Spence, A.M. 2006. The C. elegans sex-determining GLI protein TRA-1A is regulated by sex-specific proteolysis. Dev Cell 11(5): 733-740.

Seila, A.C. and Sharp, P.A. 2008. Small RNAs tell big stories in Whistler. Nat Cell Biol 10(6): 630-633.

Seydoux, G. and Braun, R.E. 2006. Pathway to totipotency: lessons from germ cells. Cell 127(5): 891-904.

Seydoux, G. and Dunn, M.A. 1997. Transcriptionally repressed germ cells lack a subpopulation of phosphorylated RNA polymerase II in early embryos of Caenorhabditis elegans and Drosophila melanogaster. Development 124(11): 2191-2201.

Seydoux, G., Mello, C.C., Pettitt, J., Wood, W.B., Priess, J.R., and Fire, A. 1996. Repression of gene expression in the embryonic germ lineage of C. elegans. Nature 382(6593): 713- 716.

Sha, K. and Fire, A. 2005. Imprinting capacity of gamete lineages in Caenorhabditis elegans. Genetics 170(4): 1633-1652.

236

She, X., Xu, X., Fedotov, A., Kelly, W.G., and Maine, E.M. 2009. Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway. PLoS Genet 5(8): e1000624.

Shi, Y. and Mello, C. 1998. A CBP/p300 homolog specifies multiple differentiation pathways in Caenorhabditis elegans. Genes Dev 12(7): 943-955.

Sijen, T., Fleenor, J., Simmer, F., Thijssen, K.L., Parrish, S., Timmons, L., Plasterk, R.H., and Fire, A. 2001. On the role of RNA amplification in dsRNA-triggered gene silencing. Cell 107(4): 465-476.

Sijen, T. and Plasterk, R.H. 2003. Transposon silencing in the Caenorhabditis elegans germ line by natural RNAi. Nature 426(6964): 310-314.

Sijen, T., Steiner, F.A., Thijssen, K.L., and Plasterk, R.H. 2007. Secondary siRNAs result from unprimed RNA synthesis and form a distinct class. Science 315(5809): 244-247.

Simmer, F., Tijsterman, M., Parrish, S., Koushika, S.P., Nonet, M.L., Fire, A., Ahringer, J., and Plasterk, R.H. 2002. Loss of the putative RNA-directed RNA polymerase RRF-3 makes C. elegans hypersensitive to RNAi. Curr Biol 12(15): 1317-1319.

Simpson, V.J., Johnson, T.E., and Hammen, R.F. 1986. Caenorhabditis elegans DNA does not contain 5-methylcytosine at any time during development or aging. Nucleic Acids Res 14(16): 6711-6719.

Smardon, A., Spoerke, J.M., Stacey, S.C., Klein, M.E., Mackin, N., and Maine, E.M. 2000. EGO-1 is related to RNA-directed RNA polymerase and functions in germ-line development and RNA interference in C. elegans. Curr Biol 10(4): 169-178.

Solari, F., Bateman, A., and Ahringer, J. 1999. The Caenorhabditis elegans genes egl-27 and egr-1 are similar to MTA1, a member of a chromatin regulatory complex, and are redundantly required for embryonic patterning. Development 126(11): 2483-2494.

Sonnichsen, B., Koski, L.B., Walsh, A., Marschall, P., Neumann, B., Brehm, M., Alleaume, A.M., Artelt, J., Bettencourt, P., Cassin, E. et al. 2005. Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans. Nature 434(7032): 462-469.

Spence, A.M., Coulson, A., and Hodgkin, J. 1990. The product of fem-1, a nematode sex- determining gene, contains a motif found in cell cycle control proteins and receptors for cell-cell interactions. Cell 60(6): 981-990.

Spike, C.A., Bader, J., Reinke, V., and Strome, S. 2008. DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells. Development 135(5): 983-993.

Starostina, N.G., Lim, J.M., Schvarzstein, M., Wells, L., Spence, A.M., and Kipreos, E.T. 2007. A CUL-2 ubiquitin ligase containing three FEM proteins degrades TRA-1 to regulate C. elegans sex determination. Dev Cell 13(1): 127-139.

237

Strahl, B.D. and Allis, C.D. 2000. The language of covalent histone modifications. Nature 403(6765): 41-45.

Strome, S. and Lehmann, R. 2007. Germ versus soma decisions: lessons from flies and worms. Science 316(5823): 392-393.

Subramaniam, K. and Seydoux, G. 1999. nos-1 and nos-2, two genes related to Drosophila nanos, regulate primordial germ cell development and survival in Caenorhabditis elegans. Development 126(21): 4861-4871.

Sulston, J.E. and Horvitz, H.R. 1977. Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Dev Biol 56(1): 110-156.

Tabara, H., Grishok, A., and Mello, C.C. 1998. RNAi in C. elegans: soaking in the genome sequence. Science 282(5388): 430-431.

Tabara, H., Sarkissian, M., Kelly, W.G., Fleenor, J., Grishok, A., Timmons, L., Fire, A., and Mello, C.C. 1999. The rde-1 gene, RNA interference, and transposon silencing in C. elegans. Cell 99(2): 123-132.

Tabara, H., Yigit, E., Siomi, H., and Mello, C.C. 2002. The dsRNA binding protein RDE-4 interacts with RDE-1, DCR-1, and a DExH-box helicase to direct RNAi in C. elegans. Cell 109(7): 861-871.

Takasaki, T., Liu, Z., Habara, Y., Nishiwaki, K., Nakayama, J., Inoue, K., Sakamoto, H., and Strome, S. 2007. MRG-1, an autosome-associated protein, silences X-linked genes and protects germline immortality in Caenorhabditis elegans. Development 134(4): 757-767.

Talbert, P.B. and Henikoff, S. 2010. Histone variants--ancient wrap artists of the epigenome. Nat Rev Mol Cell Biol 11(4): 264-275.

Terranova, R., Pujol, N., Fasano, L., and Djabali, M. 2002. Characterisation of set-1, a conserved PR/SET domain gene in Caenorhabditis elegans. Gene 292(1-2): 33-41.

Tijsterman, M., Okihara, K.L., Thijssen, K., and Plasterk, R.H. 2002. PPW-1, a PAZ/PIWI protein required for efficient germline RNAi, is defective in a natural isolate of C. elegans. Curr Biol 12(17): 1535-1540.

Timmons, J.A., Court, D.L., and Fire, A. 2001. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene 263(1- 2): 103-112.

Tops, B.B., Tabara, H., Sijen, T., Simmer, F., Mello, C.C., Plasterk, R.H., and Ketting, R.F. 2005. RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans. Nucleic Acids Res 33(1): 347-355.

Updike, D.L. and Mango, S.E. 2006. Temporal regulation of foregut development by HTZ- 1/H2A.Z and PHA-4/FoxA. PLoS Genet 2(9): e161.

238

Updike, D.L. and Strome, S. 2009. A genomewide RNAi screen for genes that affect the stability, distribution and function of P granules in Caenorhabditis elegans. Genetics 183(4): 1397-1419.

Vagin, V.V., Sigova, A., Li, C., Seitz, H., Gvozdev, V., and Zamore, P.D. 2006. A distinct small RNA pathway silences selfish genetic elements in the germline. Science 313(5785): 320- 324. van Wolfswinkel, J.C., Claycomb, J.M., Batista, P.J., Mello, C.C., Berezikov, E., and Ketting, R.F. 2009. CDE-1 affects chromosome segregation through uridylation of CSR-1-bound siRNAs. Cell 139(1): 135-148.

Vasale, J.J., Gu, W., Thivierge, C., Batista, P.J., Claycomb, J.M., Youngman, E.M., Duchaine, T.F., Mello, C.C., and Conte, D., Jr. 2010. Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway. Proc Natl Acad Sci U S A 107(8): 3582-3587.

Vastenhouw, N.L., Brunschwig, K., Okihara, K.L., Muller, F., Tijsterman, M., and Plasterk, R.H. 2006. Gene expression: long-term gene silencing by RNAi. Nature 442(7105): 882.

Vastenhouw, N.L., Fischer, S.E., Robert, V.J., Thijssen, K.L., Fraser, A.G., Kamath, R.S., Ahringer, J., and Plasterk, R.H. 2003. A genome-wide screen identifies 27 genes involved in transposon silencing in C. elegans. Curr Biol 13(15): 1311-1316.

Vastenhouw, N.L. and Plasterk, R.H. 2004. RNAi protects the Caenorhabditis elegans germline against transposition. Trends Genet 20(7): 314-319.

Vella, M.C. and Slack, F.J. C. elegans microRNAs (September 21, 2005), WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.26.1, http://www.wormbook.org.

Ventura-Holman, T., Lu, D., Si, X., Izevbigie, E.B., and Maher, J.F. 2003. The Fem1c genes: conserved members of the Fem1 gene family in vertebrates. Gene 314: 133-139.

Ventura-Holman, T. and Maher, J.F. 2000. Sequence, organization, and expression of the human FEM1B gene. Biochem Biophys Res Commun 267(1): 317-320.

Ventura-Holman, T., Seldin, M.F., Li, W., and Maher, J.F. 1998. The murine fem1 gene family: homologs of the Caenorhabditis elegans sex-determination protein FEM-1. Genomics 54(2): 221-230.

Verdel, A., Jia, S., Gerber, S., Sugiyama, T., Gygi, S., Grewal, S.I., and Moazed, D. 2004. RNAi-mediated targeting of heterochromatin by the RITS complex. Science 303(5658): 672-676.

Vivegananthan, U. 2004. Molecular and Genetic Analysis of the Sex-Determining Proteins FEM-1 and FEM-3. Ph.D. Thesis, 208 pp., University of Toronto, Toronto.

239

Vought, V.E., Ohmachi, M., Lee, M.H., and Maine, E.M. 2005. EGO-1, a putative RNA-directed RNA polymerase, promotes germline proliferation in parallel with GLP-1/notch signaling and regulates the spatial organization of nuclear pore complexes and germline P granules in Caenorhabditis elegans. Genetics 170(3): 1121-1132.

Wagner, K.D., Wagner, N., Ghanbarian, H., Grandjean, V., Gounon, P., Cuzin, F., and Rassoulzadegan, M. 2008. RNA induction and inheritance of epigenetic cardiac hypertrophy in the mouse. Dev Cell 14(6): 962-969.

Walstrom, K.M., Schmidt, D., Bean, C.J., and Kelly, W.G. 2005. RNA helicase A is important for germline transcriptional control, proliferation, and meiosis in C. elegans. Mech Dev 122(5): 707-720.

Wang, G. and Reinke, V. 2008. A C. elegans Piwi, PRG-1, regulates 21U-RNAs during spermatogenesis. Curr Biol 18(12): 861-867.

Wang, X., Zhao, Y., Wong, K., Ehlers, P., Kohara, Y., Jones, S.J., Marra, M.A., Holt, R.A., Moerman, D.G., and Hansen, D. 2009. Identification of genes expressed in the hermaphrodite germ line of C. elegans using SAGE. BMC genomics 10: 213.

Ward, S., Argon, Y., and Nelson, G.A. 1981. Sperm morphogenesis in wild-type and fertilization-defective mutants of Caenorhabditis elegans. J Cell Biol 91(1): 26-44.

Wilkins, C., Dishongh, R., Moore, S.C., Whitt, M.A., Chow, M., and Machaca, K. 2005. RNA interference is an antiviral defence mechanism in Caenorhabditis elegans. Nature 436(7053): 1044-1047.

Williams, B.D., Schrank, B., Huynh, C., Shownkeen, R., and Waterston, R.H. 1992. A genetic mapping system in Caenorhabditis elegans based on polymorphic sequence-tagged sites. Genetics 131(3): 609-624.

Wilm, T., Demel, P., Koop, H.U., Schnabel, H., and Schnabel, R. 1999. Ballistic transformation of Caenorhabditis elegans. Gene 229(1-2): 31-35.

Wolffe, A.P. and Matzke, M.A. 1999. Epigenetics: regulation through repression. Science 286(5439): 481-486.

Xu, L., Fong, Y., and Strome, S. 2001. The Caenorhabditis elegans maternal-effect sterile proteins, MES-2, MES-3, and MES-6, are associated in a complex in embryos. Proc Natl Acad Sci U S A 98(9): 5061-5066.

Yi, W., Ross, J.M., and Zarkower, D. 2000. mab-3 is a direct tra-1 target gene regulating diverse aspects of C. elegans male sexual development and behavior. Development 127(20): 4469-4480.

Yigit, E., Batista, P.J., Bei, Y., Pang, K.M., Chen, C.C., Tolia, N.H., Joshua-Tor, L., Mitani, S., Simard, M.J., and Mello, C.C. 2006. Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi. Cell 127(4): 747-757.

240

Zaratiegui, M., Irvine, D.V., and Martienssen, R.A. 2007. Noncoding RNAs and gene silencing. Cell 128(4): 763-776.

Zarkower, D. Somatic sex determination (February 10, 2006), WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.84.1, http://www.wormbook.org.

Zhang, H., Azevedo, R.B., Lints, R., Doyle, C., Teng, Y., Haber, D., and Emmons, S.W. 2003. Global regulation of Hox gene expression in C. elegans by a SAM domain protein. Dev Cell 4(6): 903-915.

Zhang, H., Christoforou, A., Aravind, L., Emmons, S.W., van den Heuvel, S., and Haber, D.A. 2004. The C. elegans Polycomb gene SOP-2 encodes an RNA binding protein. Mol Cell 14(6): 841-847.

Zhang, T., Sun, Y., Tian, E., Deng, H., Zhang, Y., Luo, X., Cai, Q., Wang, H., Chai, J., and Zhang, H. 2006. RNA-binding proteins SOP-2 and SOR-1 form a novel PcG-like complex in C. elegans. Development 133(6): 1023-1033.

Zhou, Z. and Reed, R. 2003. Purification of functional RNA-protein complexes using MS2- MBP. Current Protocols in Molecular Biology / edited by Frederick M Ausubel et al. Chapter 27: Unit 27.23.