Dissertation
Entitled
Novel Regulators of Kidney Homeostasis and Blood Pressure Regulation
By
Usman Mohammad Ashraf
Submitted to the Graduate Faculty as partial fulfillment of the requirements for the
Doctor of Philosophy Degree in Biomedical Science: Molecular Medicine
______Dr. Sivarajan Kumarasamy, Committee Chair
______Dr. Edwin Sanchez, Committee Member
______Dr. Guillermo Vazquez, Committee Member
______Dr. Beata Lecka-Czernik, Committee Member
______Dr. Jiang Tian , Committee Member
______Dr. Amanda C. Bryant-Friedrich, Dean of the College of Graduate Studies
The University of Toledo August 2020
© 2020 Usman Mohammad Ashraf This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of
Novel Regulators of Kidney Homeostasis and Blood Pressure Regulation By
Usman Mohammad Ashraf
Submitted to the Graduate Faculty as partial fulfillment of the requirements for the
Doctor of Philosophy Degree in Biomedical Science: Molecular Medicine
The University of Toledo August 2020
Hypertension is a complex polygenic trait influenced by multiple genetic and environmental factors. However, the genetic factors and the molecular mechanism by which they influence hypertension is not completely understood. Our laboratory is currently focusing on understanding the physiological and molecular aspects of two candidate genes for hypertension; Regulated Endocrine Specific Protein 18 (Resp18) and
Chicken Ovalbumin Upstream Promoter Transcription Factor II (Coup-TFII). Previously, we have shown that a targeted disruption of Resp18 locus in Dahl Salt Sensitive (SS) rats
(Resp18mutant) resulted in higher blood pressure (BP), increased renal fibrosis, urinary protein excretion, and decreased mean survival time on a long term (6-week) exposure to
2% high salt (HS) diet. To further our investigations, we tested the vascular reactivity in mesenteric arteries and glomerular filtration rate (GFR) by using FITC-sinistrin clearance measured by NIC- transdermal device. Through our study, we found that the Resp18mutant rats exhibited vascular dysfunction, as evidenced by a decrease in vasorelaxation in response to SNP and ACH. Furthermore, we found that Resp18mutant rats demonstrated a decrease in GFR. Furthermore, dopaminergic agonists decrease the expression of Resp18, whereas dopaminergic antagonists increase its expression
iii suggesting a molecular link between Resp18 and dopamine. Hence, we are interested in testing the renal dopaminergic pathway in the kidney and renal proximal tubule (RPT) cells isolated from Resp18mutant and SS rats. Dopamine levels in the renal cortical specimens
mutant obtained from Resp18 rats were significantly decreased along with a decrease in D1- like dopamine receptors (D1R & D5R) expression in the kidney. Upon urine analysis and dopamine release assay in RPT cells, we observed that the Resp18mutant rats secrete an increased amount of dopamine compared to the SS rats. Based on the prominent kidney injury phenotype, we tested the hypothesis that targeted disruption of Resp18 in the SS rat, changes the renal transcriptomic response to HS diet. We tested this hypothesis, using deep
RNA sequencing (RNA-seq) approach and subsequent pathway analysis of the complete renal transcriptome of SS and Resp18mutant rats. To test this, both SS and Resp18mutant rats were exposed to a one-week HS diet treatment. Through radio-telemetry procedure, we found that the systolic BP was increased in the Resp18mutant rats compared with SS rats even with short term (one-week) exposure to HS diet. Using RNA-seq approach, we found that Resp18mutant rats showed a differential expression of 25 genes, of which one was an upregulation of Renin (Ren) gene. We confirmed the upregulation of Ren and other differentially expressed genes via qRT-PCR analysis. Furthermore, the renin activity is found to be higher in Resp18mutant rats serum compared with SS rats maintained on a HS diet for week. Collectively, these observations demonstrate that upon disruption of the
Resp18 gene in SS rats alters the transcriptomics signatures in the kidney as an early response to salt insult and thus increase BP. Coup-TFII, a member of the nuclear receptor superfamily act as a critical player in various physiological process, including regulating metabolism. Previously, we have shown that upon targeted disruption of Coup-TFII locus
iv in SS rats (Coup-TFIImutant) resulted in lower BP, improved cardiac function, and lower urinary protein excretion on a long-term exposure to HS diet. Coup-TFIImutant rats on HS diet exhibited lower levels of renal fibrosis and showed a superior kidney function by displaying a higher GFR. Furthermore, targeted disruption of Coup-TFII favors antifibrotic signaling, which is evident through a significant downregulation of R-SMAD (pro-fibrotic;
SMAD3) levels, while exhibiting an upregulation of I-SMAD (antifibrotic; SMAD7) levels. In concert with these findings, there was a significant reduction in pro-fibrotic proteins such as Col3A1. In summary, our study provides enough evidence to show that targeted disruption of Coup-TFII in SS rats protects the kidney from fibrosis through regulating SMAD family proteins. Our studies thus far serve as a fundamental basis to validate the candidate genes for BP and investigate their potential roles and mechanisms in
BP regulation.
v This Dissertation is dedicated to my parents Mohammad and Eram Ashraf, who have raised be me to be the person that I am today. Each and every step of my journey, you guys have always been there for me through the good times and the bad times. Thank you for instilling in me the virtues of perseverance, confidence, and courage to always strive for excellence and never settle for less. From the bottom of my heart, thank you for everything.
vi Acknowledgements
First and foremost, I would like to thank my mentor as well as friend Dr. Sivarajan
Kumarasamy for not only providing me with the opportunity to obtain my Ph.D. but also for supporting me no matter what the circumstance. He is one of the most brilliant and caring individuals I have ever meet, and it has indeed been an honor and privilege to work with him over the years. I wish Dr. Sivarajan Kumarasamy all the best of luck in the future and hope to see the lab thrive. I would also like to thank all my committee members for all their support, guidance, and advice throughout my studies. I want to thank the Department of Physiology and Pharmacology, all the students, faculty members, and staff. Everyone is caring, and easy to talk to. It felt like we all were one big family and I will always cherish that. Lastly, I wanted to thank my undergraduate mentor, Dr. Jason Tennessen; without him, this none of this would have been possible.
vii Table of Contents
Abstract ...... iii
Acknowledgements ...... vii
Table of Contents ...... viii
List of Tables ...... xiii
List of Figures ...... xiv
List of Abbreviations ...... xvi
List of Symbols ...... xix
1 Genetics of Hypertension ...... 1
1.1 A Short History ...... 2
1.2 Epidemiology of Hypertension ...... 4
1.3 How Hypertensive Candidate Gene are Discovered ...... 6
1.3.1 Genetic Linkage Studies in Humans for Hypertension ...... 6
1.3.2 Genome Wide Association Studies for Hypertension in Humans .....8
1.4 Rat Genetic Models for Hypertension Research ...... 9
1.4.1 Various Rat Genetic Models to Study Hypertension ...... 10
1.4.2 The Use of Rat Models to Find Hypertensive Candidate Genes .....11
1.4.3 Validation of BP candidate Genes Using Gene Editing Technology.13
1.5 Pathophysiology of Salt Induced Hypertension ...... 14
viii 1.5.1 The Harmful Effects of Salt Induced Hypertension Leading to End
Organ Damage ...... 14
1.5.2 The Mechanism of Salts Effect on Cardiovascular and Other
Organs ……………………………………………………………………………15
1.6 Physiology of the Kidney...... 17
1.6.1 The Functional Anatomy of the Nephron ...... 18
1.6.2 Glomerular Filtration ...... 20
1.6.3 Water and Electrolyte Homeostasis ...... 21
1.7 The Kidney and Hypertension ...... 22
1.7.1 Renin-Angiotensin-Aldosterone System (RAAS) ...... 22
1.7.2 The Intrarenal Dopaminergic System ...... 26
1.8 Summary ...... 28
2 An Introduction to a Novel Endocrine Protein -Regulated Endocrine
Specific Protein -18 (RESP18) ...... 32
2.1Structure of RESP18 ...... 33
2.2 Intracellular Localization and Degradation of RESP18...... 35
2.3 RESP18 Involvement in the Secretory Pathway ...... 36
2.4 Association of Resp18 in Various Organ Systems ...... 37
2.5 RESP18 a Novel Candidate Gene for Hypertension...... 41
2.6 Summary ...... 42
3 Deep Transcriptomic Profiling of Dahl Salt Sensitive Rat Kidneys with Mutant
Form of Resp18...... 43
3.1 Introduction ...... 43
ix 3.2 Material and Methods ...... 45
3.2.1 Animals ...... 45
3.2.2 Generation of Resp18mutant Rats ...... 45
3.2.3 Blood Pressure Measurement ...... 46
3.2.4 Total RNA Isolation and qPCR Analysis ...... 46
3.2.5 RNA Sequencing ...... 47
3.2.6 Measurement of Serum Renin activity ...... 48
3.2.6 Statistical analysis ...... 48
3.3 Results ...... 49
3.3.1 Resp18mutant Rats Maintains Elevated Blood Pressure Compared with
Wild Type SS Rats …….……………………...…………………………49
3.3.2 Transcriptome Analysis of Resp18mutant Rat Kidneys ...... 49
3.3.3 Renin Activity is increased in Resp18mutant rats ...... 51
3.4 Discussion ...... 51
3.5 Conclusion ...... 56
4 Intrarenal Dopaminergic System Is Dysregulated in Resp18mutant Rats ...... 65
4.1 Introduction ...... 65
4.2 Materials and Methods ...... 67
4.2.1 Animals ...... 67
4.2.2 Generation of Resp18mutant rats ...... 68
4.2.3 Food and Water Intake ...... 68
4.2.4 Vascular Myograph ...... 68
4.2.5 Glomerular Filtration Rate in Conscious Rats ...... 69
x 4.2.6 Immunohistochemistry of the Kidneys ...... 69
4.2.7Measurement of Dopamine ...... 70
4.2.8 Immunoblotting ...... 71
4.2.9 Sodium Measurements ...... 72
4.2.10 Isolation and Primary Culture of Renal Primary Proximal Tubule
Cells……………………………………………………………………...72
4.2.11 Dopamine Release assay ...... 72
4.2.12 Total RNA Isolation and qPCR Analysis ...... 73
4.2.13 Statistical Analysis ...... 73
4.3 Results ...... 74
4.3.1 Resp18mutant Rats Have Vascular Dysfunction and Reduced GFR ...74
4.3.2 Resp18mutant Rats Have Alteration in the Pressure Natriuresis
Response ...... 75
4.3.3 Resp18mutant Rats Have an Increase in Renal Macrophage Infiltration
.………………………………………………………………………….75
4.3.4 Dysregulation of Renal Dopaminergic System is Present in
Resp18mutant rats ...... 76
4.4 Discussion ...... 77
4.5 Conclusion ...... 81
5 Targeted Disruption of Coup-TFII Leads to a Decrease in Renal Fibrosis by
Increasing SMAD7 levels ...... 89
5.1 Introduction ...... 89
5.2 Materials and Methods ...... 92
xi 5.2.1 Animals ...... 92
5.2.2 Generation of Coup-TFIImutant Rats ...... 92
5.2.3 Glomerular Filtration Rate Measurement in Conscious Rats ...... 92
5.2.4 Total RNA Isolation and qPCR Analysis ...... 93
5.2.5 Western Blotting ...... 94
5.2.6 Renal Histology ...... 94
5.2.7 Statistical Analysis ...... 95
5.3 Results ...... 95
5.3.1 Coup-TFIImutant Rats Maintained on High Salt Diet Shows a Renal
Protective phenotype ...... 95
5.3.2 Coup-TFIImutant Rat Have Less Fibrosis and Macrophage Infiltration
in the Kidney ...... 96
5.3.3 Coup-TFIImutant Targeted Disruption of Coup-TFII Increases SMAD7
Expression ...... 97
5.4 Discussion ...... 97
5.5 Conclusion ...... 99
6 Summary ...... 107
References……………………………………………………………………... 112
Appendix A……………………………………………………………………..144
xii List of Tables
3 – 1 qRT-PCR Primers Used to Validate RNA-Seq Results:...... 63
3 – 2 List of All Upregulated and Downregulated Genes Found in Resp18mutant Rat
Kidneys after One-Week Exposure to HS Diet Treatment: ...... 64
5 – 1 qRT-PCR Primers Used ...... 106
xiii List of Figures
1 – 1 Causes of Essential Hypertension ...... 30
1 – 2 The Functional Anatomy of the Nephron ...... 31
3 – 1 Resp18mutant Rats Have Elevated Blood Pressure Compared to Wild-Type SS
Rats ……………………………………………………………………………………57
3 – 2 Transcriptome Response to One-week HS Treatment is altered in Resp18mutant Rat
Kidney ...... 58
3 – 3 qRT-PCR Validation of RNA Sequencing Results ...... 60
3 – 4 KEGG Pathway Analysis from RNA Sequencing Results ...... 61
mutant 3 – 5 Renin Activity is Increased in Resp18 Rats After One-week Exposure to HS
Diet ...... 62
4 – 1 Resp18mutant Rats Have Vascular Dysfunction After 6-week Exposure to HS Diet
...... 82
4 – 2 Resp18mutant Have Decreased GFR ...... 83
4 – 3 Resp18mutant Rat’s Pressure Natriuresis is Shifted Down and to the Right; Relative
Kidney Weight is Increased in Resp18mutant Rats ...... 84
4 – 4 Resp18mutant Rats Have Increased Renal Macrophage Infiltration ...... 85
4 – 5 Resp18mutant Rats Have Increased Urinary Dopamine ...... 86
mutant 4 – 6 Resp18 Rats Have Decreased Renal D1-like Receptor Protein Expression ...87
xiv 4 – 7 RPT Cells Isolated from the Resp18mutant Rats Have Increased Dopamine
Production…………………………………………………………………………...... 88
5 – 1 Coup-TFIImutant Rats Display a Superior GFR ...... 100
5 – 2 Coup-TFIImutant Rats Show a Reduction in Renal Fibrosis and Macrophage
Infiltration ...... 101
5 – 3 Targeted Disruption of Coup-TFII Dysregulates SMAD Signaling Gene
Expressions ...... 103
5 – 4 Targeted Disruption of Coup-TFII and SMAD Status in the Kidneys ...... 104
5 – 5 COUP-TFII Intervene with TGF- β Mediated SMAD Signaling Cascade in the
Events of Renal Fibrosis ...... 105
xv
List of Abbreviations:
ACE...... Angiotensin converting enzyme AGT ...... Angiotensinogen AngI ...... Angiotensin I AngII ...... Angiotensin II ANS...... Autonomic Nervous System
B.W ...... Body Weight BMI ...... Body Mass Index BP ...... Blood Pressure BUN ...... Blood Urea Nitrogen
CHARGE ...... Heart and Aging Research in Genome Epidemiology CKD ...... Chronic Kidney Disease COUP-TFII ...... Chicken Ovalbumin Upstream Promoter Transcription Factor II CRISPR/Cas9 ...... Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR Associated Protein 9
DCV ...... Dese Core Vesicle DNA ...... Deoxyribonucleic Acid
FBPP ...... Family Blood Pressure Program FH ...... Fawn-Hooded rats
GFR ...... Glomerular Filtration Rate GH ...... Genetically Hypertensive Rats GlobalBPgen ...... Global Blood Presser Genetics GWAS ...... Genome Wide Association Studies
HS ...... High Salt
xvi
I Cells ...... Intercalated cells
L-DOPA ...... L-Dihydroxyphenylalanine LEW ...... Lewis rat LH ...... Lyon Hypertensive rats LL ...... Lyon Low blood pressure rats LN ...... Lyon Normotensive rats LS ...... Low Salt LVH ...... Left Ventricular Hypertrophy
MAF ...... Minor Allele Frequency MHS ...... Milan Hypertensive Strain mmHg ...... Millimeters Mercury mRNA ...... Messenger Ribonucleic Acid
NHLBI ...... National Heart, Lung, and Blood Institute NIH ...... National Institute of Health
P Cells ...... Principle Cells PA ...... Primary Aldosteronism
QTL ...... Quantitative Trait Loci
R ...... Dahl Salt-Resistant RAAS ...... Renin-Angiotensin-Aldosterone System RESP18 ...... Regulated Endocrine Specific Protein-18 RNA ...... Ribonucleic Acid ROS ...... Reactive Oxygen Species RPT ...... Renal Proximal Tubule
SCG ...... Superior Cervical Ganglion SHR ...... Spontaneously Hypertensive Rats SNP ...... Single Nucleotide Polymorphism SS ...... Dahl Salt Sensitive
TALEN ...... Transcription Activator-Like Effector Nucleases
xvii
WHO ...... World Health Organization WKY ...... Wistar-Kyoto rats WTCCC ...... Wellcome Trust Case Control Consortium
ZFN ...... Zinc Finger Nuclease
xviii List of Symbols
bp ...... base pair dl ...... deciliter g ...... gram kb ...... kilobase mg ...... milligram ml ...... milliliter mm ...... millimeter mmHg ...... millimeter of mercury α ...... Alpha β ...... Beta μg ...... microgram μl ...... microliter > ...... greater than < ...... less than = ...... equal to
xix
Chapter 1
Genetics of Hypertension
Hypertension, also known as high blood pressure (BP) in humans, is classified as systolic BP over 130mmHg) and diastolic BP over 80 mmHg (1). There are two types of hypertension, essential hypertension (primary hypertension) or secondary hypertension (2).
Essential hypertension accounts for 95% of all hypertensive cases; however, there are no medical causes that account for it (2). Whereas secondary hypertension has an underlying clinical cause such as pre-existing kidney disease, diabetes, or obesity (2). Therefore, essential hypertension is known as the “silent killer” because often there are no warning signs or symptoms. Hypertension was recognized as a specific disorder a little over a century ago, not long after accurate methods for measuring BP were first developed (3).
Hypertension is a complex polygenic trait that is under the influence of multiple environmental and genetic factors that are synergistically at play (Fig 1 – 1) (4, 5).
Environmental factors that are known to increase the risk of developing hypertension include stress, increase in dietary salt-intake, smoking, and inadequate physical activity (5,
1 6). While the environmental factors leading to hypertension can be controlled to a certain extent, by adopting healthy lifestyle, it is clear that making healthy lifestyle modifications sometimes is not enough. Familial and twin studies have shown that 30%-50% of the phenotypic variations are attributable to genetic heritability, while 50% is due to the environmental effects (7). It has also been well documented that the heritability of hypertension is 34%-67% (8). Therefore, genetic factors play a significant role in the development and progression of hypertension. Recent advancements in technology and classical genetic approaches have allowed us to hone in identifying novel candidate genes/genetic loci, which have found to be associated with hypertension (9, 10). Through extensive research, we hope to shed light on the knowledge gap for how these novel genetic factors affect molecular pathways in the pathophysiology of hypertension.
1.1 A Short History:
Galen was a Greek physician, surgeon, and philosopher in ancient Greece who was the first to propose a circulatory system in the human body (11, 12). The circulatory system was built on the ideas conceived by Hippocrates that the arteries stop bleeding after death.
Galen had believed that the circulatory system was filled with “pneuma” (life-giving force), which the heart like a fountain continuously produce this “pneuma” and nourished the body with blood (11). In 1616 William Harvey announced that Galen was wrong in his assertion
(11). The heart does not consistently produce blood, yet Harvey proposed there was only a finite amount of blood that circulates in our body (11).
The Yellow Emperor of China, Huangdi, had known about the importance of changes in pulse 4000 years ago (13). With remarkable precision, it has been documented
2 that the emperor would comment that people who overeat salt had a hard pulse and would die young (13). In 1733 Reverend Stephen Hales (1677-1761) performed his famous experiment showing that blood rose to a height of 8 feet and 3 inches in a glass tube placed in the artery of a horse (12). This discovery of BP remained ignored for nearly a century until more non-invasive BP measurements were invented.
In 1855, Karl Vierodt (1818-1884) discovered that with enough pressure, the arterial pulse could be halted (14). On this principle, Vierodt introduced the sphygmograph
(14). With advancements in Vierodt’s design in 1896, a decisive year in the history of BP,
Scipione Riva-Rocci (1863 - 1937) developed the first mercury sphygmomanometer (15).
His design consisted of an inflatable cuff which can be placed over the upper arm to constrict the brachial artery (15). The cuff was connected to a glass manometer filled with mercury to measure the pressure exerted on the arm (15). The glass manometer, however, only gave us the measurement for systolic BP. It was not until 1905 when a young Russian surgeon Nikolai Korotkoff (1874 - 1920) observed sounds made by the constriction of the artery using a stethoscope (16). Korotkoff found that there were specific characteristic sounds at certain points during inflation (systolic BP) and deflation (diastolic BP) (16).
Therefore, the pressure at the sound of inflation was termed systolic BP, and the pressure at the sound of deflation was termed diastolic BP.
The discovery of hypertension is credited to Richard Bright (1789 - 1858), who had found the association between renal disease and left ventricular hypertrophy (LVH)(17,
18). His speculation turned out to be correct, but the verification had to wait until BP could be clinically measured. For 50 years after Bright made his initial discovery, it was believed that most cases for hypertension was caused by renal disease (17). Substantial doubt started
3 to arise, and by the latter part of the 19th-century, physicians in Germany, France, and
Britain made cases where hypertension can arise from non-renal causes (17).
Britain physician Sir Thomas Clifford Allburt (1836-1925) had termed this elevated
BP as hyerpiesis but never caught on (19). Eberhnd Frank replaced it in 1911 to Essentielle
Hypertonie, which became known as essential hypertension(19). According to the Oxford
English Dictionary, essential in a medical context is idiopathic, which relates to any disease for which the cause is unknown. Therefore, the definition of essential hypertension is the unknown cause of hypertension.
1.2 Epidemiology of Hypertension:
Hypertension is the leading risk factor for cardiovascular and renal disease (20).
Also, hypertension is one of the leading cause of mortality in worldwide (20). In 2010, a total of 1.38 billion people (31.1% of the global adult population) had hypertension (21).
Previously, hypertension has been defined as systolic BP greater or equal to 140 mmHg or diastolic BP greater than or equal to 90 (21). However, since then, the American Heart
Association (AHA) and American College of Cardiology (ACC) has changed the guidelines for hypertension. As per the updated guidelines an individual having systolic
BP greater than 130mmHg and/or diastolic BP higher than or 80mmHg considered as hypertensive.
According to the Center for Disease Control (CDC) and prevention, as of 2016, in the United States, the prevalence of hypertension was 29.0% (22). Its prevalence increases with age group; age group 18-39 (7.5%), 40-59 (33.2%) and 60 and over, (63.1 %).
However, hypertension is slightly more prevalent in men (30.2%) than women (27.7%) in
4 the United States (22). Hypertension prevalence was also higher among adult non-Hispanic black Americans (40.3%) than non-Hispanic white Americans (27.8%), non-Hispanic
Asians (25.0%) or Hispanic (27.8%).
The prevalence of hypertension is rising not only in the United States but globally due to an aging population and the increased exposure of unhealthy lifestyle risks such as diets higher in sodium and lack of physical activity. However, changes in hypertension prevalence are not uniform worldwide. High-income countries have seen a decrease in hypertension over the past two decades (21). Whereas low- and middle-income countries have experienced a significant increase in hypertension prevalence (21).
A study conducted using data obtained from 844 studies performed in 154 countries with nearly 9 million participants, estimated that in 2015 the global mean age-standardized systolic BP was 127.0mmHg in men and 122.3mmHg in women, whereas the global mean age-standardized diastolic BP is 78.7 mmHg in men and 76.7 mmHg in women (23).
Higher mean age-standardized systolic and diastolic BPs in both men and women were found in South Asia, Sub-Saharan Africa, and Central and Eastern Europe (23). Whereas lower mean age-standardized mean BPs were found in high-income Western and Asian
Pacific regions (23).
Currently, hypertension is known as an epidemic worldwide. This large-scale study also reported that over the past 40 years, the mean age-standardized BP had not changed much. In men, the mean age-standardized systolic BP in 1975 was 126.6mmHg compared to 2015 127.0 mmHg (23). Whereas in women, the mean age-standardized systolic BP during this period was 123.9mmHg to 122.3mmHg (23). The trend for mean age- standardized diastolic BP for men and women were also the same (23). Hypertension a
5 complex trait influenced by environmental and genetic factors, but the socio-economic factors also play a role. Studies have shown that a $50,000 difference in income can correlate with 0.6mmHg lower systolic BP (16).
1.3 How Hypertensive Candidate Genes are Discovered:
Genomics, when broadly defined, is the study of the structure and function of an organism’s most fundamental component, DNA, including all protein-coding and non- coding genes. On the other hand, genetics study these individual genes and how they can synergistically interact to allow complex and vital reactions to take place to sustain human life. Many early genetic studies were done in hypertension were focused on Mendelian (or monogenic) form of hypertension (24). For example, glucocorticoid remediable aldosteronism occurs from the unequal crossing of two genes on chromosome 8, which are involved in adrenal steroid biosynthesis (24, 25). This mutation ultimately increases aldosterone synthase activity, increasing aldosterone. Therefore, plasma volume increases, and the patient would exhibit high BP (25). Most hypertensive cases are polygenic. Early linkage studies in humans allowed us to identify the genetic loci, leading the charge on attempting to dissect the genetic architecture of hypertension.
1.3.1 Genetic Linkage Studies in Humans for Hypertension:
Linkage studies are some of the first Genome-Wide Association Study (GWAS) undertaken to identify novel genetic loci, which are significantly associated with hypertension. Linkage studies look for correlation (or linkage) between a genetic marker such as a single nucleotide polymorphism (SNP) or a continuous stretch of many
6 nucleotides on a chromosome and the extent of BP. If this allelic variation shows to increase BP in a population, then it is believed to be a significant genetic locus attributed to hypertension.
Large scale efforts were taken in 1995 by the National Heart, Lung, and Blood
Institute (NHLBI) of the National Institute of Health (NIH), which funded the Family
Blood Pressure Program (FBPP) to recruit subjects from the African American, Mexican
American, Asian American, and non-Hispanic white American populations to study the genetic determinants of hypertension (26). Genome-wide linkage analysis conducted from the data set from FBPP in 2011 revealed five novel BP loci or quantitative trait loci (QTL)
6p22.3, 8q23.1, 20q13.12, 21q21.1, and 21q21.3 (27). This study included a total of 13,000 individuals, 32.5% African Americans, 16.5% Asian Americans, 18.7% Hispanic
Americans, and 32.5% non-Hispanic white Americans (27).
Linkage studies have also been conducted in different regions of the globe. For example, linkage studies have been conducted in rural Nigerian regions consisting of 1054 individuals coming from 188 families (28). From this study, many novel loci were detected to have a significant association with hypertension on human chromosome 6 (6q2.9) and 7
(7p4.73), (7q2.6) and (7q1.6) (28). Another study from China with 328 individuals, of which 111 were hypertensive, and the others were there siblings (29). This study from
China found SNPs on chromosome 5 (5q31.1) to be significantly associated with hypertension (29). Besides, they also found many regions on chromosome 2 (2q22) and 5
(5p13) to be associated with systolic and diastolic BP, respectively (29). Other extensive meta-analysis studies from Caucasian populations have led to the discovery of linkage
7 between two regions on chromosome 2 (2p12-q22.1) and chromosome 3 (3p14.1-q12.3) with hypertension (30).
We have gained much insight from human linkage studies by identifying many novel genetic loci that were found to have a significant association with hypertension.
However, these studies also imposed a significant limitation. One major limitation was that these studies highlighted large regions of the chromosomes, which encompassed many genes. To get data with even greater precision, scientists would have to rely on meiotic recombination events to occur within shorter intervals. Nevertheless, in ordered to do so, we would run into a problem. We would require a large population size to generate this level of precision, and still, the precision would not be at the single-gene level.
1.3.2 Genome-Wide Association Studies for Hypertension in Humans:
Recent advancements in technology have allowed us to decipher the human genome sequence. Since then, GWAS have gained much importance in the discovery of new genes that are significantly associated with hypertension. In GWAS, BP levels can be adjusted for age, sex, and body mass index (BMI) (31). Also, in GWAS, if two alleles for each SNP have a different prevalence in the population, then the least frequent allele will be defined as the minor allele (32). The minor allele frequency (MAF) and the total number of SNPs in the population share an inverse relationship (32). Therefore, GWAS's statistical power is proportional to sample size, MAF, and each SNPs effect on systolic BP and diastolic BP
(33). GWAS provides us other tools like normotensive patients to compare the whole genome to hypertensive patients, allowing us to identify SNPs that occur exclusively in hypertensive individuals.
8 A GWAS was conducted in 2007 by the Wellcome Trust Case Control Consortium.
However, the sample size of which they used 14,000 individuals was not able to detect any significant loci with hypertension (34). Upon further haplotype analysis revealed that a suggestive association on human chromosome 15 (15q26.2) with hypertension and this region contain only one protein-coding gene, which coded for the gene Chicken Ovalbumin
Upstream Promoter Transcription Factor II (COUP-TFII) (9). A couple of years later, in
2009, a GWAS study consisting of 34,000 individuals of European ancestry conducted by the Global Blood Presser Genetics (Global BPgen) consortium (35). They found eight novel loci associated with systolic BP or diastolic BP, and these variants were near the genes CYP17A1, CYP1A2, C10ORF107, FGF5, MTHFR, PLCD3, AND ZNF652 (35).
Another GWAS study conducted by the Heart and Aging Research in Genome
Epidemiology (CHARGE) consortium allowed researchers to find novel genes such as
ATP2B1, SH3B3, TBX3, and TBX5 for BP (31). All these studies are accumulating a large amount of evidence that genetic factors play a vital role in the development and progression of hypertension. However, these candidate genes must be validated for their candidacy before they can be further studied.
1.4 Rat Genetic Models for Hypertension Research:
Laboratory animal models serves as a valuable tool and allow us to understand the pathophysiology and develop a therapeutic intervention for many diseases. These animals are used in basic medical science and veterinary research varying from different models such as mice, rats, rabbits, guinea pigs, sheep, goats, cattle, pigs, primates, dogs, cats, birds, fish, and frogs (36). Among the different species, rat genetic models have been considered
9 as a popular model as a result of the availability of different inbred strains and characteristics.
1.4.1 Various Rat Genetic Models to Study Hypertension:
Various rat inbred strains are currently being used to study the hypertension and most frequently used strains including but not limited to Spontaneously Hypertensive Rats
(SHR), Dahl Salt-Sensitive (SS) rats, New Zealand, and Milan strains. SHR rats are the descendants of an outbred Wistar male rat that was spontaneously hypertensive and was mated with a female rat, which had elevated BP from a colony in Kyoto, Japan (37, 38).
The Wistar-Kyoto rats (WKY) are a normotensive strain that is usually used as a normotensive control to compared with SHRs (39).
The Dahl salt-sensitive (SS) rats and the Dahl salt-resistant (SR) rat are the most extensively used inbred rat models to study genetics of hypertension (40, 41). The SS and
SR rats were originally derived from Sprague Dawley rats, which had been bred based on their response to BP changes after high salt diet treatment (40, 41). The SS rats are salt sensitive and spontaneously develops hypertension even on a low salt diet, however on a high salt diet it develops hypertension much faster rate. On the contrary, the SR rats are resistant to salt-induced hypertension, even on a chronic high salt diet treatment. Dahl rats were originally maintained as an outbred stock, and Dr. John P. Rapp developed the inbred stocks of SS/Jr and SR/Jr rats at the University of Toledo College of Medicine and Life
Sciences formerly known as Medical College of Ohio (MCO)(42).
Other hypertensive rat strains that are popularly used in hypertension research included Fawn-Hooded (FH) rats, exhibit a spontaneous increase in systolic BP beginning
10 at 5 weeks of age, and increased proteinuria (43). Genetically hypertensive (GH) rats are developed by being selectively bred based on BP without any dietary intervention (44).
Lyon hypertensive (LH), Lyon low blood pressure (LL), and Lyon normotensive (LN) rats are selectivity bred for high (LH), low (LL), and normal (LN) BP without any external environmental or dietary treatments (45, 46). The Milan strain of rats was also selectively bred for BP, resulting in the development of the Milan hypertensive strain (MHS) rat and the Milan normotensive strain (MNS) (47). These rat genetic models have undergone extensive genetic analysis resulting in the discovery of many new quantitative trait loci
(QTLs) for blood pressure (44).
1.4.2 The Use of Rat Models to Find Hypertensive Candidate Genes:
The traditional genetic approach to determine the molecular basis of hypertension in the SS rat and the normotensive strain had been limited to linkage studies and substitution mapping (48). Substitution mapping resulted in the generation of congenic strains that were genetically identically to the SS rat expect for the integrated regions from the normotensive strain (49). Each of these congenic strains, acted as a genetic tool to identify novel genetic determinants associated with hypertension. Through congenic studies crossing SS rats with a variety of normotensive strains, have resulted in the discovery of BP QTLs on almost every chromosome (10).
The overall goal of mapping a gene to a specific region with high resolution is aimed to identify a novel gene associated with hypertension. Combining QTL and microarray analysis initially allowed the researchers to prioritize candidate genes for BP
(49). Congenic rats developed by replacing the SS rat allele with corresponding Lewis
11 (LEW) rat alleles in BP QTL regions on chromosome 1 (50). These congenic rats lead to the localization of BP QTL to 13.5-cM region corresponded to 20.92 Mb on rat chromosome 1 named OTL1b region (50).
Furthermore, out of 231 positional candidate genes within this QTL, 17 of them were differentially expressed between congenic and SS rat kidneys (49). Of the three genes, two of these genes (ManIIX and unknown transcript (XM_489186)) were found to be downregulated in the congenic strain compared to the SS rat kidneys (49). The one gene which was found to be upregulated in the congenic strain compared to the SS was Coup-
TFII (49). The potential role of these genes in hypertension was initially unknown.
However, GWAS in humans indicated COUP-TFII as a candidate gene for hypertension, as previously mentioned (9, 34). Coup-TFII is a transcription factor belonging to the nuclear receptor family and the candidacy for BP regulation has been validated using a novel Coup-TFIImutant rat generated on SS genetic background (51, 52).
Similarly, a BP QTL was identified on rat chromosome 9 through substitution mapping studies using SS and SR rats (53). Initially, this QTL was localized to a region of
34.2cM, and later this QTL region was further refined into smaller QTL with the interval of 2.4cM region on rat chromosome 9 (54). Upon gene chip analysis of the kidney of these rats, only two protein-coding genes were found to be located on chromosome 9; (i) the
Regulated Endocrine-Specific Protein 18 (Resp18) and (ii) Glutathione Transferase
1(Gsta1) (10). However, only Resp18 was mapped onto the BP-QTL region and was found to be 7.3 times lower in the congenic rat, which contains the SR form of Resp18 (10). With further precision, this QTL was mapped down to a <0.4cM or 493kb, and still included the gene Resp18 (10). Nucleotide variation was found between SS and SR DNA for Resp18 in
12 exon 2, where there was a (T/C) variation in the coding sequencing, leading to an amino acid change (Ile/Val) in the protein product. Genes such as Coup-TFII, Resp18, and many other candidate genes with an association with hypertension must now be validated.
1.4.3 Validation of BP candidate Genes Using Gene Editing Technology:
Novel gene-editing techniques have been employed to develop novel gene-edited animal models to validate the candidacy of genes in hypertension. Popular techniques include but are not limited to the use of Zinc Finger Nuclease (ZFN), Transcription
Activator-Like Effector Nucleases (TALENS), and Clustered Regularly Interspaced Short
Palindromic Repeats- CRISPR-associated protein 9 (CRISPR/Cas9) system (55) (56).
ZFN’s are consist of a DNA-binding domain and a DNA cleave domain of a restriction endonuclease (FokI) (57). A single zinc finger is comprised of 30 amino acids that can bind to three base pairs (57). Therefore, three zinc fingers are combined to recognize nine base pairs on a genomic DNA with strand specificity. In addition, a triplet zinc fingers were designed to bind to 9 specific base pairs on the opposite strand (57). FokI domains can only cut DNA, upon dimerization; therefore, a pair of ZFN are required for to introduce double strand break in a specified genomic locus. After successful cleavage by the FokI domains, the host will repair the DNA through non-homologous end joining, which can result in the introduction or deletion of nucleotides.
13 1.5 Pathophysiology of Salt Induced Hypertension:
The term salt (1g sodium = 2.5g salt) are often interchangeable; however, by mass salt is comprised of 40% sodium and 60% chloride (58). Salt is the primary source of sodium in our diets, approximately 90% (58). Although refrigeration technologies have obviated the need for salt, the average sodium intake is 4g/day in most countries. This is double the daily recommended 2g/day sodium intake by the World Health Organization
(WHO) (59). Over many years a vast and diverse body of knowledge and evidence has consistently shown a positive correlation between increase in dietary salt intake and rise in
BP (60).
1.5.1 The Harmful Effects of Salt Induced Hypertension Leading to End
Organ Damage:
The detrimental effect of salt is not restricted to increase the BP, and also known to affect multiple organs in the body through various mechanisms such as hormonal and inflammatory mechanisms as well as more novel pathways such as the immune response and the gut microbiome (58). Upon increase in BP, it also promotes threat to the vasculature system and increases the risk of endothelial dysfunction vice versa, generalized atherosclerosis, arteriosclerotic stenosis, and increases the remodeling of small and large arteries (61). High BP is also well known to disrupt the homeostasis of the heart, leading to left ventricular hypertrophy, atrial fibrillation, coronary heart disease, coronary microangiopathy, and heart failure (58). High BP can increase the risk of stroke, acute hypertensive encephalopathy, intracerebral hemorrhage, lacunar infarctions, and vascular dementia in the brain (58). Many research laboratories have documented that there is a
14 strong association is existing between hypertension and kidney dysfunction. High BP causes the kidney function to deteriorate causing albuminuria, proteinuria, a reduction in the glomerular filtration rate (GFR), chronic renal insufficiency, leading to chronic kidney disease and resulting ultimately in renal failure (62).
1.5.2 The Mechanism of Salts Effect on Cardiovascular and Other
Organs:
A high salt diet can cause harmful effects on the cardiovascular and other organs
(63). Aldosterone is a hormone that stimulates the absorption of sodium by the kidneys and therefore regulates water and electrolyte balance (63). High aldosterone levels have been correlated with left ventricular hypertrophy. Studies have shown associations between left ventricular hypertrophy and reduced urinary sodium excretion, especially in patients with hypertension (63, 64). Aldosterone affects the redox potential of the cell, and an excessive salt load further amplifies this effect (65). These changes in the intracellular redox state lead to the activation of the mineralocorticoid receptors (58). Activation of the mineralocorticoid receptor leads to the expression of proteins regulating ionic and water transports mainly via the epithelial sodium channel (ENaC), Na+/K+ pump, and serum and glucocorticoid-induced kinase (SGK1) (58). This results in the reabsorption of sodium and water, increasing blood volume, and therefore increasing BP. This ultimately leads to an increased production of reactive oxygen species (ROS), which can cause cellular and tissue injury.
Increase dietary salt intake can lead to end-organ damage via inflammation and oxidative stress (66). The inflammatory mechanism in mediating the damage of salt on the
15 endothelium and kidney has been well studied (66). Increase in dietary salt in patients who also have chronic kidney disease (CKD) has shown to promote a proinflammatory and profibrotic state (66). Previously, it has been shown that upon salt loading, stimulate the production of pro-oxidant enzymes leading to a change in renal hemodynamics (67).
Exceeding the daily recommended salt intake over the period of time in humans increase the urinary excretion of albumin (albuminuria), while reducing salt intake has been found to reduce albuminuria (58). Excess salt loading can also cause damage to the endothelium via suppress the activity of antioxidant enzymes such as superoxide dismutase and thus increase the risk of developing oxidative stress (58). Furthermore, in-vitro experiments performed using endothelial cells have shown that upon salt loading, these cells show an increase in stiffness and reduced the excretion of nitric oxide (68). In humans, increase in dietary salt intake has shown to increase arterial stiffness, and whereas reducing the dietary salt intake has shown to improve endothelial function (69).
HS diet intake can dysregulate the proper balance of the immune response by enhancing the development of macrophages and T cells with proinflammatory functions
(70). HS diet has shown to increase the expression levels of interleukin 17 (Il-17), which
+ increases the production of CD4 T-helper 17 (Th17) cells and leads to the development of autoimmune disease and inflammatory renal disease, such as glomerulonephritis (70).
Furthermore, increase in Il-17 levels during HS diet intake, act on smooth muscle cells and adventitial fibroblasts and decrease the bioavailability of the nitric oxide, known for its role in vasodilation (70).
Salt loading has also had deteriorative effects on the bones (71). An increase in salt loading damages the bones by increasing urinary calcium excretion (since sodium and
16 calcium reabsorption pathways are linked) and consequently increasing bone remodeling
(71). Calcium is the chief supportive element in bones, and loss of calcium can lead to osteoporosis, especially in women. Th17 cells are produced in response to increasing salt load and associated with bone loss through the production of proinflammatory cytokines
(71). Unfortunately, regulatory T cells (also known as Treg cells), which are associated with protecting the bone by producing anti-inflammatory factors, are suppressed by HS salt diet load (71).
The gut microbiome has been proposed as a moderator of the effects of salt and our health outcomes. Increase in dietary salt intake reduces the number of certain lactic acid bacteria in the gut of mice and humans (72). Also, it has been reported that increase in salt loading can alter the gut microbiome composition (72). HS diet regimen has shown to increase plasma trimethylamine n-oxide levels, which is a microbiome-dependent metabolite for cardiovascular diseases (58). Besides, chronic HS diet stud conducted in animal models has shown to impair cognitive function, especially in domains related to spatial memory, possibly via oxidative stress and gut microbiome–dependent inflammation
(60, 73-75)
1.6 Physiology of the Kidney:
The kidney is comprised of more than a million nephrons, also known as the functional unit of the kidneys (62). Each nephron is composed of renal tubules, glomerulus, and blood vessels that allow the passages of substances back and forth to filter the waste and keep essential nutrients (62). The normal filtrate, which passes through the kidneys are comprised of water, glucose, amino acids, urea, creatinine, and ionic solutes such as
17 sodium, chloride, calcium, potassium, and bicarbonate (62). Red blood cells and proteins are not found in the filtrate because these are too large to pass through the glomerular filtration membrane (62). When these large molecules are present in the filtrate, this is an indication that the glomerular filtration membrane is damaged.
1.6.1 The Functional Anatomy of the Nephron:
The glomerulus is about 200μm in diameter and is formed by the invagination of a cluster of nerve endings, spores, or small blood vessels and capillaries funneling into
Bowman’s capsule (Fig 1 – 2) (62). The capillaries get their blood supply from the afferent arteriole and leaves by efferent arteriole. Blood is separated from the glomerular filtrate in the glomerulus, which is a cluster of intertwined capillaries. In the Bowman’s capsule, two cell layers are responsible for separating the blood from the glomerular filtrate, the capillary endothelium, and the specialized epithelium of the capsule (62). The glomerular capillaries endothelium has pores called fenestration pores that are surrounded by the podocyte cells. Podocytes have long projections coming off the cells that wrap around the capillaries, forming filtration slits. These slits are approximately 25nm wide and can be closed by a thin membrane (62). Mesangial cells found between the basal lamina and the glomerular basement membrane in the capillaries can also filter the blood and remove trapped residues and aggregated, proteins keeping the filtrate free of debris (62). Therefore, the filtration membrane is comprised of three structures: fenestrated endothelium of the glomerular capillary, the mesangial cells, and the podocytes.
The first segment of the nephron is the proximal tubule cells, which contain many brush border cells in its luminal region (Fig 1 – 2) (62). These brush border cells contain
18 many microvilli enhancing the surface area to enhance the reabsorption function. Proximal nephrons also known as proximal convoluted tubules and proximal straight tubules from
S1 to S3 segments. The proximal tubule cells are divided into three segments; S1 and S2 are located at middle and late portion of the convoluted tubules, whereas the S3 segment is located in the straight proximal tubule cells (62). The filtrate which enters the proximal tubule cells is reabsorbed into the peritubular capillaries, including two-third of all salt and water, 100% of organic solutes, 65% of all potassium, 50% of all urea, 80% of all phosphate, and roughly 80% of all citrate (62).
The next portion of the nephron is the loop of Henle, which is a U-shaped tube (Fig
1 – 2). This can be divided into 4 parts. The thin descending limb which has relatively low permeability to ions and urea, while being highly permeable to water (62). The thin ascending limb, which is permeable to ions, but impermeable to water. The thick ascending limb is impermeable to water; however, sodium, potassium, and chloride ions are reabsorbed by active transport via the Na-K-Cl cotransporter (NKCC2) (62). The thick ascending limb is responsible for approximately 25% of total sodium reabsorption along the nephron (62). The TAL becomes distal convoluted tubule at the macula densa (the plaque of renal tubular cells at this junction) next to its parent glomerulus at the vascular pole (62). The macula densa, the renin-secreting granular cells, and the neighboring lacis cells form the juxtaglomerular apparatus. The final part is the cortical thick ascending limb, which drains urine into the distal convoluted tubule cells and then flow into the collecting ducts (62). The epithelium of the collecting ducts consists of intercalated cells (I cell) and principle cells (P cells). P cells typically contain few organelles and are involved in sodium reabsorption and vasopressin-stimulated water reabsorption (62). On the other hand, I cell
19 typically has an increased number of microvilli, cytoplasmic vesicles, and mitochondria; furthermore, these cells are heavily involved in acid-base balance.
1.6.2 Glomerular Filtration:
Glomerular filtration rate (GFR) refers to the flow of plasma from the glomerulus into Bowman’s space over a specified period and is typically measured in humans and animals by measuring the urinary, renal or plasma clearance of either creatinine or an substance injected in bolus (76). This substance should be freely filtered, not metabolized by the renal tubules and neither secreted nor reabsorbed by the tubules. Renal plasma clearance is the volume of plasma from which a substance is completely removed by the kidney in a given amount of time (76). GFR and clearance are measured in mL/min.
Therefore, GFR is equal to the concentration of a substance in the urine, multiplied by the urine flow per unit of time all divided by the arterial plasma level of the substance (76).
The laws that control the filtration across the glomerular capillaries are the same as the govern filtration across all capillaries. These laws are based on the principle that the capillary bed's permeability, the capillary bed's size, and the hydrostatic and osmotic pressures gradients govern filtration (76). The permeability of the glomerular capillaries is
50x of capillaries found in skeletal muscle (76). Interestingly the filtration of cationic substances up to 8nm is much higher than neutral substances. Since the glomerular capillary wall contains sialoproteins that are negatively charged, which facilitates higher filtration rate for cationic substances (76). Consequently, negatively charged ions are repelled, resulting in a filtrate that contains an only anionic substance, which is 4nm in diameter. For instance, Albumin, which is a negatively charged protein and is 7nm in
20 diameter, usually has a filtrate concentration of 0.2%. However, damage to the sialoproteins in kidney disease can lead to an increase in urinary excretion of albumin, commonly known as albuminuria (76).
The size of the capillary beds is governed by the mesangial cells (76). Angiotensin
II (Ang II) has shown to be a key regulator of mesangial cell contraction and decrease the size of the capillary beds, therefore, reducing GFR (77). Hydrostatic pressure is defined as the pressure produced by a fluid against a surface; in this case, there is fluid on both sides exerting pressure in opposing directions (78). The net fluid movement will be in the direction of the lowest pressure. On average, the hydrostatic pressure in the capillaries is
55mmHg, and the fluid pressure in the Bowman’s capsule is 15mmHg (Fig 1 – 2) (78).
There is also another opposing force, the osmotic pressure. The osmotic pressure in the capillaries are close to 30 mmHg were as the osmotic pressure in the Bowman’s capsule is almost zero (Fig 1 – 2) (78). Therefore, the net pressure is 10 mmHg outward (Fig 1 – 2).
1.6.3 Water and Electrolyte Homeostasis:
Sodium is vital in many cellular processes; however, as mentioned previously, too much sodium can be detrimental to the system. In general, almost 99% of the filtered sodium is recaptured in different segments of renal tubules (79). Factors that affect sodium reabsorption include but certainly not limited to the circulation levels of aldosterone, atrial natriuretic peptide, and the rate of tubular secretion of hydrogen ion and potassium (79).
Most of the filtered potassium is reabsorbed in the proximal tubular cells, and thick ascending loop of Henle (80). The rate of potassium secretion is proportional to the rate of filtrate. In addition, the amount of potassium secreted is equal to the potassium intake and
21 the number of other ions (80). The amount of water, which is retained by the kidneys, is dependent on the osmotic pressures. Water will travel the route of least resistance.
However, if the kidney filtration system is damaged and fails to regulate electrolyte balance, which results in an increase in sodium retention and thus favors water retention.
Such changes lead to an increase in blood volume, results in high BP.
1.7 The Kidney and Hypertension:
The association between hypertension and renal disease is well known (81). In the context of hypertension, the onset of CKD is considered a cause of a worsening prognosis and can lead to further cardiovascular complications, also increase morbidity and mortality rate (81). Many genes have been highlighted to be associated with hypertension, and more of the one gene is undoubtedly involved. Furthermore, changes in gene expression patterns significantly influence and lead to the impairment of a specific signaling pathway, which could play a pathophysiological role in the development of hypertension. Of these systems, two significant roles in water and electrolyte homeostasis are the renin-angiotensin- aldosterone system (RAAS) and the renal dopaminergic system (82, 83).
1.7.1 Renin-Angiotensin-Aldosterone System (RAAS):
Chronic activation of the RAAS has been well studied and is known to cause hypertension, congestive heart failure, and chronic kidney disease (82). Renin is released from the juxtaglomerular cells in response to a lower BP, and/or decrease in dietary sodium intake (29, 35). Once renin is released into the circulation, it can act on its target angiotensinogen (Agt) and cleave it to produce angiotensin I (AngI). However, AngI is
22 physiologically inactive, but it is converted into angiotensin II (AngII) by angiotensin- converting enzyme (ACE) (29, 35). AngII then can act on AT1-R in the adrenal cortex to stimulate aldosterone production, which in turn increases the sodium reabsorption and potassium excretion by the distal tubule and collecting duct (18). Also, AngII acts on other organs such as the brain and blood vessels to promote hypertensive signaling events (2,
48). In the kidney, AngII can increase sodium reabsorption by increasing the expression of
Na+/H+ exchanger in the proximal convoluted tubules (22). Due to its osmotic property, increase in Na+ reabsorption also favors water retention, leading to an increase in blood volume and, thus, increases the BP. AngII can lead to vasoconstriction in the systemic arterioles, causing an increase in BP (50). Finally, in the brain, AngII can increase water intake and stimulate the secretion of antidiuretic hormone, (ADH) which increases water reabsorption (42).
The RAAS is one of the critical systems involved in the regulation of BP and fluid balance (82). An increase in both AngII and aldosterone levels in plasma and tissues are known to promote pro-fibrotic gene expressions and induce an inflammatory response in the kidney (82). Suppression of the RAAS is a crucial therapeutic strategy that has been taken advantage of as a treatment for chronic kidney disease. For example, angiotensin- converting enzyme (ACE) inhibitors are widely used for the treatment of hypertension (82).
Renin is rate limiting in the production of AngII, a hormone that ultimately integrates cardiovascular and renal physiology to regulate BP as well as electrolyte and volume homeostasis (82). Renin is synthesized as preprorenin in the juxtaglomerular cells, and then cleaved to prorenin. The granules can release renin as prorenin or in its active form as renin (84). Acute stimulation of renin release main involves the exocytosis of
23 mature active renin, whereas a chronic stimulation of renin release involves the exocytosis of both pro-renin and renin into the circulation (85). Agt is constitutively synthesized and released by hepatocytes and found at a higher concentration when compared to renin (86).
Agt first must be oxidized, so it can undergo a conformational change allowing renin to access and cleave Agt to AngI. Renin catalytic activity is 4x higher for AngI formation when Agt is oxidized.
Since renin plays an essential role in the rate-limiting step of the RAAS pathway.
Furthermore, genetic disruption of adrenergic receptors has shown to reduce renin levels
(87). Similarly, a knockout of Gsα, a vital receptor involved in the intracellular signaling of cAMP, can also abolish renin expression in the developing kidney (88). This in turn reduces the development of glomerulus in all mammals after birth (82). Although the juxtaglomerular cells are the primary site of renin production, it has been found that renin expression can also be detected in the distal nephron segments (82). Models of kidney disease have shown that there is an increase in renin expression in the distal nephron. In adult kidney, stimuli such as chronic ischemia, prolonged adrenergic activation, and a reduction in sodium levels increase the number of cells expressing renin (89). Renin expression can also be altered by epigenetic/transcriptional mechanisms, micro RNAs, and small noncoding RNA that can regulate gene expressions at a post transcriptional level
(82). Renin expression is also under the control of intracellular factors such as cAMP, cGMP, and calcium (82). Renin is also regulated by short loop feedback. The angiotensin receptor, which is expressed in the juxtaglomerular cells and AngII, may exert inhibition of renin release (82). There are multiple levels for renin regulations, which also include genetic regulations. A 242 bp enhancer element is located at -2866 to -2625 in the Ren gene
24 (90). There are three distinct DNA binding sites which are conserved between mouse and humans, and these are, (i) CRE which can be recognized by CREB, and nuclear factor kappa B (Nf-κB), (ii) the E-box that can bind upstream stimulatory factors 1 and 2 (USF-
1/2), and (iii) two TGACCT motifs which can bind retinoic acid receptor (RXR) (90-92).
Once AngI is produced, angiotensin converting enzyme (ACE) generates a vasoactive peptide known as AngII by cleaving 2 amino acids from the c-terminus of AngI
(82). ACE gene has been proposed as a candidate gene for hypertension, cardiovascular disease, and kidney disease (82). The biological function of AngII is carried out by the cell surface receptors that belong to 7 trans-membrane receptors and can be divided into two pharmacological classes AT1 and AT2. AngII classical signaling is carried out via AT1, including the renin feedback, stimulation of renal tubular sodium reabsorption, and the release of aldosterone from the adrenal glomerulosa (82). Besides this known action, aldosterone excretes its effect on the kidney, blood vessels, and the heart, which can lead to pathological consequences, especially under a HS diet.
An increase in aldosterone production, also known as primary aldosteronism (PA) is a common cause of BP elevation. Patients who exhibit PA also show cardiac remodeling, endothelial dysfunction, and albuminuria (93). This is especially true if patients continuing in eating foods containing high level of sodium. In rat animal models of PA and under an
HS diet regimen, albuminuria is attributed to podocyte injury (93). More surprisingly, patients with metabolic syndrome, which has also been closely linked to rise in BP, and increase in aldosterone levels (93). Many accumulating studies have revealed that aldosterone plays a significant role in the development of salt-sensitive hypertension.
25 1.7.2 The Intrarenal Dopaminergic System:
Independent of the nervous system, the kidney contains all the bioenzymatic machinery necessary to produce dopamine. Renal dopamine production relies on the precursor L-dihydroxyphenylalanine (L-DOPA) and dopa decarboxylase activity. The proximal tubule is the site of dopamine production, and the amount of L-DOPA is taken up by both salt-dependent and independent transporters (83). The uptake of L-DOPA is the rate-limiting step in the synthesis of dopamine in the kidney. Dopamine can then either be excreted via the urine or degraded via catechol-O-methyl transferase (COMT) by methylation to produce 3-methoxytyamine, followed by deamination via monoamine oxidase (MAO) to 3,4-dihydroxyphenylacetic acid (94).
In kidney, dopamine is one of the critical regulators of salt and water reabsorption.
Dopamine carries out its function through two families of receptors, which are located on the tubular cell surface: D1-like receptors (D1R and D5R) and D2-like receptors (D2R, D3R, and D4R) (94). Activation of D1-like receptors inhibits the activity of sodium hydrogen ion exchange (NHE3), chloride bicarbonate exchanger (AE1), sodium phosphate cotransport
(PiT2), sodium-potassium ATPase (ATP1A1), and sodium bicarbonate co-transporter
(NBC) which all play a role in sodium reabsorption (95). D1-like receptors are coupled to stimulatory G protein GαS and Golf, which have the capacity to activate adenylate cyclase
(82). Whereas, D2-like receptors are coupled to the inhibitory G proteins Gαi and Go, which are characterized by inhibiting adenylate cyclase (82). The increase of adenylate cyclase increases the levels of cyclic adenosine 3’, 5’- monophosphate (cAMP) and protein kinase
A (PKA) activation (96). PKA than can directly phosphorylate a protein of interest, such as sodium transporting protein (96). Moreover, D1-like receptors are known to stimulate
26 the expression of phospholipase Cβ1 in renal tubule cells, whereas the D2-like receptors can inhibit, protein kinase B (Akt) signaling pathway. An interaction between D1-like and
D2-like receptors increases phospholipase C stimulation (97). Dopamine via the D1-like receptors can inhibit AngII mediated contraction in mesangial cells in the glomeruli (98).
Dopamine can also induce depolarization of podocytes that may lead to its relaxation (99).
This suggests that dopamine increase natriuresis and diuresis by increasing the amount of water and filtration at the glomerular level. Furthermore, dopamine is known to promote anti-inflammatory and antioxidants response.
Impairment of the renal dopaminergic system in hypertension has been well studied, and there is a strong implication that the renal dopaminergic system's alteration plays a prominent role in pathophysiology of hypertension. Experimental evidences obtained through various animal models strongly suggest that renal dopaminergic system impairment leading to a hypertensive phenotype. This includes D1-like receptor impairment in SHR, and SS rats lead to an increase in BP, sodium reabsorption, and decrease in diuresis (100, 101). Moreover, the reduction of renal dopamine by genetic ablation of dopamine decarboxylase in mice have shown an increase albuminuria, renal macrophage infiltration, and renal nitrotyrosine levels (102). Interestingly, there is an interaction between the intrarenal dopaminergic system and the AngII at the receptor level
(103). D1-like receptors and the AT2 can synergistically oppose the vasoconstrictor and anti-natriuretic function by AngII on the AT1 (104). This was confirmed by providing rats with fenoldopam, which is a D1-like receptor agonist, allowing AT2 to translocate from the intracellular compartment to the cell membrane (104). Therefore, the intrarenal dopamine system delivers a beneficial action on BP regulation and must be tightly regulated.
27 Impairments in the dopaminergic system can lead to increased sodium, and water retention, therefore, can lead to hypertension.
1.8 Summary:
This chapter was to shed light on the experimental genetic approaches which have been applied for decades to investigate and better understand the genetics of hypertension.
Human and rat linkage studies have identified many genetic loci responsible for the development and progression of hypertension. To this date, many novel genes/loci have been identified for their association with hypertension, including Coup-TFII and Resp18.
However, these genes still have to be validated for their association with hypertension.
Advancement in technologies has given us to manipulate host genome using novel gene- editing tools such as ZFN, TALENs, and CRISPR/Cas9. These gene editing tools are valuable to generate genetically engineered animal models of hypertension to validate the prioritized candidate genes for hypertension.
Excess salt intake is a significant contributor to an increase in BP and increase the risk of end organ damage. Experimental evidence obtained from laboratory animal models suggests that hypertension is a complex polygenic trait, and the list of genes associated with this trait is continuing. These genes must be tightly regulated in order to maintain proper electrolyte and fluid homeostasis. Any alteration in these genes can also lead to the impairment of specific signaling pathway, which could play a pathophysiological role in the development of hypertension. Due to the complexity of the genetic regulation of hypertension, it has become very challenging for scientist to develop simple therapeutic strategies to attenuate hypertension. At best, identification and understanding of novel
28 genes’ role in hypertension may lead to personalized medicine that can be given to patients based on their genetic makeup to cure hypertension in the future.
29
Figure 1 – 1 Causes of Essential Hypertension: Hypertension is a complex polygenic trait which is under the influences of many environmental and genetic factors.
30
Figure 1 – 2 The Functional Anatomy of the Nephron: The nephron consists of the glomerulus that is about 200μm in diameter, the proximal tubule cells, the loop of Henle, which is a U-shaped tube that is divided into the descending limb and the ascending limb.
Then Finally, the distal convoluted tubule merges into the collecting ducts. In the glomeruli, the net fluid movement will be in the direction of the lowest pressure. On average, the hydrostatic pressure in the capillaries (glomerulus capillary blood pressure) is 55mmHg, and the fluid pressure in the Bowman’s capsule (capsular space hydrostatic pressure) is 15mmHg. There is also another opposing force, the osmotic pressure. The osmotic pressure in the capillaries (glomerular capillary osmotic pressure) is close to 30 mmHg were as the osmotic pressure in the Bowman’s capsule is almost zero. Therefore, the net pressure is 10 mmHg outward. However, many factors can affect the GFR, such as a change in renal blood flow, change in hydrostatic pressures, changes in BP, and changes in permeability.
31
Chapter 2
An Introduction to a Novel Endocrine Protein-Regulated
Endocrine Specific Protein -18 (RESP18)
Regulated Endocrine-Specific Protein-18 (RESP18) is an 18kDa protein that was initially found in rat neuro intermediate pituitary cDNA library in response to dopaminergic agents in parallel with endogenous prohormone, proopiomelanocortin
(POMC) (105). Dopaminergic agent was found to regulate Resp18 expression (106). For example, dopaminergic agonist has been associated with a decrease in Resp18 expression whereas dopaminergic antagonist has shown to increase Resp18 expression (106). Resp18 expression has been found in multiple cell types ranging from the adrenal medulla, brain, kidney, pancreas, pituitary, retina, stomach, testis, and thyroid (106). The highest expression of Resp18 was found in the pituitary gland, while expression of Resp18 has also been shown in the neurons of the hypothalamus and the surrounding diencephalon, and the brain stem the site of neuropeptide and catecholamine synthesize (107). Resp18 has also shown sequence homology to an islet cell antigen 512 (IA-2) and could be a novel molecule involved in secretory pathways for neuropeptide or hormones (108).
32 As mentioned in Chapter 1, Resp18 was prioritized as a candidate gene for hypertension through substitution mapping studies conducted using the Dahl Salt-Sensitive
(SS) and Dahl Salt-Resistant (SR) rats (109). The same locus in the SS rat also contains a urinary protein excretion quantitative trait locus (QTL). Therefore, we sought out to validate Resp18 candidacy for hypertension by generating a genetically engineered animal model in which the Resp18 gene is disrupted in the SS rat genetic background (109).
Previously, we have shown that targeted disruption of Resp18 in SS rats leads to an increase in both systolic and diastolic blood pressure (BP) upon a high salt diet treatment (109).
Interestingly deep RNA-sequencing in the micro dissected rat renal tubules discovered that Resp18 gene expression is found in the renal proximal tubule (RPT) cells
(110). This pattern of expression is interesting and could be taken as evidence to speculate that Resp18 may play a role in renal handling of sodium and water and thus BP regulation.
However, not much is known about this novel endocrine protein, here we have compiled all the literature of Resp18 into a comprehensive review.
2.1 Structure of RESP18:
Resp18, transcripts are 800 nucleotides in length and contains the code for a 20 kDa protein product (111). This 20 kDa is cleaved off its NH2-terminal and produces an 18kDa protein, known as Resp18. In-Vitro transcription/translation and subcellular fractionation studies have shown that the N-terminal is cleaved via co-translationally (111). These results are suggestive that Resp18 is contained in the lumen region of the endoplasmic reticulum
(ER). Nucleotide variation is found between SS and SR rats cDNA has an A/G single nucleotide polymorphism at position 286, leading to an amino acid change (Ile/Val) in the
33 protein at position 67 (10). In addition, Resp18 was believed to contain two paired basic amino acids that served as an endoproteolytic cleavage site. However, the labeling of
Resp18 in corticotropic tumor cells (AtT-20) did not show the production of smaller peptide products (105). It is believed that isoforms of Resp18 exist, which are greater than
18kDa. This protein result from the O-glycosylation as the protein proceeds through the secretory pathways (106).
RESP18 gene expression is present across all mammals, where the sequence homology of monkey and chimpanzee RESP18 is 90% identical to humans (108). Mouse and rat RESP18 only share 65% sequence homology with its human counterpart (108).
Interestingly, the mouse also expresses a unique form of Resp18 known as Resp18-C, which is a shorter 120 amino acids. However, the first 115 amino acids of Resp18-C are homologous to Resp18 (112). In humans, three isoforms of RESP18 exist, RESP18α,
RESP18β, and a pseudogene (108). RESP18α, RESP18β encode for proteins which are 173 and 228 amino acids respectively, where RESP18α and RESP18β share 90% sequence homology (108). Both RESP18α and RESP18β are also found to share sequence homology with the luminal domain of the IA-2, also known as protein tyrosine phosphate receptor type N (PTPRN). The RESP18 gene and IA-2 in humans are arranged very close to less than 45-kb regions apart on chromosome 2 (2q35). This suggests that RESP18 could be an evolutionarily related member of the IA-2 (108).
34 2.2 Intracellular Localization and Degradation of RESP18:
RESP18 was found in hypothalamic nuclei via immunostaining and limited to cell bodies and dendritic processes (106). RESP18 expression in the ER has also been validated by dual label confocal microscopy and immunostaining in multiple neuroendocrine cell lines such as (AtT-20, GH3, RIN, and PC12) (112). Though the localization of RESP18 is similar to other ER proteins, however its degradation pathway is different. RESP18 protein is degraded 20 minutes after other ER proteins are degraded. This suggests that RESP18 degradation takes place after its transport from the ER (112). Typically, RESP18 half-life was about 18 minutes found in AtT-20 pituitary tumor cells. Upon treatment of carbonyl cyanide m-chlorophenylhydrazone, which is a mitochondrial uncoupler that inhibits the vesicular transport, the half-life of RESP18 rose to 99 minutes (113). Blocking ER protein transport has shown to increase RESP18 half-life up to 400 minutes. On the other hand, using chloroquine, an inhibitor of lysosomal protease, or nocadozole, an inducer of retrograde transport if Golgi proteins to the ER had minimal effects on the half-life of
RESP18 (114). Overall, these results suggest that RESP18 degradation occurs outside of the ER and could require (112). One possibility is that RESP18 could be degraded in the
Coat protein complex II (COPII) – type vesicles that are involved in transport from the ER
(115). Other mechanisms for degradation for RESP18 could include degradation by a cysteine protease, which is involved in the secretory pathway. When AtT-20 cells are treated with Calpain, a calcium-dependent, non-lysosomal cysteine protease has shown to decrease RESP18 degradation (112). It should be mentioned that the RESP18 mRNA expression is higher than the protein product, implying post-transcriptional and post- translational modifications alter RESP18 expression (106).
35 2.3 RESP18 Involvement in the Secretory Pathway:
Resp18 was first discovered in 1994 in the intermediate pituitary of rats because of its regulations with POMC upon dopaminergic treatments (116). The intermediate pituitary is very useful in studying secretion of peptides and hormones due to the vast amounts of melanotropes of which respond to dopaminergic stimuli (116). RESP18 can only exit the
ER once there is an increase in protein expression, and then it can proceed to the secretory pathway (106). RESP18 is considered a lumicrine protein, since it is contained within the secretory pathway (117). High level of Resp18 expression was found in the anterior pituitary and hypothalamic nuclei, suggest that RESP18 could play a role in the synthesis and/or secretion (112, 117). Chromogranin B, a secretory protein that plays a role in hormone packing and secretion, and RESP18 was found to be co-regulated with POMC in response to dopaminergic agents (116). However, studies conducted in the AtT-20 cells show that RESP18 did not cofractionate with POMC, or synaptotagmin, which is a secretory granule, and synaptic vesicle marker (112).
Dense core vesicle (DCV) is vital for the release of biogenic amine neurotransmitters, neuropeptides, and hormones (114). One of the most convincing experimental evidence supporting RESP18 role in the secretory pathway comes from its shared sequence homology with the luminal region of IA-2, which is a DCV (108). IA-2 and its paralog (IA-2β) play a critical role in regulating insulin secretion (114). The N- terminal of IA-2 is also known as the RESP18 homology domain (RESP18-HD), is comprised of 35-134 amino acids (118). This N-terminal domain of IA-2 is believed to play a vital role in the sorting of IA-2 into secretory granules (118). When secretory granule mature, the pro-protein pro-IA2 is cleaved by the prohormone convertases resulting in the
36 formations of the mature ectodomain IA-2. The secretory function of IA-2 is believed to be harbored in the RESP18-HD, whereas the rest of IA-2 is responsible for the ER retention signal (118). In order for IA-2 to exit the ER, pro-IA-2 must form a dimer to overcome the
ER retention signal (118). Furthermore, the deletion of the RESP18-HD impairs the sorting capability of IA-2 into secretory granules. The RESP18-HS acts as a condensing factor for protein sorting and granulogenesis (119). In summary, literature evidences for Resp18 have shown to speculate that Resp18 may play an essential role in the sorting and trafficking of
DCV in the secretory pathway.
2.4 Association of Resp18 in Various Organ Systems:
Resp18 expression has been found in numerous neurological tissues which include, the forebrain, brainstem, and sympathetic ganglia. Resp18 expression has also been found in multiple cell types from the anterior pituitary glands; these include corticotropes, gonadotrophs, mammotropes, and somatotrophs thyrotropes. In the intermediate pituitary,
Resp18 expression was found in melanotropes, whereas in the diencephalon, Resp18 expression is found in the thalamus, hypothalamus, pineal gland, and the posterior pituitary gland (105). However, not much about Resp18 function in neurological tissue is known.
RESP18 has found to play a role in neurogenerative diseases such as Parkinson’s disease
(120).The area of the brain, which is profoundly affected by Parkinson’s disease, the striatum, and substantia nigra, also have increased expression of Resp18 mRNA (121).To study the role of Resp18 in Parkinson’s disease, novel Resp18 knock mice were developed
(Resp18-/-) (120). Upon knock out of Resp18, they found that these mice have reduced locomotor activity in an open field test. However, they did not see any difference in the
37 striatal dopamine level. In addition, the Resp18-/- mice also showed a decrease in involuntary movement and locomotor coordination (120). Overall, the study reported that decrease in dopaminergic neurons and the inhibition of MPTP in the Resp18-/- mice suggest that a deficiency of Resp18 can lead to protective effect during Parkinson’s disease or prevent the initial onset of Parkinson’s.
Resp18 expression was found to be higher in rat pituitary, specifically in the anterior, intermediate, and posterior pituitary, and also is found in high levels in the hippocampus, amygdala, and several hypothalamic nuclei (106). The intermediate pituitary is composed mainly of melanotropes that are controlled by dopaminergic agents (111).
Both POMC and Resp18 levels were found to be modulated with dopaminergic agents such as dopamine receptor antagonist haloperidol has shown to increase Resp18 mRNA levels in rat pituitary melanotropes (117). Whereas dopamine receptor agonist bromocriptine was found to decrease Resp18 mRNA (117). Expression levels of Resp18 are 7-fold higher in haloperidol treated rat neuro intermediate pituitary lobe when compared to the bromocriptine-treatment (111). In the pituitary, the highest levels of Resp18 were found in the intermediate pituitary, but Resp18 protein was found in higher levels in the anterior pituitary, adrenal medulla, and the pancreatic islets (111). As mentioned before, this alteration in mRNA and protein expression suggests a post-transcriptional mechanism involved in Resp18 protein expression, which may be cell-specific (106). Resp18 expression has been localized to the site of catecholamine synthesize and secretion in the cell. In the hypothalamus, specifically, the paraventricular and supraoptic nuclei, which are involved in oxytocin and vasopressin hormone secretion, also show high levels of Resp18 mRNA (111, 122, 123).
38 Resp18 expression is found in multiple cell types within the pancreas rats. Resp18 was found in the glucagon, producing α-cells, insulin-producing β-cells, and δ-cells, which expression somatostatin (108). Though Resp18 expression is found in many different cells in the pancreas, the expression pattern mimics more like that of insulin (105). Like insulin, glucose has been found to mediate Resp18 expression. Experimental in-vitro models in
MIN6 cells exposed to high glucose (25mM) showed an increase in Resp18, compared to low glucose (3mM) (108). As mentioned previously, Resp18 has found to share sequence homology with a DCV transmembrane protein involved in insulin secretion known as IA-
2. Downregulation of IA-2 has been associated with a decrease in insulin secretion and glucose intolerance in mice (124). These mice exhibit a 40-45% reduction in insulin release in response to glucose and maintain elevated blood glucose levels (125). The sequence homology to IA-2 and response to blood glucose, such as insulin, suggest Resp18 may be of importance when regulated glucose homeostasis.
Outside the brain, the highest expression of Resp18 is found in the testis but not in the ovary or the epididymis (126). RESP18 deficiency has been correlated with embryonic lethality, suggesting that RESP18 is essential for early development (127). Both isoforms of Resp18, the 18kDa, and 19kDa was identified in the testes and sperm (126). In the seminiferous tubules, there was a varying density of Resp18 all over the cells. This change in density may be due to the need of Resp18 during different stages of the seminiferous epithelium cycle (126) Resp18 expression was also found in spermatocytes and developing spermatids (127). Through the sperm production cycle Resp18 was found to be higher in pachytene spermatocytes, and spermatids, whereas we see a decrease in elongating
39 spermatids (126). This expression suggests that Resp18 may play a role in sperm production in the male reproductive system.
Resp18 expression was found in the endocrine cells of the stomach, the gastric mucosa, and with expression also found in the small and large intestines (128). Resp18 expression was highest in the gastric mucosa, specifically the ghrelin-producing A-like cells, and the gastrin-producing G-cells (128). The A and G-cells play a vital role in digestion, gastrointestinal motility by secretions of hormones. Ghrelin, the hunger hormone, sends signals to the hypothalamus via the vagus and the enterochromaffin-like cells (ECL) in the stomach. This signal to the hypothalamus induces gastric acid (HCl) secretion by the parietal cells and also promotes G-cells to produce and secrete gastrin, which also induces HCl secretion by the parietal cells (125, 129, 130). Within the rat gastric mucosa, Resp18 was found to be co-localized with either gastrin or ghrelin in the antrum of the stomach (128). Upon proton pump inhibitor treatment of omeprazole Resp18 expression was upregulated in rat gastric mucosa (131). Hypergastrinemia induced by acid inhibition, fasting, and re-feeding conditions all have been shown to alter Resp18 expression (128). Moreover, rats treated with pantoprazole, a proton pump inhibitor, postulated that the hypergastrinemia could be associated with the increase in Resp18 (128).
Other agents that reduce gastric acid secretion such as octreotide, a somatostatin analog, also increase Resp18 expression. However, octreotide did not have much of any effect in
Ghrelin. Taken together, this suggests that Resp18 could play a role in gastrin secretion and have minor effects on ghrelin.
40 2.5 RESP18 a Novel Candidate Gene for Hypertension:
Genome-wide QTL mapping studies conducted using SS rats resulted in identification of many genomic loci that significantly associated with BP and/or urinary protein excretion (UPE) QTLs (10, 109, 132-134). One such study led to identification of
BP and UPE QTL in rat chromosome 9 and Resp18 was prioritized as candidate gene for
BP, based on the BP phenotype and differential expression of Resp18 in the kidneys between the SS and SR rats (10). To validate Resp18 association with BP regulation, a
Resp18mutant rat was created in the SS rat genetic background. Custom zinc-finger nuclease
(ZFN) targeted exon 3 of Resp18, which resulted in a 7-base pair deletion causing a frameshift introducing a premature stop codon (109). Resp18mutant rat, therefore, produced a truncated polypeptide with 111aa compared to the wild type (SS) 175aa (109). When the
Resp18mutant rat was challenged with a high salt diet, there was a significant increase in both the systolic and diastolic BP compared to the wild type SS rat (109). This salt-dependent increase in BP suggests that Resp18 involvement in salt-induced hypertension. The kidney is critical to the overall fluid and electrolyte balance and regulation of BP (135). In addition, the Resp18mutant rat showed a significant increase in proteinuria and a decrease in mean survival time in a salt-dependent manner (109). The targeted disruption of Resp18 leads to an increase in renal fibrosis, and upregulation of fibrotic gene expressions in their kidneys
(109). Taken together, these findings suggested that Resp18 function is vital for BP regulation by modulating proper kidney function upon an increase in sodium loading.
41 2.6 Summary:
Till date, the exact molecular function of Resp18 is still uncertain; however, Resp18 is found to be expressed in many tissue types. Resp18 was initially identified in a neuroendocrine tissue. Many studies show that Resp18 is expressed in the adrenal medulla, brain, pancreas, pituitary, kidney, retina, stomach, superior cervical ganglion, testis, thyroid, and plasma. Interestingly, Resp18 shares sequence homology with IA-2, which is involved in insulin secretion, and therefore Resp18 is also thought to have secretory function. Moreover, dopaminergic agents, glucose, insulin, and glucocorticoids were found to modulate Resp18 gene expression. Resp18 was prioritized as a candidate gene for BP in a substitution mapping study conducted in Dahl rats. Previously, we have shown that targeted disruption of the Resp18 gene in the Dahl SS rat aggravate salt-induced hypertension. Taken into consideration that Resp18 expression was found in the RPT, the site of the renal dopaminergic system and site of sodium and water reabsorption. Therefore, it is crucial to study Resp18 function in the kidney.
42
Chapter 3
Deep Transcriptomic Profiling of Dahl Salt Sensitive Rat
Kidneys with Mutant Form of Resp18
3.1 Introduction
The interplay between genetic and environmental factors plays a vital role in the development and progression of hypertension, also known as high blood pressure (BP)
(136-138). Currently, 30% of adults in the United States have hypertension and are at an increased risk of developing heart disease and renal disease (22, 139). Environmental factors such as an increase in dietary salt intake, high-calorie diets, and sedentary lifestyles are known to increase the risk for developing hypertension (52, 109, 140). However, the molecular basis of increased risk for developing high BP and renal disease remains largely unknown. Thus, identifying gene/genetic loci that contribute to high BP and renal disease is fundamental in understanding these complex diseases.
It is well known that the upregulation of the Renin-Angiotensin-Aldosterone
System (RAAS) pathway increases BP and plays a vital role on water and electrolyte homeostasis (7, 141). However, advancements in technology have provided us with new
43 tools (gene-editing) to uncover the physiological and molecular aspects of genes associated with hypertension (142). Dahl Salt sensitive (SS) rats are well-established and extensively used rat genetic model to study salt induced hypertension and renal failure (52, 109, 133,
143). Quantitative trait locus (QTL) mapping studies conducted in the SS rats has led to the identification of many genetic loci responsible for salt-induced hypertension and renal disease (10, 44, 52, 132, 144-146). One such QTL study identified a genomic segment on rat chromosome 9 containing a potential candidate gene for BP and proteinuria, and this gene was found to be the Regulated Endocrine Specific Protein-18 (Resp18) (10, 143).
Resp18 expression has been identified in a series of tissues and cell types; however the precise function of this novel endocrine protein is currently unknown (147).
In order to validate Resp18’s candidacy for hypertension, Resp18mutant rat was generated by targeted disruption of Resp18 locus in SS rat (109). This targeted disruption results in the deletion of seven base pairs in exon3 of Resp18 and introduced a premature stop codon in the protein coding sequence (109). Previously, we have shown that the
Resp18mutant rats maintained on a HS diet (2% NaCl) for 6 weeks exhibited an increase in
BP, renal fibrosis, proteinuria and reduced mean survival time (109). Furthermore, we also observed a significant increase in pro-fibrotic gene expressions such as Collagen type 1
(Col1a1), Collagen type 3 (Col3a1), and Transforming growth factor beta (Tgf-β) in the
Resp18mutant rat kidneys (109). From this earlier work, we concluded that Resp18 gene function is vital in BP regulation by modulating proper kidney homeostasis upon excess salt loading.
Here we set out to study the role of Resp18 in HS diet mediated regulation of gene transcription. Therefore, we tested the hypothesis that targeted disruption of Resp18 in SS
44 rat kidneys, changes the transcriptomic response to HS diet treatment. We tested this hypothesis with complete renal transcriptome from SS and Resp18mutant rat kidneys using deep RNA sequencing (RNA-seq) approach and subsequent pathway analysis.
3.2 Materials and Methods:
3.2.1Animals:
Male Dahl salt-sensitive/Mcw (SS) and Resp18mutant rats were concomitantly bred and raised on a low salt diet (0.3% NaCl; Harlan Teklad diet 7034) until 6 weeks of age.
After 6 weeks of age, these animals were switched to a diet containing high salt (HS) diet
(2% NaCl; Harlan Teklad diet 94217), and animals were maintained on a HS diet until the end of the study. The rats were euthanized after 1-week exposure to a HS diet and kidneys from the rats were immediately frozen with liquid nitrogen and total RNA extraction was then performed as outlined below. All animals were kept on a 12:12-h light-dark cycle in a climate-controlled room. Rat chow and water were provided ad libitum. The study protocol was approved by the Institutional Animal Care and Use Committee of the
University of Toledo in accordance with the National Institutes of Health Guide for the
Care and Use of Laboratory Animals and followed ARRIVE guidelines.
3.2.2 Generation of Resp18mutant Rats:
Resp18mutant rat was generated in the SS rat genetic background by targeted disruption of Resp18 gene locus as previously described (109).
45 3.2.3 Blood Pressure Measurement:
At five weeks of age, both SS and Resp18mutant rats were anesthetized using isoflurane and surgically implanted in with radiotelemetry transmitters, as described previously (Kumarasamy et al., 2015; Kumarasamy et al., 2018). Post-surgery, the rats were housed individually and allowed to recover for 3 days. The BP, using the DSI software and equipment (https://www.datasci.com/), was recorded from SS and
Resp18mutant rats a day before starting the HS diet and 2 and 7 days after the start of the HS diet. Systolic, diastolic, and mean arterial pressures were collected every 4 h for 24 h using the Dataquest A.R.T 4.2 software.
3.2.4 Total RNA Isolation and qPCR Analysis:
Total RNA was isolated from SS and Resp18mutant rat kidneys after one-week exposure to a HS diet, using TRIzol Reagent (Invitrogen) according to the manufacturer’s protocol. The purity and concentration of the RNA were determined by NanoDrop one
(Thermofisher). Five-micrograms of DNase-treated total RNA was used for the first-strand cDNA synthesis using M-MLV reverse transcriptase (Promega, USA) as per the manufacturer’s protocol. Quantitative PCR was performed in the Quantstudio5 Real-Time
PCR instrument (Life technologies) using Power UP SYBR Green PCR master mix
(Invitrogen, USA) using gene specific primers (Table 3 – 1). The gene expression data were normalized with Gapdh and the change in gene expressions were calculated by the
ΔΔCt method; data are expressed as fold change relative to control (109).
46 3.2.5 RNA Sequencing:
Sequencing libraries were generated from 3 μg of RNA, using a NEBnext Ultra RNA
Library Prep Kit for Illumina (NEB, USA). PCR products were purified (AMPure XP system) and library quality was assessed on the Agilent Bioanalyzer 2100 system.
Clustering was performed on a cBot Cluster Generation System, using HiSeq PE Cluster kit cBot-HS (Illumina). After cluster generation, the library was sequenced on an Illumina
HiSeq platform, and 125bp/150 base paired-end reads were generated. All downstream analysis was done on clean high-quality data. Reference genome and gene model annotation files were downloaded directly from genome website. Index of the reference from which the genome was built, used hisat2 2.1.0. The paired end-clean reads were aligned to the reference genome, using HISAT2. Gene expression levels were quantified using HTSeq v0.6.1 to count the read numbers mapped to each gene. The fragment per kilobase of transcript sequence per million base pairs sequenced (FPKM) was calculated based on the length of the gene and reads-count mapped to this gene. Differential expression analysis of two conditions/groups (two biological replicates per condition) was performed using the DESeq R package (1.18.0). DESeq provides statistical routines for determining differential expression in digital gene expression data, using a negative binomial distribution model. The resulting P-values were adjusted, using the Benjamini and Hochberg’s approach for controlling false discovery rate. Genes with an adjusted
P<0.05 found by DESeq were assigned as differentially expressed. Gene Ontology (GO) enrichment of differentially expressed genes was analyzed by the GOseq R package, in which gene length bias was corrected. GO terms with a corrected P<0.05 were considered
47 significantly enriched by differential expressed genes. Data were uploaded to the NCBI
GEO database (GSE 149006).
3.2.6 Measurement of Serum Renin activity:
Serum renin activity was measured in SS and Resp18mutant rats raised on low salt
(0.3% NaCl) diet and after one week of HS diet. Renin activity was measured using a renin assay kit (MAK157 -Sigma Aldrich, USA). In brief, the samples, and standards were loaded into their respective wells. After 30 min incubation at 25oC in the dark, fluorescence was measured at 540 nm excitation and 590 nm emission, using the
SpectraMax M3 microplate reader (Molecular Devices, CA USA).
3.2.7 Statistical Analysis:
Data are presented as mean ± standard error mean (SEM). Data were analyzed by unpaired t-test or Two-way ANOVA wherever appropriate with P value of <0.05 was used as a threshold for statistical significance. Figures were generated with GraphPad Prism software (version 7; GraphPad Software Inc., La Jolla, CA).
48 3.3 Results
mutant 3.3.1 Resp18 Rats Maintains Elevated Blood Pressure Compared with Wild Type SS Rats:
It is well known that increase in dietary salt intake increases the risk of developing hypertension and renal damage in rodents and humans (52, 109, 148). Chronic hypertension can cause irreversible end organ damage (149). Previously, we have shown
mutant that the Resp18 rats had an increase in BP and an increase in renal fibrosis on a 2%
mutant NaCl (HS) diet for 6 weeks (109). In the current study, we found that the Resp18 rats had elevated BP on the basal low salt diet (LS) and HS diet treatment compared with SS rats (Fig 3 – 1A). Though, DBP was significantly different at the basal LS diet, however, such difference in DBP was not carried through, when the rats exposed to HS diet (Fig 3 –
1B). Similar to SBP, we did observe an increase in mean atrial pressure (MAP) in the
mutant Resp18 rats on the basal LS diet and HS diet exposure compared with SS rats (Fig 3 –
1C).
3.3.2 Transcriptome Analysis of Resp18mutant Rat Kidneys:
Based on our previous finding, we believe that the Resp18 gene plays an essential role in the increase in BP with an increase in salt intake (109). Therefore, we sought out to understand how the targeted disruption of Resp18 affects the transcriptomic response in
Resp18mutant rat kidneys after exposure to HS diet. Our RNA sequencing results show distinct difference in transcriptome response of SS and Resp18mutant rats as seen in the heat map (Fig 3 – 2A and Table 3 – 2). Using a volcano plot to infer the overall distribution of
49 differentially expressed genes, we found 25 genes that were differentially expressed between the SS and Resp18mutant kidneys with the threshold set at P<0.05 with all biological variation removed by DESeq (Fig 3 – 2B). Of the 25 genes, 12 were up regulated while 13 were down regulated (Fig 3 – 2B). Venn diagram of the RNA-seq data showed 370 genes uniquely expressed in Resp18mutant kidneys and 294 genes uniquely expressed in SS rat kidneys (Fig 3 – 2C). To validate our RNA-seq results, we performed quantitative real- time PCR (qRT-PCR) of mRNA for a subset of genes that were differentially expressed between the two rat strains. Through qRT-PCR analysis, we validated the differential expressions of up-regulated genes, such as Selectin P ligand (Selplg), A disintegrin and metalloproteinase with thrombospondin motifs-like 2 (Adamtsl2), ATP-binding cassette, subfamily A (ABC1), member 8a (Abca8a), Dipeptidase 1 (Dpep1), Calbindin 1(Calb1),
Renin (Ren), Ubiquitin C-terminal hydrolase L3 (Uchl3), Prefoldin subunit 4 (Pfdn4),
Copine 7 (Cpne7), and Transient receptor potential cation channel, subfamily V, member
5 (Trpv5) and downregulated genes, such as Regulated endocrine-specific protein 18
(Resp18), Homer scaffold protein 1 (Homer1), Eukaryotic translation initiation factor 4A2
(Eif4a2), and Unc-79 homolog, NALCN channel complex subunit (Unc79)(Fig 3 – 3). We also found that ten novel transcripts were differentially expressed between SS and
Resp18mutant rats. Since these are newly annotated, no information is available if these transcripts code for protein-coding gene or transcribed as non-coding RNA.
The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were analyzed on the RNA-seq data to identify significantly enriched pathways associated with the differentially expressed genes. Through our analysis, we found 11 significantly enriched pathways, by DEGs (differential gene expressions), included upregulated pathways in the
50 Resp18mutant rat such as the transcriptional mis-regulation in cancer, Staphylococcus aureus infection, renin secretion, renin-angiotensin system, p53 signaling, endocrine, and other factor-regulated calcium reabsorbing, cell adhesion molecule (CAMs), and ABC transporters (Fig 3 – 4). KEGG pathway analysis also showed 3 pathways with down- regulated genes that included RNA transport, glutamatergic synapse and FoxO signaling pathway (Fig 3 – 4).
3.3.3 Renin Activity is increased in Resp18mutant Rats:
The RAAS plays a pivotal role in fluid and electrolyte homeostasis and BP regulation (150-153). Through RNA seq analysis and subsequent validation of RNA- seq results by qRT-PCR analysis, we found a significant upregulation of renin gene expression in Resp18mutant rat kidneys compared with SS rats. Renin is the first rate-limiting enzyme in the RAAS pathway(154). We measured renin activity in the serum from SS and
Resp18mutant rats, one day before and one week after HS diet (Fig 3 – 5A). On LS diet (0.3%
NaCl), renin activity was not different between the two groups. However, after one week
mutant of HS diet, the serum renin activity decreased in SS but not in Resp18 rats such that
mutant serum renin activity became higher in Resp18 than SS rats (Fig 3 – 5B).
3.4 Discussion:
We reported that targeted disruption of the Resp18 gene in Dahl SS rats (Resp18mutant) aggravates salt-induced hypertension and renal injury, however, the molecular mechanism was for the hypertension was not studied (109). Several studies have shown that SS rats fed HS diet for more than 2 weeks exhibit severe renal damage and increased urinary
51 protein excretion (155-159). Indeed, we also observed an increase in urinary protein excretion in the Resp18mutant rats after long term HS diet when compared to the wild type
SS rats (109). On HS diet, the mean survival time of Resp18mutant rats was decreased by 50 days, compared with SS rats fed the same HS diet. These results suggest that the Resp18 gene plays an essential role in decelerating the progression of salt-induced renal injury and hypertension. The current study was aimed to capture the early transcriptomic changes in the kidney in Resp18mutant rats fed HS diet for one week. RNA-sequencing revealed 25
DEG’s between SS and Resp18mutant rat kidneys. Among them, six genes are associated with hypertension: Homer1, Selplg, Abca8a, Dpep1, Calb1 and Ren. Ren is well known for its role in the regulation of renal function and BP (160, 161). We found that serum renin activity is higher in Resp18mutant than SS rats. Our findings suggest that HS diet increases
BP in Resp18mutant rats and promotes transcriptomic responses that are known to increase
BP.
Previously we have shown that genetic ablation of the Resp18 gene in SS rats aggravates salt-induced hypertension and renal injury (109). Furthermore, through deep
RNA-sequencing (RNA-Seq) from micro dissected rat tubule segments, it has been found that the Resp18 gene expression is highest in the renal proximal tubule cells (110). Based on the adverse renal outcomes seen in Resp18mutant rat kidneys (109), we prioritized that
Resp18 gene function in the kidney is crucial for maintaining normal BP and protect the kidney from salt-induced injury. In the current study, we found that after one-week exposure to HS diet, the Resp18mutant rats had higher BP than SS rats. Furthermore, through
RNA-Seq analysis, we found that 25 genes were differentially expressed between
mutant Resp18 and SS rat kidneys, in which 13 genes were found to be downregulated and 12
52 genes were found to be upregulated. Of the upregulated genes we have validated and confirmed the RNA-Seq data through qRT-PCR analysis for Selplg, Adamtsl2, Abca8a,
Dpep1, Calb1, Ren, Ulch3, Pfdn4, Cpne7, and Trpv5 in addition to downregulated genes such as Resp18, Homer1, Eif4a2, and Unc79.
Of these validated genes, we found that six genes that are known to be associated with hypertension, these include, Homer1 (162), Selplg (163), Abca8a (164), Dpep1 (165,
166), Calb1 (167), and Ren (151, 168). Studies have shown that variation within the SELPLG gene alters SELP/SELPLG binding capacity, which may lead to fewer leukocyte–endothelium and leukocyte–platelet complexes and potentially reduce the risk of stroke (163). Homer, known as a scaffolding protein, well defined for its role in the nervous system (169). Moreover, researchers began to investigate the role of Homer in cardiovascular disease (170, 171), where HOMER1 expression was found to be upregulated in coronary artery disease patients (169). It also found that it plays a role in regulating the
G-protein-coupled receptors (172). SNP within the ABCC8 gene, a member of the superfamily of ATP-binding cassette (ABC) transporters, was found to be associated with pulmonary arterial hypertension (173) and Single nucleotide polymorphisms s within the ABCC8 gene locus are associated with type-2 diabetes and BP in the Japanese population (174). Dpep1, another differentially expressed gene encodes for a membrane bound enzyme in the kidney, which is involved in the hydrolysis of dipeptides, such as glutathione and other similar proteins (175, 176). Furthermore, Dpep1 regulates leukotriene activity by catalyzing the conversion of leukotriene D4 to leukotriene E4(177,
178). Leukotrienes are pro-inflammatory mediators and are associated with inflammatory disease(179). In the kidney, Calb1regulates renal tubular Ca2+ reabsorption (180, 181),
53 along with other partners such as Trpv5, Trpv6, Pmca1b calcium pump, and Ncx1 exchanger (182). Interestingly, in our studies we found that Trpv5 was upregulated in
Resp18mutant rat kidneys, and Single nucleotide polymorphisms in TRPV5 is associated with the number and recurrence of kidney stones in patients with nephrolithiasis (183, 184).
Other differentially expressed genes such as Adamtsl2, is translated to a secreted glycoprotein that binds to the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein-1 (185). Through substitution mapping studies, genes such as Pfdn4 (186, 187), Cpne7 (145, 188, 189), Eif4a2 (190,
191), and Unc79 (192), were found to be significantly associated with BP, stress-related neuroendocrine reactivity, and urinary albumin excretion.
In our study, we found that the Ren gene was differentially expressed between SS and
Resp18mutant rats’ kidneys. As aforementioned the RAAS is important in the regulation of water and electrolyte balance and BP (153, 154, 193). Renin is the first rate-limiting enzyme in the RAAS pathway. Renin is released from the juxtaglomerular cells in response to low dietary sodium intake, among others to maintain normal fluid and electrolyte balance and BP (152, 193, 194). However, inappropriately increased activity of the RAAS can lead to hypertension. Through KEGG pathway analysis, we found that the RAS is
mutant upregulated in the Resp18 rat kidneys. We also found that serum renin activity is
mutant increased in Resp18 rats. The Dahl SS rat is a low renin model of hypertension, and
HS diet suppresses the renin level (195) in Dahl rats. In our study, serum renin activity was similar in Resp18mutant and SS rats. Following one-week of HS diet, serum renin activities
mutant decreased in SS rats but not in Resp18 rats, such that serum renin activity became
mutant higher in Resp18 than SS rats. The serum renin activity measurement and the gene-
54 expression analysis using RNA-seq approach strongly suggest that the upregulation of the renin could be one of the possible mechanisms for hypertensive phenotype in Resp18mutant rats. However, it remains to be determined if the relatively increased renin activity Resp18mutant rats contribute to their higher BP than SS rats and whether their intrarenal RAS is different from each other.
Not much is currently known about Resp18 cellular function. However through bioinformatics studies, it was found that RESP18 shares sequence homology with the luminal region of IA-2, a dense core vesicle transmembrane protein involved in insulin secretion (196). RESP18 is also expressed in the lumen of DCVs (108). These studies could be taken to indicate that Resp18 plays a role in hormone or peptide secretion. Therefore,
Resp18 could control renin secretion and play a vital role in regulating the BP during high- salt diet-fed conditions. More detailed studies will be required to validate the relationship between the Resp18 and renin synthesis or secretion and this could help increase our understanding of the RAS in pathogenesis and progression of hypertension. An increase in renin gene expression and renin circulating levels promote hypertension and other cardiovascular and renal complications (197-199). Whether the failure of HS diet to decrease serum renin activity participates in the aggravation of the hypertension in
Resp18mutant rats remains to be determined. As of now, there is only one FDA-approved renin inhibitor, i.e., aliskiren, in the treatment of hypertension. The possibility exists that drugs that stimulate Resp18 could act as renin inhibitors.
55 3.5 Conclusion:
In summary, targeted disruption of the Resp18 locus in SS rats aggravates the hypertensive phenotype after short-term exposure to a HS diet. This was associated with a failure of the HS diet to decrease renin activity in Resp18mutant rats. This finding is in agreement with the RNA-Seq analysis that the RAS pathway is upregulated Resp18mutant rats. Resp18 shares sequence homology with IA-2 a, dense core vesicle involved in hormone secretion. Based on our current study, we speculate that the Resp18 gene plays a pivotal role in either renin synthesis or secretion, preventing the inhibitory effect of HS diet on renin secretion and promoting the aggravation of the hypertension. However, we did rule out the possibility of additional genes that regulate the BP and renal phenotype of Resp18mutant rats. Further studies are required to understand the molecular aspects of
Resp18 role in BP regulation and kidney homeostasis.
56
Figure 3 – 1: Resp18mutant Rats Have Elevated Blood Pressure Compared to Wild-type
SS rats: Systolic blood pressure (A), diastolic blood pressure (B) and mean arterial pressure (MAP) (C) were measured using radiotelemetry in 6-week-old SS and
Resp18mutant rats fed LS (0.3% NaCl) diet from birth, 2 days after HS (2% NaCl) diet and one-week after HS diet (n = 8/group). Data are presented as the 4 h average recordings obtained continuously every 5 min for 24 h. Data are mean ± SEM. *P<0.05, **P<0.01
***P<0.001 vs SS rats and vs LS, two-way ANOVA and Sidak post-hoc test.
57
Figure 3 – 2: Transcriptome Response to One-week HS Treatment is Altered in
mutant mutant Resp18 Rat Kidney: After 1-week of HS diet, the kidneys of SS and Resp18 rats were harvested and total RNA was isolated for RNA sequencing. (A) The heat map of
FPKM cluster analysis, using the log10 (FPKM+1) value. Red denotes genes with high expression levels, and blue denotes genes with low expression levels, observed in SS and
mutant Resp18 rat kidneys. The color ranges from red to blue represents the log10 (FPKM+1) value from large too small. (B) Volcano plots for SS and Resp18mutant rat. The x-axis shows the fold-change in gene expression between samples (-log10(padj)) and the y-axis shows the statistical significance of the difference (log2 (fold-change)). Significantly up- and down-regulated genes are highlighted in red and green, respectively. Genes which were not differentially expressed, between SS and Resp18mutant rats are in blue. (C) Venn diagram: yellow represents the uniquely expressed genes in the SS rat kidney and purple
58 represents the uniquely expressed genes in the Resp18mutant rat kidney. The overlap represents the genes common in SS and Resp18mutant rat kidneys (n=3/group).
59
Figure 3 – 3: qRT-PCR Validation of RNA Sequencing Results: After one-week exposure to HS diet, the kidneys of the SS and Resp18mutant rats were harvested and total
RNA was isolated, converted into cDNA, followed by qRT-PCR. Results from qRT-PCR analysis for gene expressions that were significantly (A) downregulated and (B) upregulated in SS and Resp18mutant rat kidneys are shown (n=4/group). Data are mean ±
SEM. *P<0.05, **P<0.01 ***P<0.001, SS vs Resp18mutant, unpaired t-test.
60
Figure 3 – 4: KEGG Pathway Analysis from RNA Sequencing Results: KEGG analysis of DEG’s in SS and Resp18mutant rat kidneys. Green text represents pathways with upregulated genes; Red text represents pathways with downregulated genes. Dot size represents the number of different genes and the color represents the q-value.
61
mutant Figure 3 – 5: Renin Activity is Increased in Resp18 Rats After One-Week
Exposure to HS Diet: (A) Serum samples for renin assay were collected one day before the SS and Resp18mutant rats were fed LS diet (n=5-6/group). (B) After 1-week of HS diet, serum renin activity was measured in SS and Resp18mutant rats (n=8/group). Data are mean
± SEM. *P<0.05, SS vs Resp18mutant rats, unpaired t-test.
62 Table 3 – 1: qRT-PCR Primers Used to Validate RNA-Seq Results: Primer Name Sequence Abca8a RT-F AGCTGAGGTGTGCAGGATCT Abca8a RT-R CAGTTTCCCTTCGCTTTCTG Adamstl2 RT-F CCAGTGCCAGACAGAGACAA Adamstl2 RT-R CAGAACCACTTCGCATCTGA Calb1 RT- F GGAGCTGCAGAACTTGATCC Calb1 RT- R ATCGAAAGAGCAGCAGGAAA Cpne7 RT-F ACAAGAACTCTGGGGTGGTG Cpne7 RT-R GGTACTCGTTGGGCTGGTAA Dpep1 RT-F ACCTGACCCTTACGCACAAC Dpep1 RT-R ACACCCAGACGGTTCATCTC Eif4a2 RT-F AGAGGAGTGGAAGCTGGACA Eif4a2 RT-R TCACCATGCAGAGCAGAAAC Gapdh-RT-F CAAGATGGTGAAGGTCCGTGTG Gapdh-RT-R AGAGCCTGTGTCCATACTTTG Homer1 RT-F CACTGGGAGGCTGAACTAGC Homer1 RT-R ACCGCGTTTGCTTGACTACT Pfdn4 RT-F CGGAGACGTTTTCATTAGCC Pfdn4 RT-R CGCCACTCTGGACTCTAAGG Ren RT-F TCTCTCCCAGAGGGTGCTAA Ren RT-R CCCTCCTCACACAACAAGGT Resp18 RT-F ATCCAGCGAAGATGCAGAGT Resp18 RT-R ACCATCGTGGGCATTTATGT Selplg RT-F TTCCCACACTTCCTTCTGCT Selplg RT-R CACGCTGTAGTCGGGGTATT Trpv5 RT-F CATCGAAGTTCCCACAACCT Trpv5 RT-R GAATGTCAGCTCCATGCTCA Uchl3 RT-F TCGCGAACAACAAAGACAAG Uchl3 RT-R TTCTCCAGGTGTCTGGCTCT Unc79 RT-F CAGGACCACATGTTGATTGC Unc79 RT-R AAGGGACAGAGCGTGAAGAA
63 Table 3 – 2: List of all Up Regulated and Downregulated Genes Found in mutant Resp18 Rat Kidneys after One-Week Exposure to HS Diet Treatment. List of Down Regulated Genes Gene name Gene description log2FoldChange padj Eif4a2 eukaryotic translation 0.00061 initiation factor 4A2 -0.63575 Unc79 unc-79 homolog, NALCN 0.00949 channel complex subunit -0.90731 ENSRNOG00000010422 -1.2483 0.01000 Resp18 regulated endocrine- 3.9E-43 specific protein 18 -4.3172 Homer1 homer scaffold protein 1 -0.63524 0.00949 Novel00109 -0.7907 0.00020 Novel00241 -0.81664 0.00132 Novel00708 -1.2424 0.03258 Novel00709 -0.60067 0.04973 Novel01045 -0.54959 0.04300 Novel01255 -0.53767 0.01352 Novel01426 -0.77176 0.00036 Novel01443 -0.7229 0.01352
List of Upregulated Genes Gene name Gene description log2FoldChange padj Selplg selectin P ligand 1.1675 0.03258 Ren renin 0.91222 0.00856 Abca8a ATP-binding cassette, 0.00949 subfamily A (ABC1), member 8a 0.77681 Calb1 calbindin 1 0.65088 0.00022 ENSRNOG00000008645 0.88936 0.01931 Trpv5 transient receptor potential 0.01931 cation channel, subfamily V, member 5 0.78894 Cpne7 Copine 7 0.71039 0.01255 Dpep1 dipeptidase 1 0.98727 6.0E-05 Adamtsl2 ADAMTS-like 2 0.83505 0.00061 Uchl3 ubiquitin C-terminal 6.9E-09 hydrolase L3 3.7844 ENSRNOG00000047786 2.9866 0.00230 Pfdn4 prefoldin subunit 4 0.78121 0.04973
64
Chapter 4
Intrarenal Dopaminergic System is Dysregulated in Dahl SS
Rats with Mutant Form of Resp18
4.1 Introduction Hypertension is a multifactorial polygenic disease that has been closely associated with an increased risk for developing cardiovascular disease and a principal risk factor for stroke and renal disease (109, 200, 201). Furthermore, the onset and progression of high blood pressure (BP) and associated renal disease are multiply by genetic and environmental factors such as an increase in dietary salt intake, smoking, and alcohol consumption (52,
109, 202, 203). However, the genetic and molecular basis of increased risk for developing high BP and renal disease remains largely unknown. Current statistics suggest that 30-50% of BP variations can be attributed to genetic factors alone (8, 204). Also, chronic kidney disease (CKD) currently affects 15% of the US population, of which hypertension is the leading cause (205). Thus, identifying gene/genetic loci that contribute to high BP is fundamental in the understanding of this complex disease.
65 The Dahl Salt-Sensitive (SS) rat is one of the most extensively studied models for salt-induced hypertension and renal injury (52, 109, 202, 203, 206-209). Substitution mapping studies conducted in SS rats led to the identification of genetic loci responsible for salt-induced hypertension and renal disease (10, 44, 52, 109, 202, 203). One such study leads to the discovery of the gene named Regulated Endocrine Specific Protein-18
(Resp18) prioritized as a candidate gene for BP (10). Resp18 was first identified by screening the rat neuro intermediate pituitary cDNA
library for transcripts whose expression was regulated in parallel with the endogenous prohormone proopiomelanocortin in response to dopaminergic agents (105).
Resp18 candidacy for hypertension was validated by a generating a novel whole-body
Resp18 mutant rat created in SS rat genetic background (109). Previously, we have shown that upon a high salt diet (2% NaCl) regimen, both systolic and diastolic BP were significantly increased in Resp18mutant rats compared to SS rats (109), as well as an increase in renal fibrosis and urinary protein excretion (UPE) (109).
Dopaminergic agonists decrease the expression of Resp18, whereas dopaminergic antagonists increase its expression suggesting a molecular link between Resp18 and dopamine (105, 117). Apart from its role as a neurotransmitter, dopamine mediates other essential physiologic functions, including the regulation of BP and the balance of water and electrolytes in the kidney (94, 210, 211). Secondary to the brain, the kidneys serve as a significant source of dopamine production independent of the nervous system (210, 212).
L-3-4-dihydroxyphenylalanine (L-DOPA) is transported to the renal proximal tubule
(RPT) cells and converted into dopamine by dopamine decarboxylase enzyme (213). The dopamine generated from RPT cells is secreted into the renal tubular lumen and acts in an
66 autocrine/paracrine manner (212). Interestingly, deep RNA-sequencing performed in micro-dissected rat renal tubules showed that the Resp18 gene expression was noted in the renal proximal tubule (RPT) cells (110).
We have shown that Resp18mutant maintained on a HS diet had higher BP and UPE, and lower mean survival time than wild-type SS rats (109). Given that Resp18 is expressed in RPT cells and that its expression changes in response to dopaminergic agents, it is possible that Resp18 plays a crucial role in the regulation of salt-induced increase in BP and consequently, renal injury. The present study tests this hypothesis by examining whether targeted disruption of Resp18 gene in SS rats increases BP and causes impairment of renal function via abolishing/disrupting the renal protective effect exerted by the renal dopaminergic system.
4.2 Material and Methods
4.2.1 Animals:
All animals were kept on a 12:12-h light-dark cycle in a climate-controlled room.
Rat chow and water were provided ad libitum. The study protocol was approved by the
Institutional Animal Care and Use Committee of the University of Toledo in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and followed ARRIVE guidelines. Male Dahl Salt-Sensitive/Mcw (SS) and Resp18mutant rats were bred, housed, and raised on low-salt diet (0.3% NaCl; Harlan Teklad diet 7034) until six weeks of age before being switched to a high-salt (HS) (2% NaCl; Harlan Teklad diet 94217) diet for the remainder of the experimental protocol. The rats were euthanized
67 at the end of the experimental period (after 6 weeks exposure to HS diet) and organs were collected for experimental purposed outline below.
4.2.2 Generation of Resp18mutant Rats:
Resp18mutant rat was generated in the SS rat genetic background by using the zinc- finger nuclease method as detailed elsewhere (109, 214).
4.2.3 Food and Water Intake:
After 6 weeks on HS diet the SS and Resp18mutant rats were housed individually in comprehensive lab animal monitoring system (CLAMS) for 4 days. Food and water intake of each rats was recorded in real time.
4.2.4 Vascular Myograph:
mutant After 6 weeks on HS diet, SS and Resp18 rats were euthanized by the CO2 inhalation method. The second and third-order mesenteric arteries were dissected and placed in cold Krebs-Henseleit solution (KHS). Segments, 2 mm in length, were mounted in wire myograph chambers (Danish Myo Tech, model 610M; JP-Trading I/S). For isometric tension recording, two steel wires were introduced through the lumen of the mounted arteries. The arteries were allowed to equilibrate in KHS, pH 7.4 for 15 min. The arterial diameters were determined after stretching to their optimal lumen diameter, based on the internal circumference/wall tension. The vessels were then washed again with KHS and allowed to equilibrate for 20 min. The concentration-response curve was first measured for acetylcholine (ACh) (10-9 M to 10-4.5M). Thereafter, the arteries were washed and
68 allowed to equilibrate in KHS solution for 20 min, before the concentration-response curve for sodium nitroprusside (SNP) (10-9 M to 10-4.5M) was assessed.
4.2.5 Glomerular Filtration Rate in Conscious Rats:
Glomerular filtration rate (GFR) was measured in SS and Resp18mutant rats via the transcutaneous clearance of fluorescein-isothiocyanate (FITC)-sinistrin using a NIC-
Kidney device (Mannheim Pharma & Diagnostics GmbH, Mannheim, Germany) as described in (215-217). In brief, SS and Resp18mutant rats were anesthetized for ~10 min
(2% v/v isoflurane). Meanwhile, the device was turned on via connecting to a rechargeable lithium battery and then attached to the back of the rat using a double-sided adhesive tape and the device protected with one layer of adhesive gauze tape. After recording the baseline period for ~2-5-min, FITC-sinistrin (5 mg/100 g dissolved in physiological saline solution) was administered into rats via the tail vein injection. Following FITC–sinistrin administration, each rat was placed into an individual cage to minimize the risk of probe dislodgement. After 2 h recording period, the device was carefully removed, and the data analyzed using NIC-Kidney device partner software (MPDlab v1.0, Mannheim Pharma &
Diagnostics, GmbH). All rats had access to food and water except during the 2 h GFR measurement period.
4.2.6 Immunohistochemistry of the Kidneys:
Kidneys were dissected from 12-week-old SS, and Resp18mutant rats maintained on a 2.0% NaCl diet starting from 6 weeks of age. Dissected kidneys were fixed in 10% formalin and embedded in paraffin. Slides were deparaffinized in xylene washes and
69 rehydrated with graded series of ethanol. Sections were then incubated in PBS with 3%
H2O2 for 10 mins to inactivate endogenous peroxidase. Slides were washed 5 mins in PBST
(PBS + 1% Tween 20) and blocked with 3% bovine serum albumin in PBST (blocking buffer) for 2 h at 4°C. Rabbit anti-CD68 (1:100; Santa Cruz; sc-70760; ) was diluted in blocking buffer and incubated at 4°C overnight. Slides were washed three times for 30 mins in PBST and Biotinylated goat anti-rabbit secondary antibody (1:500, Abcam; ab64256) was used for development with avidin-biotinylated HRP complex (Vectastain
ABC Elite kit; PK-6100; Vector Laboratories) followed by counterstaining with hematoxylin and mounted for image capture. For no primary antibody control the tissues were incubated with blocking buffer, without primary antibody. Once processed and prepared for imaging, kidney slides were viewed, and images captured with Nikon Ni-E
Motorized Upright microscope equipped with DS-QiMc camera and NIS-Element software. Twenty fields (each field equal to 0.56 mm2) were randomly selected for each renal cortex and outer medulla. The numbers of immuno-labeled cells were counted manually or by an automated counting method.
4.2.7 Measurement of Dopamine:
Urinary dopamine levels were measured by the Neurochemistry Core Laboratory at Vanderbilt University’s Center for Molecular Neuroscience Research. Dopamine concentrations in the renal cortex and cell culture medium were detected using HPLC-EC system as described in (218, 219). In brief, perchloric acid (HClO4) (0.25N) was used for lysis and sonication of renal cortex samples. Subsequently, the samples were centrifuged at 14000 × g for 20 min at 4°C. The supernatants were collected and filtered through a 0.22
70 μm filter, and the pellets were saved for protein quantification assay. The filtered samples were then injected onto a C18 column (3.2 × 150 mm, 3μm particle size, Thermo
Scientific). Reagents (54.3 mM sodium phosphate, 0.215 mM octyl sodium sulphate, 0.32 mM citric acid, and 11% methanol (pH~ 4.4)) were mixed to prepare the mobile phase. For the detection of dopamine, the CoulArray coulometric detector (model 5600A, ESA, Inc.) was used, and the dopamine peaks were shown on the chromatograms of the CoulArray software. The external dopamine standard was used to determine the area under the curve of standard peaks using different concentrations. This represents the standard calibration curve. According to the established standard curve, the levels of the dopamine in the renal cortex of both groups were measured. Protein quantification assay was performed to normalize the dopamine level in the renal cortex to the relative amount of protein in each sample.
4.2.8 Immunoblotting:
At 12 weeks of age, after 6 weeks on HS diet, the SS and Resp18mutant rats were euthanized, and the kidneys immediately snap-frozen. Total protein from the kidney was isolated using TPER reagent (Thermofisher, USA), containing protease and phosphatase inhibitor cocktail (Pierce, USA). Protein concentrations in the lysates were measured using the BCA colorimetric method (Thermo Fisher, USA). From each sample, 40 μg of protein were used for western blot analysis. The following primary antibodies were used: D1R
(EMD Millipore, #MAB5290), D5R (EMD Millipore, #MAB5292), and GAPDH (Cell
Signaling Technology, #14C10).
71 4.2.9 Sodium Measurement:
At 12 weeks of age, after 6 weeks on HS diet, the SS and Resp18mutant rats were placed individually in metabolic cages, for 24 h urine collection (109). The rats were provided free access to drinking water. Sodium was measured using the diazyme sodium enzymatic assay (DZ114b-K), per manufacturer’s instructions.
4.2.10 Isolation and Primary Culture of Renal Proximal Tubule (RPT)
Cells:
RPTs were isolated from cortical slices obtained from SS and Resp18mutant rats and placed in primary cultures (220, 221).
4.2.11 Dopamine Release Assay:
Dopamine released from primary cultures of RPT cells isolated from SS and
Resp18mutant rat was assayed as reported (222). In brief, RPT cell monolayers, seeded into six-well plates, were washed and pre-incubated with and without reserpine, for 20 mins at
37°C before L-Dopa was added into the wells. The monoamine oxidase inhibitor pargyline
(10µM) and the catechol-O-methyltransferase inhibitor tolcapone (1µM) were added into the cell culture dish 20 mins before the experiment to preserve dopamine from enzymatic degradation. After 20 min incubation, the RPT cells were incubated with L-DOPA (75 µM) in HBSS buffer for 2 h at 37°C; the concentration of dopamine in the incubation media reaches the maximum with 75 M L-DOPA (222). The medium was collected to measure dopamine at 0, 30, 60- and 120-mins time intervals. The inhibitors were present during the entire period of time. 25µl of 0.25N HClO4 were added to 1ml of cell supernatant and
72 stored at -80°C. The amount of dopamine in the cell supernatants was measured by HPLC, as described in (222, 223).
4.2.12 Total RNA Isolation and qPCR Analysis:
Total RNA was isolated from RPT cells isolated from SS and Resp18mutant rat kidneys using Trizol Reagent (Invitrogen) according to the manufacturer’s protocol. The purity and concentration of the RNA were determined by NanoDropOone (Thermofisher).
1µg of DNase-treated total RNA was used for first-strand complementary DNA synthesis using M-MLV reverse transcriptase (Promega) as per the vendor’s protocol. Quantitative
PCR was performed in the Quantstudio 5 Real-Time PCR machine (Life technologies) using Power SYBR Green PCR master mix (Invitrogen) and gene-specific primers for
Resp18 (Resp18-RT-F; ATCCAGCGAAGATGCAGAGT, Resp-18-RT-R;
ACCATCGTGGGCATTTATGT). The gene expression data were normalized to Gapdh
(Gapdh-RT-F; CAAGATGGTGAAGGTCCGTGTG, and Gapdh-RT-R;
AGAGCCTGTGTCCATACTTTG). Gene expressions were calculated by the delta-delta
Ct method; data were expressed as fold change relative to SS rats (109).
4.2.13 Statistical Analysis:
Data are presented as mean ± standard error mean (SEM). Significant differences between groups were analyzed by unpaired t-test. P-value of <0.05 was used as a threshold for statistical significance.
73 4.3 Results
mutant 4.3.1 Resp18 Rats Have Vascular Dysfunction and Reduced GFR:
To determine whether the increase in BP observed in Resp18mutant rats was associated with vascular dysfunction, vasoreactivity was measured in second-/third-order mesenteric arteries dissected from the SS and Resp18mutant rats mounted on vascular bath, as described (52). Endothelium-dependent vasorelaxation to acetylcholine (ACh) was assessed by adding increasing concentrations of ACh (10-9 M to 10-4.5M) to the vessel preparation. ACh-induced vasorelaxation was significantly decreased in Resp18mutant rats compared with SS rats (Fig. 4 – 1A). Endothelium-independent vasorelaxation to sodium nitroprusside (SNP) was assessed by adding increasing concentrations of SNP (10-9 M to
10-4.5M) to the vessel preparation. Similar to the ACh studies, endothelium-independent vasorelaxation induced by SNP was decreased in Resp18mutant rats compared with SS rats
(Fig. 4 – 1B). Next, we tested the effect of the HS diet on GFR in SS and Resp18mutant rats.
Consistent with dietary salt causing increased vascular resistance, poor myogenic response, and impaired vascular relaxation, there may be changes in renal hemodynamics and GFR in salt-sensitive hypertension (224, 225). In the current study, we observed a decreased
GFR in Resp18mutant rats (0.655 ml/min/100g B.W ± 0.0503) as compared with SS rats (1.31
/min/100g B.W ± 0.0898) (Fig 4 – 2).
74 4.3.2 Resp18mutant Rats Have Alteration in the Pressure Natriuresis
Response:
Resp18mutant rats had an increase in relative kidney weight (Fig. 4 – 3A), without any significant differences in food intake, water intake, and body weight, in response to
HS diet (Fig 4 – 3B-D). The kidney plays a pivotal role in the long-term regulation of BP, in part, by the pressure-natriuresis (PN) mechanism that connects renal perfusion pressure to the excretion of sodium and water (226). Consistent with this mechanism, we detected a right and downward shift in the relationship between BP and sodium excretion in response to HS in Resp18mutant rats, indicating impaired PN response in these mutant rats
(Fig. 4 – 3E). These data show that the disruption of the Resp18 gene causes dysregulation of the PN response to HS diet.
4.3.3 Resp18mutant Rats Have an Increase in Renal Macrophage
Infiltration:
As we have previously shown, the Resp18mutant rats, on high salt diet, had an increase in renal fibrosis (109). Monocytes/macrophages are involved in the pathogenesis of both experimental and human renal diseases and implicated in the induction of injury and fibrosis (227, 228). In addition, macrophage cell infiltration mediates local injury during the progression of chronic kidney disease (CKD). Consistent with these reports, immunohistochemical analysis showed an increase in CD68+ positive macrophage infiltration in the cortex and outer medulla of Resp18mutant rat kidneys compared with SS rat kidneys (Fig 4 – 4A & B).
75 4.3.4 Dysregulation of Renal Dopaminergic System is Present in
Resp18mutant Rats:
With the reported high expression of Resp18 in RPT cells, the site of dopamine production in the kidney, and with Resp18 gene expression regulated by dopaminergic drugs, it is plausible that targeted disruption of Resp18 interrupts the renal dopaminergic system (105). To test this hypothesis, we measured intrarenal and urinary dopamine levels in HS diet-fed SS and Resp18mutant rats. Following 6 weeks of HS diet, dopamine levels in the cortical slices of Resp18mutant rat kidneys were reduced (Fig 4 – 5A), but urinary dopamine levels were increased in Resp18mutant compared with SS rats (Fig. 4 – 5B). The increase in urinary dopamine observed in HS-fed Resp18mutant rats implies induction of dopamine synthesis within the kidney in response to high sodium intake. Renal endogenous dopamine acts as a natriuretic hormone.
Dopamine exerts its anti-hypertensive effects, in part by occupation of D1-like dopamine receptors, such as D1R and D5R. In the current study, we have observed a
mutant significant downregulation of both the D1R and D5R protein in Resp18 rat kidneys
(Fig. 4 – 6). Downregulation of these receptors provided impetus to speculate that
mutant dopamine is unable to exert its action in the Resp18 rats due to the lack of D1-like receptor availability. The increase in renal dopamine release may be a compensatory mechanism. To test this hypothesis, we measured dopamine released in the medium of primary cultures of RPT cells obtained from kidney cortical slices. We also measured
Resp18 gene expression in RPT cells, along with dopamine measurements in the incubation media of the RPT cells. At the basal level, Resp18 expression was significantly downregulated in RPT cells isolated from Resp18mutant compared with SS rats (Fig. 4 –
76 7A). L-DOPA increased Resp18 gene expression reaching a peak at 30 min of treatment
(Figs. 4 – 7B & C) and decreasing to the basal level at 60-120 min in SS rat RPT cells
(Fig. 4 – 7B). By contrast, Resp18 expression remains high at 30 to 120 min in RPT cells from Resp18mutant rats (Fig. 4 – 7C). Moreover, we observed a steady-state increase in dopamine release into the incubation media in both SS and Resp18mutant rat RPT cells (Fig.
4 – 7D-G). However, the amount of dopamine released into the incubation media was higher in RPT cells from Resp18mutant rats than those from SS rats.
4.4 Discussion
We have shown previously that Resp18mutant rats maintained on HS diet for 6 weeks demonstrated a hypertensive phenotype with increased renal fibrosis and UPE (109). The current studies demonstrated that these mutant rats have increased vascular resistance, as shown by reduced response to vasodilating agents, such as ACh and SNP. We also observed a shift in PN curve down to the right in Resp18mutant rats, indicating that these rats excrete less sodium even at higher BP; Resp18mutant rats have a PN defect. However, time- course measurements of renal sodium handling could provide additional insights on the rats’ PN response that were potentially missed by our end-point measurement. Nonetheless, the current studies also show that Resp18mutant rats have a reduction in GFR and an increase in macrophage infiltration in the kidneys. Furthermore, we also observed a decrease in renal dopamine levels and an increase in urinary dopamine excretion in Resp18mutant rats.
These occurred with a significant reduction of both D1R and D5R protein levels in these mutant rats. Dopamine release assays in primary cultures of RPT cells revealed dysregulated dopamine production in Resp18mutant rats. Together, our results suggest that
77 mutant in Resp18 rat kidney, D1-like receptors are dysregulated, as evidenced by the decreased renal D1R and D5R expression and decreased renal sodium excretion, but increased dopamine release from the kidney. Although, D1-like receptor responses were not studied, overall, our study supports the hypothesis that targeted disruption of Resp18 gene leads to a rise in BP, due in part to a decrease in GFR and natriuretic function, involving dysregulation of the renal dopaminergic system to a greater extent than that observed in the SS genetic background (229). PN is the increase in sodium excretion as a consequence of the increase in BP and renal perfusion pressure (230). An impairment in the PN response can lead to hypertension by the defective relationship between renal perfusion pressure and sodium excretion (230). In our study, we detected an impairment in the PN response in
Resp18mutant rats as demonstrated by a significant increase in BP and lower sodium excretion when compared with SS controls. The GFR was significantly lower in
Resp18mutant than SS rats on the HS diet. The decline in GFR could lead to CKD (231).
The slopes of the PN response in S/Jr strain and R/Jr rats are similar but that of the former is shifted to the right of the latter exposure to a high-salt diet. This resetting is not related to renal cortical and papillary blood flow or renal interstitial pressure but rather due to increased renal tubular sodium transport (232). In the current study, we observed a shift to the right in PN response in Resp18mutant rats which was associated with impaired vasorelaxation response to Ach and SNP. It is possible that decrease in GFR observed in the Resp18mutant rats could be due to impaired myogenic response leading to vasoconstriction of afferent arterioles, which may protect the kidney from hydrostatic pressure damage (233, 234). The increase in perfusion pressure and impaired renal myogenic response in Resp18mutant rats could have led to renal injury. The increase in
78 perfusion pressure and impaired renal myogenic response in Resp18mutant rats could have led to renal injury as evidenced by the increase in renal fibrosis, UPE, and macrophage infiltration (109, 234-236). The renal inflammation in SS rats, however, may be independent of the increase in blood pressure (237). Taken together, our findings suggest that Resp18 gene is critical in maintaining a proper kidney function and BP homeostasis in an SS rat model for hypertension.
Resp18 is expressed in RPT cells, where L-DOPA is converted into dopamine independent of the nervous system (110, 211, 238, 239). Indeed, Resp18 gene expression is found to be modulated by dopaminergic agents; the D2-like receptor agonist bromocriptine decreases Resp18 mRNA levels, whereas the D2-like receptor antagonist haloperidol increases Resp18 mRNA levels (117). In the current study, we found that the dopamine levels in renal cortical slices of Resp18mutant were significantly low compared to
SS rats. However, the urinary levels of dopamine were found to be higher in Resp18mutant than SS rats, indicating an increase in the secretion of dopamine into the tubular lumen. In normotensive humans and rodents that renal dopamine production is increased in response to HS diet (102, 240-242). Dahl SS rats may actually have a decrease urinary dopamine production with salt loading (242). Dopamine in the kidney plays a significant role in regulating the extracellular fluid volume and sodium excretion (94, 102, 210, 211, 240,
243). Dopamine decreases renal tubular sodium by inhibiting sodium cotransporters, ion channels, sodium pump, and sodium exchangers, such as NHE3 in RPT cells. Dopamine’s antihypertensive effects are carried out through the stimulation of the five dopamine receptor subtypes, including D1R and D5R (94, 102, 210, 211, 240, 243). In the present
mutant study, we found that both D1R and D5R expressions were downregulated in Resp18
79 rat kidneys. D1R and D5R are expressed in almost all segments of the nephron, including the proximal tubule as well as in the tunica media of the arterioles (94, 102, 210, 211, 240,
243). Disruption of Drd5 gene in mice causes hypertension that is aggravated by an increase in salt intake. More interestingly, these Drd5-/- mice also exhibit a rightward shift in the PN response similar to that observed in Resp18mutant rats (244). Additionally, the downregulation of Drd1 has been shown to dysregulate renal function, thus playing a vital role in the pathogenesis of hypertension (245, 246). The inflammation in Resp18mutant rat kidneys may also be related to dopamine receptor dysfunction.
Our dopamine release assay demonstrated an increase in dopamine secretion into the medium of primary culture of RPT cells isolated from Resp18mutant as compared with
SS rats. However, unlike SS RPT cells, the expression of Resp18 remains upregulated 120 min after L-DOPA treatment. By contrast, the Resp18 expression in SS RPT cells peaked at 30 min and fell 60 to 120 min post-treatment. This shows a tight negative feedback between Resp18 gene expression and dopamine production in RPT cells. Our findings are also in alignment with the published results reported that the Resp18 gene expression is negatively regulated by the dopamine agonist and positively regulated by a dopamine antagonist (105). It is well-established that a correlation exists between dietary intake of sodium and renal dopamine production/excretion in both humans and laboratory animals
(94, 211, 222, 229, 238, 247). There was persistent and greater increase in dopamine production in RPT cells from Resp18mutant rats than SS rats. The increased RPT cell dopamine production in Resp18mutant rats is reflected by the increase in urinary dopamine.
Nevertheless, the natriuresis with salt loading in less in Resp18mutant than SS rats suggesting an impaired function of renal dopamine receptors. Therefore, the hypertensive phenotype
80 observed in Resp18mutant rats may be caused by dysregulated renal dopaminergic system.
Further studies will be required to extend our current understanding of the role of this novel endocrine protein Resp18 in renal dopaminergic receptor function and signaling.
4.5 Conclusion
Overall, we have highlighted the physiological relevance of Resp18 in BP homeostasis and renal function using a novel global Resp18mutant rat model maintained on a HS diet. The current study showed that HS diet caused an increase vascular resistance, decrease in GFR, and a right-shift in the PN curve in Resp18mutant rats, relative to SS controls. More importantly, we found that the renal dopaminergic system is dysregulated in Resp18mutant rats which is a previously unrecognized physiological role of Resp18, an emerging endocrine protein, in BP homeostasis and renal function.
81
Figure 4 – 1: Resp18mutant Rats Have Vascular Dysfunction After 6-week Exposure to
HS Diet: (A) Concentration-response curve to acetylcholine (ACh) and (B) sodium nitroprusside (SNP) in mesenteric arteries isolated from SS and Resp18mutant rats (n=4-
6/group). Values are mean ± SEM. *P<0.05 vs Resp18mutant, unpaired t-test.
82
Figure 4 – 2: Resp18mutant Have Decreased GFR: SS and Resp18mutant rats were injected with FITC-sinistrin. The clearance of FITC-sinistrin was measured via the fluorescence detector NIC-kidney device placed on the animal’s back (n =8). Data are mean ± SEM.;
**p<0.01, unpaired t-test.
83
Figure 4 – 3: Resp18mutant Rat’s Pressure Natriuresis is Shifted Down and to the Right;
Relative Kidney Weight is Increased in Resp18mutant Rats: (A) Relative kidney (kidney weight/body weight) (n=9-11), (B) food, and (C) water intake were measured (n=4), (D) bodyweight (n=9-11), was measured in both SS and Resp18mutant rats 6 weeks after HS diet. (E) Relationship between blood pressure and sodium excretion after 6 weeks on HS diet. Data are mean ± SEM. **P<0.01, unpaired t-test.
84
Figure 4 – 4: Resp18mutant rats Have Increased Renal Macrophage Infiltration:
Representative images of renal sections probed with CD68 antibody (A) kidney cortex (B) kidney outer medulla (n=4). Graphs represent the quantification of percent of area with
CD68+ macrophage infiltration. Data are mean ± SEM. *P<0.05, **P<0.01, unpaired t-test.
85
Figure 4 – 5: Resp18mutant rats Have Increased Urinary Dopamine: After 6-weeks exposure to HS diet, the intra renal dopamine concentration was measured (n = 5/group)
(A) and the urine (n = 7-8/group) (B) of SS and Resp18mutant rats. Data are mean ± SEM.
*P<0.05, unpaired t-test.
86
mutant Figure 4 – 6: Resp18 Rats Have Decreased Renal D1-like Receptor Protein
Expression: SS and Resp18mutant rats were maintained on an HS diet for 6 weeks, then rat kidneys were harvested. Kidney protein lysates were immunoblotted for (A) D1R and (B)
D5R and quantified by densitometry analysis using Image-J program (n=6). Data are mean
± SEM. **P<0.01, ***P<0.001, unpaired t-test.
87 Figure 4 – 7: RPT Cells Isolated from the Resp18mutant Rats Have Increased Dopamine
Production: (A) Resp18 mRNA expression levels in RPT cells from SS and Resp18mutant rats (n = 4). (B) Resp18 mRNA expression levels were measured in primary RPT cells treated with L-DOPA (75 M) in the presence of monoamine oxidase inhibitor pargyline
(10 µM) and the catechol-O-methyltransferase inhibitor tolcapone (1 µM). (B) SS rats (n=4 in triplicates) and (C) Resp18mutant rats Dopamine levels were measured in RPT cells from
SS and Resp18mutant rats before (D) and after the L-DOPA treatment (E) 30 min (n=9), (F)
60 min (n=9), and (G) 120 min (n=9). Data are mean ± SEM. *P<0.05, ***P<0.001, unpaired t-test.
88
Chapter 5
Targeted Disruption of Coup-TFII Leads to Decrease in Renal
Fibrosis by Increasing SMAD7 Levels.
5.1 Introduction: Hypertension, also known as high blood pressure (BP), is a complex polygenic trait that is influenced by multiple genetic and environmental factors (22, 52, 109, 248-251).
Environmental factors such as excess salt intake in modern diets, smoking, and sedentary lifestyles are known to increase the risk of developing hypertension and chronic kidney disease (CKD) (22, 252, 253). While genetic factors play a role in the development of hypertension, the identity, number, and magnitude of their effect remain largely unknown.
Furthermore, hypertensive individuals also develop CKD, and it currently encompasses about 15% of the US population (1). Through familial and twin studies, it has been found that CKD and BP can be attributed to the interactions made between complex genetic factors and the environment (7). Therefore, it is crucial to understand the genetic component of CKD and BP regulation in order to create new therapeutic approaches.
89 Genome-wide association study (GWAS) have greatly expanded our understanding of the genetic architecture of complex traits, including hypertension and CKD (254). In one such GWAS conducted by the Wellcome Trust Case Control Consortium (WTCCC) reported a suggestive association on human chromosome 15 (15q26.2) with hypertension
(34). Further haplotype analysis revealed that the same locus is significantly associated with hypertension, and this region contains one protein-coding gene, named COUP-TFII
(9). COUP-TFII is a transcriptional regulator that plays many essential roles starting from embryonic development to an indispensable role in various physiological processes and cellular signaling events (51). Moreover, substitution mapping studies in rats and linkage studies in humans have prioritized COUP-TFII as a candidate gene for BP (49, 255-259).
To validate the candidacy of Coup-TFII in BP regulation, we applied Zinc-finger nuclease
(ZFN) technology to develop a novel mutant rat model for Coup-TFII in Dahl Salt
Sensitive (SS) rat genetic background (52). Custom pairs of ZFN were designed to target the hinge region of the Coup-TFII gene (exon 3) in SS rats, which resulted in a 15bp deletion that caused the loss of 5 amino acids (159-163aa) in COUP-TFII protein (52). The hinge region was selected for targeted disruption due to a decreased chance for embryonic lethality compared to other regions, such as the DNA binding domain (DBD) or Ligand binding domain (LBD) (51, 52). When provided an HS diet (2% NaCl) for 6 weeks, the
Coup-TFIImutant rats exhibited a lower systolic and diastolic BP compared to SS rats (52).
Also, the Coup-TFIImutant rats exhibited a superior vascular & renal protective phenotype by displaying a decrease in vascular resistance and a decrease in total urinary protein excretion (52).
90 Renal fibrosis is a common pathological hallmark of CKD and is characterized by excessive deposition of extracellular matrix in the kidney (260). If left untreated, renal fibrosis can lead to progressive renal dysfunction and may lead to end-stage renal disease
(261). Transforming growth factor-β (TGF-β) is well known for its role in mediating renal fibrosis in various models of hypertension (209, 262, 263). TGF-β mediated fibrotic signaling is carried out by the SMAD family proteins (261). SMAD proteins involved in the fibrosis signaling cascade are divided into two groups, pro-fibrotic R-SMADs (SMAD2 and SMAD3) and anti-fibrotic I-SMAD (SMAD7), which suppress the activity of R-
SMADS (261). Co-SMAD (SMAD4) plays a critical role in the nucleocytoplasmic shuttling of pSMAD2 and pSMAD3. Translocation of this SMAD complex into the nucleus, promote the transcription of pro-fibrotic gene expressions, such as Collagen- type 1 and 3 (Col1A1 and Col3A1) (261). Furthermore, COUP-TFII is known to be involved in the TGF-β signaling pathway during the development of breast cancer (264,
265). However, the role of COUP-TFII has been controversial; COUP-TFII inhibits the
TGF-β pathway by interacting with SMAD4, but on the other hand, others have shown that
COUP-TFII promotes TGF-β signaling by inhibiting SMAD7 (260, 265, 266). However, the involvement of COUP-TFII in TGF-β signaling cascade in the development of renal fibrosis is not known. With this background, we pursued our study to understand the mechanistic link between COUP-TFII and TGF-β mediated SMAD signaling in the progression of renal fibrosis.
91 5.2 Materials and Methods
5.2.1 Animals:
All animals were kept on a 12:12-h light-dark cycle in a climate-controlled room.
Rat chow and water were provided ad libitum. The study protocol was approved by the
Institutional Animal Care and Use Committee of the University of Toledo in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and followed ARRIVE guidelines. Male Dahl Salt-Sensitive/Mcw (SS) and Coup-
TFIImutant rats were concomitantly bred and raised on a low salt diet (0.3% NaCl; Harlan
Teklad diet 7034) until 40 days of age. After 40 days of age, these animals were switched to high salt (HS) (2% NaCl; Harlan Teklad diet 94217) and animals remained maintained on HS diet for 6 weeks until the end of the study. The rats were euthanized after 6-week exposure to a HS diet and kidneys were removed and stored for further analysis.
5.2.2 Generation of Coup-TFIImutant Rats:
Coup-TFIImutant rats were generated in the SS rat genetic background using ZFN mediated targeted disruption of Coup-TFII gene locus as previously described (52).
5.2.3 Glomerular Filtration Rate in Conscious Rats:
Glomerular filtration rate (GFR) was measured in SS and Coup-TFIImutant rats via the transcutaneous clearance of fluorescein-isothiocyanate (FITC)-Sinistrin using a NIC- kidney device (Mannheim Pharma & Diagnostics GmbH, Mannheim, Germany) as described in (215-217). In brief, SS and Coup-TFIImutant rats were anesthetized using
92 isoflurane for ~2-5 min. Meanwhile, the device was turned on via connecting to a rechargeable lithium battery and then attached to the back of the rat using double-sided adhesive tape. The device was protected with one layer of adhesive gauze tape. After recording the baseline period for ~2-5-min, FITC-sinistrin (5 mg/100 g of B.W.), dissolved in physiological saline) was administered into rats via the tail vein injection. Following
FITC-sinistrin administration, each rat was then placed into an individual cage to prevent the dislodgement of the probe. After a 2 h recording period, the device was carefully removed from the rat and the data was analyzed using NIC-kidney device software
(MPDlab v1.0, Mannheim Pharma & Diagnostics, GmbH) the T ½ FITC-sinistrin was calculated. Then using equation 1 GFR was calculated using the T ½ FITC-sinistrin. All rats had access to food and water except during the 2 h GFR measurement period.
5.2.4 Total RNA Isolation and qPCR Analysis:
Total RNA was isolated from SS and Coup-TFIImutant rat kidneys using TRIzol
Reagent (Invitrogen, USA) and purified using the Pure-link RNA isolation kit (Invitrogen,
USA). The purity and concentration of the RNA were determined by NanoDrop one
(Thermofisher, USA). Five-micrograms of DNase-treated total RNA was used for the first- strand cDNA synthesis using M-MLV reverse transcriptase (Promega, USA). Quantitative
PCR was performed in the Quantstudio5 Real-Time PCR instrument (Life technologies) using Power UP SYBR Green PCR master mix (Invitrogen, USA) using gene-specific
93 primer pairs (Table 5 – 1). Gene expressions were normalized with Gapdh, and the changes in gene expressions were calculated by the ΔΔCt method; data are expressed as fold change relative to control.
5.2.5 Western Blotting:
Total protein from SS and Coup-TFIImutant rat kidneys were isolated using TPER reagent (Thermofisher, USA), containing protease and phosphatase inhibitor cocktail
(Pierce, USA). Protein concentration in the lysates was measured using BCA kit (Thermo
Fisher, USA). From each sample 40μg, of protein was used for western blot. The following primary antibodies were used in western blot analyses: pSMAD3 (Thermofisher, #44-
246G), pSMAD2 (Cell Signaling Technology, #3101), total SMAD2/3 (BD Transduction
Laboratories, #610842), SMAD7 (Millipore, #ST1625) & COL3A1 (Genetex,
GTX26308), GAPDH (Cell Signaling Technology, #14C10) and β-Actin (Cell Signaling
Technology, #4970).
5.2.6 Renal Histology:
The percent of renal fibrosis was evaluated by Masson’s trichrome staining, as previously described (109). In brief, SS and Coup-TFIImutant rat kidneys were harvested after 6 weeks exposure to HS diet, and the samples were preserved in 10% buffered formalin and then embedded in paraffin. Five micrometer thick sections were then stained with Masson’s trichrome stain and the macrophage infiltration was examined by immunohistochemistry. In brief, paraffin-embedded kidney sections were de-paraffinized, and antigen retrieval was carried out in citrate buffer. Slides where blocked with 10%
94 serum for 2 h and incubated with anti-rat CD68 (Bio-Rad # MCA341R, 1:200 dilution).
CD68+ cells were detected using Vectastain Elite ABC kit and peroxidase substrate kit
(Vector Laboratories Inc). The images were visualized, captured, and analyzed using
VS120 Virtual Slide Microscope (Olympus). Images were then analyzed using the Leica
X application.
5.2.7 Statistical Analysis:
Data are presented as mean ± standard error mean (SEM). Data were analyzed by unpaired t-test and, P-value of <0.05 was used as a threshold for statistical significance.
Figures were generated with GraphPad Prism software (version 7; GraphPad Software Inc.,
La Jolla, CA).
5.3 Results:
5.3.1 Coup-TFIImutant Rats Maintained on High Salt Diet Have Renal
Protective Phenotype:
Previously, we have shown that Coup-TFIImutant rats have less proteinuria while maintaining a lower BP on a diet consisting of 2% high salt (HS) for 6 weeks (52). This led us to believe that targeted disruption of Coup-TFII could lead to a renal protective phenotype under an HS loading. Glomerular filtration rate (GFR) allows us to measure kidney function and assess the stage of kidney disease (267). To measure the kidney function, we used a transcutaneous GFR monitor and directly measured the clearance of the FITC-sinistrin bolus. The FITC-sinistrin bolus was delivered at 5mg/100g B.W, via tail vein injection. Transdermal measurements of FITC-sinistrin clearance have shown to
95 provide a more sensitive and accurate measurement of renal function compared to traditional parameters such as serum creatinine and blood urea nitrogen (BUN) (268, 269).
Indeed we observed a similar trend with the SS rats maintained on a 2% HS diet for 6 weeks in which we observed a GFR value of (0.9633ml/min/100g B.W ± 0.0479) as compared to the Coup-TFIImutant rats which had a GFR of (1.77 ml/min/100g B.W ± 0.0975)
(Fig 5 – 1). Therefore, a superior GFR after 6 weeks of HS diet loading suggests that targeted disruption of Coup-TFII leads to a superior kidney function despite the excess salt loading.
5.3.2 Coup-TFIImutant Rat Have Less Fibrosis and Macrophage
Infiltration in the Kidney:
Furthermore, we performed Masson’s trichrome staining in kidney sections to assess the level of renal fibrosis. We found that Coup-TFIImutant rats had less renal fibrosis compared to the SS rats (Fig 5 – 2A). In addition, several lines of experimental evidence demonstrated macrophage cell infiltration mediates local injury during the progression of
CKD (248, 270, 271). Therefore, we measured the infiltration of macrophages by checking
CD68+ positive cells by immunohistochemistry. We observed a significant decrease in
CD68+ positive macrophage infiltration staining in the Coup-TFIImutant rat kidneys (Fig 5
– 2B).
96 5.3.3 Targeted Disruption of Coup-TFII Increases SMAD7 Expression:
We studied the downstream signaling effect of TGF-β by studying the SMAD signaling pathway. In our study, we found a significant downregulation of R-Smad, Smad3
(Fig 5 – 3B) and Co-Smad, Smad4 (Fig 5 – 3C) gene expressions in the Coup-TFIImutant rat kidneys. This was also evident by a significant downregulation of pSMAD3 protein levels in the Coup-TFIImutant rat’s kidneys (Figure 5 – 4B). pSMAD3, with the help of SMAD4, initiate transcription of pro-fibrotic proteins such as Col1A1 and Col3A1. Furthermore, we found a significant downregulation of Col3A1 levels (Fig 5 – 4D) in the Coup-TFIImutant rat kidneys. Interestilngly, we observed a significant increase in the SMAD7 levels in the
Coup-TFIImutant rat kidneys both at the transcript (Fig 5 – 3D) and protein level (Fig 5 –
4C). Smad7 is known to suppress the levels of R-Smads, such as Smad3, therefore, inhibiting the signaling propagation of TGF-β (261). However, Smad7 has also been found to inhibit R-Smads and preventing the activation of R-Smads (261).
5.4 Discussion
COUP-TFII is a transcriptional regulator and known to be involved in numerous diseases (51, 52, 272, 273). Despite its linkage with hypertension, the molecular mechanism in renal disease remains unknown (52). Previously, we have shown that a ZFN mediated targeted disruption of Coup-TFII locus in SS rats (Coup-TFIImutant) lowers BP on an HS diet treatment (52). The Coup-TFIImutant rats also demonstrated an improved cardiac function as evidenced by superior left ventricular function and a decrease in proteinuria compared with SS rats (52). Kidney plays an inevitable role in water and electrolyte balance and BP regulation. In the present study, we investigated the role of Coup-TFII in
97 the progression of renal fibrosis during increase in dietary salt intake. Upon exposure to
HS diet for 6 weeks, Coup-TFIImutant rat have less renal fibrosis compared with SS rats. In addition, the Coup-TFIImutant rats have increased GFR, exhibiting a superior kidney function, as compared to the SS rats.
CKD patients often see an increase in renal fibrosis and a decline in GFR (274). A hierarchy of pro-fibrotic factors exist, one of them being TGF-β. Diets rich in salt have shown to increase the levels of TGF-β (209, 275). Therefore, we measured the downstream
SMAD signaling and saw that targeted disruption of Coup-TFII lead to a decrease in pSMAD3 levels. SMAD7 is an I-SMAD and well-known for its role in inhibiting SMAD3
(276, 277). Therefore, an increase in SMAD7 could lead to a reduction in SMAD3 levels and reduction in SMAD3 phosphorylation by downregulation of the TβRI. However, TβRI can phosphorylate both SMAD2 and SMAD3, yet we do not see any differential expression of pSMAD2. Although SMAD2 and SMAD3 share 90% sequence homology, SMAD3 has a more pronounced role in renal fibrosis (278). SMAD3 forms a complex with SMAD4 and can translocate into the nuclease and regulate the transcription of fibrotic proteins such as Col1a1 and Col3a1. The Coup-TFIImutant rat showed downregulation of Smad4 mRNA in addition to the downregulation of downstream pro-fibrotic protein Col3a1. We believe that this downregulation of Col3a1 is ultimately leading to a decrease in renal fibrosis and superior kidney function compared to the SS rats on an HS diet.
Coup-TFII role with TGF-β and SMAD7 has remained controversial. TGF-β has been identified as a major inducer of the epithelial-mesenchymal transition (EMT) during cancer progression along with its role in fibrosis (260). Studies have shown that COUP-
TFII can inhibit TGF-β or TβRI and could reduce the metastasis potential of cancer by
98 blocking EMT pathways in breast cancer (279). However, other studies have shown that
COUP-TFII inhibits Smad7 expression and promotes TGF-β mediated EMT signaling in colorectal cancer cells (CRC) via transactivation of miR-21 (260). Inhibition of miR21 has been known to increase SMAD7 levels and inhibits renal fibrosis in mice (278). Besides,
Smad7-/- mice show increased levels of SMAD3 in their kidneys and develop severe renal fibrosis (278). Furthermore, SMAD3 promotes the expression of E3 ligases, such as
Smurf2 and Arkidia, which can bind and degrade SMAD7 (261). SMAD3 can directly regulate the level of collagen and, therefore, the level of renal fibrosis. Based on our findings, we believe that targeted disruption of Coup-TFII in SS rats protects the kidney from salt induced renal fibrosis, via upregulation of SMAD7 levels (Fig 5 – 6). However, further studies were required to understand the molecular mechanisms of Coup-TFII involvement in regulating SMAD proteins in the context of renal fibrosis.
5.5 Conclusions:
Taken together, our study findings support that Coup-TFII could be a pro-fibrotic switch that acts as a critical regulator of the TGF-β/SMAD pathway by inhibiting the anti- fibrotic protein SMAD7. Targeted disruption of the Coup-TFII in SS rats inhibits TGF-β mediated signaling cascade and associated with an increase in SMAD7 levels. This abolishes the ability of R-SMAD, such as SMAD3, to successfully translocate into the nuclease and carry out the transcription of pro-fibrotic gene expressions such as Col1a1 and Col3a1.
99
Figure 5 – 1: Coup-TFIImutant rats Display a Superior GFR: FITC-sinistrin bolus based on body weight 5mg/100g b.w was administrated via tail vein injection. Clearance was measured via the transdermal fluorescence detector on the animal’s back (n=8). Data are mean ± SEM. Statistical significance was calculated by unpaired t-test; ***p<0.001.
100
Figure 5 – 2: Coup-TFIImutant rats Show a Reduction in Renal Fibrosis and
Macrophage Infiltration: (A) Representative image of renal sections stained with
Masson’s-trichrome stain (n=3). Black arrows denote the area of collagen staining in blue color. (B) Representative images of renal sections probed with the CD68 antibody (n=3).
Arrows indicated CD68+ macrophages. Graphs represent the quantification of percent of
101 area coverage of renal fibrosis and CD68+ macrophage infiltration. Data are mean ± SEM.
Statistical significance was calculated by unpaired t-test; *p<0.05, ***p<0.001.
102
Figure 5 – 3: Targeted Disruption of Coup-TFII Dysregulates SMAD Signaling Gene
Expressions: qRT-PCR analysis for (A) Smad2, (B) Smad3, (C) Smad4, and (D) Smad7 were performed in HS diet-fed SS and Coup-TFIImutant rat kidneys (n=3-4). Data are mean
± SEM. Statistical significance was calculated by unpaired t-test; *P<0.05.
103
Figure 5 – 4: Targeted Disruption of Coup-TFII and SMAD Staus in the Kidneys:
After 6 weeks Exposure to HS Diet the SS and Coup-TFIImutant rat kidneys were harvested and protein lysates were used for westernblotting. Protein expressions of (A) pSMAD2,
(B) pSMAD3, (C) COL1A1, and (D) SMAD7 levels were measured and quantified by densitometry analysis using Image-J program (n=4). Data are mean ± SEM. Statistical significance was calculated by unpaired t-test; *P<0.05, **P<0.01.
104
Figure 5 – 5: COUP-TFII Intervene with TGF-β Mediated SMAD Signaling Cascade in the Event of Renal Fibrosis: TGF-β induces the phosphorylation of the TGF-β receptors, which phosphorylates SMAD2/3 complex. With the help of SMAD4, SMAD2/3 comoplexes translocate into the nucleus and drive the gene expressions of pro-fibrotic genes such as Col1a1 and Col3a1. However, SMAD7 can inhibit the translocation of
SMAD2/3/4 complex into the nucleus. We have found that COUP-TFII also plays a role in this pathway by inhibiting SMAD7 and therefore allowing TGF-β to propagate its signal through SMAD2/3.
105 Table 5 – 1: qRT-PCR Primers Used Primer Name Sequence r-Gapdh-RT-F CAAGATGGTGAAGGTCCGTGTG r-Gapdh-RT-R AGAGCCTGTGTCCATACTTTG r-Smad2-RT-F ACCCACTCCATTCCAGAAAAC r-Smad2-RT-R AGAGCCTGTGTCCATACTTTG r-Smad3-RT-F GAGCCGAGTACAGGAGACAGA r-Smad3-RT-R ATCTGGGTGAGGACCTTGTC r-Smad4-RT-F TGTTAGCCCCATCAGAGTCTA r-Smad4-RT-R AGCTATCTGCAACAGTCCTTC r-Smad7-RT-F CGGAAGTCAAGAGGCTGTGT r-Smad7-RT-R GGAGTAAGGAGGGGGAG
106
Chapter 6
Summary:
Hypertension is a complex multifactorial disease that is polygenic and influenced by multiple environmental and genetic factors. While the environmental factors that increase the risk of developing hypertension or increase the morbidity of hypertension can be controlled with more favorable lifestyle (such as reducing the amount of salt intake, increase in physical activity, quit smoking and alcohol consumption) choices, we cannot choose our genetics. Therefore, it is clear that making these beneficial changes in our lifestyles may not be enough to attenuate hypertension. This raises two critical questions, such as which genes are involved, and how these genes are integrated into BP regulation.
Through GWAS and genetic linkage studies using laboratory animal models, scientists have uncovered many potential candidate genes that may have an association for hypertension. Of the many genes discovered, my dissertation focused on two of them; the
Chicken Ovalbumin Upstream Promoter Transcription factor-2 (COUP-TFII) and the
Regulated Endocrine Specific Protein-18 (RESP18). Like all candidate genes for hypertension, these genes first had to be validated for their candidacy for BP regulation. In order to validate the candidacy of these genes, novel genetic rat models were developed in
107 the SS rat genetic background for Coup-TFII and Resp18. As a result, this led to the generation of the Coup-TFIImutant rat and the Resp18mutant rat. When we challenged the Coup-TFIImutant rats with an HS diet, they showed an attenuated response to salt induced hypertension compared to the wildtype SS rats, whereas the Resp18mutant rat shown to aggravate the salt induced hypertension response after 6-weeks exposure to HS diet. What is surprising was that on a LS diet, there was no difference in the BP between the wildtype
SS rats and Coup-TFIImutant rats and the wildtype SS rats and Resp18mutant rats. Therefore, both Coup-TFII and Resp18 had been validated for the candidacy for salt-sensitive hypertension.
The validation of hypertensive candidate genes answers one of the two questions.
However, the question remains how mechanistically these genes can regulate BP. In addition to the alteration of BP response to an HS diet, we also observed alteration in kidney homeostasis in both the Coup-TFIImutant rat and the Resp18mutant rat. As expected, the targeted disruption of Coup-TFII leads to a reno-protective phenotype. However, targeted disruption of Resp18 leads to a reno-deteriorative phenotype. We know that the kidney is an essential organ in BP regulation, so any alteration of the kidney homeostasis could alter BP response. Therefore, to understand the physiological relevance of Coup-
TFII and Resp18 in the kidney, we performed a series of experiments to study the mechanism of salt-induced hypertension and kidney homeostasis. Of these pathways, we investigated the Renin-Angiotensin Aldosterone System (RAAS) and the renal dopaminergic system in the Resp18mutant rat, and the TGF-β mediated renal fibrosis pathway in the Coup-TFIImutant.
108 Through RNA seq approach we discovered that targeted disruption of Resp18 can lead to an increase in the Ren gene expression in the kidney along with other gene closely associated with hypertension and proteinuria (Homer1, Selplg, Abca8a, Dpep1,
Calb1 and Ren) which also could explain the increase in circulatory Renin levels in Resp18mutant rat. An increase in renin levels over stimulates the RAAS pathway, therefore, leading to an increase in BP. SS rats are considered as a low renin model of hypertension, and it has been previously shown that the HS diet suppresses the renin level in these rats. At the basal level, the plasma renin activity from Resp18mutant rats was comparable to that of SS rats. However, following one-week exposure to HS diet renin activity was found to be significantly higher in Resp18mutant rats compared with SS rats.
Interestingly, unlike SS rats plasma renin activity, which was decreased, the plasma renin activity from Resp18mutant rats was similar between basal and after one-week exposure to
HS diet. Both the plasma renin activity measurement and the gene-expression analysis using RNA-Seq approach strongly suggest that the upregulation of renin could be one of the possible mechanisms for hypertensive phenotype seen in Resp18mutant rats.
From the initial report discovering Resp18, we know that dopaminergic agents can alter Resp18 expression. The kidney, specifically the RPT cells, houses the site of the renal dopaminergic system, which upon stimulation has shown to reduce BP. However, we saw a dysregulation of the renal dopaminergic system in the Resp18mutant rat, as evidenced by a decrease in renal dopamine levels and an increase in urinary dopamine excretion in
Resp18mutant rats after 6-weeks exposure to HS diet. Dopamine carries out its anti- hypertensive effects via D1-like dopamine receptors such as D1R and D5R. In addition, we
mutant found a significant reduction of both D1R and D5R receptor levels in the Resp18 rat
109 kidneys. We showed that the Resp18mutant rats have dysregulated dopamine secretion upon dopamine release assay performed in primary RPT cells. Therefore, we suspect that in
mutant Resp18 rat kidney, the D1- like receptors may be desensitized to dopamine and as evident by the increase in dopamine release from the kidney. In summary, the
“how” Resp18 alters BP could be explained by the upregulation of the Ren gene expression in the kidney at the initial stage of the disease and a dysregulation of the renal dopaminergic system in the latter stages of hypertension.
TGF-β is well known for its role in mediating renal fibrosis in various models of hypertension, and its fibrotic signaling is carried out by the SMAD family proteins.
In Coup-TFIImutant rat kidneys, the SMAD signaling cascade is disrupted. Disruption of
Coup-TFII leads to a significant downregulation of R-SMAD (pro-fibrotic; SMAD3) levels while exhibiting an upregulation of I-SMAD (anti-fibrotic; SMAD7) levels compared to respective control groups. In concert with these findings, there was a reduction in pro- fibrotic protein such as Col3A1. Therefore, we conclude that the Coup-TFII gene function is critical in the progression of renal fibrosis through the regulation of I-SMAD (SMAD7).
Our studies here have only investigated two (Resp18 and Coup-TFII) of the many hypertensive candidate genes which have been discovered. With the advantage of novel gene-edited rat models, we can investigate the molecular pathways by which these genes regulate BP. We have found that these hypertensive candidate genes, especially Resp18 and Coup-TFII, play an essential role in maintaining kidney homeostasis in salt-induced hypertension. Our studies thus far serve as a fundamental basis to further validate other hypertensive candidate genes and investigate their potential roles and mechanisms in BP
110 regulation. Discovering and understating these novel genes associated with hypertension can lead to novel therapies and expand our knowledge of this complex polygenic trait.
111
References
1. Erratum Regarding "US Renal Data System 2017 Annual Data Report: Epidemiology of Kidney Disease in the United States" (Am J Kidney Dis. 2018;71[3][suppl 1]:Svii,S1-S676). Am J Kidney Dis. 2018;71(4):501. Epub 2018/03/27. doi: 10.1053/j.ajkd.2018.03.001. PubMed PMID: 29579418; PMCID: PMC6608572.
2. Gupta-Malhotra M, Banker A, Shete S, Hashmi SS, Tyson JE, Barratt MS, Hecht JT, Milewicz DM, Boerwinkle E. Essential hypertension vs. secondary hypertension among children. Am J Hypertens. 2015;28(1):73-80. Epub 2014/05/21. doi: 10.1093/ajh/hpu083. PubMed PMID: 24842390; PMCID: PMC4318949.
3. Saklayen MG, Deshpande NV. Timeline of History of Hypertension Treatment. Front Cardiovasc Med. 2016;3:3. Epub 2016/03/05. doi: 10.3389/fcvm.2016.00003. PubMed PMID: 26942184; PMCID: PMC4763852.
4. Pei Z, Liu J, Liu M, Zhou W, Yan P, Wen S, Chen Y. Risk-Predicting Model for Incident of Essential Hypertension Based on Environmental and Genetic Factors with Support Vector Machine. Interdiscip Sci. 2018;10(1):126-30. Epub 2018/01/31. doi: 10.1007/s12539-017-0271-2. PubMed PMID: 29380342.
5. Kokubo Y, Padmanabhan S, Iwashima Y, Yamagishi K, Goto A. Gene and environmental interactions according to the components of lifestyle modifications in hypertension guidelines. Environ Health Prev Med. 2019;24(1):19. Epub 2019/03/13. doi: 10.1186/s12199-019-0771-2. PubMed PMID: 30857519; PMCID: PMC6410507.
6. Waken RJ, de Las Fuentes L, Rao DC. A Review of the Genetics of Hypertension with a Focus on Gene-Environment Interactions. Curr Hypertens Rep. 2017;19(3):23. Epub 2017/03/12. doi: 10.1007/s11906-017-0718-1. PubMed PMID: 28283927; PMCID: PMC5647656.
7. Butler MG. Genetics of hypertension. Current status. J Med Liban. 2010;58(3):175- 8. Epub 2011/04/06. PubMed PMID: 21462849; PMCID: PMC5132177.
8. Hottenga JJ, Boomsma DI, Kupper N, Posthuma D, Snieder H, Willemsen G, de Geus EJ. Heritability and stability of resting blood pressure. Twin Res Hum Genet. 2005;8(5):499-508. Epub 2005/10/11. doi: 10.1375/183242705774310123. PubMed PMID: 16212839.
112
9. Browning BL, Browning SR. Haplotypic analysis of Wellcome Trust Case Control Consortium data. Hum Genet. 2008;123(3):273-80. Epub 2008/01/29. doi: 10.1007/s00439-008-0472-1. PubMed PMID: 18224336; PMCID: PMC2384233.
10. Garrett MR, Meng H, Rapp JP, Joe B. Locating a blood pressure quantitative trait locus within 117 kb on the rat genome: substitution mapping and renal expression analysis. Hypertension. 2005;45(3):451-9. Epub 2005/01/19. doi: 10.1161/01.HYP.0000154678.64340.7f. PubMed PMID: 15655120.
11. Pasipoularides A. Galen, father of systematic medicine. An essay on the evolution of modern medicine and cardiology. Int J Cardiol. 2014;172(1):47-58. Epub 2014/01/28. doi: 10.1016/j.ijcard.2013.12.166. PubMed PMID: 24461486.
12. Karamanou M, Papaioannou TG, Tsoucalas G, Tousoulis D, Stefanadis C, Androutsos G. Blood pressure measurement: lessons learned from our ancestors. Curr Pharm Des. 2015;21(6):700-4. Epub 2014/10/25. doi: 10.2174/1381612820666141023163313. PubMed PMID: 25341864.
13. Li S, Zhao J. [Exploration on two methods of waiting for qi in needle insertion and withdrawal of acupuncture reinforcing and reducing technique recorded in Neijing (The Yellow Emperor's Classic of Internal Medicine)]. Zhongguo Zhen Jiu. 2017;37(4):448-52. Epub 2017/12/13. doi: 10.13703/j.0255-2930.2017.04.027. PubMed PMID: 29231601. 14. Grzybowski A, Sak J, Pawlikowski J. 500(th) anniversary of the birth of the precursor of modern cardiology: Josephus Struthius Polonus (1510-1568). Cardiol J. 2011;18(5):581-6. Epub 2011/09/29. PubMed PMID: 21948000.
15. Roguin A. Scipione Riva-Rocci and the men behind the mercury sphygmomanometer. Int J Clin Pract. 2006;60(1):73-9. Epub 2006/01/18. doi: 10.1111/j.1742-1241.2005.00548.x. PubMed PMID: 16409431.
16. Estanol B, Delgado G, Borgstein J. Korotkoff sounds -- the improbable also occurs. Arq Bras Cardiol. 2013;101(5):e99-e105. Epub 2013/12/18. doi: 10.5935/abc.20130217. PubMed PMID: 24343557; PMCID: PMC4081176.
17. White PD. The heart in hypertension since the days of Richard Bright. Can Med Assoc J. 1946;54:129-36. Epub 1946/02/01. PubMed PMID: 21011164.
18. Goldsmith D. High blood pressure and the kidney. Kidney Int. 2000;58(3):1358. Epub 2000/09/06. doi: 10.1046/j.1523-1755.2000.00296.x. PubMed PMID: 10972703.
19. Calvo-Vargas CG. [A centennial of two great discoveries in the history of medicine: hyperpiesis and the sphygmomanometer (1896-1996)]. Gac Med Mex. 1996;132(5):529- 34. Epub 1996/09/01. PubMed PMID: 9011515.
113 20. Collaborators GBDCoD. Global, regional, and national age-sex-specific mortality for 282 causes of death in 195 countries and territories, 1980-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet. 2018;392(10159):1736-88. Epub 2018/11/30. doi: 10.1016/S0140-6736(18)32203-7. PubMed PMID: 30496103; PMCID: PMC6227606.
21. Mills KT, Bundy JD, Kelly TN, Reed JE, Kearney PM, Reynolds K, Chen J, He J. Global Disparities of Hypertension Prevalence and Control: A Systematic Analysis of Population-Based Studies From 90 Countries. Circulation. 2016;134(6):441-50. Epub 2016/08/10. doi: 10.1161/CIRCULATIONAHA.115.018912. PubMed PMID: 27502908; PMCID: PMC4979614.
22. Fryar CD, Ostchega Y, Hales CM, Zhang G, Kruszon-Moran D. Hypertension Prevalence and Control Among Adults: United States, 2015-2016. NCHS Data Brief. 2017(289):1-8. Epub 2017/11/21. PubMed PMID: 29155682.
23. Collaboration NCDRF. Worldwide trends in blood pressure from 1975 to 2015: a pooled analysis of 1479 population-based measurement studies with 19.1 million participants. Lancet. 2017;389(10064):37-55. Epub 2016/11/20. doi: 10.1016/S0140- 6736(16)31919-5. PubMed PMID: 27863813; PMCID: PMC5220163.
24. Arnett DK, Claas SA. Omics of Blood Pressure and Hypertension. Circ Res. 2018;122(10):1409-19. Epub 2018/05/12. doi: 10.1161/CIRCRESAHA.118.311342. PubMed PMID: 29748366.
25. Lifton RP, Dluhy RG, Powers M, Rich GM, Cook S, Ulick S, Lalouel JM. A chimaeric 11 beta-hydroxylase/aldosterone synthase gene causes glucocorticoid- remediable aldosteronism and human hypertension. Nature. 1992;355(6357):262-5. Epub 1992/01/16. doi: 10.1038/355262a0. PubMed PMID: 1731223.
26. Investigators F. Multi-center genetic study of hypertension: The Family Blood Pressure Program (FBPP). Hypertension. 2002;39(1):3-9. Epub 2002/01/19. doi: 10.1161/hy1201.100415. PubMed PMID: 11799070.
27. Simino J, Shi G, Kume R, Schwander K, Province MA, Gu CC, Kardia S, Chakravarti A, Ehret G, Olshen RA, Turner ST, Ho LT, Zhu X, Jaquish C, Paltoo D, Cooper RS, Weder A, Curb JD, Boerwinkle E, Hunt SC, Rao DC. Five blood pressure loci identified by an updated genome-wide linkage scan: meta-analysis of the Family Blood Pressure Program. Am J Hypertens. 2011;24(3):347-54. Epub 2010/12/15. doi: 10.1038/ajh.2010.238. PubMed PMID: 21151011; PMCID: PMC3405908.
28. Adeyemo A, Luke A, Wu X, Cooper RS, Kan D, Omotade O, Zhu X. Genetic effects on blood pressure localized to chromosomes 6 and 7. J Hypertens. 2005;23(7):1367- 73. Epub 2005/06/09. doi: 10.1097/01.hjh.0000173519.06353.8b. PubMed PMID: 15942459.
114 29. Guo Y, Tomlinson B, Chu T, Fang YJ, Gui H, Tang CS, Yip BH, Cherny SS, Hur YM, Sham PC, Lam TH, Thomas NG. A genome-wide linkage and association scan reveals novel loci for hypertension and blood pressure traits. PLoS One. 2012;7(2):e31489. Epub 2012/03/03. doi: 10.1371/journal.pone.0031489. PubMed PMID: 22384028; PMCID: PMC3286457.
30. Koivukoski L, Fisher SA, Kanninen T, Lewis CM, von Wowern F, Hunt S, Kardia SL, Levy D, Perola M, Rankinen T, Rao DC, Rice T, Thiel BA, Melander O. Meta-analysis of genome-wide scans for hypertension and blood pressure in Caucasians shows evidence of susceptibility regions on chromosomes 2 and 3. Hum Mol Genet. 2004;13(19):2325-32. Epub 2004/08/06. doi: 10.1093/hmg/ddh237. PubMed PMID: 15294874.
31. International Consortium for Blood Pressure Genome-Wide Association S, Ehret GB, Munroe PB, Rice KM, Bochud M, Johnson AD, Chasman DI, Smith AV, Tobin MD, Verwoert GC, Hwang SJ, Pihur V, Vollenweider P, O'Reilly PF, Amin N, Bragg-Gresham JL, Teumer A, Glazer NL, Launer L, Zhao JH, Aulchenko Y, Heath S, Sober S, Parsa A, Luan J, Arora P, Dehghan A, Zhang F, Lucas G, Hicks AA, Jackson AU, Peden JF, Tanaka T, Wild SH, Rudan I, Igl W, Milaneschi Y, Parker AN, Fava C, Chambers JC, Fox ER, Kumari M, Go MJ, van der Harst P, Kao WH, Sjogren M, Vinay DG, Alexander M, Tabara Y, Shaw-Hawkins S, Whincup PH, Liu Y, Shi G, Kuusisto J, Tayo B, Seielstad M, Sim X, Nguyen KD, Lehtimaki T, Matullo G, Wu Y, Gaunt TR, Onland-Moret NC, Cooper MN, Platou CG, Org E, Hardy R, Dahgam S, Palmen J, Vitart V, Braund PS, Kuznetsova T, Uiterwaal CS, Adeyemo A, Palmas W, Campbell H, Ludwig B, Tomaszewski M, Tzoulaki I, Palmer ND, consortium CA, Consortium CK, KidneyGen C, EchoGen c, consortium C- H, Aspelund T, Garcia M, Chang YP, O'Connell JR, Steinle NI, Grobbee DE, Arking DE, Kardia SL, Morrison AC, Hernandez D, Najjar S, McArdle WL, Hadley D, Brown MJ, Connell JM, Hingorani AD, Day IN, Lawlor DA, Beilby JP, Lawrence RW, Clarke R, Hopewell JC, Ongen H, Dreisbach AW, Li Y, Young JH, Bis JC, Kahonen M, Viikari J, Adair LS, Lee NR, Chen MH, Olden M, Pattaro C, Bolton JA, Kottgen A, Bergmann S, Mooser V, Chaturvedi N, Frayling TM, Islam M, Jafar TH, Erdmann J, Kulkarni SR, Bornstein SR, Grassler J, Groop L, Voight BF, Kettunen J, Howard P, Taylor A, Guarrera S, Ricceri F, Emilsson V, Plump A, Barroso I, Khaw KT, Weder AB, Hunt SC, Sun YV, Bergman RN, Collins FS, Bonnycastle LL, Scott LJ, Stringham HM, Peltonen L, Perola M, Vartiainen E, Brand SM, Staessen JA, Wang TJ, Burton PR, Soler Artigas M, Dong Y, Snieder H, Wang X, Zhu H, Lohman KK, Rudock ME, Heckbert SR, Smith NL, Wiggins KL, Doumatey A, Shriner D, Veldre G, Viigimaa M, Kinra S, Prabhakaran D, Tripathy V, Langefeld CD, Rosengren A, Thelle DS, Corsi AM, Singleton A, Forrester T, Hilton G, McKenzie CA, Salako T, Iwai N, Kita Y, Ogihara T, Ohkubo T, Okamura T, Ueshima H, Umemura S, Eyheramendy S, Meitinger T, Wichmann HE, Cho YS, Kim HL, Lee JY, Scott J, Sehmi JS, Zhang W, Hedblad B, Nilsson P, Smith GD, Wong A, Narisu N, Stancakova A, Raffel LJ, Yao J, Kathiresan S, O'Donnell CJ, Schwartz SM, Ikram MA, Longstreth WT, Jr., Mosley TH, Seshadri S, Shrine NR, Wain LV, Morken MA, Swift AJ, Laitinen J, Prokopenko I, Zitting P, Cooper JA, Humphries SE, Danesh J, Rasheed A, Goel A, Hamsten A, Watkins H, Bakker SJ, van Gilst WH, Janipalli CS, Mani KR, Yajnik CS, Hofman A, Mattace-Raso FU, Oostra BA, Demirkan A, Isaacs A, Rivadeneira F, Lakatta EG, Orru M, Scuteri A, Ala-Korpela M, Kangas AJ, Lyytikainen LP, Soininen P,
115 Tukiainen T, Wurtz P, Ong RT, Dorr M, Kroemer HK, Volker U, Volzke H, Galan P, Hercberg S, Lathrop M, Zelenika D, Deloukas P, Mangino M, Spector TD, Zhai G, Meschia JF, Nalls MA, Sharma P, Terzic J, Kumar MV, Denniff M, Zukowska- Szczechowska E, Wagenknecht LE, Fowkes FG, Charchar FJ, Schwarz PE, Hayward C, Guo X, Rotimi C, Bots ML, Brand E, Samani NJ, Polasek O, Talmud PJ, Nyberg F, Kuh D, Laan M, Hveem K, Palmer LJ, van der Schouw YT, Casas JP, Mohlke KL, Vineis P, Raitakari O, Ganesh SK, Wong TY, Tai ES, Cooper RS, Laakso M, Rao DC, Harris TB, Morris RW, Dominiczak AF, Kivimaki M, Marmot MG, Miki T, Saleheen D, Chandak GR, Coresh J, Navis G, Salomaa V, Han BG, Zhu X, Kooner JS, Melander O, Ridker PM, Bandinelli S, Gyllensten UB, Wright AF, Wilson JF, Ferrucci L, Farrall M, Tuomilehto J, Pramstaller PP, Elosua R, Soranzo N, Sijbrands EJ, Altshuler D, Loos RJ, Shuldiner AR, Gieger C, Meneton P, Uitterlinden AG, Wareham NJ, Gudnason V, Rotter JI, Rettig R, Uda M, Strachan DP, Witteman JC, Hartikainen AL, Beckmann JS, Boerwinkle E, Vasan RS, Boehnke M, Larson MG, Jarvelin MR, Psaty BM, Abecasis GR, Chakravarti A, Elliott P, van Duijn CM, Newton-Cheh C, Levy D, Caulfield MJ, Johnson T. Genetic variants in novel pathways influence blood pressure and cardiovascular disease risk. Nature. 2011;478(7367):103-9. Epub 2011/09/13. doi: 10.1038/nature10405. PubMed PMID: 21909115; PMCID: PMC3340926.
32. International HapMap C. A haplotype map of the human genome. Nature. 2005;437(7063):1299-320. Epub 2005/10/29. doi: 10.1038/nature04226. PubMed PMID: 16255080; PMCID: PMC1880871.
33. Reich DE, Lander ES. On the allelic spectrum of human disease. Trends Genet. 2001;17(9):502-10. Epub 2001/08/30. doi: 10.1016/s0168-9525(01)02410-6. PubMed PMID: 11525833.
34. Wellcome Trust Case Control C. Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. Nature. 2007;447(7145):661-78. Epub 2007/06/08. doi: 10.1038/nature05911. PubMed PMID: 17554300; PMCID: PMC2719288.
35. Newton-Cheh C, Johnson T, Gateva V, Tobin MD, Bochud M, Coin L, Najjar SS, Zhao JH, Heath SC, Eyheramendy S, Papadakis K, Voight BF, Scott LJ, Zhang F, Farrall M, Tanaka T, Wallace C, Chambers JC, Khaw KT, Nilsson P, van der Harst P, Polidoro S, Grobbee DE, Onland-Moret NC, Bots ML, Wain LV, Elliott KS, Teumer A, Luan J, Lucas G, Kuusisto J, Burton PR, Hadley D, McArdle WL, Wellcome Trust Case Control C, Brown M, Dominiczak A, Newhouse SJ, Samani NJ, Webster J, Zeggini E, Beckmann JS, Bergmann S, Lim N, Song K, Vollenweider P, Waeber G, Waterworth DM, Yuan X, Groop L, Orho-Melander M, Allione A, Di Gregorio A, Guarrera S, Panico S, Ricceri F, Romanazzi V, Sacerdote C, Vineis P, Barroso I, Sandhu MS, Luben RN, Crawford GJ, Jousilahti P, Perola M, Boehnke M, Bonnycastle LL, Collins FS, Jackson AU, Mohlke KL, Stringham HM, Valle TT, Willer CJ, Bergman RN, Morken MA, Doring A, Gieger C, Illig T, Meitinger T, Org E, Pfeufer A, Wichmann HE, Kathiresan S, Marrugat J, O'Donnell CJ, Schwartz SM, Siscovick DS, Subirana I, Freimer NB, Hartikainen AL, McCarthy MI, O'Reilly PF, Peltonen L, Pouta A, de Jong PE, Snieder H, van Gilst WH, Clarke R, Goel
116 A, Hamsten A, Peden JF, Seedorf U, Syvanen AC, Tognoni G, Lakatta EG, Sanna S, Scheet P, Schlessinger D, Scuteri A, Dorr M, Ernst F, Felix SB, Homuth G, Lorbeer R, Reffelmann T, Rettig R, Volker U, Galan P, Gut IG, Hercberg S, Lathrop GM, Zelenika D, Deloukas P, Soranzo N, Williams FM, Zhai G, Salomaa V, Laakso M, Elosua R, Forouhi NG, Volzke H, Uiterwaal CS, van der Schouw YT, Numans ME, Matullo G, Navis G, Berglund G, Bingham SA, Kooner JS, Connell JM, Bandinelli S, Ferrucci L, Watkins H, Spector TD, Tuomilehto J, Altshuler D, Strachan DP, Laan M, Meneton P, Wareham NJ, Uda M, Jarvelin MR, Mooser V, Melander O, Loos RJ, Elliott P, Abecasis GR, Caulfield M, Munroe PB. Genome-wide association study identifies eight loci associated with blood pressure. Nat Genet. 2009;41(6):666-76. Epub 2009/05/12. doi: 10.1038/ng.361. PubMed PMID: 19430483; PMCID: PMC2891673.
36. Leong XF, Ng CY, Jaarin K. Animal Models in Cardiovascular Research: Hypertension and Atherosclerosis. Biomed Res Int. 2015;2015:528757. Epub 2015/06/13. doi: 10.1155/2015/528757. PubMed PMID: 26064920; PMCID: PMC4433641.
37. Doggrell SA, Brown L. Rat models of hypertension, cardiac hypertrophy and failure. Cardiovasc Res. 1998;39(1):89-105. Epub 1998/10/09. doi: 10.1016/s0008- 6363(98)00076-5. PubMed PMID: 9764192.
38. Okamoto K, Tabei R, Fukushima M, Nosaka S, Yamori Y. Further observations of the development of a strain of spontaneously hypertensive rats. Jpn Circ J. 1966;30(6):703- 16. Epub 1966/06/01. doi: 10.1253/jcj.30.703. PubMed PMID: 6012808.
39. Kurtz TW, Morris RC, Jr. Biological variability in Wistar-Kyoto rats. Implications for research with the spontaneously hypertensive rat. Hypertension. 1987;10(1):127-31. Epub 1987/07/01. doi: 10.1161/01.hyp.10.1.127. PubMed PMID: 3596765.
40. Dahl LK, Heine M, Tassinari L. Effects of chronia excess salt ingestion. Evidence that genetic factors play an important role in susceptibility to experimental hypertension. J Exp Med. 1962;115:1173-90. Epub 1962/06/01. doi: 10.1084/jem.115.6.1173. PubMed PMID: 13883089; PMCID: PMC2137393.
41. Joe B. Dr Lewis Kitchener Dahl, the Dahl rats, and the "inconvenient truth" about the genetics of hypertension. Hypertension. 2015;65(5):963-9. Epub 2015/02/04. doi: 10.1161/HYPERTENSIONAHA.114.04368. PubMed PMID: 25646295; PMCID: PMC4393342.
42. Rapp JP, Dene H. Development and characteristics of inbred strains of Dahl salt- sensitive and salt-resistant rats. Hypertension. 1985;7(3 Pt 1):340-9. Epub 1985/05/01. PubMed PMID: 3997219.
43. Kuijpers MH, de Jong W. Spontaneous hypertension in the fawn-hooded rat: a cardiovascular disease model. J Hypertens Suppl. 1986;4(3):S41-4. Epub 1986/10/01. PubMed PMID: 3465907.
117 44. Rapp JP. Genetic analysis of inherited hypertension in the rat. Physiol Rev. 2000;80(1):135-72. Epub 2000/01/05. doi: 10.1152/physrev.2000.80.1.135. PubMed PMID: 10617767.
45. Sassard J, Lo M, Liu KL. Lyon genetically hypertensive rats: an animal model of "low renin hypertension". Acta Pharmacol Sin. 2003;24(1):1-6. Epub 2003/01/04. PubMed PMID: 12511223.
46. Liu KL, Sassard J, Benzoni D. In the Lyon hypertensive rat, renal function alterations are angiotensin II dependent. Am J Physiol. 1996;271(2 Pt 2):R346-51. Epub 1996/08/01. doi: 10.1152/ajpregu.1996.271.2.R346. PubMed PMID: 8770133.
47. Bianchi G, Fox U, Imbasciati E. The development of a new strain of spontaneously hypertensive rats. Life Sci. 1974;14(2):339-47. Epub 1974/01/16. doi: 10.1016/0024- 3205(74)90064-2. PubMed PMID: 4813594.
48. Garrett MR, Joe B, Dene H, Rapp JP. Identification of blood pressure quantitative trait loci that differentiate two hypertensive strains. J Hypertens. 2002;20(12):2399-406. Epub 2002/12/11. doi: 10.1097/00004872-200212000-00019. PubMed PMID: 12473864. 49. Joe B, Letwin NE, Garrett MR, Dhindaw S, Frank B, Sultana R, Verratti K, Rapp JP, Lee NH. Transcriptional profiling with a blood pressure QTL interval-specific oligonucleotide array. Physiol Genomics. 2005;23(3):318-26. Epub 2005/10/06. doi: 10.1152/physiolgenomics.00164.2004. PubMed PMID: 16204469.
50. Saad Y, Garrett MR, Rapp JP. Multiple blood pressure QTL on rat chromosome 1 defined by Dahl rat congenic strains. Physiol Genomics. 2001;4(3):201-14. Epub 2001/02/13. doi: 10.1152/physiolgenomics.2001.4.3.201. PubMed PMID: 11160999.
51. Ashraf UM, Sanchez ER, Kumarasamy S. COUP-TFII revisited: Its role in metabolic gene regulation. Steroids. 2019;141:63-9. Epub 2018/11/28. doi: 10.1016/j.steroids.2018.11.013. PubMed PMID: 30481528; PMCID: PMC6435262.
52. Kumarasamy S, Waghulde H, Gopalakrishnan K, Mell B, Morgan E, Joe B. Mutation within the hinge region of the transcription factor Nr2f2 attenuates salt-sensitive hypertension. Nat Commun. 2015;6:6252. doi: 10.1038/ncomms7252. PubMed PMID: 25687237; PMCID: PMC4486351.
53. Rapp JP, Garrett MR, Dene H, Meng H, Hoebee B, Lathrop GM. Linkage analysis and construction of a congenic strain for a blood pressure QTL on rat chromosome 9. Genomics. 1998;51(2):191-6. Epub 1998/09/02. doi: 10.1006/geno.1998.5394. PubMed PMID: 9722941.
54. Meng H, Garrett MR, Dene H, Rapp JP. Localization of a blood pressure QTL to a 2.4-cM interval on rat chromosome 9 using congenic strains. Genomics. 2003;81(2):210- 20. Epub 2003/03/07. doi: 10.1016/s0888-7543(03)00003-x. PubMed PMID: 12620399.
118 55. Meek S, Mashimo T, Burdon T. From engineering to editing the rat genome. Mamm Genome. 2017;28(7-8):302-14. Epub 2017/07/29. doi: 10.1007/s00335-017-9705- 8. PubMed PMID: 28752194; PMCID: PMC5569148.
56. Lanigan TM, Kopera HC, Saunders TL. Principles of Genetic Engineering. Genes (Basel). 2020;11(3). Epub 2020/03/14. doi: 10.3390/genes11030291. PubMed PMID: 32164255.
57. Porteus MH, Carroll D. Gene targeting using zinc finger nucleases. Nat Biotechnol. 2005;23(8):967-73. Epub 2005/08/06. doi: 10.1038/nbt1125. PubMed PMID: 16082368.
58. He FJ, Tan M, Ma Y, MacGregor GA. Salt Reduction to Prevent Hypertension and Cardiovascular Disease: JACC State-of-the-Art Review. J Am Coll Cardiol. 2020;75(6):632-47. Epub 2020/02/15. doi: 10.1016/j.jacc.2019.11.055. PubMed PMID: 32057379.
59. Powles J, Fahimi S, Micha R, Khatibzadeh S, Shi P, Ezzati M, Engell RE, Lim SS, Danaei G, Mozaffarian D, Global Burden of Diseases N, Chronic Diseases Expert G. Global, regional and national sodium intakes in 1990 and 2010: a systematic analysis of 24 h urinary sodium excretion and dietary surveys worldwide. BMJ Open. 2013;3(12):e003733. Epub 2013/12/25. doi: 10.1136/bmjopen-2013-003733. PubMed PMID: 24366578; PMCID: PMC3884590.
60. He FJ, MacGregor GA. Reducing population salt intake worldwide: from evidence to implementation. Prog Cardiovasc Dis. 2010;52(5):363-82. Epub 2010/03/17. doi: 10.1016/j.pcad.2009.12.006. PubMed PMID: 20226955.
61. Choi HY, Park HC, Ha SK. Salt Sensitivity and Hypertension: A Paradigm Shift from Kidney Malfunction to Vascular Endothelial Dysfunction. Electrolyte Blood Press. 2015;13(1):7-16. Epub 2015/08/05. doi: 10.5049/EBP.2015.13.1.7. PubMed PMID: 26240595; PMCID: PMC4520886.
62. Gueutin V, Deray G, Isnard-Bagnis C. [Renal physiology]. Bull Cancer. 2012;99(3):237-49. Epub 2011/12/14. doi: 10.1684/bdc.2011.1482. PubMed PMID: 22157516.
63. Funder JW. Aldosterone and Mineralocorticoid Receptors-Physiology and Pathophysiology. Int J Mol Sci. 2017;18(5). Epub 2017/05/12. doi: 10.3390/ijms18051032. PubMed PMID: 28492512; PMCID: PMC5454944.
64. Zilbermint M, Xekouki P, Faucz FR, Berthon A, Gkourogianni A, Schernthaner- Reiter MH, Batsis M, Sinaii N, Quezado MM, Merino M, Hodes A, Abraham SB, Libe R, Assie G, Espiard S, Drougat L, Ragazzon B, Davis A, Gebreab SY, Neff R, Kebebew E, Bertherat J, Lodish MB, Stratakis CA. Primary Aldosteronism and ARMC5 Variants. J Clin Endocrinol Metab. 2015;100(6):E900-9. Epub 2015/03/31. doi: 10.1210/jc.2014- 4167. PubMed PMID: 25822102; PMCID: PMC4454793.
119 65. Fan C, Kawai Y, Inaba S, Arakawa K, Katsuyama M, Kajinami K, Yasuda T, Yabe- Nishimura C, Konoshita T, Miyamori I. Synergy of aldosterone and high salt induces vascular smooth muscle hypertrophy through up-regulation of NOX1. J Steroid Biochem Mol Biol. 2008;111(1-2):29-36. Epub 2008/06/03. doi: 10.1016/j.jsbmb.2008.02.012. PubMed PMID: 18514509.
66. Jablonski KL, Racine ML, Geolfos CJ, Gates PE, Chonchol M, McQueen MB, Seals DR. Dietary sodium restriction reverses vascular endothelial dysfunction in middle- aged/older adults with moderately elevated systolic blood pressure. J Am Coll Cardiol. 2013;61(3):335-43. Epub 2012/11/13. doi: 10.1016/j.jacc.2012.09.010. PubMed PMID: 23141486; PMCID: PMC3549053.
67. Tojo A, Kimoto M, Wilcox CS. Renal expression of constitutive NOS and DDAH: separate effects of salt intake and angiotensin. Kidney Int. 2000;58(5):2075-83. Epub 2000/10/24. doi: 10.1111/j.1523-1755.2000.00380.x. PubMed PMID: 11044228.
68. Li J, White J, Guo L, Zhao X, Wang J, Smart EJ, Li XA. Salt inactivates endothelial nitric oxide synthase in endothelial cells. J Nutr. 2009;139(3):447-51. Epub 2009/01/30. doi: 10.3945/jn.108.097451. PubMed PMID: 19176751; PMCID: PMC2646221.
69. Dickinson KM, Clifton PM, Keogh JB. Endothelial function is impaired after a high-salt meal in healthy subjects. Am J Clin Nutr. 2011;93(3):500-5. Epub 2011/01/14. doi: 10.3945/ajcn.110.006155. PubMed PMID: 21228265.
70. Wu C, Yosef N, Thalhamer T, Zhu C, Xiao S, Kishi Y, Regev A, Kuchroo VK. Induction of pathogenic TH17 cells by inducible salt-sensing kinase SGK1. Nature. 2013;496(7446):513-7. Epub 2013/03/08. doi: 10.1038/nature11984. PubMed PMID: 23467085; PMCID: PMC3637879.
71. Dar HY, Singh A, Shukla P, Anupam R, Mondal RK, Mishra PK, Srivastava RK. High dietary salt intake correlates with modulated Th17-Treg cell balance resulting in enhanced bone loss and impaired bone-microarchitecture in male mice. Sci Rep. 2018;8(1):2503. Epub 2018/02/08. doi: 10.1038/s41598-018-20896-y. PubMed PMID: 29410520; PMCID: PMC5802842.
72. Marshall BJ, Ohye DF, Christian JH. Tolerance of bacteria to high concentrations of NaCl and glycerol in the growth medium. Appl Microbiol. 1971;21(2):363-4. Epub 1971/02/01. PubMed PMID: 5549707; PMCID: PMC377177.
73. Liu YZ, Chen JK, Li ZP, Zhao T, Ni M, Li DJ, Jiang CL, Shen FM. High-salt diet enhances hippocampal oxidative stress and cognitive impairment in mice. Neurobiol Learn Mem. 2014;114:10-5. Epub 2014/04/23. doi: 10.1016/j.nlm.2014.04.010. PubMed PMID: 24752150.
74. Ge Q, Wang Z, Wu Y, Huo Q, Qian Z, Tian Z, Ren W, Zhang X, Han J. High salt diet impairs memory-related synaptic plasticity via increased oxidative stress and
120 suppressed synaptic protein expression. Mol Nutr Food Res. 2017;61(10). Epub 2017/06/28. doi: 10.1002/mnfr.201700134. PubMed PMID: 28654221; PMCID: PMC5656827.
75. Faraco G, Brea D, Garcia-Bonilla L, Wang G, Racchumi G, Chang H, Buendia I, Santisteban MM, Segarra SG, Koizumi K, Sugiyama Y, Murphy M, Voss H, Anrather J, Iadecola C. Dietary salt promotes neurovascular and cognitive dysfunction through a gut- initiated TH17 response. Nat Neurosci. 2018;21(2):240-9. Epub 2018/01/18. doi: 10.1038/s41593-017-0059-z. PubMed PMID: 29335605; PMCID: PMC6207376.
76. Pollak MR, Quaggin SE, Hoenig MP, Dworkin LD. The glomerulus: the sphere of influence. Clin J Am Soc Nephrol. 2014;9(8):1461-9. Epub 2014/05/31. doi: 10.2215/CJN.09400913. PubMed PMID: 24875196; PMCID: PMC4123398.
77. Stoll D, Yokota R, Sanches Aragao D, Casarini DE. Both aldosterone and spironolactone can modulate the intracellular ACE/ANG II/AT1 and ACE2/ANG (1- 7)/MAS receptor axes in human mesangial cells. Physiol Rep. 2019;7(11):e14105. Epub 2019/06/06. doi: 10.14814/phy2.14105. PubMed PMID: 31165585; PMCID: PMC6548847.
78. Mahato HS, Ahlstrom C, Jansson-Lofmark R, Johansson U, Helmlinger G, Hallow KM. Mathematical model of hemodynamic mechanisms and consequences of glomerular hypertension in diabetic mice. NPJ Syst Biol Appl. 2019;5:2. Epub 2018/12/20. doi: 10.1038/s41540-018-0077-9. PubMed PMID: 30564457; PMCID: PMC6288095 and H.S.M. have received research funding from AstraZeneca Pharmaceuticals.
79. Stanhewicz AE, Kenney WL. Determinants of water and sodium intake and output. Nutr Rev. 2015;73 Suppl 2:73-82. Epub 2015/08/21. doi: 10.1093/nutrit/nuv033. PubMed PMID: 26290293.
80. Unwin RJ, Capasso G, Shirley DG. An overview of divalent cation and citrate handling by the kidney. Nephron Physiol. 2004;98(2):p15-20. Epub 2004/10/23. doi: 10.1159/000080259. PubMed PMID: 15499218.
81. Mennuni S, Rubattu S, Pierelli G, Tocci G, Fofi C, Volpe M. Hypertension and kidneys: unraveling complex molecular mechanisms underlying hypertensive renal damage. J Hum Hypertens. 2014;28(2):74-9. Epub 2013/06/28. doi: 10.1038/jhh.2013.55. PubMed PMID: 23803592.
82. Sparks MA, Crowley SD, Gurley SB, Mirotsou M, Coffman TM. Classical Renin- Angiotensin system in kidney physiology. Compr Physiol. 2014;4(3):1201-28. Epub 2014/06/20. doi: 10.1002/cphy.c130040. PubMed PMID: 24944035; PMCID: PMC4137912.
83. Choi MR, Kouyoumdzian NM, Rukavina Mikusic NL, Kravetz MC, Roson MI, Rodriguez Fermepin M, Fernandez BE. Renal dopaminergic system: Pathophysiological
121 implications and clinical perspectives. World J Nephrol. 2015;4(2):196-212. Epub 2015/05/08. doi: 10.5527/wjn.v4.i2.196. PubMed PMID: 25949933; PMCID: PMC4419129.
84. Nishimura H. Renin-angiotensin system in vertebrates: phylogenetic view of structure and function. Anat Sci Int. 2017;92(2):215-47. Epub 2016/10/09. doi: 10.1007/s12565-016-0372-8. PubMed PMID: 27718210.
85. Toffelmire EB, Slater K, Corvol P, Menard J, Schambelan M. Response of plasma prorenin and active renin to chronic and acute alterations of renin secretion in normal humans. Studies using a direct immunoradiometric assay. J Clin Invest. 1989;83(2):679- 87. Epub 1989/02/01. doi: 10.1172/JCI113932. PubMed PMID: 2643635; PMCID: PMC303729.
86. Lynch KR, Peach MJ. Molecular biology of angiotensinogen. Hypertension. 1991;17(3):263-9. Epub 1991/03/01. doi: 10.1161/01.hyp.17.3.263. PubMed PMID: 1999356.
87. Neubauer B, Machura K, Schnermann J, Wagner C. Renin expression in large renal vessels during fetal development depends on functional beta1/beta2-adrenergic receptors. Am J Physiol Renal Physiol. 2011;301(1):F71-7. Epub 2011/03/11. doi: 10.1152/ajprenal.00443.2010. PubMed PMID: 21389089.
88. Neubauer B, Machura K, Chen M, Weinstein LS, Oppermann M, Sequeira-Lopez ML, Gomez RA, Schnermann J, Castrop H, Kurtz A, Wagner C. Development of vascular renin expression in the kidney critically depends on the cyclic AMP pathway. Am J Physiol Renal Physiol. 2009;296(5):F1006-12. Epub 2009/03/06. doi: 10.1152/ajprenal.90448.2008. PubMed PMID: 19261741; PMCID: PMC4067120.
89. Gomez RA, Chevalier RL, Everett AD, Elwood JP, Peach MJ, Lynch KR, Carey RM. Recruitment of renin gene-expressing cells in adult rat kidneys. Am J Physiol. 1990;259(4 Pt 2):F660-5. Epub 1990/10/01. doi: 10.1152/ajprenal.1990.259.4.F660. PubMed PMID: 2221104.
90. Todorov VT, Volkl S, Muller M, Bohla A, Klar J, Kunz-Schughart LA, Hehlgans T, Kurtz A. Tumor necrosis factor-alpha activates NFkappaB to inhibit renin transcription by targeting cAMP-responsive element. J Biol Chem. 2004;279(2):1458-67. Epub 2003/10/18. doi: 10.1074/jbc.M308697200. PubMed PMID: 14563845.
91. Pan L, Black TA, Shi Q, Jones CA, Petrovic N, Loudon J, Kane C, Sigmund CD, Gross KW. Critical roles of a cyclic AMP responsive element and an E-box in regulation of mouse renin gene expression. J Biol Chem. 2001;276(49):45530-8. Epub 2001/09/21. doi: 10.1074/jbc.M103010200. PubMed PMID: 11564732.
122 92. Shi Q, Gross KW, Sigmund CD. Retinoic acid-mediated activation of the mouse renin enhancer. J Biol Chem. 2001;276(5):3597-603. Epub 2000/11/04. doi: 10.1074/jbc.M008361200. PubMed PMID: 11058598.
93. Liang W, Chen C, Shi J, Ren Z, Hu F, van Goor H, Singhal PC, Ding G. Disparate effects of eplerenone, amlodipine and telmisartan on podocyte injury in aldosterone- infused rats. Nephrol Dial Transplant. 2011;26(3):789-99. Epub 2010/08/24. doi: 10.1093/ndt/gfq514. PubMed PMID: 20729265; PMCID: PMC3108348.
94. Armando I, Konkalmatt P, Felder RA, Jose PA. The renal dopaminergic system: novel diagnostic and therapeutic approaches in hypertension and kidney disease. Transl Res. 2015;165(4):505-11. Epub 2014/08/19. doi: 10.1016/j.trsl.2014.07.006. PubMed PMID: 25134060; PMCID: PMC4305499.
95. Pedrosa R, Jose PA, Soares-da-Silva P. Defective D1-like receptor-mediated inhibition of the Cl-/HCO3- exchanger in immortalized SHR proximal tubular epithelial cells. Am J Physiol Renal Physiol. 2004;286(6):F1120-6. Epub 2004/02/19. doi: 10.1152/ajprenal.00433.2003. PubMed PMID: 14970001.
96. Silva E, Gomes P, Soares-da-Silva P. Increases in transepithelial vectorial Na+ transport facilitates Na+-dependent L-DOPA transport in renal OK cells. Life Sci. 2006;79(8):723-9. Epub 2006/04/08. doi: 10.1016/j.lfs.2006.02.018. PubMed PMID: 16600308.
97. Yu PY, Asico LD, Eisner GM, Jose PA. Differential regulation of renal phospholipase C isoforms by catecholamines. J Clin Invest. 1995;95(1):304-8. Epub 1995/01/01. doi: 10.1172/JCI117656. PubMed PMID: 7814630; PMCID: PMC295432.
98. Barnett R, Singhal PC, Scharschmidt LA, Schlondorff D. Dopamine attenuates the contractile response to angiotensin II in isolated rat glomeruli and cultured mesangial cells. Circ Res. 1986;59(5):529-33. Epub 1986/11/01. doi: 10.1161/01.res.59.5.529. PubMed PMID: 3467880.
99. Bek M, Fischer KG, Greiber S, Hupfer C, Mundel P, Pavenstadt H. Dopamine depolarizes podocytes via a D1-like receptor. Nephrol Dial Transplant. 1999;14(3):581-7. Epub 1999/04/08. doi: 10.1093/ndt/14.3.581. PubMed PMID: 10193803.
100. Ohbu K, Kaskel FJ, Kinoshita S, Felder RA. Dopamine-1 receptors in the proximal convoluted tubule of Dahl rats: defective coupling to adenylate cyclase. Am J Physiol. 1995;268(1 Pt 2):R231-5. Epub 1995/01/01. doi: 10.1152/ajpregu.1995.268.1.R231. PubMed PMID: 7840326.
101. Nishi A, Eklof AC, Bertorello AM, Aperia A. Dopamine regulation of renal Na+,K(+)-ATPase activity is lacking in Dahl salt-sensitive rats. Hypertension. 1993;21(6 Pt 1):767-71. Epub 1993/06/01. doi: 10.1161/01.hyp.21.6.767. PubMed PMID: 8099063.
123 102. Banday AA, Lokhandwala MF. Dopamine receptors and hypertension. Curr Hypertens Rep. 2008;10(4):268-75. Epub 2008/07/16. doi: 10.1007/s11906-008-0051-9. PubMed PMID: 18625155.
103. Desir GV. Role of renalase in the regulation of blood pressure and the renal dopamine system. Curr Opin Nephrol Hypertens. 2011;20(1):31-6. Epub 2010/11/26. doi: 10.1097/MNH.0b013e3283412721. PubMed PMID: 21099685.
104. Padia SH, Kemp BA, Howell NL, Keller SR, Gildea JJ, Carey RM. Mechanisms of dopamine D(1) and angiotensin type 2 receptor interaction in natriuresis. Hypertension. 2012;59(2):437-45. Epub 2011/12/29. doi: 10.1161/HYPERTENSIONAHA.111.184788. PubMed PMID: 22203736; PMCID: PMC3279722.
105. Darlington DN, Mains RE, Eipper BA. Location of neurons that express regulated endocrine-specific protein-18 in the rat diencephalon. Neuroscience. 1996;71(2):477-88. Epub 1996/03/01. PubMed PMID: 9053801.
106. Darlington DN, Schiller MR, Mains RE, Eipper BA. The expression of regulated endocrine-specific protein of 18 kDa in peptidergic cells of rat peripheral endocrine tissues and in blood. J Endocrinol. 1997;155(2):329-41. Epub 1998/01/01. PubMed PMID: 9415067.
107. Darlington DN, Schiller MR, Mains RE, Eipper BA. Expression of RESP18 in peptidergic and catecholaminergic neurons. J Histochem Cytochem. 1997;45(9):1265-77. Epub 1997/09/01. doi: 10.1177/002215549704500910. PubMed PMID: 9283614.
108. Zhang G, Hirai H, Cai T, Miura J, Yu P, Huang H, Schiller MR, Swaim WD, Leapman RD, Notkins AL. RESP18, a homolog of the luminal domain IA-2, is found in dense core vesicles in pancreatic islet cells and is induced by high glucose. J Endocrinol. 2007;195(2):313-21. Epub 2007/10/24. doi: 10.1677/JOE-07-0252. PubMed PMID: 17951542.
109. Kumarasamy S, Waghulde H, Cheng X, Haller ST, Mell B, Abhijith B, Ashraf UM, Atari E, Joe B. Targeted disruption of regulated endocrine-specific protein ( Resp18) in Dahl SS/Mcw rats aggravates salt-induced hypertension and renal injury. Physiol Genomics. 2018;50(5):369-75. Epub 2018/03/24. doi: 10.1152/physiolgenomics.00008.2018. PubMed PMID: 29570433; PMCID: PMC6008117.
110. Lee JW, Chou CL, Knepper MA. Deep Sequencing in Microdissected Renal Tubules Identifies Nephron Segment-Specific Transcriptomes. J Am Soc Nephrol. 2015;26(11):2669-77. Epub 2015/03/31. doi: 10.1681/ASN.2014111067. PubMed PMID: 25817355; PMCID: PMC4625681.
111. Bloomquist BT, Darlington DN, Mains RE, Eipper BA. RESP18, a novel endocrine secretory protein transcript, and four other transcripts are regulated in parallel with pro-
124 opiomelanocortin in melanotropes. J Biol Chem. 1994;269(12):9113-22. Epub 1994/03/25. PubMed PMID: 8132649.
112. Schiller MR, Mains RE, Eipper BA. A neuroendocrine-specific protein localized to the endoplasmic reticulum by distal degradation. J Biol Chem. 1995;270(44):26129-38. Epub 1995/11/03. doi: 10.1074/jbc.270.44.26129. PubMed PMID: 7592816.
113. Palokangas H, Ying M, Vaananen K, Saraste J. Retrograde transport from the pre- Golgi intermediate compartment and the Golgi complex is affected by the vacuolar H+- ATPase inhibitor bafilomycin A1. Mol Biol Cell. 1998;9(12):3561-78. Epub 1998/12/08. doi: 10.1091/mbc.9.12.3561. PubMed PMID: 9843588; PMCID: PMC25677.
114. Cai T, Fukushige T, Notkins AL, Krause M. Insulinoma-Associated Protein IA-2, a Vesicle Transmembrane Protein, Genetically Interacts with UNC-31/CAPS and Affects Neurosecretion in Caenorhabditis elegans. J Neurosci. 2004;24(12):3115-24. Epub 2004/03/27. doi: 10.1523/JNEUROSCI.0101-04.2004. PubMed PMID: 15044551.
115. Sato K, Nakano A. Oligomerization of a cargo receptor directs protein sorting into COPII-coated transport vesicles. Mol Biol Cell. 2003;14(7):3055-63. Epub 2003/07/15. doi: 10.1091/mbc.e03-02-0115. PubMed PMID: 12857885; PMCID: PMC165697.
116. Bloomquist BT, Darlington DN, Mueller GP, Mains RE, Eipper BA. Regulated endocrine-specific protein-18: a short-lived novel glucocorticoid-regulated endocrine protein. Endocrinology. 1994;135(6):2714-22. Epub 1994/12/01. doi: 10.1210/endo.135.6.7988462. PubMed PMID: 7988462.
117. Schiller MR, Mains RE, Eipper BA. A novel neuroendocrine intracellular signaling pathway. Mol Endocrinol. 1997;11(12):1846-57. Epub 1997/11/22. doi: 10.1210/mend.11.12.0024. PubMed PMID: 9369452.
118. Torkko JM, Primo ME, Dirkx R, Friedrich A, Viehrig A, Vergari E, Borgonovo B, Sonmez A, Wegbrod C, Lachnit M, Munster C, Sica MP, Ermacora MR, Solimena M. Stability of proICA512/IA-2 and its targeting to insulin secretory granules require beta4- sheet-mediated dimerization of its ectodomain in the endoplasmic reticulum. Mol Cell Biol. 2015;35(6):914-27. Epub 2015/01/07. doi: 10.1128/MCB.00994-14. PubMed PMID: 25561468; PMCID: PMC4333099.
119. Toledo PL, Torkko JM, Muller A, Wegbrod C, Sonmez A, Solimena M, Ermacora MR. ICA512 RESP18 homology domain is a protein-condensing factor and insulin fibrillation inhibitor. J Biol Chem. 2019;294(21):8564-76. Epub 2019/04/14. doi: 10.1074/jbc.RA119.007607. PubMed PMID: 30979722; PMCID: PMC6544868.
120. Su J, Wang H, Yang Y, Wang J, Li H, Huang D, Huang L, Bai X, Yu M, Fei J, Huang F. RESP18 deficiency has protective effects in dopaminergic neurons in an MPTP mouse model of Parkinson's disease. Neurochem Int. 2018;118:195-204. Epub 2018/07/03. doi: 10.1016/j.neuint.2018.06.010. PubMed PMID: 29964075.
125 121. Huang Y, Xu J, Liang M, Hong X, Suo H, Liu J, Yu M, Huang F. RESP18 is involved in the cytotoxicity of dopaminergic neurotoxins in MN9D cells. Neurotox Res. 2013;24(2):164-75. Epub 2013/01/16. doi: 10.1007/s12640-013-9375-6. PubMed PMID: 23319378.
122. Mitre M, Minder J, Morina EX, Chao MV, Froemke RC. Oxytocin Modulation of Neural Circuits. Curr Top Behav Neurosci. 2018;35:31-53. Epub 2017/09/03. doi: 10.1007/7854_2017_7. PubMed PMID: 28864972; PMCID: PMC5834368.
123. Gizowski C, Trudel E, Bourque CW. Central and peripheral roles of vasopressin in the circadian defense of body hydration. Best Pract Res Clin Endocrinol Metab. 2017;31(6):535-46. Epub 2017/12/12. doi: 10.1016/j.beem.2017.11.001. PubMed PMID: 29224666.
124. Cai WW, Wang L, Chen Y. Aspartyl aminopeptidase, encoded by an evolutionarily conserved syntenic gene, is colocalized with its cluster in secretory granules of pancreatic islet cells. Biosci Biotechnol Biochem. 2010;74(10):2050-5. Epub 2010/10/15. PubMed PMID: 20944418.
125. Yakabi K, Kawashima J, Kato S. Ghrelin and gastric acid secretion. World J Gastroenterol. 2008;14(41):6334-8. Epub 2008/11/15. doi: 10.3748/wjg.14.6334. PubMed PMID: 19009648; PMCID: PMC2766114.
126. Schiller MR, Darlington DN. Stage-specific expression of RESP18 in the testes. J Histochem Cytochem. 1996;44(12):1489-96. Epub 1996/12/01. doi: 10.1177/44.12.8985141. PubMed PMID: 8985141.
127. Liang M, Yang JL, Bian MJ, Liu J, Hong XQ, Wang YC, Huang YF, Gu SP, Yu M, Huang F, Fei J. Requirement of regulated endocrine-specific protein-18 for development and expression of regulated endocrine-specific protein-18 isoform c in mice. Mol Biol Rep. 2011;38(4):2557-62. Epub 2010/11/26. doi: 10.1007/s11033-010-0394-6. PubMed PMID: 21104147.
128. Erlandsen SE, Qvigstad G, Fossmark R, Bakke I, Chen D, Sandvik AK. Regulated endocrine-specific protein 18 (RESP18) is localized to and regulated in A-like cells and G- cells in rat stomach. Regul Pept. 2012;177(1-3):53-9. Epub 2012/05/09. doi: 10.1016/j.regpep.2012.04.008. PubMed PMID: 22561140.
129. Sato T, Nakamura Y, Shiimura Y, Ohgusu H, Kangawa K, Kojima M. Structure, regulation and function of ghrelin. J Biochem. 2012;151(2):119-28. Epub 2011/11/02. doi: 10.1093/jb/mvr134. PubMed PMID: 22041973.
130. Schubert ML. Gastric acid secretion. Curr Opin Gastroenterol. 2016;32(6):452-60. Epub 2016/10/18. doi: 10.1097/MOG.0000000000000308. PubMed PMID: 27607343. 131. Norsett KG, Laegreid A, Langaas M, Worlund S, Fossmark R, Waldum HL, Sandvik AK. Molecular characterization of rat gastric mucosal response to potent acid
126 inhibition. Physiol Genomics. 2005;22(1):24-32. Epub 2005/04/14. doi: 10.1152/physiolgenomics.00245.2004. PubMed PMID: 15827235.
132. Eliopoulos V, Dutil J, Deng Y, Grondin M, Deng AY. Severe hypertension caused by alleles from normotensive Lewis for a quantitative trait locus on chromosome 2. Physiol Genomics. 2005;22(1):70-5. Epub 2005/04/14. doi: 10.1152/physiolgenomics.00019.2005. PubMed PMID: 15827238.
133. Flister MJ, Prisco SZ, Sarkis AB, O'Meara CC, Hoffman M, Wendt-Andrae J, Moreno C, Lazar J, Jacob HJ. Identification of hypertension susceptibility loci on rat chromosome 12. Hypertension. 2012;60(4):942-8. Epub 2012/08/08. doi: 10.1161/HYPERTENSIONAHA.112.198200. PubMed PMID: 22868394; PMCID: PMC3873777.
134. Haller ST, Kumarasamy S, Folt DA, Wuescher LM, Stepkowski S, Karamchandani M, Waghulde H, Mell B, Chaudhry M, Maxwell K, Upadhyaya S, Drummond CA, Tian J, Filipiak WE, Saunders TL, Shapiro JI, Joe B, Cooper CJ. Targeted disruption of Cd40 in a genetically hypertensive rat model attenuates renal fibrosis and proteinuria, independent of blood pressure. Kidney Int. 2017;91(2):365-74. Epub 2016/10/04. doi: 10.1016/j.kint.2016.08.015. PubMed PMID: 27692815; PMCID: PMC5237403.
135. Armando I, Villar VA, Jose PA. Genomics and pharmacogenomics of salt-sensitive hypertension Minireview. Curr Hypertens Rev. 2015;11(1):49-56. Epub 2015/01/01. PubMed PMID: 28392754; PMCID: PMC4875776.
136. Currie G, Delles C. The Future of "Omics" in Hypertension. Can J Cardiol. 2017;33(5):601-10. Epub 2017/02/06. doi: 10.1016/j.cjca.2016.11.023. PubMed PMID: 28161100; PMCID: PMC5417769.
137. Padmanabhan S, Aman A, Dominiczak AF. Genomics of hypertension. Pharmacol Res. 2017;121:219-29. Epub 2017/05/13. doi: 10.1016/j.phrs.2017.04.031. PubMed PMID: 28495658.
138. Padmanabhan S, Joe B. Towards Precision Medicine for Hypertension: A Review of Genomic, Epigenomic, and Microbiomic Effects on Blood Pressure in Experimental Rat Models and Humans. Physiol Rev. 2017;97(4):1469-528. Epub 2017/09/22. doi: 10.1152/physrev.00035.2016. PubMed PMID: 28931564; PMCID: PMC6347103.
139. Taylor DA. Hypertensive Crisis: A Review of Pathophysiology and Treatment. Crit Care Nurs Clin North Am. 2015;27(4):439-47. Epub 2015/11/17. doi: 10.1016/j.cnc.2015.08.003. PubMed PMID: 26567490.
140. Chaar LJ, Coelho A, Silva NM, Festuccia WL, Antunes VR. High-fat diet-induced hypertension and autonomic imbalance are associated with an upregulation of CART in the dorsomedial hypothalamus of mice. Physiol Rep. 2016;4(11). Epub 2016/06/09. doi: 10.14814/phy2.12811. PubMed PMID: 27273815; PMCID: PMC4908489.
127 141. Lifton RP, Gharavi AG, Geller DS. Molecular mechanisms of human hypertension. Cell. 2001;104(4):545-56. Epub 2001/03/10. doi: 10.1016/s0092-8674(01)00241-0. PubMed PMID: 11239411.
142. Parmar PG, Taal HR, Timpson NJ, Thiering E, Lehtimaki T, Marinelli M, Lind PA, Howe LD, Verwoert G, Aalto V, Uitterlinden AG, Briollais L, Evans DM, Wright MJ, Newnham JP, Whitfield JB, Lyytikainen LP, Rivadeneira F, Boomsma DI, Viikari J, Gillman MW, St Pourcain B, Hottenga JJ, Montgomery GW, Hofman A, Kahonen M, Martin NG, Tobin MD, Raitakari O, Vioque J, Jaddoe VWV, Jarvelin MR, Beilin LJ, Heinrich J, van Duijn CM, Pennell CE, Lawlor DA, Palmer LJ, Early G, Lifecourse Epidemiology C. International Genome-Wide Association Study Consortium Identifies Novel Loci Associated With Blood Pressure in Children and Adolescents. Circ Cardiovasc Genet. 2016;9(3):266-78. Epub 2016/03/13. doi: 10.1161/CIRCGENETICS.115.001190. PubMed PMID: 26969751; PMCID: PMC5279885.
143. Garrett MR, Dene H, Rapp JP. Time-course genetic analysis of albuminuria in Dahl salt-sensitive rats on low-salt diet. J Am Soc Nephrol. 2003;14(5):1175-87. Epub 2003/04/23. doi: 10.1097/01.asn.0000060572.13794.58. PubMed PMID: 12707388.
144. Endres BT, Priestley JR, Palygin O, Flister MJ, Hoffman MJ, Weinberg BD, Grzybowski M, Lombard JH, Staruschenko A, Moreno C, Jacob HJ, Geurts AM. Mutation of Plekha7 attenuates salt-sensitive hypertension in the rat. Proc Natl Acad Sci U S A. 2014;111(35):12817-22. Epub 2014/08/20. doi: 10.1073/pnas.1410745111. PubMed PMID: 25136115; PMCID: PMC4156702.
145. Siegel AK, Kossmehl P, Planert M, Schulz A, Wehland M, Stoll M, Bruijn JA, de Heer E, Kreutz R. Genetic linkage of albuminuria and renal injury in Dahl salt-sensitive rats on a high-salt diet: comparison with spontaneously hypertensive rats. Physiol Genomics. 2004;18(2):218-25. Epub 2004/05/27. doi: 10.1152/physiolgenomics.00068.2004. PubMed PMID: 15161966.
146. Joe B, Shapiro JI. Molecular mechanisms of experimental salt-sensitive hypertension. J Am Heart Assoc. 2012;1(3):e002121. Epub 2012/11/07. doi: 10.1161/JAHA.112.002121. PubMed PMID: 23130148; PMCID: PMC3487327. 147. Atari E, Perry MC, Jose PA, Kumarasamy S. Regulated Endocrine-Specific Protein-18, an Emerging Endocrine Protein in Physiology: A Literature Review. Endocrinology. 2019;160(9):2093-100. Epub 2019/07/12. doi: 10.1210/en.2019-00397. PubMed PMID: 31294787.
148. Ha SK. Dietary salt intake and hypertension. Electrolyte Blood Press. 2014;12(1):7-18. Epub 2014/07/26. doi: 10.5049/EBP.2014.12.1.7. PubMed PMID: 25061468; PMCID: PMC4105387.
149. Rinschen MM, Palygin O, Guijas C, Palermo A, Palacio-Escat N, Domingo- Almenara X, Montenegro-Burke R, Saez-Rodriguez J, Staruschenko A, Siuzdak G.
128 Metabolic rewiring of the hypertensive kidney. Sci Signal. 2019;12(611). Epub 2019/12/12. doi: 10.1126/scisignal.aax9760. PubMed PMID: 31822592.
150. Christlieb AR, Long R, Underwood RH. Renin-angiotensin-aldosterone system, electrolyte homeostasis and blood pressure in alloxan diabetes. Am J Med Sci. 1979;277(3):295-303. Epub 1979/05/01. doi: 10.1097/00000441-197905000-00008. PubMed PMID: 453234.
151. Onuigbo MA. Does concurrent renin-angiotensin-aldosterone blockade in (older) chronic kidney disease patients play a role in the acute renal failure epidemic in US hospitalized patients?--Three cases of severe acute renal failure encountered in a northwestern Wisconsin Nephrology practice. Hemodial Int. 2009;13 Suppl 1:S24-9. Epub 2009/09/25. doi: 10.1111/j.1542-4758.2009.00416.x. PubMed PMID: 19775421.
152. Ma TK, Kam KK, Yan BP, Lam YY. Renin-angiotensin-aldosterone system blockade for cardiovascular diseases: current status. Br J Pharmacol. 2010;160(6):1273- 92. Epub 2010/07/02. doi: 10.1111/j.1476-5381.2010.00750.x. PubMed PMID: 20590619; PMCID: PMC2938800.
153. Forrester SJ, Booz GW, Sigmund CD, Coffman TM, Kawai T, Rizzo V, Scalia R, Eguchi S. Angiotensin II Signal Transduction: An Update on Mechanisms of Physiology and Pathophysiology. Physiol Rev. 2018;98(3):1627-738. Epub 2018/06/07. doi: 10.1152/physrev.00038.2017. PubMed PMID: 29873596; PMCID: PMC6335102.
154. AlQudah M, Hale TM, Czubryt MP. Targeting the renin-angiotensin-aldosterone system in fibrosis. Matrix Biol. 2020. Epub 2020/05/19. doi: 10.1016/j.matbio.2020.04.005. PubMed PMID: 32422329.
155. Gu JW, Tian N, Shparago M, Tan W, Bailey AP, Manning RD, Jr. Renal NF- kappaB activation and TNF-alpha upregulation correlate with salt-sensitive hypertension in Dahl salt-sensitive rats. Am J Physiol Regul Integr Comp Physiol. 2006;291(6):R1817- 24. Epub 2006/07/15. doi: 10.1152/ajpregu.00153.2006. PubMed PMID: 16840655.
156. Meng S, Roberts LJ, 2nd, Cason GW, Curry TS, Manning RD, Jr. Superoxide dismutase and oxidative stress in Dahl salt-sensitive and -resistant rats. Am J Physiol Regul Integr Comp Physiol. 2002;283(3):R732-8. Epub 2002/08/20. doi: 10.1152/ajpregu.00346.2001. PubMed PMID: 12185008.
157. Meng S, Cason GW, Gannon AW, Racusen LC, Manning RD, Jr. Oxidative stress in Dahl salt-sensitive hypertension. Hypertension. 2003;41(6):1346-52. Epub 2003/04/30. doi: 10.1161/01.HYP.0000070028.99408.E8. PubMed PMID: 12719439.
158. Fehrenbach DJ, Dasinger JH, Lund H, Zemaj J, Mattson DL. Splenocyte transfer exacerbates salt-sensitive hypertension in rats. Exp Physiol. 2020;105(5):864-75. Epub 2020/02/09. doi: 10.1113/EP088340. PubMed PMID: 32034948.
129 159. Sufiun A, Rahman A, Rafiq K, Fujisawa Y, Nakano D, Kobara H, Masaki T, Nishiyama A. Association of a Disrupted Dipping Pattern of Blood Pressure with Progression of Renal Injury during the Development of Salt-Dependent Hypertension in Rats. Int J Mol Sci. 2020;21(6). Epub 2020/03/28. doi: 10.3390/ijms21062248. PubMed PMID: 32213948; PMCID: PMC7139748.
160. Jan Danser AH. Renin and prorenin as biomarkers in hypertension. Curr Opin Nephrol Hypertens. 2012;21(5):508-14. Epub 2012/07/24. doi: 10.1097/MNH.0b013e32835623aa. PubMed PMID: 22820372.
161. Li XC, Zhu D, Zheng X, Zhang J, Zhuo JL. Intratubular and intracellular renin- angiotensin system in the kidney: a unifying perspective in blood pressure control. Clin Sci (Lond). 2018;132(13):1383-401. Epub 2018/07/11. doi: 10.1042/CS20180121. PubMed PMID: 29986878; PMCID: PMC6383523.
162. Tucsek Z, Noa Valcarcel-Ares M, Tarantini S, Yabluchanskiy A, Fulop G, Gautam T, Orock A, Csiszar A, Deak F, Ungvari Z. Hypertension-induced synapse loss and impairment in synaptic plasticity in the mouse hippocampus mimics the aging phenotype: implications for the pathogenesis of vascular cognitive impairment. Geroscience. 2017;39(4):385-406. Epub 2017/07/01. doi: 10.1007/s11357-017-9981-y. PubMed PMID: 28664509; PMCID: PMC5636782.
163. Volcik KA, Catellier D, Folsom AR, Matijevic N, Wasserman B, Boerwinkle E. SELP and SELPLG genetic variation is associated with cell surface measures of SELP and SELPLG: the Atherosclerosis Risk in Communities Carotid MRI Study. Clin Chem. 2009;55(6):1076-82. Epub 2009/04/28. doi: 10.1373/clinchem.2008.119487. PubMed PMID: 19395438; PMCID: PMC2812411.
164. Chauvet C, Menard A, Xiao C, Aguila B, Blain M, Roy J, Deng AY. Novel genes as primary triggers for polygenic hypertension. J Hypertens. 2012;30(1):81-6. Epub 2011/11/30. doi: 10.1097/HJH.0b013e32834dddb1. PubMed PMID: 22124177.
165. Pare G, Chasman DI, Parker AN, Zee RR, Malarstig A, Seedorf U, Collins R, Watkins H, Hamsten A, Miletich JP, Ridker PM. Novel associations of CPS1, MUT, NOX4, and DPEP1 with plasma homocysteine in a healthy population: a genome-wide evaluation of 13 974 participants in the Women's Genome Health Study. Circ Cardiovasc Genet. 2009;2(2):142-50. Epub 2009/12/25. doi: 10.1161/CIRCGENETICS.108.829804. PubMed PMID: 20031578; PMCID: PMC2745176.
166. Takeuchi F, Akiyama M, Matoba N, Katsuya T, Nakatochi M, Tabara Y, Narita A, Saw WY, Moon S, Spracklen CN, Chai JF, Kim YJ, Zhang L, Wang C, Li H, Li H, Wu JY, Dorajoo R, Nierenberg JL, Wang YX, He J, Bennett DA, Takahashi A, Momozawa Y, Hirata M, Matsuda K, Rakugi H, Nakashima E, Isono M, Shirota M, Hozawa A, Ichihara S, Matsubara T, Yamamoto K, Kohara K, Igase M, Han S, Gordon-Larsen P, Huang W, Lee NR, Adair LS, Hwang MY, Lee J, Chee ML, Sabanayagam C, Zhao W, Liu J, Reilly DF, Sun L, Huo S, Edwards TL, Long J, Chang LC, Chen CH, Yuan JM, Koh WP,
130 Friedlander Y, Kelly TN, Bin Wei W, Xu L, Cai H, Xiang YB, Lin K, Clarke R, Walters RG, Millwood IY, Li L, Chambers JC, Kooner JS, Elliott P, van der Harst P, International Genomics of Blood Pressure C, Chen Z, Sasaki M, Shu XO, Jonas JB, He J, Heng CK, Chen YT, Zheng W, Lin X, Teo YY, Tai ES, Cheng CY, Wong TY, Sim X, Mohlke KL, Yamamoto M, Kim BJ, Miki T, Nabika T, Yokota M, Kamatani Y, Kubo M, Kato N. Interethnic analyses of blood pressure loci in populations of East Asian and European descent. Nat Commun. 2018;9(1):5052. Epub 2018/11/30. doi: 10.1038/s41467-018- 07345-0. PubMed PMID: 30487518; PMCID: PMC6261994.
167. Dunbar DR, Khaled H, Evans LC, Al-Dujaili EA, Mullins LJ, Mullins JJ, Kenyon CJ, Bailey MA. Transcriptional and physiological responses to chronic ACTH treatment by the mouse kidney. Physiol Genomics. 2010;40(3):158-66. Epub 2009/11/19. doi: 10.1152/physiolgenomics.00088.2009. PubMed PMID: 19920212; PMCID: PMC2825763.
168. Manrique C, Lastra G, Gardner M, Sowers JR. The renin angiotensin aldosterone system in hypertension: roles of insulin resistance and oxidative stress. Med Clin North Am. 2009;93(3):569-82. Epub 2009/05/12. doi: 10.1016/j.mcna.2009.02.014. PubMed PMID: 19427492; PMCID: PMC2828938.
169. Jing X, Chen SS, Jing W, Tan Q, Yu MX, Tu JC. Diagnostic potential of differentially expressed Homer1, IL-1beta, and TNF-alpha in coronary artery disease. Int J Mol Sci. 2014;16(1):535-46. Epub 2015/01/01. doi: 10.3390/ijms16010535. PubMed PMID: 25551602; PMCID: PMC4307261.
170. Guo WG, Su FF, Yuan LJ, Yang GD, Shi XQ, Li RY, Shu Q, Liu XT, Lu ZF, Zheng QS. Simvastatin inhibits angiotensin II-induced cardiac cell hypertrophy: role of Homer 1a. Clin Exp Pharmacol Physiol. 2010;37(1):40-5. Epub 2009/06/12. doi: 10.1111/j.1440-1681.2009.05221.x. PubMed PMID: 19515066.
171. Chiarello C, Bortoloso E, Carpi A, Furlan S, Volpe P. Negative feedback regulation of Homer 1a on norepinephrine-dependent cardiac hypertrophy. Exp Cell Res. 2013;319(12):1804-14. Epub 2013/05/15. doi: 10.1016/j.yexcr.2013.04.019. PubMed PMID: 23664835.
172. Zhou L, Huang Y, Zhang Y, Zhao Q, Zheng B, Lou Y, Zhu D. mGluR5 stimulating Homer-PIKE formation initiates icariin induced cardiomyogenesis of mouse embryonic stem cells by activating reactive oxygen species. Exp Cell Res. 2013;319(10):1505-14. Epub 2013/03/26. doi: 10.1016/j.yexcr.2013.03.017. PubMed PMID: 23524143. 173. Bohnen MS, Ma L, Zhu N, Qi H, McClenaghan C, Gonzaga-Jauregui C, Dewey FE, Overton JD, Reid JG, Shuldiner AR, Baras A, Sampson KJ, Bleda M, Hadinnapola C, Haimel M, Bogaard HJ, Church C, Coghlan G, Corris PA, Eyries M, Gibbs JSR, Girerd B, Houweling AC, Humbert M, Guignabert C, Kiely DG, Lawrie A, MacKenzie Ross RV, Martin JM, Montani D, Peacock AJ, Pepke-Zaba J, Soubrier F, Suntharalingam J, Toshner M, Treacy CM, Trembath RC, Vonk Noordegraaf A, Wharton J, Wilkins MR, Wort SJ, Yates K, Graf S, Morrell NW, Krishnan U, Rosenzweig EB, Shen Y, Nichols CG, Kass
131 RS, Chung WK. Loss-of-Function ABCC8 Mutations in Pulmonary Arterial Hypertension. Circ Genom Precis Med. 2018;11(10):e002087. Epub 2018/10/26. doi: 10.1161/CIRCGEN.118.002087. PubMed PMID: 30354297; PMCID: PMC6206877. 174. Sakamoto Y, Inoue H, Keshavarz P, Miyawaki K, Yamaguchi Y, Moritani M, Kunika K, Nakamura N, Yoshikawa T, Yasui N, Shiota H, Tanahashi T, Itakura M. SNPs in the KCNJ11-ABCC8 gene locus are associated with type 2 diabetes and blood pressure levels in the Japanese population. J Hum Genet. 2007;52(10):781-93. Epub 2007/09/08. doi: 10.1007/s10038-007-0190-x. PubMed PMID: 17823772.
175. Nafar M, Kalantari S, Samavat S, Rezaei-Tavirani M, Rutishuser D, Zubarev RA. The novel diagnostic biomarkers for focal segmental glomerulosclerosis. Int J Nephrol. 2014;2014:574261. Epub 2014/05/03. doi: 10.1155/2014/574261. PubMed PMID: 24790760; PMCID: PMC3984796.
176. Nakagawa H, Inazawa J, Inoue K, Misawa S, Kashima K, Adachi H, Nakazato H, Abe T. Assignment of the human renal dipeptidase gene (DPEP1) to band q24 of chromosome 16. Cytogenet Cell Genet. 1992;59(4):258-60. Epub 1992/01/01. doi: 10.1159/000133263. PubMed PMID: 1544318.
177. Inamura T, Pardridge WM, Kumagai Y, Black KL. Differential tissue expression of immunoreactive dehydropeptidase I, a peptidyl leukotriene metabolizing enzyme. Prostaglandins Leukot Essent Fatty Acids. 1994;50(2):85-92. Epub 1994/02/01. doi: 10.1016/0952-3278(94)90152-x. PubMed PMID: 8171072.
178. Yamaya M, Sekizawa K, Terajima M, Okinaga S, Ohrui T, Sasaki H. Dipeptidase inhibitor and epithelial removal potentiate leukotriene D4-induced human tracheal smooth muscle contraction. Respir Physiol. 1998;111(1):101-9. Epub 1998/03/13. doi: 10.1016/s0034-5687(97)00099-6. PubMed PMID: 9496476.
179. Samuelsson B. Leukotrienes: mediators of immediate hypersensitivity reactions and inflammation. Science. 1983;220(4597):568-75. Epub 1983/05/06. doi: 10.1126/science.6301011. PubMed PMID: 6301011.
180. Sooy K, Kohut J, Christakos S. The role of calbindin and 1,25dihydroxyvitamin D3 in the kidney. Curr Opin Nephrol Hypertens. 2000;9(4):341-7. Epub 2000/08/05. doi: 10.1097/00041552-200007000-00004. PubMed PMID: 10926169.
181. Iida T, Fujinaka H, Xu B, Zhang Y, Magdeldin S, Nameta M, Liu Z, Yoshida Y, Yaoita E, Tomizawa S, Saito A, Yamamoto T. Decreased urinary calbindin 1 levels in proteinuric rats and humans with distal nephron segment injuries. Clin Exp Nephrol. 2014;18(3):432-43. Epub 2013/07/19. doi: 10.1007/s10157-013-0835-3. PubMed PMID: 23864347.
182. Lambers TT, Mahieu F, Oancea E, Hoofd L, de Lange F, Mensenkamp AR, Voets T, Nilius B, Clapham DE, Hoenderop JG, Bindels RJ. Calbindin-D28K dynamically controls TRPV5-mediated Ca2+ transport. EMBO J. 2006;25(13):2978-88. Epub
132 2006/06/10. doi: 10.1038/sj.emboj.7601186. PubMed PMID: 16763551; PMCID: PMC1500989.
183. Oddsson A, Sulem P, Helgason H, Edvardsson VO, Thorleifsson G, Sveinbjornsson G, Haraldsdottir E, Eyjolfsson GI, Sigurdardottir O, Olafsson I, Masson G, Holm H, Gudbjartsson DF, Thorsteinsdottir U, Indridason OS, Palsson R, Stefansson K. Common and rare variants associated with kidney stones and biochemical traits. Nat Commun. 2015;6:7975. Epub 2015/08/15. doi: 10.1038/ncomms8975. PubMed PMID: 26272126; PMCID: PMC4557269.
184. Khaleel A, Wu MS, Wong HS, Hsu YW, Chou YH, Chen HY. A Single Nucleotide Polymorphism (rs4236480) in TRPV5 Calcium Channel Gene Is Associated with Stone Multiplicity in Calcium Nephrolithiasis Patients. Mediators Inflamm. 2015;2015:375427. Epub 2015/06/20. doi: 10.1155/2015/375427. PubMed PMID: 26089600; PMCID: PMC4452106.
185. Le Goff C, Morice-Picard F, Dagoneau N, Wang LW, Perrot C, Crow YJ, Bauer F, Flori E, Prost-Squarcioni C, Krakow D, Ge G, Greenspan DS, Bonnet D, Le Merrer M, Munnich A, Apte SS, Cormier-Daire V. ADAMTSL2 mutations in geleophysic dysplasia demonstrate a role for ADAMTS-like proteins in TGF-beta bioavailability regulation. Nat Genet. 2008;40(9):1119-23. Epub 2008/08/05. doi: 10.1038/ng.199. PubMed PMID: 18677313; PMCID: PMC2675613.
186. Cicila GT, Rapp JP, Bloch KD, Kurtz TW, Pravenec M, Kren V, Hong CC, Quertermous T, Ng SC. Cosegregation of the endothelin-3 locus with blood pressure and relative heart weight in inbred Dahl rats. J Hypertens. 1994;12(6):643-51. Epub 1994/06/01. PubMed PMID: 7963489.
187. Duong C, Charron S, Xiao C, Hamet P, Menard A, Roy J, Deng AY. Distinct quantitative trait loci for kidney, cardiac, and aortic mass dissociated from and associated with blood pressure in Dahl congenic rats. Mamm Genome. 2006;17(12):1147-61. Epub 2006/12/05. doi: 10.1007/s00335-006-0086-7. PubMed PMID: 17143582.
188. Llamas B, Contesse V, Guyonnet-Duperat V, Vaudry H, Mormede P, Moisan MP. QTL mapping for traits associated with stress neuroendocrine reactivity in rats. Mamm Genome. 2005;16(7):505-15. Epub 2005/09/10. doi: 10.1007/s00335-005-0022-2. PubMed PMID: 16151695.
189. Pravenec M, Gauguier D, Schott JJ, Buard J, Kren V, Bila V, Szpirer C, Szpirer J, Wang JM, Huang H, et al. Mapping of quantitative trait loci for blood pressure and cardiac mass in the rat by genome scanning of recombinant inbred strains. J Clin Invest. 1995;96(4):1973-8. Epub 1995/10/01. doi: 10.1172/JCI118244. PubMed PMID: 7560090; PMCID: PMC185835.
190. Garrett MR, Joe B, Yerga-Woolwine S. Genetic linkage of urinary albumin excretion in Dahl salt-sensitive rats: influence of dietary salt and confirmation using
133 congenic strains. Physiol Genomics. 2006;25(1):39-49. Epub 2006/03/15. doi: 10.1152/physiolgenomics.00150.2005. PubMed PMID: 16534143.
191. Kloting I, Kovacs P, van den Brandt J. Quantitative trait loci for body weight, blood pressure, blood glucose, and serum lipids: linkage analysis with wild rats (Rattus norvegicus). Biochem Biophys Res Commun. 2001;284(5):1126-33. Epub 2001/06/21. doi: 10.1006/bbrc.2001.5091. PubMed PMID: 11414700.
192. Schulz A, Schlesener M, Weiss J, Hansch J, Wendt N, Kossmehl P, Grimm D, Vetter R, Kreutz R. Protective effect of female gender on the development of albuminuria in a polygenetic rat model is enhanced further by replacement of a major autosomal QTL. Clin Sci (Lond). 2008;114(4):305-11. Epub 2007/10/24. doi: 10.1042/CS20070300. PubMed PMID: 17953514.
193. Munoz-Durango N, Fuentes CA, Castillo AE, Gonzalez-Gomez LM, Vecchiola A, Fardella CE, Kalergis AM. Role of the Renin-Angiotensin-Aldosterone System beyond Blood Pressure Regulation: Molecular and Cellular Mechanisms Involved in End-Organ Damage during Arterial Hypertension. Int J Mol Sci. 2016;17(7). Epub 2016/06/28. doi: 10.3390/ijms17070797. PubMed PMID: 27347925; PMCID: PMC4964362.
194. Nakagawa P, Nair AR, Agbor LN, Gomez J, Wu J, Zhang SY, Lu KT, Morgan DA, Rahmouni K, Grobe JL, Sigmund CD. Increased Susceptibility of Mice Lacking Renin-b to Angiotensin II-Induced Organ Damage. Hypertension. 2020;76(2):468-77. Epub 2020/06/09. doi: 10.1161/HYPERTENSIONAHA.120.14972. PubMed PMID: 32507043; PMCID: PMC7347438.
195. Kobori H, Nishiyama A, Abe Y, Navar LG. Enhancement of intrarenal angiotensinogen in Dahl salt-sensitive rats on high salt diet. Hypertension. 2003;41(3):592- 7. Epub 2003/03/08. doi: 10.1161/01.HYP.0000056768.03657.B4. PubMed PMID: 12623964; PMCID: PMC2572575.
196. Sosa L, Torkko JM, Primo ME, Llovera RE, Toledo PL, Rios AS, Flecha FL, Trabucchi A, Valdez SN, Poskus E, Solimena M, Ermacora MR. Biochemical, biophysical, and functional properties of ICA512/IA-2 RESP18 homology domain. Biochim Biophys Acta. 2016;1864(5):511-22. Epub 2016/02/03. doi: 10.1016/j.bbapap.2016.01.013. PubMed PMID: 26836020.
197. Malha L, Sison CP, Helseth G, Sealey JE, August P. Renin-Angiotensin- Aldosterone Profiles in Pregnant Women With Chronic Hypertension. Hypertension. 2018;72(2):417-24. Epub 2018/06/27. doi: 10.1161/HYPERTENSIONAHA.118.10854. PubMed PMID: 29941520; PMCID: PMC6051425.
198. Li W, Sullivan MN, Zhang S, Worker CJ, Xiong Z, Speth RC, Feng Y. Intracerebroventricular infusion of the (Pro)renin receptor antagonist PRO20 attenuates deoxycorticosterone acetate-salt-induced hypertension. Hypertension. 2015;65(2):352-61.
134 Epub 2014/11/26. doi: 10.1161/HYPERTENSIONAHA.114.04458. PubMed PMID: 25421983; PMCID: PMC4902274.
199. Harlan SM, Heinz-Taheny KM, Sullivan JM, Wei T, Baker HE, Jaqua DL, Qi Z, Cramer MS, Shiyanova TL, Breyer MD, Heuer JG. Progressive Renal Disease Established by Renin-Coding Adeno-Associated Virus-Driven Hypertension in Diverse Diabetic Models. J Am Soc Nephrol. 2018;29(2):477-91. Epub 2017/10/25. doi: 10.1681/ASN.2017040385. PubMed PMID: 29061652; PMCID: PMC5791057.
200. Vachiery JL, Adir Y, Barbera JA, Champion H, Coghlan JG, Cottin V, De Marco T, Galie N, Ghio S, Gibbs JS, Martinez F, Semigran M, Simonneau G, Wells A, Seeger W. Pulmonary hypertension due to left heart diseases. J Am Coll Cardiol. 2013;62(25 Suppl):D100-8. Epub 2013/12/21. doi: 10.1016/j.jacc.2013.10.033. PubMed PMID: 24355634.
201. Mule G, Castiglia A, Cusumano C, Scaduto E, Geraci G, Altieri D, Di Natale E, Cacciatore O, Cerasola G, Cottone S. Subclinical Kidney Damage in Hypertensive Patients: A Renal Window Opened on the Cardiovascular System. Focus on Microalbuminuria. Adv Exp Med Biol. 2017;956:279-306. Epub 2016/11/23. doi: 10.1007/5584_2016_85. PubMed PMID: 27873229.
202. Gopalakrishnan K, Kumarasamy S, Abdul-Majeed S, Kalinoski AL, Morgan EE, Gohara AF, Nauli SM, Filipiak WE, Saunders TL, Joe B. Targeted disruption of Adamts16 gene in a rat genetic model of hypertension. Proc Natl Acad Sci U S A. 2012;109(50):20555-9. Epub 2012/11/28. doi: 10.1073/pnas.1211290109. PubMed PMID: 23185005; PMCID: PMC3528556.
203. Kumarasamy S, Gopalakrishnan K, Toland EJ, Yerga-Woolwine S, Farms P, Morgan EE, Joe B. Refined mapping of blood pressure quantitative trait loci using congenic strains developed from two genetically hypertensive rat models. Hypertens Res. 2011;34(12):1263-70. Epub 2011/08/05. doi: 10.1038/hr.2011.116. PubMed PMID: 21814219; PMCID: PMC3808166.
204. Kupper N, Willemsen G, Riese H, Posthuma D, Boomsma DI, de Geus EJ. Heritability of daytime ambulatory blood pressure in an extended twin design. Hypertension. 2005;45(1):80-5. Epub 2004/11/24. doi: 10.1161/01.HYP.0000149952.84391.54. PubMed PMID: 15557390.
205. Saran R, Robinson B, Abbott KC, Agodoa LYC, Bhave N, Bragg-Gresham J, Balkrishnan R, Dietrich X, Eckard A, Eggers PW, Gaipov A, Gillen D, Gipson D, Hailpern SM, Hall YN, Han Y, He K, Herman W, Heung M, Hirth RA, Hutton D, Jacobsen SJ, Jin Y, Kalantar-Zadeh K, Kapke A, Kovesdy CP, Lavallee D, Leslie J, McCullough K, Modi Z, Molnar MZ, Montez-Rath M, Moradi H, Morgenstern H, Mukhopadhyay P, Nallamothu B, Nguyen DV, Norris KC, O'Hare AM, Obi Y, Park C, Pearson J, Pisoni R, Potukuchi PK, Rao P, Repeck K, Rhee CM, Schrager J, Schaubel DE, Selewski DT, Shaw SF, Shi JM, Shieu M, Sim JJ, Soohoo M, Steffick D, Streja E, Sumida K, Tamura MK, Tilea A,
135 Tong L, Wang D, Wang M, Woodside KJ, Xin X, Yin M, You AS, Zhou H, Shahinian V. US Renal Data System 2017 Annual Data Report: Epidemiology of Kidney Disease in the United States. Am J Kidney Dis. 2018;71(3S1):A7. Epub 2018/02/27. doi: 10.1053/j.ajkd.2018.01.002. PubMed PMID: 29477157.
206. Haque MZ, Ares GR, Caceres PS, Ortiz PA. High salt differentially regulates surface NKCC2 expression in thick ascending limbs of Dahl salt-sensitive and salt-resistant rats. Am J Physiol Renal Physiol. 2011;300(5):F1096-104. Epub 2011/02/11. doi: 10.1152/ajprenal.00600.2010. PubMed PMID: 21307126; PMCID: PMC3094058. 207. Wade B, Petrova G, Mattson DL. Role of immune factors in angiotensin II-induced hypertension and renal damage in Dahl salt-sensitive rats. Am J Physiol Regul Integr Comp Physiol. 2018;314(3):R323-R33. doi: 10.1152/ajpregu.00044.2017. PubMed PMID: 29118017; PMCID: 5899245.
208. Huang B, Cheng Y, Usa K, Liu Y, Baker MA, Mattson DL, He Y, Wang N, Liang M. Renal Tumor Necrosis Factor alpha Contributes to Hypertension in Dahl Salt-Sensitive Rats. Sci Rep. 2016;6:21960. doi: 10.1038/srep21960. PubMed PMID: 26916681; PMCID: 4768148.
209. Chen CC, Geurts AM, Jacob HJ, Fan F, Roman RJ. Heterozygous knockout of transforming growth factor-beta1 protects Dahl S rats against high salt-induced renal injury. Physiol Genomics. 2013;45(3):110-8. doi: 10.1152/physiolgenomics.00119.2012. PubMed PMID: 23249995; PMCID: 3568879.
210. Cuevas S, Villar VA, Jose PA, Armando I. Renal dopamine receptors, oxidative stress, and hypertension. Int J Mol Sci. 2013;14(9):17553-72. doi: 10.3390/ijms140917553. PubMed PMID: 23985827; PMCID: 3794741.
211. Harris RC, Zhang MZ. Dopamine, the kidney, and hypertension. Curr Hypertens Rep. 2012;14(2):138-43. Epub 2012/03/13. doi: 10.1007/s11906-012-0253-z. PubMed PMID: 22407378; PMCID: PMC3742329.
212. Armando I, Villar VA, Jose PA. Dopamine and renal function and blood pressure regulation. Compr Physiol. 2011;1(3):1075-117. Epub 2011/07/01. doi: 10.1002/cphy.c100032. PubMed PMID: 23733636.
213. Chugh G, Pokkunuri I, Asghar M. Renal dopamine and angiotensin II receptor signaling in age-related hypertension. Am J Physiol Renal Physiol. 2013;304(1):F1-7. Epub 2012/10/26. doi: 10.1152/ajprenal.00441.2012. PubMed PMID: 23097467; PMCID: PMC3543617.
214. Geurts AM, Cost GJ, Remy S, Cui X, Tesson L, Usal C, Menoret S, Jacob HJ, Anegon I, Buelow R. Generation of gene-specific mutated rats using zinc-finger nucleases. Methods in molecular biology. 2010;597:211-25. doi: 10.1007/978-1-60327-389-3_15. PubMed PMID: 20013236.
136 215. Ellery SJ, Cai X, Walker DD, Dickinson H, Kett MM. Transcutaneous measurement of glomerular filtration rate in small rodents: through the skin for the win? Nephrology. 2015;20(3):117-23. doi: 10.1111/nep.12363. PubMed PMID: 25388805.
216. Schock-Kusch D, Xie Q, Shulhevich Y, Hesser J, Stsepankou D, Sadick M, Koenig S, Hoecklin F, Pill J, Gretz N. Transcutaneous assessment of renal function in conscious rats with a device for measuring FITC-sinistrin disappearance curves. Kidney Int. 2011;79(11):1254-8. doi: 10.1038/ki.2011.31. PubMed PMID: 21368744.
217. Schock-Kusch D, Sadick M, Henninger N, Kraenzlin B, Claus G, Kloetzer HM, Weiss C, Pill J, Gretz N. Transcutaneous measurement of glomerular filtration rate using FITC-sinistrin in rats. Nephrol Dial Transplant. 2009;24(10):2997-3001. doi: 10.1093/ndt/gfp225. PubMed PMID: 19461009.
218. Das SC, Althobaiti YS, Alshehri FS, Sari Y. Binge ethanol withdrawal: effects on post-withdrawal ethanol intake, glutamate–glutamine cycle and monoamine tissue content in P rat model. Behavioural brain research. 2016;303:120-5.
219. Almalki AH, Das SC, Alshehri FS, Althobaiti YS, Sari Y. Effects of sequential ethanol exposure and repeated high-dose methamphetamine on striatal and hippocampal dopamine, serotonin and glutamate tissue content in Wistar rats. Neuroscience letters. 2018;665:61-6.
220. Liu J, Yan Y, Liu L, Xie Z, Malhotra D, Joe B, Shapiro JI. Impairment of Na/K- ATPase signaling in renal proximal tubule contributes to Dahl salt-sensitive hypertension. J Biol Chem. 2011;286(26):22806-13. Epub 2011/05/11. doi: 10.1074/jbc.M111.246249. PubMed PMID: 21555512; PMCID: PMC3123048.
221. Gopalakrishnan K, Kumarasamy S, Yan Y, Liu J, Kalinoski A, Kothandapani A, Farms P, Joe B. Increased Expression of Rififylin in A < 330 Kb Congenic Strain is Linked to Impaired Endosomal Recycling in Proximal Tubules. Front Genet. 2012;3:138. Epub 2012/08/15. doi: 10.3389/fgene.2012.00138. PubMed PMID: 22891072; PMCID: PMC3413941.
222. Maurel A, Spreux-Varoquaux O, Amenta F, Tayebati SK, Tomassoni D, Seguelas MH, Parini A, Pizzinat N. Vesicular monoamine transporter 1 mediates dopamine secretion in rat proximal tubular cells. Am J Physiol Renal Physiol. 2007;292(5):F1592-8. doi: 10.1152/ajprenal.00514.2006. PubMed PMID: 17244889.
223. Almalki AH, Das SC, Alshehri FS, Althobaiti YS, Sari Y. Effects of sequential ethanol exposure and repeated high-dose methamphetamine on striatal and hippocampal dopamine, serotonin and glutamate tissue content in Wistar rats. Neuroscience letters. 2018;665:61-6. doi: 10.1016/j.neulet.2017.11.043. PubMed PMID: 29174641; PMCID: 5801213.
137 224. Roman RJ. Abnormal renal hemodynamics and pressure-natriuresis relationship in Dahl salt-sensitive rats. Am J Physiol. 1986;251(1 Pt 2):F57-65. Epub 1986/07/01. doi: 10.1152/ajprenal.1986.251.1.F57. PubMed PMID: 3728685.
225. Fink GD, Takeshita A, Mark AL, Brody MJ. Determinants of renal vascular resistance in the Dahl strain of genetically hypertensive rat. Hypertension. 1980;2(3):274- 80. Epub 1980/05/01. doi: 10.1161/01.hyp.2.3.274. PubMed PMID: 7390606.
226. Cowley AW, Roman RJ, Fenoy FJ, Mattson DL. Effect of renal medullary circulation on arterial pressure. J Hypertens Suppl. 1992;10(7):S187-93. Epub 1992/12/01. PubMed PMID: 1291653.
227. Duffield JS. Macrophages and immunologic inflammation of the kidney. Semin Nephrol. 2010;30(3):234-54. Epub 2010/07/14. doi: 10.1016/j.semnephrol.2010.03.003. PubMed PMID: 20620669; PMCID: PMC2922007.
228. Cao Q, Harris DC, Wang Y. Macrophages in kidney injury, inflammation, and fibrosis. Physiology (Bethesda). 2015;30(3):183-94. Epub 2015/05/03. doi: 10.1152/physiol.00046.2014. PubMed PMID: 25933819.
229. Asghar M, Tayebati SK, Lokhandwala MF, Hussain T. Potential dopamine-1 receptor stimulation in hypertension management. Curr Hypertens Rep. 2011;13(4):294- 302. Epub 2011/06/03. doi: 10.1007/s11906-011-0211-1. PubMed PMID: 21633929.
230. Ivy JR, Bailey MA. Pressure natriuresis and the renal control of arterial blood pressure. J Physiol. 2014;592(18):3955-67. Epub 2014/08/12. doi: 10.1113/jphysiol.2014.271676. PubMed PMID: 25107929; PMCID: PMC4198007.
231. Pechman KR, De Miguel C, Lund H, Leonard EC, Basile DP, Mattson DL. Recovery from renal ischemia-reperfusion injury is associated with altered renal hemodynamics, blunted pressure natriuresis, and sodium-sensitive hypertension. Am J Physiol Regul Integr Comp Physiol. 2009;297(5):R1358-63. doi: 10.1152/ajpregu.91022.2008. PubMed PMID: 19710386; PMCID: 2777774.
232. Roman RJ, Kaldunski M. Pressure natriuresis and cortical and papillary blood flow in inbred Dahl rats. Am J Physiol. 1991;261(3 Pt 2):R595-602. Epub 1991/09/01. doi: 10.1152/ajpregu.1991.261.3.R595. PubMed PMID: 1887948.
233. Hayashi K, Epstein M, Saruta T. Altered myogenic responsiveness of the renal microvasculature in experimental hypertension. J Hypertens. 1996;14(12):1387-401. PubMed PMID: 8986920.
234. Ge Y, Fan F, Didion SP, Roman RJ. Impaired myogenic response of the afferent arteriole contributes to the increased susceptibility to renal disease in Milan normotensive rats. Physiol Rep. 2017;5(3). Epub 2017/02/15. doi: 10.14814/phy2.13089. PubMed PMID: 28193784; PMCID: PMC5309574.
138 235. Feng W, Guan Z, Xing D, Li X, Ying WZ, Remedies CE, Inscho EW, Sanders PW. Avian erythroblastosis virus E26 oncogene homolog-1 (ETS-1) plays a role in renal microvascular pathophysiology in the Dahl salt-sensitive rat. Kidney Int. 2020;97(3):528- 37. Epub 2020/01/15. doi: 10.1016/j.kint.2019.09.025. PubMed PMID: 31932071; PMCID: PMC7039742.
236. Evans LC, Petrova G, Kurth T, Yang C, Bukowy JD, Mattson DL, Cowley AW, Jr. Increased Perfusion Pressure Drives Renal T-Cell Infiltration in the Dahl Salt-Sensitive Rat. Hypertension. 2017;70(3):543-51. Epub 2017/07/12. doi: 10.1161/HYPERTENSIONAHA.117.09208. PubMed PMID: 28696224; PMCID: PMC5589123.
237. Banek CT, Gauthier MM, Van Helden DA, Fink GD, Osborn JW. Renal Inflammation in DOCA-Salt Hypertension. Hypertension. 2019;73(5):1079-86. Epub 2019/03/19. doi: 10.1161/HYPERTENSIONAHA.119.12762. PubMed PMID: 30879356; PMCID: PMC6540804.
238. Zhang MZ, Yao B, Wang S, Fan X, Wu G, Yang H, Yin H, Yang S, Harris RC. Intrarenal dopamine deficiency leads to hypertension and decreased longevity in mice. J Clin Invest. 2011;121(7):2845-54. Epub 2011/06/28. doi: 10.1172/JCI57324. PubMed PMID: 21701066; PMCID: PMC3223841.
239. Jiang X, Zhang Y, Yang Y, Yang J, Asico LD, Chen W, Felder RA, Armando I, Jose PA, Yang Z. Gastrin stimulates renal dopamine production by increasing the renal tubular uptake of l-DOPA. Am J Physiol Endocrinol Metab. 2017;312(1):E1-E10. Epub 2016/10/27. doi: 10.1152/ajpendo.00116.2016. PubMed PMID: 27780818; PMCID: PMC5283882.
240. Zeng C, Sanada H, Watanabe H, Eisner GM, Felder RA, Jose PA. Functional genomics of the dopaminergic system in hypertension. Physiol Genomics. 2004;19(3):233- 46. Epub 2004/11/19. doi: 10.1152/physiolgenomics.00127.2004. PubMed PMID: 15548830.
241. Hussain T, Lokhandwala MF. Renal dopamine receptors and hypertension. Exp Biol Med (Maywood). 2003;228(2):134-42. Epub 2003/02/04. PubMed PMID: 12563019. 242. Kuchel O, Racz K, Debinski W, Falardeau P, Buu NT. Contrasting dopaminergic patterns in two forms of genetic hypertension. Clin Exp Hypertens A. 1987;9(5-6):987- 1008. Epub 1987/01/01. doi: 10.3109/10641968709161461. PubMed PMID: 3621631. 243. Felder RA, Seikaly MG, Cody P, Eisner GM, Jose PA. Attenuated renal response to dopaminergic drugs in spontaneously hypertensive rats. Hypertension. 1990;15(6 Pt 1):560-9. Epub 1990/06/01. PubMed PMID: 1971811.
244. Wang X, Luo Y, Escano CS, Yang Z, Asico L, Li H, Jones JE, Armando I, Lu Q, Sibley DR, Eisner GM, Jose PA. Upregulation of renal sodium transporters in D5 dopamine receptor-deficient mice. Hypertension. 2010;55(6):1431-7. Epub 2010/04/21.
139 doi: 10.1161/HYPERTENSIONAHA.109.148643. PubMed PMID: 20404220; PMCID: PMC2876328.
245. Zhang H, Sun ZQ, Liu SS, Yang LN. Association between GRK4 and DRD1 gene polymorphisms and hypertension: a meta-analysis. Clin Interv Aging. 2016;11:17-27. Epub 2016/01/06. doi: 10.2147/CIA.S94510. PubMed PMID: 26730182; PMCID: PMC4694673.
246. Albrecht FE, Drago J, Felder RA, Printz MP, Eisner GM, Robillard JE, Sibley DR, Westphal HJ, Jose PA. Role of the D1A dopamine receptor in the pathogenesis of genetic hypertension. J Clin Invest. 1996;97(10):2283-8. Epub 1996/05/15. doi: 10.1172/JCI118670. PubMed PMID: 8636408; PMCID: PMC507308.
247. Carey RM, Van Loon GR, Baines AD, Ortt EM. Decreased plasma and urinary dopamine during dietary sodium depletion in man. J Clin Endocrinol Metab. 1981;52(5):903-9. Epub 1981/05/01. doi: 10.1210/jcem-52-5-903. PubMed PMID: 7228993.
248. Lu X, Crowley SD. Inflammation in Salt-Sensitive Hypertension and Renal Damage. Curr Hypertens Rep. 2018;20(12):103. Epub 2018/11/01. doi: 10.1007/s11906- 018-0903-x. PubMed PMID: 30377822.
249. Titze J, Luft FC. Speculations on salt and the genesis of arterial hypertension. Kidney Int. 2017;91(6):1324-35. Epub 2017/05/16. doi: 10.1016/j.kint.2017.02.034. PubMed PMID: 28501304.
250. Sanada H, Jones JE, Jose PA. Genetics of salt-sensitive hypertension. Curr Hypertens Rep. 2011;13(1):55-66. Epub 2010/11/09. doi: 10.1007/s11906-010-0167-6. PubMed PMID: 21058046; PMCID: PMC4019234.
251. Rust P, Ekmekcioglu C. Impact of Salt Intake on the Pathogenesis and Treatment of Hypertension. Adv Exp Med Biol. 2017;956:61-84. Epub 2016/10/21. doi: 10.1007/5584_2016_147. PubMed PMID: 27757935.
252. Babu M, Drawz P. Masked Hypertension in CKD: Increased Prevalence and Risk for Cardiovascular and Renal Events. Curr Cardiol Rep. 2019;21(7):58. Epub 2019/05/22. doi: 10.1007/s11886-019-1154-4. PubMed PMID: 31111326.
253. Qian Q. Salt, water and nephron: Mechanisms of action and link to hypertension and chronic kidney disease. Nephrology. 2018;23 Suppl 4:44-9. Epub 2018/10/10. doi: 10.1111/nep.13465. PubMed PMID: 30298656; PMCID: PMC6221012.
254. Mattson DL, Liang M. Hypertension: From GWAS to functional genomics-based precision medicine. Nat Rev Nephrol. 2017;13(4):195-6. Epub 2017/03/07. doi: 10.1038/nrneph.2017.21. PubMed PMID: 28262776; PMCID: PMC5531442.
140 255. Yagil C, Hubner N, Kreutz R, Ganten D, Yagil Y. Congenic strains confirm the presence of salt-sensitivity QTLs on chromosome 1 in the Sabra rat model of hypertension. Physiol Genomics. 2003;12(2):85-95. Epub 2002/11/21. doi: 10.1152/physiolgenomics.00111.2002. PubMed PMID: 12441404.
256. Kato N, Nabika T, Liang YQ, Mashimo T, Inomata H, Watanabe T, Yanai K, Yamori Y, Yazaki Y, Sasazuki T. Isolation of a chromosome 1 region affecting blood pressure and vascular disease traits in the stroke-prone rat model. Hypertension. 2003;42(6):1191-7. Epub 2003/11/19. doi: 10.1161/01.HYP.0000103161.27190.67. PubMed PMID: 14623828.
257. Cui ZH, Ikeda K, Kawakami K, Gonda T, Nabika T, Masuda J. Exaggerated response to restraint stress in rats congenic for the chromosome 1 blood pressure quantitative trait locus. Clin Exp Pharmacol Physiol. 2003;30(7):464-9. Epub 2003/06/26. PubMed PMID: 12823260.
258. Xu X, Yang J, Rogus J, Chen C, Schork N, Xu X. Mapping of a blood pressure quantitative trait locus to chromosome 15q in a Chinese population. Hum Mol Genet. 1999;8(13):2551-5. Epub 1999/11/11. doi: 10.1093/hmg/8.13.2551. PubMed PMID: 10556304.
259. Weder AB, Delgado MC, Zhu X, Gleiberman L, Kan D, Chakravarti A. Erythrocyte sodium-lithium countertransport and blood pressure: a genome-wide linkage study. Hypertension. 2003;41(3 Pt 2):842-6. Epub 2003/03/08. doi: 10.1161/01.HYP.0000048703.16933.6D. PubMed PMID: 12624006.
260. Wang H, Nie L, Wu L, Liu Q, Guo X. NR2F2 inhibits Smad7 expression and promotes TGF-beta-dependent epithelial-mesenchymal transition of CRC via transactivation of miR-21. Biochem Biophys Res Commun. 2017;485(1):181-8. Epub 2017/02/14. doi: 10.1016/j.bbrc.2017.02.049. PubMed PMID: 28192117.
261. Meng XM, Tang PM, Li J, Lan HY. TGF-beta/Smad signaling in renal fibrosis. Front Physiol. 2015;6:82. Epub 2015/04/09. doi: 10.3389/fphys.2015.00082. PubMed PMID: 25852569; PMCID: PMC4365692.
262. Dahly-Vernon AJ, Sharma M, McCarthy ET, Savin VJ, Ledbetter SR, Roman RJ. Transforming growth factor-beta, 20-HETE interaction, and glomerular injury in Dahl salt- sensitive rats. Hypertension. 2005;45(4):643-8. Epub 2005/02/23. doi: 10.1161/01.HYP.0000153791.89776.43. PubMed PMID: 15723968.
263. Meng XM, Huang XR, Xiao J, Chen HY, Zhong X, Chung AC, Lan HY. Diverse roles of TGF-beta receptor II in renal fibrosis and inflammation in vivo and in vitro. J Pathol. 2012;227(2):175-88. Epub 2011/12/23. doi: 10.1002/path.3976. PubMed PMID: 22190171.
141 264. Nandakumar P, Tin A, Grove ML, Ma J, Boerwinkle E, Coresh J, Chakravarti A. MicroRNAs in the miR-17 and miR-15 families are downregulated in chronic kidney disease with hypertension. PLoS One. 2017;12(8):e0176734. Epub 2017/08/05. doi: 10.1371/journal.pone.0176734. PubMed PMID: 28771472; PMCID: PMC5542606.
265. Bao Y, Gu D, Feng W, Sun X, Wang X, Zhang X, Shi Q, Cui G, Yu H, Tang C, Deng A. COUP-TFII regulates metastasis of colorectal adenocarcinoma cells by modulating Snail1. Br J Cancer. 2014;111(5):933-43. Epub 2014/07/18. doi: 10.1038/bjc.2014.373. PubMed PMID: 25032732; PMCID: PMC4150277.
266. Qin J, Wu SP, Creighton CJ, Dai F, Xie X, Cheng CM, Frolov A, Ayala G, Lin X, Feng XH, Ittmann MM, Tsai SJ, Tsai MJ, Tsai SY. COUP-TFII inhibits TGF-beta-induced growth barrier to promote prostate tumorigenesis. Nature. 2013;493(7431):236-40. Epub 2012/12/04. doi: 10.1038/nature11674. PubMed PMID: 23201680; PMCID: PMC4022346.
267. Pasala S, Carmody JB. How to use... serum creatinine, cystatin C and GFR. Arch Dis Child Educ Pract Ed. 2017;102(1):37-43. Epub 2016/09/21. doi: 10.1136/archdischild- 2016-311062. PubMed PMID: 27647862.
268. Cowley AW, Jr., Ryan RP, Kurth T, Skelton MM, Schock-Kusch D, Gretz N. Progression of glomerular filtration rate reduction determined in conscious Dahl salt- sensitive hypertensive rats. Hypertension. 2013;62(1):85-90. Epub 2013/05/01. doi: 10.1161/HYPERTENSIONAHA.113.01194. PubMed PMID: 23630946; PMCID: PMC3806646.
269. Scarfe L, Schock-Kusch D, Ressel L, Friedemann J, Shulhevich Y, Murray P, Wilm B, de Caestecker M. Transdermal Measurement of Glomerular Filtration Rate in Mice. J Vis Exp. 2018(140). Epub 2018/11/06. doi: 10.3791/58520. PubMed PMID: 30394397; PMCID: PMC6235579.
270. Andrade-Oliveira V, Foresto-Neto O, Watanabe IKM, Zatz R, Camara NOS. Inflammation in Renal Diseases: New and Old Players. Front Pharmacol. 2019;10:1192. Epub 2019/10/28. doi: 10.3389/fphar.2019.01192. PubMed PMID: 31649546; PMCID: PMC6792167.
271. Anders HJ, Suarez-Alvarez B, Grigorescu M, Foresto-Neto O, Steiger S, Desai J, Marschner JA, Honarpisheh M, Shi C, Jordan J, Muller L, Burzlaff N, Bauerle T, Mulay SR. The macrophage phenotype and inflammasome component NLRP3 contributes to nephrocalcinosis-related chronic kidney disease independent from IL-1-mediated tissue injury. Kidney Int. 2018;93(3):656-69. Epub 2017/12/16. doi: 10.1016/j.kint.2017.09.022. PubMed PMID: 29241624.
272. Xie X, Wu SP, Tsai MJ, Tsai S. The Role of COUP-TFII in Striated Muscle Development and Disease. Curr Top Dev Biol. 2017;125:375-403. Epub 2017/05/22. doi: 10.1016/bs.ctdb.2016.12.006. PubMed PMID: 28527579.
142 273. Xu M, Qin J, Tsai SY, Tsai MJ. The role of the orphan nuclear receptor COUP- TFII in tumorigenesis. Acta Pharmacol Sin. 2015;36(1):32-6. Epub 2014/10/07. doi: 10.1038/aps.2014.86. PubMed PMID: 25283503; PMCID: PMC4571324.
274. Webster AC, Nagler EV, Morton RL, Masson P. Chronic Kidney Disease. Lancet. 2017;389(10075):1238-52. Epub 2016/11/27. doi: 10.1016/S0140-6736(16)32064-5. PubMed PMID: 27887750.
275. Feng W, Dell'Italia LJ, Sanders PW. Novel Paradigms of Salt and Hypertension. J Am Soc Nephrol. 2017;28(5):1362-9. Epub 2017/02/22. doi: 10.1681/ASN.2016080927. PubMed PMID: 28220030; PMCID: PMC5407734.
276. Yoshida K, Murata M, Yamaguchi T, Matsuzaki K. TGF-beta/Smad signaling during hepatic fibro-carcinogenesis (review). Int J Oncol. 2014;45(4):1363-71. Epub 2014/07/23. doi: 10.3892/ijo.2014.2552. PubMed PMID: 25050845; PMCID: PMC4151811.
277. Hayashi H, Abdollah S, Qiu Y, Cai J, Xu YY, Grinnell BW, Richardson MA, Topper JN, Gimbrone MA, Jr., Wrana JL, Falb D. The MAD-related protein Smad7 associates with the TGFbeta receptor and functions as an antagonist of TGFbeta signaling. Cell. 1997;89(7):1165-73. Epub 1997/06/27. doi: 10.1016/s0092-8674(00)80303-7. PubMed PMID: 9215638.
278. Liu Z, Huang XR, Lan HY. Smad3 mediates ANG II-induced hypertensive kidney disease in mice. Am J Physiol Renal Physiol. 2012;302(8):F986-97. Epub 2012/01/13. doi: 10.1152/ajprenal.00595.2011. PubMed PMID: 22237801.
279. Zhang C, Han Y, Huang H, Qu L, Shou C. High NR2F2 transcript level is associated with increased survival and its expression inhibits TGF-beta-dependent epithelial-mesenchymal transition in breast cancer. Breast Cancer Res Treat. 2014;147(2):265-81. Epub 2014/08/19. doi: 10.1007/s10549-014-3095-3. PubMed PMID: 25129343.
143
Appendix A
Publications and Presentations:
Publications:
1. St Clair, S.L., Li, H., Ashraf, U., Karty, J.A. & Tennessen, J.M. “Metabolomic Analysis Reveals That the Drosophila melanogaster Gene lysine Influences Diverse Aspects of Metabolism”. Genetics; 207, 1255-1261 (2017). PMID: 28986444
2. Kumarasamy, S., Waghulde, H., Cheng, X., Haller, ST., Mell, B., Abhijith, B., Ashraf, U.M., Atari, E., & Joe, B. “Targeted disruption of regulated endocrine- specific protein (Resp18) in Dahl SS/Mcw rats aggravates salt-induced hypertension and renal injury”. Physiol Genomics; 50, 369-375 (2018). PMID: 295704
3. Fan, Xiaoming, Ashraf, U.M., Drummond, C. A., Shi, H., Zhang, X., Kumarasamy, S., & Tian, J., “Characterization of a Long Non-Coding RNA, the Antisense RNA of Na/K-ATPase α1 in Human Kidney Cells.” International Journal of Molecular Sciences; 19, 7 2123. 21 (2018). PMID: 30037072
4. Ashraf U.M., Sanchez ER, and Kumarasamy S. COUP-TFII revisited: Its role in metabolic gene regulation. Steroids; 141: 63-69, (2018). PMID: 30481528
5. Shalaby, R., Petzer, J. P., Petzer, A., Ashraf, U. M., Atari, E., Alasmari, F., Khalil, A. (2019). SAR and molecular mechanism studies of monoamine oxidase inhibition by selected chalcone analogs. Journal of enzyme inhibition and medicinal chemistry; 34(1) 863-879. (2019). PMID: 30915862
144 Presentations:
Published Abstracts: 1. Selected for poster: Ashraf UM, and Kumarasamy S. Role of COUP-TFII in Glucose Homeostasis in Dahl Salt Sensitive Rats. The FASEB Journal 32: lb480-lb480, (2018).
2. Seclted for Oral: Ashraf, U., Durairajpandian, V., Kumarasamy, S. Coup-TFII is a Novel Regulator of the TGF-β pathway in renal fibrosis mediating the SMAD signaling cascade. Hypertension 74, A132 (2019).
Invited Speaker:
1. Competitively Selected for Oral presentation at the 45th Annual Pharmacology Research Colloquium at Michigan State University. “Novel look into Coup-TFII role in gluconeogenesis and β-oxidation in the Dahl Salt Sensitive Rat”. May 2018.
2. Competitively Selected for Oral presentation at the 2019 Graduate Research Forum at the University of Toledo College of Medicine and Life sciences. “Coup- TFII regulates SMAD signaling in the kidney of the Dahl Salt Sensitive Rat”. March 2019.
3. Competitively Selected for Oral presentation at the 2019 Gull Lake hypertension meeting at Michigan State University. “Coup-TFII plays a major role in the TGF- β pathway under high salt diet”. May 2019
4. Competitively Selected for Oral presentation at the 46th Annual Pharmacology Research Colloquium the University of Toledo. “How the Chicken ovalbumin upstream promoter transcription factor-II became a candidate gene for hypertension”. June 2019.
5. Competitively Selected for Oral presentation at the Ohio Physiological society 34th annual meeting in Dayton, OH. “Targeted disruption of Coup-TFII leads to decrease in renal fibrosis by increasing SMAD7 levels”. September 2019.
Poster presentations:
1. Ashraf, U., Kumarasamy, S. A look into Coup-TFII role in glucose homoeostasis and blood pressure regulation in Dahl SS rats. 4/28/2018. Central Society for Clinical and Translational Research (CSCTR), Chicago, IL
145 2. Ashraf, U., Durairajpandian, V., Kumarasamy, S. Targeted Disruption of Coup- TFII leads to decrease in renal fibrosis by increasing SMAD7 levels. 9/22/2019. Ohio Physiological Society. Dayton OH
3. Ashraf, U., Mell, B., Kumarasamy, S. Transcriptomic analysis of Resp18mutant rat kidney reveals upregulation of the renin-angiotensin system. 4/03/2020. Central Society for Clinical and Translational Research (CSCTR), Chicago, IL
Press Release:
1. Story in the Toledo Blade newspaper, Usman Ashraf, “UT researcher explores salt sensitivity and blood pressure.” February 2020. Press. Web.
146