Understanding the Role of Ku80 C-Terminal Region in Non-Homologous End Joining

University of Calgary PRISM: University of Calgary's Digital Repository

Graduate Studies The Vault: Electronic Theses and Dissertations

2015-12-14 A Tale of a ‘Tail’ – Understanding the Role of Ku80 C-terminal Region in Non-Homologous End Joining

Radhakrishnan, Sarvan Kumar

Radhakrishnan, S. K. (2015). A Tale of a ‘Tail’ – Understanding the Role of Ku80 C-terminal Region in Non-Homologous End Joining (Unpublished doctoral thesis). University of Calgary, Calgary, AB. doi:10.11575/PRISM/25052 http://hdl.handle.net/11023/2671 doctoral thesis

University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca UNIVERSITY OF CALGARY

A Tale of a ‘Tail’ – Understanding the Role of Ku80 C-terminal Region in Non- Homologous End Joining

Sarvan Kumar Radhakrishnan

A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

GRADUATE PROGRAM IN BIOCHEMISTRY AND MOLECULAR BIOLOGY

CALGARY, ALBERTA

DECEMBER, 2015

repair pathway in mammalian cells. The first step in NHEJ is recognition of DSBs by the

Ku heterodimer and subsequent recruitment of DNA-dependent protein kinase catalytic

subunit (DNA-PKcs), a serine/threonine protein kinase, to form the DNA-PK complex.

This complex aligns DSB ends, activates Artemis endonuclease activity and finally

recruits XRCC4-DNA ligase IV, which ligates DNA ends. The Ku heterodimer consists

of 70 and 80 kDa subunits and is conserved throughout evolution. It has been

suggested that the extreme C-terminal 14 amino acids of Ku80 is required for DNA-

PKcs recruitment and activation. However, another study demonstrated that deletion of

the Ku80 C-terminal region (CTR) does not abolish DNA-PKcs activation. Thus, there is considerable ambiguity regarding the role of the Ku80 CTR in DNA-PKcs recruitment and activation.

The aim of this study is to understand the role of Ku80 CTR in NHEJ with focus on its ability to recruit and activate DNA-PKcs kinase activity. Using clonogenic cell survival assays, I confirmed that hamster cells expressing Ku80 CTR deletions are radiosensitive and also showed sensitivity to other DSB inducing agents such as doxorubicin and neocarzinostatin. I then generated Ku80 C-terminal deletions (Ku80

residues 1-718 and 1-569), cloned them into baculovirus vectors and expressed and purified the corresponding Ku heterodimers from insect cells. In vitro

autophosphorylation reactions, in presence of calf-thymus DNA, using purified proteins showed that Ku heterodimer with Ku80 residues 1-718 showed only a slight defect in

DNA-PKcs autophosphorylation, whereas heterodimer with Ku80 residues 1-569 had significant defects in multiple DNA-PKcs autophosphorylation sites. Surprising results

ii were observed when defined DNA structures such as 25 base pair (bp) blunt ended double stranded (ds) DNA was used. Deletion of the entire Ku80 CTR (residues 570-

732) lead to abrogation of DNA-PKcs kinase activity and inability to interact with DNA-

PKcs protein. On the other hand, deletion of extreme C-terminal 14 amino acids of Ku80 did not affect DNA-PKcs kinase activity but showed defects in its ability to interact with

DNA-PKcs. These defects may underlie the radiation and chemosensitivity of Ku80

CTR deletion mutants.

iii Acknowledgements

The work presented discussed here would not have been possible without the support of Dr. Susan P. Lees-Miller. It’s been a nice experience working with her. I realized that the most important thing in science is to be able to work with your mentor and colleagues, in spite of the intellectual differences. Dr. Lees-Miller has been a great supervisor in that respect. After all no one knows who’s right or wrong in that particular moment in science. Importantly, I would like to thank her for providing the financial support for the entire duration of my studies.

I would like to thank my supervisory committee, Drs. Jennifer A. Cobb and Justin A.

MacDonald, for helping me stay focused and ask relevant questions during my PhD. I would also like to thank Dr. Greg B.G Moorhead, who agreed to be my co-supervisor in time of need. I really appreciate the Robson DNA Science Centre (formerly, Genome

Instability and Aging Group) and Arnie Charbonneau Cancer Institute, work in progress meetings and journal clubs for helpful suggestions and to hone my presentation skills.

I thank members of the Lees-Miller lab, past and present, for their scientific feedbacks during lab meetings and also, for making it fun to work in the lab. I would like to thank

Dr. Yaping Yu and Ms. Shujuan Fang in helping me with the cloning experiments and providing an uninterrupted supply of purified proteins, specifically DNA-PKcs. I would also like to thank Drs. Aaron Goodarzi and Karolin Klement for allowing me to use cell culture facility and teaching me to set up the baculovirus expression system, during the course of my project. Special mention to all the administrative, technical and support staff of Arnie Charbonneau Cancer Institute.

iv I would like to mention the unwavering support of my family members. All the experiments were performed by me, but in spirit this degree belongs to them, especially my parents.

Finally, I would like to thank my previous lab supervisor Dr. Xi-Long Zheng, who initially accepted me as a PhD student in his lab, and welcomed me to Canada. I have been lucky to make some great friends in his lab.

v Table of Contents Abstract ...... ii Acknowledgements ...... iv Table of Contents ...... vi List of Tables ...... x List of Figures and Illustrations ...... xi List of Symbols, Abbreviations and Nomenclature ...... xv

CHAPTER ONE: INTRODUCTION ...... 1 1.1 DNA damage as a threat to genomic integrity ...... 2 1.2 DNA Double Strand Break (DNA DSB) repair ...... 3 1.2.1 Homologous recombination repair (HRR) ...... 4 1.2.2 Alternative non-homologous end-joining (A-NHEJ) ...... 6 1.2.3 Non-homologous end-joining (NHEJ) ...... 6 1.3 V(D)J recombination ...... 7 1.4 IR induced foci (IRIF) ...... 7 1.5 NHEJ ...... 10 1.5.1 Ku heterodimer ...... 13 1.5.1.1 Ku in DSB repair ...... 17 1.5.1.2 Ku removal from DNA ...... 19 1.5.1.3 Ku in telomere biology ...... 19 1.5.1.4 Other functions of Ku ...... 22 1.5.2 DNA-PKcs ...... 23 1.5.2.1 DNA-PKcs structure ...... 24 1.5.2.2 DNA-PKcs in DSB repair...... 26 1.5.2.3 DNA-PKcs in mitosis ...... 28 1.5.2.4 DNA-PKcs in transcription...... 29 1.5.3 End processing factors and other proteins involved in NHEJ ...... 30 1.5.3.1 Artemis ...... 30 1.5.3.2 PNKP ...... 31 1.5.3.3 APLF ...... 32 1.5.3.4 Aprataxin ...... 33 vi 1.5.3.5 DNA polymerases ...... 33 1.5.4 XRCC4-Ligase IV (X4-L4) ...... 34 1.5.5 XLF ...... 37 1.5.6 PAXX ...... 38

CHAPTER TWO: MATERIALS AND METHODS ...... 39 2.1 Reagents ...... 40 2.2 Cell lines used in the study ...... 40 2.3 DNA Sequencing and primer synthesis ...... 40 2.4 Cloning Vectors ...... 41 2.5 Recombinant protein expression and purification from E. coli ...... 42 2.6 In vitro GST-pull down assay with purified proteins ...... 43 2.7 Preparation of cell extracts ...... 43 2.8 NET-N whole cell extracts ...... 44 2.9 Hypotonic/Hypertonic cell extracts (S10/P10 extract) ...... 44 2.10 Immunoprecipitation protocol ...... 45 2.11 Immunoprecipitation followed by mass spectrometry to determine DNA-PKcs interacting proteins...... 47 2.12 SDS-PAGE and Immunoblotting ...... 48 2.13 Gel staining protocols ...... 49 2.13.1 Coomassie staining protocol ...... 49 2.13.2 Silver staining protocol ...... 49 2.14 DNA cellulose pull down assay ...... 49 2.15 Drug treatment ...... 50 2.16 Ionizing radiation (IR) treatment ...... 51 2.17 Clonogenic cell survival assay ...... 51 2.18 Cell cycle analysis by Fluorescence Activate Cell Sorting (FACS) ...... 51 2.19 NHEJ reporter assay ...... 52 2.20 Cloning of Ku70 and Ku80 cDNA into baculovirus vector ...... 52 2.20.1 Polymerase chain reaction (PCR) reaction conditions ...... 52 2.21 Generation of recombinant bacmids ...... 53 2.22 Baculovirus generation and amplification ...... 54 vii 2.23 Protein expression and purification ...... 55 2.24 Purified DNA-PKcs ...... 57 2.25 DNA structures used in the study ...... 57 2.26 DNA-PKcs kinase assays using the p53 peptide substrate assay ...... 57 2.27 DNA-PKcs autophosphorylation determination using phosphospecific antibodies ...... 58 2.28 Biotin pull down assays ...... 59 2.29 Electrophoretic mobility shift assay (EMSA) ...... 60 2.30 Mass spectrometry analysis ...... 61 2.31 Image quantitation and statistical analysis ...... 61

CHAPTER THREE: PROTEIN PHOSPHATASES IN NON-HOMOLOGOUS END JOINING ...... 64 3.1 Introduction ...... 65 3.1.1 Protein phosphatase 1 (PP1) ...... 66 3.1.1.1 PP1 in the DNA damage response ...... 67 3.1.2 Protein phosphatase 2A (PP2A) ...... 68 3.1.2.1 PP2A in DNA damage ...... 69 3.1.3 Protein phosphatase regulation of DNA-PKcs function ...... 71 3.1.4 Bromodomain-containing protein 4 (BRD4) ...... 72 3.2 Rational and Hypothesis ...... 73 3.2.1 Specific Aims ...... 73 3.3 Results ...... 73 3.4 Discussion ...... 97 3.4.1 Co-immunoprecipitation to detect protein-protein interaction ...... 97 3.4.2 Protein phosphatases in DNA damage ...... 101

CHAPTER FOUR: THE ROLE OF THE KU80 C-TERMINAL REGION IN NON-HOMOLOGOUS END JOINING ...... 105 4.1 Introduction ...... 106 4.2 Rational and Hypothesis ...... 110 4.2.1 Specific aims ...... 110

viii 4.3 Results ...... 111 4.3.1 Bioinformatics analysis and GST-pull down assays ...... 111 4.3.2 Ku expression and cell cycle profile analysis of xrs6, hamster cells 114 4.3.3 Clonogenic cell survival assays ...... 118 4.3.4 Baculovirus expression and purification of Ku heterodimers ...... 124 4.3.5 DNA-PKcs kinase activity and biotin pull down assays ...... 128 4.4 Discussion ...... 142

CHAPTER FIVE: CONCLUSIONS AND FUTURE DIRECTIONS ...... 149

REFERENCES ...... 157

APPENDIX A: PURIFICATION OF KU HETERODIMERS FROM INSECT CELLS USING BACULOVIRUS SYSTEM...... 185

ix List of Tables Table 1-1 Disorders associated with defects in proteins involved in the NHEJ pathway...... 11

Table 2-1 List of primers used for cloning Ku70 full length and truncations into pFastbac1 vector, Ku80 full length and truncations into pFastbac HTA and pGEX6P1 plasmid...... 41

Table 2-2 List of primers used for sequence verification...... 41

Table 2-3 The PCR conditions for cloning...... 53

Table 2-4 List of DNA substrates used for DNA-PKcs kinase assay, biotin pull down assay, and EMSA...... 59

Table 2-5 List of antibodies, and the conditions, used for western blotting...... 62

Table 3-1 Classification of human protein phosphatase...... 66

Table 3-2 List of PP2A regulatory B subunits...... 70

Table 3-3 Mass spectrometry data to identify DNA-PKcs interacting proteins...... 93

Table 4-1 Summary of results...... 141

x List of Figures and Illustrations Figure 1-1 DSB repair pathways available in cells...... 4

Figure 1-2 Schematic of V(D)J recombination...... 8

Figure 1-3 IR induced γH2AX foci formation at DSB sites...... 9

Figure 1-4 Schematic of the general steps involved in the NHEJ pathway...... 13

Figure 1-5 Domain organization, crystal structure and SAXS envelope of Ku bound to DNA...... 15

Figure 1-6 Diagram depicting the different functions of Ku in cells...... 21

Figure 1-7 Domain organization and crystal structure of DNA-PKcs...... 25

Figure 1-8 Domain organization of the Artemis endonuclease...... 31

Figure 1-9 Domain organization of PNKP, APLF, and Aprataxin...... 32

Figure 1-10 Domain organization of the pol X family of DNA polymerases...... 34

Figure 1-11 Diagram depicting the domain organization of XRCC4 and DNA ligase IV...... 36

Figure 1-12 Domain organization of XLF...... 38

Figure 1-13 Domain organization of PAXX...... 38

Figure 2-1 The domain organization of DNA-PKcs and the corresponding epitopes recognized by the DNA-PKcs antibodies...... 46

Figure 2-2 The domain organization of Ku70 and the corresponding epitope recognized by the Ku70.30 antibody used to immunoprecipitate the Ku heterodimer...... 46

Figure 3-1 PP2A complex composition...... 69

Figure 3-2 A potential PP1 binding site, GILK motif, in DNA-PKcs...... 74

Figure 3-3 Lack of evidence for an interaction between DNA-PKcs and PP1c...... 76

Figure 3-4 Western blotting to validate the specificity of the PP1 isoform-specific antibodies...... 77

Figure 3-5 Lack of evidence for interaction of DNA-PKcs and Ku with the α isoform of PP1 (PP1 α)...... 78

xi Figure 3-6 Lack of evidence for interaction of DNA-PKcs and Ku with the β isoform of PP1 (PP1β)...... 79

Figure 3-7 Lack of evidence for an interaction between DNA-PKcs and Ku and the γ isoform of PP1 (PP1γ)...... 80

Figure 3-8 PP2A-Aα and PP2A-Cα subunits interact with DNA-PKcs, as determined by immunoprecipitation with the DPK1 antibody...... 82

Figure 3-9 Interaction of endogenous PP2A-Aα and PP2A-Cα with DNA-PKcs was not observed when DNA-PKcs was immunoprecipitated with the 42-27 monoclonal antibody...... 84

Figure 3-10 Interaction of Flag-tagged PP2A-Aα and PP2A-Cα with DNA-PKcs was not observed when PP2A was immunoprecipitated with the Flag antibody...... 85

Figure 3-11 Interaction of PP2A-Aα and PP2A-Cα with Ku heterodimer was not observed as determined by co-immunoprecipitation with the Ku 70.30 antibody. .. 86

Figure 3-12 PP2A- A α and PP2A-C α subunits interact nonspecifically with DNA- PKcs polyclonal antibody, DPK1...... 87

Figure 3-13 The DNA-PKcs antibody, DPK1, detects a band at 65 kDa that corresponds to the PP2A-c subunit...... 89

Figure 3-14 ClustalW2 alignment of the DPK1 antibody epitope (2018 – 2136) and the PP2A-Aα subunit showed minor sequence conservation...... 90

Figure 3-15 Immunoprecipitation of DNA-PKcs with monoclonal antibody, 18-2, followed by silver staining and identification of interacting bands by mass spectrometry...... 92

Figure 3-16 BRD4, a major DNA-PKcs interacting protein identified by MS analysis, showed no interaction with DNA-PKcs immunoprecipitated using the 42-27 monoclonal antibody...... 94

Figure 3-17 BRD4 immunoprecipitates with DNA-PKcs with the 18-2 antibody but not with the DPK1 antibody...... 95

Figure 3-18 BRD4 interacts nonspecifically with DNA-PKcs monoclonal antibody, 18- 2...... 96

Figure 3-19 NHEJ GFP reporter assay: transfection of 5µg ISce-I plasmid yields maximum possible number of GFP positive cell population...... 103

Figure 4-1 NMR structure of the Ku80 CTR...... 107

xii Figure 4-2 ClustalW2 alignment of the Ku80 CTR from different organisms demonstrates sequence conservation in higher eukaryotes but not in lower eukaryotes...... 112

Figure 4-3 Fragments of the Ku80 CTR interact with purified DNA-PKcs in vitro...... 114

Figure 4-4 Expression of Ku heterodimer in xrs6 cells and V3 cells verified by dsDNA cellulose pull-down assays...... 117

Figure 4-5 Xrs6 cells lacking Ku80 or complemented with Ku80 full-length or the Ku80 CTR mutant have similar cell cycle distribution profiles...... 118

Figure 4-6 Xrs6 cells expressing Ku80 (1-569) C-terminal truncation mutant are as radiosensitive as Ku null xrs6 cells...... 119

Figure 4-7 Clonogenic survival assay of xrs6 cells to different types of double stand break inducing drugs...... 121

Figure 4-8 Xrs6 cells are not sensitive to camptothecin...... 124

Figure 4-9 Schematic of baculovirus cloning and protein expression...... 125

Figure 4-10 Domain organization of full-length and mutant Ku70/80 heterodimer expressed and purified from insect cells...... 127

Figure 4-11 SDS PAGE and western blotting of final purified proteins...... 128

Figure 4-12 Truncation of the C-terminal of Ku80 in the Ku70/80 heterodimer leads to reduction in DNA-PKcs kinase activity...... 129

Figure 4-13 The Ku mutants are able to bind 25 base pair (bp) blunt ended double strand (ds) DNA but showed a defect in their ability to interact with DNA-PKcs. .. 131

Figure 4-14 The Ku core mutant is defective in its ability to support DNA-PKcs autophosphorylation as determined with 25 bp blunt ended dsDNA...... 133

Figure 4-15 Ku mutants are able to bind 25 bp dsDNA with a 15 nucleotide 5’ overhang but showed a defect in their ability to interact with DNA-PKcs...... 135

Figure 4-16 The Ku core mutant is defective in its ability to support DNA-PKcs autophosphorylation as determined using 25 bp dsDNA with a 15 nucleotide 5’ overhang...... 137

Figure 4-17 Ku mutants able to bind 25 bp dsDNA with a 15 nucleotide 3’ overhang but showed defect in interaction with DNA-PKcs...... 138

Figure 4-18 Ku core mutant defective in its ability to support DNA-PKcs autophosphorylation as determined using 25 bp dsDNA with a 15 nucleotide 3’ overhang...... 140 xiii Figure 4-19 DSB induction scenario in the context of chromatin...... 146

Figure 4-20 Ku80 C-terminal deletion leads to a defect in DNA-PKcs interaction and kinase activity, with an important role for DNA structure...... 147

Figure 5-1 Schematic depicting the possible role of the Ku80 CTR in the activation of DNA-PKcs kinase activity by dsDNA with blunt end structure...... 152

Figure 5-2 Schematic depicting the Ku heterodimer bound to a DSB in the presence of XRCC4 and XLF filaments...... 154

Figure A-1 Generation of plasmids containing Ku70 and Ku80 cDNAs and generation of bacmids containing Ku70 and Ku80 for expression in insect cells. 186

Figure A-2 Purification of Ku full-length heterodimer on a His trap (Ni2+-NTA) column followed by a DEAE column...... 188

Figure A-3 Purification of Ku full-length heterodimer on a heparin column...... 189

Figure A-4 Purification of Ku full-length heterodimer over a Mono Q column, followed by a single stranded DNA cellulose column...... 190

Figure A-5 Purification of the Ku70/80 LH mutant heterodimer using His trap and DEAE columns...... 191

Figure A-6 Purification of the Ku70/80 LH mutant heterodimer over a heparin column...... 192

Figure A-7 Purification of the Ku70/80 core mutant using His trap and DEAE...... 193

Figure A-8 Purification of Ku70/80 core mutant heterodimer was purified using heparin...... 194

xiv List of Symbols, Abbreviations and Nomenclature Symbol Definition 53BP1 p53-binding protein 1 A-NHEJ Alternate NHEJ APLF Aprataxin and PNK-like factor APTX Aprataxin AR Androgen receptor ATM Ataxia telangiectasia mutated ATR ATM and Rad3-related BER Base excision repair BLM Bloom syndrome protein bp Base pair BRCA2 Breast cancer type 2 susceptibility BRCT BRCA1 C-terminal CE Coding end Chk2 Checkpoint kinase 2 CHO Chinese hamster ovary CK2 Casein kinase 2 CPT Camptothecin CRISPR Clustered regularly interspaced short palindromic repeats Cryo-EM Cryo electron microscopy CSR Class switch recombination CT Computerized Tomography CT-DNA Calf thymus DNA CtIP C-Terminal Binding Protein Interacting Protein D-loop Displacement loop DNA Deoxyribonucleic acid DNA-PKcs DNA-dependent protein kinase catalytic subunit

xv ds Double stranded DSB Double strand break EMS Ethyl methanesulfonate EMSA Electrophoretic mobility shift assay EXO1 Exonuclease 1 FA Fanconi Anemia FACS Fluorescence-activated cell sorting FAS Fatty acid synthase FHA Forkhead-associated GST Glutathione S-transferase Gy Gray HC Heavy chain HEAT Huntingtin, Elongation factor 3, regulatory subunit A of PP2A, TOR1 His tag Histidine tag HIT Histidine triad HRR Homologous recombination repair HSC Hematopoietic stem cells ICL Interstrand cross link Ig Immunoglobulin IPTG Isopropylthio-β-galactoside IR Ionizing radiation

Kd Dissociation constant Ku Ku70/80 heterodimer LC Light chain LRR Leucine rich region MDC1 Mediator of DNA-damage checkpoint 1 MEM Minimum essential medium MMC Mitomycin C MMR Mismatch repair MRN Mre11, RAD50, Nbs1

xvi NAP1L Nucleosome assembly protein 1-like NCBI National Center for Biotechnology Information NEDD8 Neural precursor cell expressed, developmentally down-regulated 8 NER Nucleotide excision repair NHEJ Non-homologous end joining C-NHEJ Classical NHEJ NIRS Non-immune rabbit serum NMR Nuclear magnetic resonance nt. Nucleotide PAGE Polyacrylamide gel electrophoresis PARP1 Poly ADP ribose polymerase 1 pAS Protein A sepharose PAXX Paralog of XRCC4 and XLF PBZ Poly(ADP-ribose)-binding zinc finger pGS PGS PIKK Phosphoinositide 3-kinase-related protein kinases PLK1 Polo-like kinase 1 CDK1 Cyclin-dependent kinase 1 PNKP Polynucleotide kinase/phosphatase POT1 Protection of telomere 1 PRD PIKK regulatory domain RAP1 Repressor/activator protein 1 RNAPII RNA polymerase II holoenzyme RNF168 Ring finger protein 168 RNF8 Ring finger protein 8 ROS Reactive oxygen species RPA Replication protein A RSS Recombination signal sequence

xvii RS-SCID Radiation-sensitive severe combined immunodeficiency S Serine SAM S-Adenosyl methionine SAP SAF A/B, Acinus, PIAS SAXS Small-angle X-ray scattering SCID Severe combined immunodeficiency SDS Sodium dodecyl sulfate SE Signal end SPR Surface Plasmon Resonance ss Single stranded SSA Single strand annealing SSB Single strand break SSBR Single strand break repair SUMO Small ubiquitin-like modifier T Threonine TCR T-cell receptor TDP1 Tyrosyl-DNA phosphodiesterase 1 TDP2 Tyrosyl-DNA phosphodiesterase 2 TdT Terminal deoxynucleotidyl transferase TIN2 TRF2-interacting nuclear protein 2 TLC1 Telomerase component 1 TPP1 TINT1, PTOP, PIP1 TRF1 Telomere repeat factor 1 TRF2 Telomere repeat factor 2 USF Upstream Stimulatory Factor UV Ultraviolet VDJ Variable, Diversity, Joining vWA von Willebrand A domain WRN Werner syndrome ATP-dependent helicase X4-L4 XRCC4 – ligase IV complex

xviii XLF XRCC4-like factor XRCC4 X-ray repair complementing defective repair in Chinese hamster cells 4 XRCC5 X-ray repair complementing defective repair in Chinese hamster cells 5 XRCC6 X-ray repair complementing defective repair in Chinese hamster cells 6 Y Tyrosine γH2AX Histone H2AX phosphorylated at serine 139

xix

Chapter One: Introduction

1.1 DNA damage as a threat to genomic integrity

Genome integrity is constantly under threat, as thousands of DNA damaging events occur in cells each day. Mainly for this reason, cells have invested a lot of resources, in terms DNA repair pathways, to maintain genome integrity. DNA damage can occur as a result of fundamental cellular processes. For example, reactive oxygen species (ROS) are generated continuously as a consequence of metabolic and other –· biochemical reactions. These ROS include superoxide (O2 ), hydrogen peroxide (H2O2), · 1 hydroxyl radicals (OH ) and singlet oxygen ( O2). They can oxidize DNA, which can lead to several types of DNA damage such as generation of abasic sites and oxidized bases such as 8-oxoguanine (De Bont and van Larebeke 2004). Besides oxygen, another potential source of DNA damage is S‐adenosylmethionine (SAM), which is a reactive methyl group donor. DNA methylation plays an important role in processes such as gene regulation. Aberrant DNA methylation including the generation of 7- methylguanine, 3-ethyladenine, and O6-methylguanine. In addition, DNA bases are also susceptible to hydrolytic deamination, with cytosine and its homologue 5-methylcytosine being more susceptible (Lindahl and Barnes 2000, De Bont and van Larebeke 2004).

Environmental DNA damage can be produced by physical or chemical sources. An example of a physical genotoxic agent is ultraviolet (UV) rays from sunlight, which can induce up to 105 DNA lesions (pyrimidine dimers and 6-4 photoproducts) per cell per day (Hoeijmakers 2009). DNA damaging agents commonly used in medical settings include X-ray scans. Cancer treatment by chemotherapy drugs comprises a chemical source of DNA damage. These include: alkylating agents such as temozolomide which attaches alkyl groups to DNA bases, crosslinking agents such as mitomycin C (MMC), cisplatin, and nitrogen mustards that introduce covalent links between bases of the same DNA strand (intrastrand crosslinks) or of different DNA strands (interstrand crosslinks or ICLs). Other chemical agents, such as the topoisomerase inhibitors camptothecin (CPT), which inhibits topoisomerase I, induce the formation of single- strand breaks (SSBs) by trapping topoisomerase I - DNA covalent complexes (Ciccia and Elledge 2010).

Various repair mechanisms have evolved to counteract these lesions in cells. Mispaired DNA bases are replaced with correct bases by mismatch repair (MMR), and small chemical alterations of DNA bases are repaired by base excision repair (BER) through excision of the damaged bases. More complex lesions, such as pyrimidine dimers and intrastrand crosslinks, are corrected by nucleotide excision repair (NER). ICLs are excised by proteins involved in the genetic syndrome Fanconi anemia (FA), while SSBs are repaired by single-strand break repair (SSBR) pathways (Ciccia and Elledge 2010).

1.2 DNA Double Strand Break (DNA DSB) repair

Of the several different types of DNA lesions discussed above, none of them is as damaging as the DNA DSB. DSBs can be generated by endogenous as well as exogenous processes. Endogenously, ROS can cause DNA DSBs when both strands of DNA are damaged within ~ 10-15 bp. Also, replication fork collapse, such as when it encounters an SSB or a protein-DNA adduct, can lead to DNA DSB formation (Branzei and Foiani 2010). In addition, DSBs are purposely created in the cell in a regulated manner. For example, in immune system development, DSBs are created during antibody diversification through the processes of V (variable) D (diversity) J (joining) recombination (Schatz 2004) and class switch recombination (CSR) (Dudley, Chaudhuri et al. 2005). Another example is meiosis, where the Spo11 enzyme generates a DSB in a regulated manner to promote homologous recombination (HR), leading to greater recombination of genetic material (Keeney 2008). In some cases, uncapped or dysfunctional telomeres can also be recognized as DSBs by cells (Espejel, Franco et al. 2002). Exogenous agents such as background radiation (cosmic radiation and radon gas generated as a result of uranium decay), and ionizing radiation (IR) treatment used to treat cancer patients generates DSBs in addition to SSBs and base damage. In addition, chemotherapeutic drugs such as etoposide and doxorubicin generate DSBs by trapping topoisomerase II on DNA (Ciccia and Elledge 2010). DNA DSBs are considered the most lethal form of DNA damage. If left unrepaired or misrepaired, DSBs can lead to gross chromosomal loss or 3

rearrangements, reducing cellular viability and increasing the potential for cellular transformation. The repair of DNA DSBs can occur by non-homologous end-joining (NHEJ), homologous recombination repair (HRR) or alternative non-homologous end- joining (A-NHEJ) (Figure 1-1).

1.2.1 Homologous recombination repair (HRR)

During HRR, the homologous sister chromatid is used as a template to repair the damaged DNA strand in a mostly, error-free manner. The requirement of a sister

Figure 1-1 DSB repair pathways available in cells.

As soon as a DSB occurs, depending on the cell cycle phase, cells utilize either HRR, classical NHEJ or A-NHEJ. HRR is mainly active in late S and G2

phase whereas classical NHEJ is active throughout cell cycle. In HRR (left), the ends of the DSB undergo limited resection by the MRN complex in complex with CtIP. This is followed by more extensive 5’ to 3’ end-resection. BLM, a helicase, and EXO1 play major roles in this step. The resulting ssDNA is coated by the ssDNA binding protein RPA, which in turn is displaced by Rad51 which forms nucleofilaments, facilitated by BRCA2. This is followed by strand invasion and D-loop formation. Cells either choose to undergo crossover repair involving double Holliday junction formation or non-crossover repair. DSBs are also sensed by the Ku heterodimer (middle pathway). This pathway is discussed in detail later. In A-NHEJ (right), DSBs are sensed by PARP1, which is also facilitated by the MRN complex. The exact details of this pathway are currently under investigation. Current data suggests that A- NHEJ is active in the absence of classical NHEJ and it usually involves regions of microhomology. This is followed by flap trimming, and ligation which can be mediated by DNA ligase I or III.

chromatid limits the use of HRR for the repair of DSBs to S and G2 phases of the cell cycle. HRR is also the predominant pathway for maintaining the integrity of the genome in response to DSBs that arise during DNA replication fork breakdown. After a DSB occurs, the Mre11, RAD50, Nbs1 (MRN) complex binds to DNA to initiate end resection. The first step of resection is initiated by the MRN complex itself with help of C-Terminal Binding Protein Interacting Protein (CtIP) (Sartori, Lukas et al. 2007). The two proteins then digest the 5' ends on either side of the break to create short 3' overhangs of single-strand (ss) DNA. Another exonuclease, EXO1, together with the RecQ helicase, Bloom’s syndrome protein (BLM) mediates the processive stage of DSB resection to generate a large stretch of ssDNA terminating in a 3’-hydroxyl group (Mimitou and Symington 2008, Ciccia and Elledge 2010). The RPA protein, which has high affinity for ssDNA, then binds the ssDNA with the 3' overhang (Wold 1997). The Rad51 protein forms a filament on the nucleic acid, a process mediated by the breast cancer type 2 susceptibility (BRCA2) protein. This nucleoprotein filament then begins searching for DNA sequences similar to that of the 3' overhang. After finding such a sequence, the single-stranded nucleoprotein filament invades the similar or identical recipient DNA duplex, a process called strand invasion. The resulting structure, a displacement loop (D-loop), formed during strand invasion is extended by DNA

polymerases (Moynahan and Jasin 2010). This results in a cross-shaped structure known as a Holliday junction. Alternatively, in the presence of repetitive DNA sequences ssDNA annealing (SSA) is carried out by annealing the resected 3’ ssDNA which could be catalyzed by RAD52, followed by removal of DNA flaps by XPF/ERCC1 (Moynahan and Jasin 2010).

1.2.2 Alternative non-homologous end-joining (A-NHEJ)

Recent studies have suggested the operation of a third pathway of DSB repair.

This pathway repairs DSBs slowly (t1/2 up to 20h) (Mladenov and Iliakis 2011). This repair pathway is considered to be an alternative form of NHEJ (A-NHEJ), since it is suppressed by classical NHEJ (Simsek and Jasin 2010) and maybe by HRR as well (Wu, Wang et al. 2008). This pathway comes into picture only when the other two processes are defective. Molecular mechanisms and various proteins involved in the pathway are currently under investigation. Presently, it is thought that although A-NHEJ does not require homology for function, it could be occasionally facilitated by microhomologies found at the DNA ends (McVey and Lee 2008). This is highly likely when resection and the generation of ssDNA regions precede end-joining. A-NHEJ is considered more error prone than C-NHEJ in that DNA sequence alterations at junctions are more frequent and more extensive and the probability of chromosomal translocation is much higher (Boboila, Jankovic et al. 2010, Dueva and Iliakis 2013). There are terms, such as V(D)J recombination, IR induced foci, that are mentioned occasionally throughout this written document. Below I have given an overview of these terms to put things into context.

1.2.3 Non-homologous end-joining (NHEJ)

Discussed in detail later.

1.3 V(D)J recombination

An individual clone of mature B-cells expresses immunoglobulin (Ig) molecules as an antigen receptor (Figure 1-2 A). The typical subunit of an Ig molecule consists of two identical heavy chains (HC) and two identical light chains (LC). The N-terminal region of these chains contains the highly variable antigen binding site; whereas the C- terminal part is called the constant region (C region). The C region of the IgH chain (CH) determines the effector functions of antibodies, which are the secreted form of Ig molecules. Immunoglobulin and T-cell receptor (TCR) variable region exons are assembled from large arrays of V(D)J gene segments during the development, respectively, of B and T lymphocytes. V(D)J recombination occurs only between two gene segments flanked by recombination signal sequences (RSSs) that contain 12- and 23 bp spacers (12 RSSs and 23 RSSs), referred to as the 12/23 rule (Schatz 2004). V(D)J recombination is initiated via introduction of DSBs between the V, D, and J segments and the flanking RSSs. Subsequently, RSS ends, also called signal joints, are precisely joined, while coding ends are modified via a process that involves potential nucleotide loss and potential nucleotide addition, which is required to generate antibody diversity (Figure 1-2 B). The joining phase of the V(D)J recombination reaction is carried out primarily by the NHEJ pathway. Once a functional immunoglobulin chain is expressed, allelic exclusion operates through a feedback mechanism to prevent further rearrangements of IgH and IgL chain genes (Schatz 2004, Dudley, Chaudhuri et al. 2005, Haines, Ryu et al. 2006, Perlot and Alt 2008).

1.4 IR induced foci (IRIF)

In mammalian cells, phosphorylation of the subtype of histone H2A, called H2AX, at serine139 occurs in response to DSB formation. The phosphorylated form of H2AX is called γH2AX (Rogakou, Pilch et al. 1998). H2AX constitutes 2-25% of nucleosomes depending on cell type (Kinner, Wu et al. 2008). Histone H2AX is a substrate of several phosphoinositide 3-kinase-related protein kinases (PIKKs), such as ATM (ataxia telangiectasia mutated), ATR (ATM and Rad3-related), and DNA-dependent protein

Figure 1-2 Schematic of V(D)J recombination.

A) General outline of V(D)J recombination. The RAG1/2 endonuclease initiates V(D)J recombination by creating an SSBs at RSS sites within the V, D, and J segments. D-J segments are joined first, followed by V-DJ segments. B) RAG1/2 cleaves at signal sequences to create closed hairpin coding ends

(CEs) and blunt-ended signal ends (SEs). SEs are maintained in the post- synaptic cleavage complex by RAG1/2. The CEs require processing by DNA- PKcs, Artemis, and TdT before ligation by NHEJ.

Figure 1-3 IR induced γH2AX foci formation at DSB sites.

Images above shows IR induced foci of S139 phosphorylated H2AX in xrs6 cells. Cells were either left unirradiated or irradiated with 2 Gy and incubated for 30 min. at 37oC. After that, cells were fixed in 3% (w/v) paraformaldehyde containing 2% (w/v) sucrose in PBS and permeabilized with 0.2% (v/v) Triton X-100. Cells were then stained with a primary antibody to γH2AX and Alexa fluor 594 anti-mouse as secondary antibody. Cells were mounted on slides with medium containing DAPI to stain DNA. Images were taken using spinning disk confocal microscopy.

kinase catalytic subunit (DNA-PKcs). ATM kinase, and to some extent DNA-PKcs, are considered to phosphorylate H2AX in response to DSB formation (Stiff, O'Driscoll et al. 2004). Each IR-induced γH2AX focus represents a single DSB, at least in G1 phase cells (Figure 1-3). Depending on the cell line, 0.03-0.06% of H2AX molecules per DSB can become phosphorylated and phosphorylation spreads over 2 Mbp regions of chromatin (Rogakou, Boon et al. 1999). Phosphorylated H2AX has been shown to recruit several factors in response to IR treatment such as MDC1, RNF8, RNF168 or

53BP1, which in turn form foci and may play a role in cell cycle arrest (van Attikum and Gasser 2009, Goodarzi and Jeggo 2012).

1.5 NHEJ

NHEJ is the major pathway for repairing DSBs in cells. It is active throughout the cell cycle. For ease of understanding, it can be divided into three steps – 1) DSB detection and synapsis, 2) end processing, and 3) ligation (Figure 1-4). Although for a while it was thought that NHEJ occurs sequentially, emerging evidence suggest that is not the case. NHEJ is initiated by the binding of the Ku70/80 heterodimer to DNA DSB ends. Ku is highly abundant in mammalian cells and has extremely high affinity for DNA ends. DNA bound Ku promotes the recruitment of DNA-PKcs, generating the DNA-PK complex and activating its protein kinase activity. DNA-PK complex assembly promotes recruitment of a ligation complex that promotes the final end-joining step. The final step is DSB ligation which is mediated by DNA ligase IV, which forms a tight complex with X- ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4). Another factor, XRCC4 like factor (XLF), stimulates the activity of the XRCC4-ligase IV complex. Also, a newly identified factor paralog of XRCC4 and XLF (PAXX) seems to play a role in NHEJ as well (Ochi, Blackford et al. 2015, Xing, Yang et al. 2015). Loss of any of the ‘core’ NHEJ proteins in cells or mice confers dramatic radiosensitivity, consistent with the notion that NHEJ represents the major DSB repair pathway in mammalian cells (Mahaney, Meek et al. 2009, Ciccia and Elledge 2010, Radhakrishnan, Jette et al. 2014). Apart from the core factors, depending on the type of DSB lesion, NHEJ might require end processing factors such as polynucleotide kinase/phosphatase (PNKP), Artemis, APLF, DNA polymerases, pol λ, pol μ, and helicases such as Werner’s syndrome protein (WRN) (Mahaney, Meek et al. 2009). Table 1.1 lists the deficiencies in NHEJ proteins reported in clinic so far. More details can be found in the following review (Woodbine, Gennery et al. 2014).

Table 1-1 Disorders associated with defects in proteins involved in the NHEJ pathway.

Protein Human mutation Syndrome References

(Woodbine, Neal et al. 2013, DNA-PKcs Radiosensitive T- Mathieu, B- severe Verronese combined et al. 2015) immunodeficiency (RS-SCID) (Moshous, Pannetier et al. 2003, Lee, Artemis RS-SCID Woodbine et al. 2013)

Progressive ataxia, neurological (Guo, defects but normal Nakazawa XRCC4 immune system et al. 2015)

Ligase IV (Riballo,

RS-SCID, Critchlow et neutropenia, al. 1999, pancytopenia, and van der increased risk of Burg, van carcinogenesis Veelen et al. 2006) (Cantagrel, Immune Lossi et al. deficiency, 2007, Turul, XLF microcephaly Tezcan et al. 2011)

No patient mutations Ku70/80 observed so far

Figure 1-4 Schematic of the general steps involved in the NHEJ pathway.

A model for NHEJ depicting the central role of the Ku70/80 heterodimer. DSBs are detected by the Ku70/80 heterodimer, which interacts with multiple components of the NHEJ pathway, including DNA-PKcs, XLF, WRN, APLF, and newly identified factor PAXX, helping them get recruited at the DSB site. Non-ligatable end groups, if any, are processed by various enzymes for example PNKP, and gap filling by DNA polymerases mu and lambda. DSBs are ligated by DNA ligase IV, which exists in complex with XRCC4. How Ku is removed from DSBs is unknown, but may involve proteolytic degradation. Direct protein–protein interactions are indicated by black lines. The AP lyase activity of Ku is shown by the red arrow. ATM and DNA-PK dependent phosphorylation events are shown by red and blue P symbols, respectively. Adapted and modified from (Wang and Lees-Miller 2013, Radhakrishnan, Jette et al. 2014).

1.5.1 Ku heterodimer

The first step in NHEJ is widely accepted as the detection of the DSB ends by the Ku70/80 heterodimer (Ku). Human Ku is composed of 69 kDa and 83 kDa subunits,

also called Ku70 and Ku80 subunits, respectively. The human XRCC6 (Ku70) gene maps to chromosome 22q13 and the XRCC5 (Ku80) gene maps to 2q35 (NCBI website). Ku was first identified as an autoimmune antigen in patients with scleroderma- polymyositis overlap syndrome (Mimori, Akizuki et al. 1981). Initial studies using random mutagenesis of Chinese hamster ovary (CHO) cells with ethyl methanesulphonate (EMS) identified 6 strains that they named x-ray sensitive (xrs) that were sensitive to IR and bleomycin treatment, but resistant to UV-irradiation (Kemp, Sedgwick et al. 1984). Subsequently, these mutants were characterized and cloning of the gene revealed defects in the XRCC5 gene (Taccioli, Gottlieb et al. 1994, Singleton, Priestley et al. 1997). Since then a number of studies have been conducted to understand the molecular mechanism of the radiosensitive and V(D)J recombination defective phenotype. Ku70 or Ku80 knockout mice have been generated and characterized. Ku- deficient mice are smaller in size, ~40%-60% of the weight of control littermates. Ku70 and Ku80 form an obligate heterodimer, and the loss of one Ku subunit leads to severely reduced levels of the other (Nussenzweig, Chen et al. 1996, Zhu, Bogue et al. 1996, Gu, Jin et al. 1997, Ouyang, Nussenzweig et al. 1997). Ku-deficient animals are hypersensitive to IR (Nussenzweig, Sokol et al. 1997). Ku-deficient animals also show severe combined immunodeficiency (SCID), and fail to generate functional T and B lymphocytes effectively, due to defects in V(D)J recombination (Nussenzweig, Chen et al. 1996, Zhu, Bogue et al. 1996). Ku deficient mice show defects in both coding and signal joint formation. These findings are in line with data from Ku80-deficient rodent cell lines (e.g., xrs6), which have revealed severe defects in both signal and coding joint formation (Pergola, Zdzienicka et al. 1993, Taccioli, Rathbun et al. 1993, Taccioli, Gottlieb et al. 1994, Smith and Jackson 1999). Mouse cells deficient for Ku80 display a marked increase in chromosomal aberrations, including breakage, translocations and aneuploidy (Difilippantonio, Zhu et al. 2000).

Figure 1-5 Domain organization, crystal structure and SAXS envelope of Ku bound to DNA.

A) The Ku70/80 heterodimer. Schematic of Ku70 (upper) and Ku80 (lower) showing regions of interaction with DNA-PKcs. The N-terminal region of Ku70 (amino acids 1–33) is disordered. Ku70 contains an N-terminal von Willebrand domain (vWA) (amino acids 35–249), a core domain (amino acids 266–529) and a C-terminal SAF-A/B, Acinus, PIAS (SAP) domain (amino acids 561–609), which is linked to the core domain via a disordered linker region (amino acids 536–560). Ku80, like Ku70, shows similar domain organization with a vWA domain (amino acids 7–237), a core domain (amino acids 244–543) and a unique CTR (amino acids 544–732). Amino acids 544– 591 are predicted to be disordered and are followed by a globular region (amino acids 594–704) followed by another disordered region (amino acids 705–732). Extreme C-terminal 12 amino acids of Ku80 have been shown to interact with DNA-PKcs (Gell and Jackson 1999). B) Crystal structure of truncated Ku70/80 heterodimer bound to DNA. Ku70 is colored red and Ku80

is orange. The grey colored region in the centre is 14 bp dsDNA. Light grey is the sugar phosphate backbone and dark grey are bases (Walker, Corpina et al. 2001). C) SAXS envelope of full length Ku bound to 16 bp dsDNA. Red is DNA, and the arrow indicates the Ku80 CTR projecting away from the DNA end (Hammel, Yu et al. 2010). See text for details.

Ku is conserved across species, from bacteria to humans, although there is only 20% sequence identity (Boulton and Jackson 1996). Eukaryotic Ku70 and Ku80 subunits contain three domains: an N-terminal von Willebrand A (vWA) domain; a central core domain required for DNA binding and dimerization; and a unique C-terminal domain (Figure 1-5). The dimerization interface has been mapped within the C-terminal 20 kDa of the Ku70 subunit and the C-terminal 32 kDa of Ku80 (Wu and Lieber 1996, Dynan and Yoo 1998). The C-terminal region of Ku70 contains a SAP (SAF-A/B, Acinus and PIAS) domain, which is a putative chromatin/DNA binding domain (Aravind and Koonin 2000). The CTR of Ku80 forms a long flexible arm that may be involved in protein-protein interactions (Harris, Esposito et al. 2004, Zhang, Hu et al. 2004, Hammel, Yu et al. 2010), and, at the extreme C-terminus, a conserved region that is required for interaction with DNA-PKcs (Gell and Jackson 1999, Falck, Coates et al. 2005). Ku loads onto the DNA such that Ku70 faces proximal to the DNA end, and Ku80 on the distal side, facing away from the end. The two subunits of Ku form an asymmetric ring with an expansive base and a narrow bridge (Walker, Corpina et al. 2001). Furthermore, the crystal structure shows that the two subunits dimerize through the central domain to form a ring capable of accommodating two turns of dsDNA (approximately 14 base pairs). This ring is lined with positively charged residues positioned to interact with the sugar phosphate backbone, hence explaining the DNA sequence-independent manner of Ku binding (Walker, Corpina et al. 2001, Downs and Jackson 2004).

1.5.1.1 Ku in DSB repair

Ku is a highly abundant protein molecule in human cells (400,000 molecules –9 /cell) (Mimori, Hardin et al. 1986). Ku binds dsDNA ends with high affinity (Kd 10 M),

including 5′- or 3′- overhangs and blunt ends (Blier, Griffith et al. 1993, Dynan∼ and Yoo 1998, Arosio, Cui et al. 2002). Ku shows significantly less affinity for ssDNA ends and circular DNA (Blier, Griffith et al. 1993). This high affinity of Ku binding to DNA ends is probably to prevent nucleolytic processing of DSB ends (Mimitou and Symington 2010). Unlike many DNA damage response proteins which form IR induced foci, Ku does not seem to form any distinct foci at the site of DNA damage (Bekker-Jensen, Lukas et al. 2006). This is supported by an in vitro study, showing that only one or two Ku molecules were able to load onto a chromatin substrate (Roberts and Ramsden 2007). Studies conducted using super-resolution microscopy visualized Ku molecules at the DSB sites. Computational analysis suggested that on average there could be 1 Ku molecule present per side of DSB in vivo, probably one at each side of the DSB (Britton, Coates et al. 2013, Reid, Keegan et al. 2015).

Ku has been observed to show translocation along DNA molecules in an ATP- independent manner (de Vries, van Driel et al. 1989). Also, electrophoretic mobility shift assays (EMSA) showed that when two DNA termini are capable of base pairing, Ku can transit directly from one linear DNA molecule to another (Mimori and Hardin 1986, de Vries, van Driel et al. 1989). DNA foot printing analysis showed the presence of Ku at internal sites as well as the termini of linear DNA molecules (Bliss and Lane 1997). However, the relevance of this property in cells is unknown. It is possible that Ku utilizes this property to juxtapose the DNA termini. Consistent with this, atomic force microscopy studies have revealed the existence of internal as well as DNA end-bound DNA-PK complexes, and that Ku can juxtapose two DNA ends via a DNA looping mechanism (Cary, Peterson et al. 1997, Pang, Yoo et al. 1997, Smith and Jackson 1999). DNA bound Ku recruits DNA dependent protein kinase catalytic subunit (DNA- PKcs), a PIKK family member [discussed in detail later], together this complex is known as the DNA-PK complex. DNA-PKcs kinase activity is important for successful DNA

DSB repair, as loss of or inhibition of DNA-PKcs kinase activity, strongly diminishes NHEJ efficiency (Kurimasa, Kumano et al. 1999, Kienker, Shin et al. 2000, Zhao, Thomas et al. 2006).

IR is known to produce different types of damage to the DNA, generating non- ligatable end groups such as 3′-phosphate groups, 5′-hydroxyl groups, or 3′- phosphoglycolates (Povirk 2012). These complex ends require processing factors such as nucleases (Werner, Artemis, ExoI), polymerases (DNA polymerases μ and λ), helicases (RECQ1), and phosphodiesterases (tyrosyl-DNA phosphodiesterase 2) (Gomez-Herreros, Romero-Granados et al. 2013) that may be required to produce ligatable DNA ends (Mahaney, Meek et al. 2009). Many of these proteins have been shown to be recruited by Ku to the DNA break, and in some cases Ku directly interacts with some factors such as Werner’s (Cooper, Machwe et al. 2000, Li and Comai 2001). In addition, Ku itself has been shown to have some enzymatic activity and may also participate in the processing of DNA ends. Specifically, Ku has been reported to have 5′-dRP/AP lyase activity that removes abasic sites by nicking DNA 3′ of the abasic site via a mechanism involving a Schiff-base covalent intermediate. Several lysine residues in the Ku70 vWA domain catalyze this reaction (Roberts, Strande et al. 2010, Strande, Roberts et al. 2012).

Ku also interacts with the XRCC4-ligase IV (X4-L4) complex, which is required for the ligation of DSB ends (Nick McElhinny, Snowden et al. 2000, Hsu, Yannone et al. 2002, Mari, Florea et al. 2006, Costantini, Woodbine et al. 2007). Studies conducted using laser microbeam irradiation demonstrated that recruitment of XRCC4 to sites of DNA damage requires Ku (Yano and Chen 2008). Ku has also been shown to stimulate ligation efficiency of purified DNA ligases (Ramsden and Gellert 1998). Another core NHEJ factor, XLF, interacts with Ku as well (Yano, Morotomi-Yano et al. 2011). Laser microbeam irradiation experiments demonstrated that recruitment of XLF to sites of DNA damage requires Ku (Yano, Morotomi-Yano et al. 2008). A recently identified protein shown to be involved in NHEJ, PAXX, also requires Ku in order to be recruited at the DSB site (Craxton, Somers et al. 2015, Ochi, Blackford et al. 2015, Xing, Yang et

al. 2015). All these studies point to the central role played by Ku in NHEJ, making it imperative to understand its role in depth.

1.5.1.2 Ku removal from DNA

The crystal structure of the truncated Ku heterodimer showed how it encircles dsDNA ends. However, it also raises an interesting question as to how Ku comes off DNA once NHEJ is completed. Several interesting hypothesis have been proposed. Using Xenopus laevis egg extracts, it was shown that Ku80 bound to immobilized DNA is rapidly modified by K48-linked polyubiquitylation, which is a mark for proteasomal degradation. This study further showed that the proteolytic activity of the proteasome is required for the degradation of Ku80 once it is removed from DNA, however, it is not required for its removal from DNA (Postow, Ghenoiu et al. 2008). The E3 ubiquitin ligase, RNF8, has also been implicated in regulating Ku80 at sites of DNA damage, and RNF8 depletion resulted in prolonged retention of Ku80 at damage sites and impaired NHEJ repair (Feng and Chen 2012). Recently, another study using MLN4924, a drug that specifically inhibits conjugation of the ubiquitin-like protein, NEDD8, to target proteins, demonstrated that NEDD8 accumulation at DNA-damage sites is a highly dynamic process. Depleting cells of the NEDD8 E2-conjugating enzyme UBE2M, yields IR hypersensitivity and reduced cell survival following NHEJ. Finally, Ku was shown to be the neddylation target which promoted Ku ubiquitylation after DNA damage and release of Ku damage sites following repair (Brown, Lukashchuk et al. 2015). This model needs to satisfy the criteria that only the DNA bound Ku should be targeted for degradation rather than the unbound form (Postow 2011). This remains an area of further investigation. Moreover, a recent study demonstrated the role of RNF138 in displacing Ku from DNA, which in turn promoted HR (Ismail, Gagne et al. 2015).

1.5.1.3 Ku in telomere biology

Telomeres, the linear ends of chromosomes, have the potential to be recognized as DSBs and processed by DSB repair pathways. Telomeres are made up of long tandem arrays of duplex TTAGGG repeats which end in a 50- to 400-nt 3’ protrusion of 19

the G-rich strand (Doksani and de Lange 2014). In mammalian cells, the shelterin protein complex has evolved to bind and form protective caps on the DNA ends to prevent access by the DNA repair complexes. The shelterin complex consists of telomere repeat factor 1 (TRF1), TRF2, protection of telomere 1 (POT1), repressor/activator protein 1 (RAP1), TRF1- and TRF2-interacting nuclear protein 2 (TIN2), TPP1 (TINT1, PTOP, PIP1) (Doksani and de Lange 2014). The role of Ku in telomere maintenance in S.cerevisae has been well established. Initial observations were made showing that deletion of Ku resulted in long G-tails and shortened telomeres compared to wild type strains (Boulton and Jackson 1996, Porter, Greenwell et al. 1996). This function of Ku was found to be independent of its role in NHEJ as the deletion of ligase IV in yeast did not cause any telomere defects (Boulton and Jackson 1996). Ku interacts with the 48 nt stem-loop region of telomerase RNA subunit, telomerase component 1 (TLC1) in yeast (Stellwagen, Haimberger et al. 2003, Fisher, Taggart et al. 2004). This interaction is believed to positively regulate telomere length by recruitment of telomerase. Even though there is no sequence conservation between human and yeast telomerase RNA subunit, the interaction of Ku remains conserved (Chai, Ford et al. 2002, Ting, Yu et al. 2005). In mammals, the role of Ku in telomere biology is not as clear as in yeast. Deletion of Ku80 in human cells leads to telomere loss and abnormal telomere structure (Wang, Ghosh et al. 2009). Whereas Ku deficient mice have been reported to exhibit both telomere shortening as well as lengthening (Samper, Goytisolo et al. 2000, d'Adda di Fagagna, Hande et al. 2001). Uncapped telomeres, due to loss of shelterin complex, can be fused end-to-end by the classical NHEJ pathway leading to chromosomal aberrations (Espejel, Franco et al. 2002). Also Ku protects telomere ends from recombination and nucleolytic degradation (Maringele and Lydall 2002). The detailed mechanism of how Ku associates with telomeres in vivo is under investigation. Telomeres in many species form higher order loop structures designed to conceal the DNA ends from activating the DSB repair pathways (Doksani and de Lange 2014). Ku has been shown to interact with TRF1, TRF2 and Rap1 (Hsu,

Gilley et al. 2000, Song, Jung et al. 2000, O'Connor, Safari et al. 2004, Ribes-Zamora, Indiviglio et al. 2013).

Figure 1-6 Diagram depicting the different functions of Ku in cells.

A recent study showed that the shelterin complex factor, TRF2, inhibits Ku dependent NHEJ at telomeres. TRF2 interacts with Ku70 in a region of Ku facing outwards from DNA which is required for NHEJ. The authors also showed that this region was required for Ku-Ku heterotrimerization on opposing DNA ends. According to this data, one function of TRF2 is to prevent NHEJ at telomeres by blocking Ku mediated bridging of two telomere ends which can then be ligated by XRCC4-ligase IV (Ribes-Zamora, Indiviglio et al. 2013). In summary, uncapped telomere ends acts as DSB ends which can be fused by Ku dependent classical NHEJ, however in presence of the shelterin complex, Ku prevents aberrant recombination events at chromosomal ends (Fell and Schild-Poulter 2015).

1.5.1.4 Other functions of Ku

Apoptosis Ku70 was found to interact with Bax, and this interaction was mediated via the C- terminal region of Ku70. Bax is known to translocate from the cytosol to mitochondria in response to apoptotic stimuli. The peptide derived from this interaction site mapping blocked the mitochondrial translocation of Bax (Sawada, Hayes et al. 2003, Sawada, Sun et al. 2003). Furthermore, eight lysine residues in Ku70 were shown to be targets for acetylation in vivo. Five of them including K539, K542, K544, K533, and K556, lie in the C-terminal linker domain of Ku70 adjacent to the Bax interaction domain. Histone acetyl transferases, CBP and PCAF, efficiently acetylated K542 in vitro and associate with Ku70 in vivo. Treatment of cells with deacetylase inhibitors abolished the ability of Ku70 to suppress Bax-mediated apoptosis (Cohen, Lavu et al. 2004).

DNA sequence specific and RNA- binding of Ku A number of studies have suggested the possibility of DNA sequence specific binding of Ku (Giffin, Torrance et al. 1996, Dynan and Yoo 1998, Torrance, Giffin et al. 1998, Giffin, Gong et al. 1999). However, there has been no consensus sequence identified and definitive in vivo data remains elusive. Ku has also been reported to bind RNA in cells (Reeves 1985, Yoo and Dynan 1998). The RNA binding property of Ku seems conserved, since yeast and human Ku have been reported to bind telomere RNA (Stellwagen, Haimberger et al. 2003, Ting, Yu et al. 2005), although the significance of this interaction is not yet known. A recent study of mammalian RNA interacting proteins identified several protein domains, one of them was the SAP domain (Castello, Fischer et al. 2012). Ku70 contains a SAP domain in its C-terminal region (Aravind and Koonin 2000). The exact function of this domain and its relevance to Ku heterodimer function remains to be determined.

1.5.2 DNA-PKcs

DNA-PKcs is a large polypeptide of 4128 amino acids and is composed of a large N-terminal domain, containing HEAT (Huntingtin, Elongation factor 3, regulatory subunit A of PP2A, TOR1) repeats, and a C-terminal kinase domain flanked by FAT (FRAP, ATM, TRRAP) and FAT-C terminal (FAT-C) domains (Baretic and Williams 2014). DNA-PKcs is a member of the PIKK family of serine/threonine protein kinases that also includes ATM and ATR (Keith and Schreiber 1995). The human DNA-PKcs gene PRKDC/XRCC7 maps to chromosome 8q11 (NCBI website). Three different groups independently identified DNA-PKcs. It was found that the addition of sonicated calf thymus DNA to extracts from human cells enhanced the phosphorylation of 90 kDa heat shock protein, hsp90, and several other proteins (Walker, Hunt et al. 1985, Lees- Miller, Chen et al. 1990). Another group identified and purified the large polypeptide (p350) from HeLa cells and showed that it phosphorylated casein in a DNA-dependent manner in vitro (Carter, Kopman et al. 1988, Carter, Vancurova et al. 1990, Lees-Miller, Chen et al. 1990). This DNA-activated protein kinase activity phosphorylated hsp90 on threonine followed by glutamine, i.e. a TQ motif (Lees-Miller and Anderson 1989). Phosphorylation of transcription factor Sp1 (Jackson, MacDonald et al. 1990) and the tumour suppressor, p53, on serines followed by glutamines (i.e. SQ motifs) was observed (Lees-Miller, Sakaguchi et al. 1992). The preference for SQ/TQ sequences was further verified by combinatorial peptide assays using purified proteins (O'Neill, Dwyer et al. 2000). Another group identified p350 and the Ku heterodimer as components of a DNA-activated serine/threonine protein kinase that phosphorylated the C-terminal domain of RNA polymerase (RNAPII) (Dvir, Peterson et al. 1992, Dvir, Stein et al. 1993). Ku70/80 heterodimer was characterized as the DNA binding subunit that targets p350 (now called DNA-PKcs) to ends of dsDNA (Gottlieb and Jackson 1993). Finally DNA-PKcs was cloned and it was demonstrated that the catalytic domain had amino acid similarity to the p110 subunit of the phosphatidyl inositol 3 kinase, PI3K (Hartley, Gell et al. 1995, Jette and Lees-Miller 2015). DNA-PKcs knockout mice that are either null (Jhappan, Morse et al. 1997, Gao, Chaudhuri et al. 1998) or ablated for the kinase 23

domain have been generated (Taccioli, Amatucci et al. 1998). These mice, like SCID mice, are immunodeficient and are severely defective in V(D)J coding, but not signal joint formation.

1.5.2.1 DNA-PKcs structure

Due to the large size of DNA-PKcs, cryo-electron microscopy (cryo-EM) and negative stain EM studies have provided considerable information, albeit at low resolution, on the overall structure and dimensions of DNA-PKcs. This technique revealed a structure of a globular-shaped monomeric molecule with overall dimensions of ~ 70 - 120 Å × 130 Å × 150 - 160 Å (Chiu, Cary et al. 1998, Leuther, Hammarsten et al. 1999, Rivera-Calzada, Maman et al. 2005, Spagnolo, Rivera-Calzada et al. 2006, Rivera-Calzada, Spagnolo et al. 2007, Williams, Lee et al. 2008, Dobbs, Tainer et al. 2010, Hammel, Yu et al. 2010). These studies are in agreement with the crystal structure of DNA-PKcs, which was solved later and provided a bit more clarity. X-ray crystallographic structure of DNA-PKcs was resolved, at 6.6 Å, in complex with the Ku80 CTR. The DNA-PKcs tertiary structure measures 160 Å high and 120 Å across (Sibanda, Chirgadze et al. 2010). The crystal structure of DNA-PKcs showed a head/crown domain atop a ring-shaped palm/base region composed of two arms that encircle a central open cavity. These arms, N-terminal region, are composed of multiple anti-parallel HEAT repeats, and other α-helical structures, which fold back on themselves to create a cradle-like structure when viewed sideways. It is a strong possibility that these arms encircle the putative dsDNA binding channel. Importantly, this structural arrangement places the FAT, kinase and FAT-C domains at the apex of these arms. This arrangement makes the kinase domain exposed and accessible to the putative substrates. The regions at the top of the arms, close to the FAT- kinase - FAT- C domains, are predicted to have considerable flexibility (Sibanda, Chirgadze et al. 2010, Ochi, Wu et al. 2014). Atomic resolution of DNA-PKcs awaits crystal structure determination at higher resolution. The N-terminal HEAT repeats seems important for the regulation of DNA-PKcs kinase activity. It was shown that N-terminal constraint was able to activate DNA-PKcs kinase activity, even in the absence of the Ku/DNA complex 24

(Meek, Lees-Miller et al. 2012). Expression of the DNA-PKcs C-terminal fragment alone showed higher basal activity compared to full length DNA-PKcs, which suggests that the N-terminal region acts as regulator of kinase activity (Davis, Lee et al. 2013). Figure 1-7 shows the domain organization and crystal structure of DNA-PKcs.

Figure 1-7 Domain organization and crystal structure of DNA-PKcs.

Domain organization of DNA-PKcs. (A) Schematic of DNA-PKcs showing the putative domains and well-characterized in vivo phosphorylation sites. The N-terminal region of DNA-PKcs, extending from residues 1-3022 contains multiple HEAT repeats and other α-helical regions. A leucine rich region (LRR) spanning residues 1503-1602 has been proposed as a DNA binding region (Gupta and Meek 2005). The FAT domain comprises residues 3023–3470 and is followed by the PI3K-like kinase catalytic region (residues 3719–4015). The FATC domain spans residues 4097- 4128. A

PIKK regulatory domain (PRD) has been proposed between the kinase and FATC domains (Mordes, Glick et al. 2008). Some of the well-characterized in vivo phosphorylation sites that function in NHEJ (PQR-, ABCDE clusters and T3950) are indicated in red. See text for references and details. B) Crystal structure of DNA-PKcs, front and side view, at 6.6 Å (from (Sibanda, Chirgadze et al. 2010)) . DNA-PKcs was crystalized in complex with the Ku80 CTR region (residues 594-732). Its exact location in this crystal structure is not known (Sibanda, Chirgadze et al. 2010).

1.5.2.2 DNA-PKcs in DSB repair

In response to DNA DSBs, DNA-PKcs is quickly recruited to the DNA-Ku scaffold, to form the DNA-PK complex (Smith and Jackson 1999). Binding of DNA- PKcs, through the Ku80 CTR, causes the Ku70/80 heterodimer to move about one helical turn inward from the end (Yoo and Dynan 1999). A Ku-binding motif has been shown to be located in the C-terminal portion of DNA-PKcs (amino acids 3002–3850) (Jin, Kharbanda et al. 1997). However, another study suggests otherwise and implicates involvement of the N-terminal region as well (Davis, Lee et al. 2013). In vitro it has been determined that maximum kinase activity is achieved with approximately 1:1 stoichiometry, 1 mole of Ku heterodimer and 1 mole of DNA-PKcs (Chan, Mody et al. 1996). Recruitment of DNA-PKcs has been proposed to mediate synapsis of two DNA ends during NHEJ. Consistent with this atomic force microscopy and biochemical studies have showed that Ku or DNA-PKcs or both components are capable of aligning two DNA ends (Cary, Peterson et al. 1997, Pang, Yoo et al. 1997, Yaneva, Kowalewski et al. 1997, DeFazio, Stansel et al. 2002). Another important observation that was made in vitro, was that DNA-PKcs undergoes autophosphorylation in the presence of DNA-Ku and ATP and this leads to its inactivation and dissociation from the DNA-Ku scaffold (Chan and Lees-Miller 1996, Merkle, Douglas et al. 2002). In retrospect this is not surprising since for DSB ends to be repaired completely, DNA-PKcs needs to be removed from the ends. Several studies have now demonstrated that DNA-PKcs undergoes extensive phosphorylation in response to DSBs in cells (Douglas, Sapkota et al. 2002, Ding, Reddy et al. 2003, Douglas, Cui et al. 2007, Meek, Douglas et al. 2007,

Weterings and Chen 2007). DNA-PKcs release due to autophosphorylation was shown to mediate accessibility of the DNA termini for either end processing enzymes or ligases (Weterings, Verkaik et al. 2003, Block, Yu et al. 2004). DNA-PKcs autophosphorylation was suggested to occur in trans during the synapsis of two DNA-bound DNA-PKcs molecules (Meek, Douglas et al. 2007). This event could possibly be modifying DNA ends for proper processing by other NHEJ factors like Artemis (Goodarzi, Yu et al. 2006) and finally, ligation by XRCC4-ligase IV (Block, Yu et al. 2004). The small angle X-ray scattering (SAXS) structure of phosphorylated DNA-PKcs supports that autophosphorylation produces a large conformational change and an increase in the

Dmax from 155 to 180 Å (Hammel, Yu et al. 2010). Two major well-characterized phosphorylation clusters are referred to as the PQR cluster (residues 2023, 2029, 2041, 2053, 2056) and the ABCDE cluster (residues 2609, 2612, 2620, 2624, 2638, 2647) (Ding, Reddy et al. 2003, Cui, Yu et al. 2005). Mutation of these phosphorylation sites causes increased radiosensitivity and less efficient DSB repair. Inhibiting phosphorylation of the entire 2609 cluster leads to severe radiosensitivity and diminished processing of DNA ends (Chan, Chen et al. 2002, Ding, Reddy et al. 2003). Interestingly, mutation of single residues within this cluster has a less severe effect. Using laser microbeam irradiation followed by live cell imaging, it was shown in cells that mutation of the 2609 cluster and the S2056 residue seems to result in a slower dissociation of DNA-PKcs from DNA ends (Uematsu, Weterings et al. 2007). Phosphorylation of the T3950 residue, located in the C-terminal kinase domain, has also been reported. This site was suggested to be located in the putative activation loop site based on sequence homology to the PI3K catalytic domain. Mutation of this site with phosphomimetic aspartic acid resulted in deficient V(D)J recombination and increased radiation sensitivity (Douglas, Cui et al. 2007). Several other autophosphorylation sites, (3821, 4026, and 4102), have been identified in the C- terminal region of DNA-PKcs in vitro, although their function is not known currently (Ma, Pannicke et al. 2005). Also, a knock in mouse model of T2605, T2634, and T2643 (3A mutation, corresponding to human T2609, T2638, and T2647) was generated. These mice were found to develop congenital hematopoietic failure caused by rapid loss of

hematopoietic stem cells (HSCs) in the developing fetal liver (Zhang, Yajima et al. 2011). Based on these findings a model was proposed in which DNA-PKcs protected the termini of a broken DNA molecule by capping it and properly aligned in a synaptic complex. In cells, however, the scenario of DNA-PKcs phosphorylation is complex and other kinases have been implicated. Experiments have shown that in vivo phosphorylation of the DNA-PKcs 2609 and 2647 residues can still occur in response to DSBs in the absence of DNA-PKcs kinase activity (Chen, Uematsu et al. 2007). Another study reported that phosphorylation of the 2609 and 2647 residues, but not the 2056 residue, of DNA-PKcs is dependent on ATM (Meek, Douglas et al. 2007). Also, ATR kinase has been implicated in the regulation of DNA-PKcs phosphorylation at 2609 and 2647 residues, after UV induced DNA damage (Yajima, Lee et al. 2006). Recently, mouse model expressing a kinase-dead DNA-PKcs protein validate the importance of transphosphorylation of DNA-PKcs. It was shown to regulate end-processing by Artemis recruitment and relieve the physical blockage on end-ligation. ATM was also found to regulate DNA-PKcs phosphorylation in this model (Jiang, Crowe et al. 2015). DNA-PKcs has also been shown to phosphorylate several NHEJ proteins including the Ku heterodimer (Chan, Ye et al. 1999, Douglas, Gupta et al. 2005), XRCC4 (Yu, Wang et al. 2003, Lee, Jovanovic et al. 2004), XLF (Yu, Mahaney et al. 2008), Artemis (Ma, Pannicke et al. 2005, Goodarzi, Yu et al. 2006), and PNKP (Segal- Raz, Mass et al. 2011, Zolner, Abdou et al. 2011). But, in most cases, so far no major evidence has been found regarding the role of these phosphorylation events in NHEJ in vivo. Hence the most important substrate of DNA-PKcs seems to be DNA-PKcs itself.

1.5.2.3 DNA-PKcs in mitosis

Recent reports, from our lab and others, have demonstrated a role for DNA-PKcs in mitosis. It was observed that siRNA-mediated depletion of DNA-PKcs, or inhibition of DNA-PKcs kinase activity with NU7441 (Leahy, Golding et al. 2004), led to a number of mitotic defects including increased number of misaligned mitotic chromosomes, abnormal nuclear morphologies, and lagging chromosomes (Lee, Lin et al. 2011, 28

Douglas, Ye et al. 2014). DNA-PKcs was found to be phosphorylated on S2056, T2609, T2647 and T3950 in mitosis and phosphorylated DNA-PKcs was found to localize at centrosomes, kinetochores and at the midbody during cytokinesis (Shang, Huang et al. 2010, Lee, Lin et al. 2011, Douglas, Ye et al. 2014). Phosphorylation of S2056 in mitosis was found to be largely independent of Ku, since it was unaffected by siRNA depletion of Ku70/80 in cells that were treated with nocodazole (Douglas, Ye et al. 2014). DNA-PKcs phosphorylated checkpoint kinase 2 (Chk2) on T68 in mitosis, which was shown to be required for phosphorylation of BRCA1 on S988. This in turn regulates mitotic spindle formation to maintain genome stability (Shang, Yu et al. 2014). Phosphorylation of histone H2AX on S139 in nocodazole-treated cells requires DNA- PK, with ATM playing a lesser role (Tu, Li et al. 2013). Also, in mitosis DNA-PKcs is phosphorylated on S3205 by polo-like kinase 1 (PLK1) (Douglas, Ye et al. 2014). However, the functional significance, if any, of this phosphorylation event remains to be determined. More recently, deficiency in DNA-PKcs activity was demonstrated to cause a delay in mitotic entry due to dysregulation of cyclin-dependent kinase 1 (Cdk1) (Lee, Shang et al. 2015). These studies suggest an interesting role for DNA-PKcs protein and its kinase activity in mitosis, which seems independent of the Ku heterodimer (reviewed in (Jette and Lees-Miller 2015)).

1.5.2.4 DNA-PKcs in transcription

Initial discoveries concerning the role of DNA-PKcs in cells suggested its function in gene transcription by phosphorylation of transcription factor Sp1 (Jackson, MacDonald et al. 1990) and RNAPII (Dvir, Peterson et al. 1992). DNA-PKcs has also been shown to interact with the basal transcriptional machinery (Maldonado, Shiekhattar et al. 1996). However, there was no definitive evidence found for this function of DNA-PKcs until recently. In response to feeding/insulin, the transient double- stranded DNA breaks occurred during the transcriptional activation of the fatty acid synthase (FAS) promoter. Upstream Stimulatory Factor (USF) binding to the - 65 E-box is required for the regulation of FAS promoter activity during fasting/feeding (Wang and Sul 1995, Wang and Sul 1997, Kong, Shen et al. 2011). DNA-PK has recently been 29

shown to be required for USF-1 complex assembly and recruitment of its other interacting proteins (Wong, Chang et al. 2009). Thus, it was proposed that the transcriptional activation of lipogenic genes is impaired in DNA-PK-deficient SCID mice (Kong, Shen et al. 2011). The process of replication stalling upon collision of replication forks with damaged DNA has been well characterized. Recently, it was shown that the RNAPII bypasses the break and continues transcription elongation, upon inhibition of DNA-PK. This suggested that the activity of DNA-PK, but not the break per se, that inhibits the processivity of RNAPII (Pankotai, Bonhomme et al. 2012). New evidence is emerging showing that the DNA-PKcs could be regulating pro-metastatic signaling and tumor metastasis through transcription networks. DNA-PKcs was found to interact with androgen receptor (AR) and was recruited to the AR regulatory loci. DNA-PKcs was shown to be highly activated in metastatic tumors, independent of DNA damage indicators. DNA-PKcs activity was found to correlate with poor survival and pharmacological inhibition of DNA-PKcs prevented cancer metastasis (Goodwin, Kothari et al. 2015).

1.5.3 End processing factors and other proteins involved in NHEJ

NHEJ pathway uses several different end-processing factors, depending upon the type of lesion it encounters. Some of these factors are described below:

1.5.3.1 Artemis

Artemis, an endonuclease, plays an essential role in processing DNA hairpins formed during V(D)J recombination (Ma, Pannicke et al. 2002, Ma, Schwarz et al. 2005). Deficiency in Artemis activity results in radiation-sensitive severe combined immunodeficiency (RS-SCID) in humans (Moshous, Callebaut et al. 2001). Artemis is also required for NHEJ mediated repair of a subset of DNA DSBs that have complex ends (Riballo, Kuhne et al. 2004). Besides DNA hairpins, the precise DNA structure/s of Artemis in DSB repair is unknown and an active area of investigation. DNA-PKcs has been shown to recruit Artemis at the DSB site and its endonuclease activity requires

DNA-PKcs to undergo an autophosphorylation mediated conformational change (Goodarzi, Yu et al. 2006). Artemis has an N-terminal nuclease domain that belongs to the metallo-lactamase and β-CASP families and a C-terminal regulatory domain that is highly phosphorylated in vivo. The C-terminal region of Artemis mediates its interaction with DNA-PKcs and DNA ligase IV (Williams, Hammel et al. 2014). Also, Artemis residues 485-495 were shown to interact with ligase IV, with this interaction being essential for V(D)J recombination (De Ioannes, Malu et al. 2012, Malu, De Ioannes et al. 2012).

Figure 1-8 Domain organization of the Artemis endonuclease.

Artemis is composed of a metallo-β-lactamase domain (amino acids 1-155) and a β-CASP domain (amino acids 156-385). Amino acids 398-403 are required for interaction with DNA-PKcs. The C-terminal region of Artemis is highly phosphorylated at multiple sites both in vitro and in vivo. See text for details.

1.5.3.2 PNKP

PNKP has both 3’-DNA phosphatase and 5’-DNA kinase activities (Jilani, Ramotar et al. 1999). Several studies suggest a role for PNKP in NHEJ. PNKP has an N-terminal forkhead associated (FHA) domain that mediates its interaction with CK2 phosphorylated XRCC4 (Koch, Agyei et al. 2004). It also has a C-terminal kinase domain and the phosphatase domain is sandwiched between N- and C-terminal regions. Knockdown of PNKP in human cells renders them radiosensitive and defective in DSB repair (Rasouli-Nia, Karimi-Busheri et al. 2004).

1.5.3.3 APLF

APLF (also called C2orf13, Xip1, and PALF), has 3′ exonuclease, dsDNA endonuclease, ssDNA 3′ endonuclease activities, and AP endonuclease activities (Kanno, Kuzuoka et al. 2007, Li, Kanno et al. 2011). However, so far whether these activities are required for NHEJ is not known. Emerging evidence suggests that APLF might be having a role in complex formation of core NHEJ factors. APLF contains a PNKP-like FHA domain, and, like PNKP, interacts with CK2-phosphorylated XRCC4 and also interacts with Ku (Macrae, McCulloch et al. 2008, Grundy, Rulten et al. 2013). Studies in our lab showed that APLF interacts with DNA-PKcs in a Ku and DNA dependent manner (unpublished data). APLF has a C-terminal nucleosome assembly protein-1 (NAP1)-like motif, which may help in chromatin remodeling at the DSB site (Mehrotra, Ahel et al. 2011).

Figure 1-9 Domain organization of PNKP, APLF, and Aprataxin.

Forkhead-associated (FHA) domains are shown for PNKP, APTX, and APLF. APLF also includes two poly(ADP-ribose)-binding zinc finger (PBZ) domains, and a nucleosome assembly protein 1-like (NAP1L) motif. APLF interacts with 32

XRCC4 and Ku80. PNKP contains a phosphatase domain, and kinase domain. PNKP has been reported to interact with XRCC4 (Koch, Agyei et al. 2004). APTX contains a histidine triad (HIT) motif, and a zinc-finger motif. APTX has been reported to interact with XRCC4 (Clements, Breslin et al. 2004).

1.5.3.4 Aprataxin

DNA ligation proceeds through an intermediate where the 5′ phosphate terminal of the strand break is adenylated. Accidental abortive ligation sometimes leads to generation of an adenylated 5’ phosphate that needs to be processed before ligation (Ellenberger and Tomkinson 2008). Aprataxin has been shown to mediate this function (Ahel, Rass et al. 2006). It has also been shown to interact with XRCC4 (Clements, Breslin et al. 2004).

1.5.3.5 DNA polymerases

There are four mammalian pol X family polymerases: pol β, pol λ, pol μ and terminal deoxyribonucleotidyltransferase (TdT) (Daley, Laan et al. 2005). Each of these has an N-terminal BRCT domain and a C-terminal catalytic domain. TdT, unlike most DNA polymerases, does not require a template and catalyzes the addition of nucleotides to the 3’ terminal of a DNA molecule (Benedict, Gilfillan et al. 2000). TdT is expressed only in cells active in assembling antigen receptor genes by V(D)J recombination (Bertocci, De Smet et al. 2006). Pol λ is the unique of polymerases specifically implicated in NHEJ (Daley, Laan et al. 2005). Pol λ forms a complex with NHEJ core factors and performs gap filling when ends are only partly complementary (Garcia-Diaz, Bebenek et al. 2004). Pol μ interacts with Ku and DNA ligase IV (Mahajan, Nick McElhinny et al. 2002). Pol μ has the ability to add a base to a blunt end that is templated by the overhang on the opposite end of the DSB (Nick McElhinny, Havener et al. 2005, Waters, Strande et al. 2014).

Figure 1-10 Domain organization of the pol X family of DNA polymerases.

Members of the pol X family of DNA polymerases implicated in NHEJ possess a BRCA1 C-terminal (BRCT) domain, an 8 kilo dalton region (8kD), and a catalytic domain.

1.5.4 XRCC4-Ligase IV (X4-L4)

Once the DNA ends have been aligned and processed, the final step is ligation, which is carried out by the XRCC4-ligase IV complex (sometimes referred to as X4-L4) reviewed in (Mahaney, Meek et al. 2009). The XRCC4 gene was found to complement a CHO cell line (XR-1) that is deficient in DNA DSB repair (Bryans, Valenzano et al. 1999). XRCC4 is required for both NHEJ and V(D)J recombination (Li, Otevrel et al. 1995, Critchlow, Bowater et al. 1997). It is composed of a globular head domain, an elongated α-helical stalk and a C-terminal region (Junop, Modesti et al. 2000). The XRCC4 C-terminal region, together with the N-terminal region (residues 1-28) and central region (residues 168-200), could be responsible for cooperative DNA binding (Modesti, Hesse et al. 1999). The most well characterized binding partner of XRCC4 is DNA ligase IV (Grawunder, Wilm et al. 1997, Grawunder, Zimmer et al. 1998). XRCC4 has no known enzymatic activity but rather acts as a scaffolding protein, facilitating the

recruitment of other NHEJ proteins to the break reviewed in (Mahaney, Meek et al. 2009). Consistent with this, X4-L4 complex interacts with Ku (Nick McElhinny, Snowden et al. 2000, Hsu, Yannone et al. 2002, Costantini, Woodbine et al. 2007), PNKP (Koch, Agyei et al. 2004), APLF (Iles, Rulten et al. 2007) and XLF (Ahnesorg, Smith et al. 2006, Buck, Malivert et al. 2006) as well as with DNA (Modesti, Hesse et al. 1999). XRCC4 itself is a homodimer and two dimers can interact to form tetramers (Junop, Modesti et al. 2000, Modesti, Junop et al. 2003, Ochi, Sibanda et al. 2010, Mahaney, Hammel et al. 2013). Laser microbeam irradiation experiments have demonstrated that recruitment of XRCC4 to sites of damage requires Ku (Mari, Florea et al. 2006, Yano and Chen 2008). XRCC4 is highly phosphorylated in vivo (Critchlow, Bowater et al. 1997) and its phosphorylation is enhanced by DNA damage (Drouet, Delteil et al. 2005). It has been shown to be phosphorylated by DNA-PKcs in vitro, however, the exact function of these phosphorylation sites remains unresolved (Yu, Wang et al. 2003, Lee, Jovanovic et al. 2004). XRCC4 is also phosphorylated by casein kinase 2 (CK2) at T233, which creates a binding site for the FHA domains of PNKP (Koch, Agyei et al. 2004) and APLF (Iles, Rulten et al. 2007, Macrae, McCulloch et al. 2008), facilitating their recruitment to the DSB. Apart from phosphorylation, XRCC4 has been shown to be SUMO-ylated at lysine 210 in vivo, and this is suggested to be important for nuclear localization of XRCC4 (Yurchenko, Xue et al. 2006). Human DNA Ligase IV is unstable on its own but it is stabilized by interaction with XRCC4 (Critchlow, Bowater et al. 1997, Grawunder, Wilm et al. 1997, Bryans, Valenzano et al. 1999). It is encoded by the LIG4 gene and was identified by a genomics approach in which a human expressed sequence tags database was searched with a sequence motif that is conserved within the catalytic domain of eukaryotic DNA ligases (Wei, Robins et al. 1995, Ellenberger and Tomkinson 2008). Ligase IV can be divided into an N-terminal catalytic domain and a C-terminal that contains tandemly arrayed BRCT domains with a linker region (Ochi, Sibanda et al. 2010). Ligase IV interacts with XRCC4 mainly through the linker between the two BRCT

Figure 1-11 Diagram depicting the domain organization of XRCC4 and DNA ligase IV.

Domain organization of XRCC4 and DNA ligase IV. A) XRCC4 is comprised of head and stalk domains and an unstructured C-terminal region (CTR). Amino acids 119 - 155 in XRCC4 are required for dimerization (Junop, Modesti et al. 2000). DNA ligase IV interacts with XRCC4 between amino acids 173-195 (Sibanda, Critchlow et al. 2001). The XLF binding site is in the head region (Andres, Modesti et al. 2007). T233 has been reported to be phosphorylated by CK2 (Koch, Agyei et al. 2004). DNA-PK phosphorylates XRCC4 at S260 and S318 (Yu, Wang et al. 2003). B) DNA ligase IV is comprised of an N-terminal domain and a ligase domain (amino acids 248 - 451, NCBI database). The XRCC4 binding site in DNA ligase IV is located between the BRCT domains (Sibanda, Critchlow et al. 2001). It has been shown, in vitro, to be phosphorylated at T650, S668 and S672 (Wang, Nnakwe et al. 2004). See text for details.

domains (Sibanda, Critchlow et al. 2001, Modesti, Junop et al. 2003, Wu, Frit et al. 2009). This region also seems to be important for the catalytic activity of ligase IV (Grawunder, Zimmer et al. 1998). This linker is phosphorylated by DNA-PKcs at T650 which in turn stabilizes ligase IV (Wang, Nnakwe et al. 2004). An important feature of DNA ligase IV is its ability to join DNA ends that are non-complementary because of mismatches and/or short gaps (Gu, Lu et al. 2007). In addition to the interaction with XRCC4, the first BRCT domain has been shown to interact with the Ku heterodimer (Costantini, Woodbine et al. 2007). Targeted inactivation of LIG4 in mouse and human cells dramatically reduces V(D)J recombination and results in hypersensitivity to IR. Inactivation of the mouse LIG4 gene results in late embryonic lethality due to excessive

neuronal apoptosis and embryonic lethality (Frank, Sekiguchi et al. 1998, Grawunder, Zimmer et al. 1998). This can be rescued by concomitant loss of either p53 or ATM function (Frank, Sharpless et al. 2000, Sekiguchi, Ferguson et al. 2001).

1.5.5 XLF

XLF, structurally similar to XRCC4, is required for NHEJ and V(D)J recombination (Ahnesorg, Smith et al. 2006, Andres, Modesti et al. 2007, Li, Chirgadze et al. 2008). XLF is also capable of interacting with DNA (Lu, Pannicke et al. 2007). This interaction is highly dependent on the length of the DNA molecule and is enhanced by Ku (Yano, Morotomi-Yano et al. 2008). Laser microbeam irradiation experiments have shown that Ku is responsible for recruiting XLF at the DSB site and XRCC4 might be stabilizing it at DSB ends (Yano, Morotomi-Yano et al. 2008). XLF is phosphorylated in the C-terminal region by both ATM and DNA-PK in vivo (Yu, Mahaney et al. 2008, Mahaney, Meek et al. 2009). However, as is the case with XRCC4, the significance of these phosphorylation events remains unclear. The function of XLF at the DSB site is not fully understood. It has been suggested to stimulate the activity of DNA ligase IV towards non-compatible DNA ends (Gu, Lu et al. 2007, Tsai, Kim et al. 2007, Riballo, Woodbine et al. 2009). Recent studies are beginning to reveal its function at the DSB sites. XLF has been shown to form filaments with XRCC4, which was predicted to be playing a role in DNA end synapsis (Hammel, Yu et al. 2010, Ropars, Drevet et al. 2011, Andres, Vergnes et al. 2012). This model seems to be supported by a study, where using super resolution microscope, authors found evidence for XRCC4-XLF filaments at the DNA damage site in cells (Reid, Keegan et al. 2015). As exciting as these findings are, it generates the question of, are these filaments generated at all types of DSB sites or only a subset such as in case of mismatched ends or DSB with gaps? Where does Ku and DNA-PKcs fit in this model? As it has been shown that Ku and DNA-PKcs can mediate DNA end synapsis, the question is whether Ku is still present at the DSB site in presence of this filament. These are all areas of active investigation.

Figure 1-12 Domain organization of XLF.

XLF consists of head and stalk domains and an unstructured C-terminal domain. Leucine 115 is crucial for XRCC4 binding and amino acids 125 - 224 are involved in homodimerization. In vivo, XLF is phosphorylated at S245 by DNA-PK and S251 by ATM (Yu, Mahaney et al. 2008).

1.5.6 PAXX

Recently a new protein has been identified that plays a role in NHEJ, PAXX (paralog of XRCC4 and XLF). As the name suggests, its crystal structure was found to be similar to XRCC4 and XLF. It interacts with the Ku heterodimer, and helps promote ligation of the broken DNA (Craxton, Somers et al. 2015, Ochi, Blackford et al. 2015, Xing, Yang et al. 2015). Epistasis analysis demonstrated that PAXX functions along with XLF in response to IR induced complex DSBs, whereas its function was redundant in response to Topo2 inhibitor-induced DSBs (Xing, Yang et al. 2015).

Figure 1-13 Domain organization of PAXX.

PAXX, similar to XRCC4 and XLF, consists of a head, stalk and a smaller C- terminal domain.

Chapter Two: Materials and Methods

2.1 Reagents

Neocarzinostatin, doxorubicin, etoposide, camptothecin and dsDNA cellulose were obtained from Sigma-Aldrich (St. Louis, MO, USA).

2.2 Cell lines used in the study

All cell lines were maintained at 37°C under a humidified atmosphere of 5% CO2.

DNA-PKcs-deficient V3 cells and Ku80-deficient Xrs6 cells were maintained in minimum essential medium alpha (MEM alpha, Invitrogen) with 10% (v/v) fetal calf serum (Hyclone Inc., Logan, UT, USA), 50 U/ml of penicillin (Invitrogen), and 50 μg/ml of streptomycin (Invitrogen). For xrs6 cells stably expressing either full-length human Ku80 cDNA or Ku80 C-terminal truncation mutant (residues 1-569) 150 µg/ml hygromycin B (Invitrogen) was added. For V3 cells complemented with human DNA-PKcs cDNA 50 µg/ml of G418 (Invitrogen) was added. xrs6 cells (Jeggo and Kemp 1983) and xrs6 cells expressing full-length Ku80 and Ku80 C-terminal truncation (Weterings, Verkaik et al. 2009) were a kind gift from Dr. David J. Chen (University of Texas Southwestern Medical Center, USA). V3 cells (Whitmore, Varghese et al. 1989) and V3 cells stably expressing human DNA-PKcs (Ding, Reddy et al. 2003) were a kind gift from Dr. Kathryn Meek (Michigan State University, USA).

2.3 DNA Sequencing and primer synthesis

Primers synthesis for PCR and sequence analysis of vectors generated in this study were performed by the University Core DNA services, University of Calgary.

Table 2-1 List of primers used for cloning Ku70 full length and truncations into pFastbac1 vector, Ku80 full length and truncations into pFastbac HTA and pGEX6P1 plasmid.

All sequences are written in a 5’ to 3’ direction.

XRCC5-N CGGGATCCTATGGTGCGGTCGGGGAATAAGGC XRCC5-545N CTGGGATCCAAGGATCAAGTGACTGCTCAGGAA XRCC5-592N CTGGGATCCGTGAATCCTGCTGAAAACTTCCGT XRCC5-732C CCGCTCGAGCTATATCATGTCCAATAAATCGTCCAC XRCC5-718C CCGCTCGAGCTATACAGCTGCTGTGTCTCCACT XRCC5-709C CCGCTCGAGCTAGTCTTTGGGGGCCAGAAACTT XRCC5-569C CCGCTCGAGCTAAGTCTTTAATTTTTTAGCTGT XRCC6-N CGGGATCCATGTCAGGGTGGGAGTCATATTAC XRCC6-609C CCGCTCGAGTCAGTCCTGGAAGTGCTTGGTG XRCC6-560C CCGCTCGAGTCATGAATACTCCACCTTGGGCCTT XRCC6-536C CCGCTCGAGTCAATTGTAATCTGGTGGGTAAACA

Table 2-2 List of primers used for sequence verification.

XRCC5 Middle GAAATTTATTCATTCAGTGAGAGTCTGA XRCC6 Middle AGATACAGGCATCTTCCTTGACTTG XRCC6 Internal TTGGTGAACAGCATGATCCTC M13 Forward GTTTTCCCAGTCACGAC M13 Reverse CAGGAAACAGCTATGAC

2.4 Cloning Vectors

The coding sequences of human Ku70 (XRCC6) and Ku80 (XRCC5) (GenBank accession numbers NM_001469.4 and NM_021141.3 respectively), were previously cloned from a HeLa cDNA library into the pGEX-6P1 vector (GenBank accession number U78872; GE Healthcare Life Sciences, Little Chalfont, UK) by Dr. Yaping Yu and Ms. Shujuan Fang in our lab. These vectors were used as templates to generate

Ku70 and Ku80 full length as well as C-terminal truncation mutants for baculovirus expression. GST tagged Ku80 C-terminal fragments were generated from the full length Ku80 vector.

2.5 Recombinant protein expression and purification from E. coli

N-terminal GST-tagged recombinant proteins were expressed in E. coli BL21 (DE3) cells (Stratagene, La Jolla, California, USA). BL21 competent cells were transformed with pGEX-6P1 vectors using the heat shock method at 42oC for 60 seconds. Transformed cells were grown in 2.5% (w/v) Luria Broth (Life Technologies, Carlsbad, CA, USA) containing 100 µg/mL ampicillin (Sigma-Aldrich). A starter culture, 5 ml volume, was used to inoculate 1 L of LB media and grown overnight. The inoculum was then transferred to 1L of medium and cells were grown at RT at 200 revolutions per

minute (rpm) until an O.D600 of 1.0 was obtained. Protein expression was then induced for 4 hr by addition of isopropylthio-β-galactoside (IPTG; Invitrogen) to a final concentration of 0.2 mM. Cells were collected by centrifugation at 3000 x g for 15 min at 4oC and resuspended in 10 mL of mouse tonicity phosphate buffered saline (MTPBS)

[16 mM disodium hydrogen phosphate (Na2HPO4), 4 mM sodium dihydrogen phosphate

(NaH2PO4) pH 7.3, 150 mM sodium chloride (NaCl) containing 1 mM dithiothreitol (DTT; Calbiochem)], and protease inhibitors [0.2 mM phenylmethylsulfonyl fluoride (PMSF; Sigma-Aldrich), 0.2 µg/mL leupeptin (Roche), 0.2 µg/mL pepstatin (Roche)]. The resuspended pellet was subjected to sonication (10 x 10 sec, power setting 10; Fisher Scientific Sonic Dismembrator Model 100, Fisher Scientific, Pittsburgh, USA). After sonication, Triton X-100 was added to a final concentration of 1% (v/v), and end- over-end rotation was carried out for 5 minutes at 4oC. The lysate was centrifuged at o 15,000 x g for 15 min at 4 C (Beckman CoulterTM, Avanti J-26 XPI centrifuge). The supernatant was incubated at 4oC with end-over-end rotation for 1 hr with 1 mL of Glutathione 4B SepharoseTM beads (GE Healthcare) that had previously been washed o with MTPBS buffer and centrifuged at 250 x g at 4 C for 1 min (Beckman CoulterTM, Allegra X-15R). Following the 1 hr incubation, beads were centrifuged and the supernatant containing unbound protein was removed. The beads were washed 4 x 30 42

mL with ice-cold wash buffer (MTPBS containing 1 mM DTT and protease inhibitors). GST-fusion proteins were then eluted from the beads by incubation in 20 mL of elution buffer [20 mM glutathione (Sigma-Aldrich), 50 mM Tris-HCl pH 8.0, 1 mM DTT, and protease inhibitors] for 30 min at 4oC. At each step, the beads were centrifuged at 250 x g at 4oC for 1 min and the supernatant recovered. Protein concentrations were determined by the Bradford Protein Assay (BioRad, California, USA) at 595 nm using bovine serum albumin (BSA) as standard. Absorbance readings were taken using a Beckman Coulter DU 640 spectrophotometer (Beckman Coulter). Purity of the eluted proteins was confirmed by running a sample on a 10% (w/v) acrylamide sodium dodecylsulfate (SDS) – polyacrylamide gel electrophoresis (PAGE) gel and staining with Coomassie brilliant blue R-250 dye (BioRad). Proteins were flash frozen in aliquots using liquid nitrogen and stored at -80oC.

2.6 In vitro GST-pull down assay with purified proteins

Five μg of purified GST, purified GST-Ku80 C-terminal fragments (residues 545- 732, 592-732, 592-709, or 592-718) were bound to glutathione-Sepharose beads (GE Healthcare) and incubated with 5 µg purified DNA-PKcs alone at 4°C for 3 h with end- over-end rotation. Beads were harvested by centrifugation at 1,000 × g for 30 seconds and were washed 4 X with 1 ml NETN buffer [50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.2 mM ethylenediaminetetraacetic acid (EDTA), 0.25% (v/v) NP-40]. Two times SDS sample buffer was added to the beads, which were then heated at 95oC in a heating block for 5 minutes. Samples were immunoblotted for DNA-PKcs as described below.

2.7 Preparation of cell extracts

Cells were harvested by adding 0.05% trypsin-EDTA solution (Gibco, Life Technologies) to the cells and incubating at 37oC momentarily. Harvested cells were washed with ice-cold phosphate buffered saline [PBS: 137 mM NaCl, 1.8 mM potassium dihydrogen phosphate (KH2PO4), 10 mM Na2HPO4, 2.7 mM potassium chloride (KCl), pH 7.4], and centrifuged at ~800 x g for 5 minutes. All cell extracts were lysed in buffers

containing 0.2 mM PMSF, 2 μg/mL pepstatin, 2 μg/mL aprotinin and 2 μg/mL leupeptin to inhibit proteases. All steps were carried out on ice.

2.8 NET-N whole cell extracts

The cell pellet was resuspended in two times the packed cell volume of NET-N buffer [50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.2 mM EDTA, 1% (v/v) NP-40] containing protease inhibitors and phosphatase inhibitors as described above. Cells were incubated on ice for 15-20 min. prior to sonication (2 x 5 second bursts at setting # 4). Sonicated cells were then centrifuged at 4°C, 10,000 x g for 10 minutes and supernatants collected to generate whole cell extract (WCE).

2.9 Hypotonic/Hypertonic cell extracts (S10/P10 extract)

After washing in PBS, cells were additionally washed in low salt buffer [LSB: 10 mM HEPES-NaOH pH 7.4, 25 mM KCl, 10 mM NaCl, 1 mM magnesium chloride

(MgCl2), 0.1 mM EDTA, 1mM DTT] and then resuspended in two-times the packed cell volume of LSB containing protease inhibitors and 0.1 μM microcystin LR (MC-LR; Calbiochem) to inhibit serine/threonine protein phosphatases. Cells in hypotonic LSB were incubated on ice for 5 minutes to allow swelling to occur, followed by flash freezing in liquid nitrogen. Frozen cells were quick-thawed at 30oC, then immediately centrifuged at 10,000 x g 4oC for 10 minutes. The supernatant containing cytoplasmic proteins was referred to as the S10, while the pellet contained whole nuclei. Nuclei-containing pellets were then gently resuspended in high salt buffer (HSB: 10 mM HEPES-NaOH, pH 7.4,

0.1 mM EDTA, 25 mM KCl, 10 mM MgCl2, 450 mM NaCl, containing protease inhibitors and 0.1 μM MC-LR) at 1/5th the volume of the original volume of LSB buffer. Resuspended nuclei were incubated for ~5 minutes on ice before being centrifuged at 10,000 x g at 4oC for 10 minutes. The supernatant, containing soluble nuclear proteins was referred to as the P10. The residual pellet contained membranes, chromatin and insoluble nuclear proteins. Protein estimations were performed by the Bradford method using BSA as above.

2.10 Immunoprecipitation protocol

Cells at high (> 75%) confluency were either left untreated or treated with 10 Gy of IR and allowed to recover for different times. Cells were harvested and lysed in NET- N buffer as described above. Lysates were precleared with protein A Sepharose (pAS) or protein G Sepharose (pGS) (GE Healthcare) beads for 30 min. at 4oC. Beads were removed by centrifugation at 4oC, 800 x g for 30 seconds. The supernatant was incubated with the appropriate antibody (see Figure 2-1 and 2-2 for details of antibodies used for immunoprecipitations). Antigen-antibody complex formation was allowed to occur for 4 hrs to overnight, depending on the antibody. After that, pAS or pGS beads were added to the lysate and samples were incubated for 30 min. then centrifuged at 4oC, 800 x g for 30 seconds to pull down the complex. In experiments where overnight incubation was performed, prior to adding the pAS or pGS beads, extracts were briefly centrifuged at 10,000 g, 40C for 2 minutes to remove any precipitates. Standard wash conditions used were: 4 X with 1 ml NET-N (150 mM NaCl) buffer containing 0.25% (v/v) NP-40, followed by 2 X with NET-N buffer containing 0.5% (v/v) NP-40. For stringent wash conditions to disrupt nonspecific electrostatic and hydrophobic interactions, beads were washed once with 1 ml of TBS (Tris buffered saline, composition described below) containing 0.05% (vol/vol) Tween 20, twice with 1 ml of 50 mM HEPES-NaOH (pH 7.5), 40 mM NaCl, 2 mM EDTA, and 1% (vol/vol) Triton X- 100, and twice with 1 ml of 50 mM HEPES-NaOH (pH 7.5), 40 mM NaCl, 2 mM EDTA, and 1% (v/v) Triton X-100 containing 500 mM LiCl. All co-immunoprecipitation experiments were conducted in the presence of benzonase (Sigma-Aldrich), a broad- spectrum nuclease that degrades DNA as well as RNA, to avoid artefacts due to non- specific DNA-mediated protein interactions. After washing, SDS sample buffer was added to the beads, and samples were heated for 5 min. at 95oC in a heating block and loaded onto SDS-PAGE gels. Immunoblotting was carried out using the antibodies indicated in the figures. Negative controls for immunoprecipitation experiments were rabbit IgG, non-immune rabbit serum (NIRS) for DPK1 antibody IP, or mouse IgG1κ subtype (Abcam) as indicated in the figure legends. In some experiments, the antibody was coupled to the beads using 20 mM dimethyl pimelimidate (DMP) (Sigma-Aldrich) in 45

0.2 M sodium borate (Na2B4O7) pH 9.0 (Harlow and Lane 1999). Coupling was done at RT with end-over-end rotation. Pre- and post- couple beads were collected and run on 10% SDS-PAGE gel to validate antibody coupling to the beads.

Figure 2-1 The domain organization of DNA-PKcs and the corresponding epitopes recognized by the DNA-PKcs antibodies.

DNA-PKcs domain organization as discussed previously. Mouse monoclonal antibodies 18-2 and 42-27 recognize epitopes in the N-terminal and C- terminal region, respectively. Rabbit polyclonal antibody DPK1 was raised to residues 2018-2136 of DNA-PKcs.

Figure 2-2 The domain organization of Ku70 and the corresponding epitope recognized by the Ku70.30 antibody used to immunoprecipitate the Ku heterodimer.

Ku70 domain organization as discussed previously. Rabbit Ku70.30 antibody was raised to residues 1-114 of Ku70 subunit.

2.11 Immunoprecipitation followed by mass spectrometry to determine DNA-PKcs interacting proteins.

HeLa cells were grown on plates to ~80% confluency, trypsinized, then washed in PBS. Cells were resuspended in NET-N buffer then incubated on ice for 10 minutes to lyse, followed by sonication at output “4”, 2X 5 second. Where indicated, cells were irradiated 10 Gy and harvested within 15 minutes. Cell extracts were clarified by centrifugation at 4oC, 10,000 x g for 10 min. Protein concentrations were determined by the Detergent Compatible protein assay using BSA as standard. WCEs were adjusted to 10-15 mg/ml total protein concentration. Co-immunoprecipitation experiments were carried out using anti-DNA-PKcs mouse monocolonal antibody, 18-2 (a kind gift from Dr. Tim Carter, New York University, USA). Mouse IgG1κ subtype was used as control. Beads were resuspended in NET-N buffer containing 150 mM NaCl, 1 mM EDTA, 50 mM Tris-HCI pH 7.5 and 1% (v/v) NP-40. Lysates were precleared by addition of IgG1κ coupled pGS (for 7.5-10 mg WCE, 40 μl slurry was used) overnight with rotation at 4°C. Extracts were centrifuged at 3000 x g for 1 minute to remove beads then centrifuged at 10,000 x g at 4°C for 10 minutes to remove insoluble proteins. Extracts were precleared again with the same amount of IgG1-coupled pGS, as above for 3 hours. Pre- cleared extracts (20 mg protein per IP) were incubated with either IgG coupled pGS (7.5-10 mg extract per 15 µl beads) or 18-2 IgG coupled to PGS (same ratio of extract/beads) for 4 hours at 4°C. Beads were spun down at 1000 x g for 30 seconds then washed 4 X with NET-N containing 0.5% (v/v) NP-40, 2 X with 1% (v/v) NP-40 followed by 1 X with 20 mM Tris-HCl pH 7.5. Proteins were eluted from beads by addition of 30 μl 1% SDS (freshly made from powder). Samples were boiled then diluted by addition of 90 μl water and sent to Dr. Nick Morrice, Beatson Cancer Institute, Glasgow, Scotland, UK for mass spectrometric analysis. Samples were reduced and alkylated, run on NUPAGE gradient SDS PAGE gels (Invitrogen) and analysed by mass spectrometry (MS). Immunoprecipitation experiments were carried out by Mrs. Ruiqiong Ye in the Lees-Miller lab. Mass spectrometry was carried out by Dr Nick Morrice, Beatson Institute, Glasgow, Scotland.

2.12 SDS-PAGE and Immunoblotting

Proteins with molecular weights ≥ 200 kDa were analyzed on 8% (w/v) acrylamide-low bis-acrylamide gels (Chan, Mody et al. 1996) and all others were analyzed on 10% (w/v) acrylamide gels (Sambrook, Fritsch et al. 1989). SDS-PAGE was conducted in SDS running buffer containing 50 mM Tris base, 384 mM glycine, and 0.1% (w/v) SDS, pH 8.3. Samples were loaded onto gels using SDS-sample buffer [2 X SDS-sample buffer: 100 mM Tris-Cl, pH 6.8, 4% (w/v) SDS, 355 mM 2- betamercaptoethanol, 20% (v/v) glycerol, and 0.2% (w/v) bromophenol blue]. Electrophoresis was conducted at 100 V for the stacking gel and 140 V for the resolving gel at RT. Broad range protein molecular weight markers (BioRad) [200 kDa (myosin), 116 kDa (β-galactosidase), 97 kDa (phosphorylase b), 66 kDa (serum albumin), 45 kDa (ovalbumin), 31 kDa (carbonic anhydrase), 21.5 kDa (trypsin inhibitor), 14.4 kDa (lysozyme), 6.5 kDa (aprotinin)] were used. SDS - PAGE separated proteins were transferred to nitrocellulose membranes (BioRad) using the wet transfer apparatus (BioRad). Transfer of proteins ≥ 200 kDa was carried out in modified electroblot buffer [48 mM Tris base, 39 mM glycine, 20% (v/v) methanol] containing SDS 0.036% (w/v). For proteins ≤ 200 kDa, transfer was carried out in electroblot buffer with no SDS [25 mM Tris base, 192 mM glycine, 20% (v/v) methanol]. Transfers were conducted at 100 V for 1 hr at RT. Membranes were stained with Ponceau S (BioRad) and blocked in Tris-buffered saline (TBS) (20 mM Tris base, 150 mM NaCl, pH 7.5) containing 0.1% (v/v) Tween 20 (TTBS) and 5% (w/v) skim milk powder for at least 1 hr at RT. Membranes were washed with TTBS and incubated with primary antibody at the concentrations and times indicated in Table 2-5. Primary antibodies were made up in TTBS containing 0.1% (w/v) gelatin or 1 mg/ml BSA and 0.02% (w/v) sodium azide. Goat anti-mouse or goat anti-rabbit secondary antibodies conjugated to horse radish peroxidase (BioRad) were used in TTBS containing 10% (w/v) skim milk powder and incubated for indicated time period. Membranes were again washed with at least 3 changes of TTBS for minimum of 30 min. at RT. Finally proteins detected by adding Western Lightning Plus-ECL (Perkin Elmer, Waltham, MA, USA) to the membranes and exposed to autoradiographic film (Fuji Film, Tokyo, Japan). If 48

indicated, nitrocellulose membranes were stripped of antibody by incubation in stripping buffer [60 mM Tris-HCl pH 6.8, 2% (w/v) SDS, 0.7% (v/v) 2-mercaptoethanol] for 15 min at 55oC then re-blocked and incubated with a second antibody as above.

2.13 Gel staining protocols

2.13.1 Coomassie staining protocol

Where indicated, gels were stained with 0.2% (w/v) Coomassie brilliant blue R- 250 (BioRad), 50% (v/v) methanol, 10% (v/v) glacial acetic acid and 40% water. Gels destained with a mixture of 40% (v/v) methanol, 10% (v/v) glacial acetic acid, 50% water. 2.13.2 Silver staining protocol

When indicated, immediately following electrophoresis, gels were fixed with 10 ml glacial acetic acid, 40 ml methanol, 50 µl of 37% (v/v) formaldehyde, and 50 ml distilled water for at least 1 hr, followed by washing 3 X 15 min. with 50% (v/v) ethanol. Gels were then treated with 1 mM sodium dithionite reducing solution for 1 min. and washed immediately with water. Silver nitrate staining solution [0.2% (w/v) silver nitrate, 75 µl of 37% (v/v) formaldehyde in 100 ml. distilled water] was added to the gel and incubated for 15-20 min. Gels were washed again with water. Protein bands on gels were visualized by adding developer solution [6% (w/v) sodium carbonate, 50 µl 37% (v/v) formaldehyde, 0.001% (w/v) sodium thiosulphate]. Reactions were stopped by adding stop solution [3.5% (v/v) glacial acetic acid in developer solution]. Gels were then washed with water and stored after drying.

2.14 DNA cellulose pull down assay

Cell extracts were prepared by the hypotonic/hypertonic (S10/P10) extraction method as described above, with some modification. After collecting S10 and P10 fractions, both were mixed together and the final salt concentration was adjusted to 150 mM. This combined fraction was used then incubated with preswollen ds DNA cellulose

(Sigma-Aldrich). Lysates with DNA-cellulose were incubated at 4oC for 1 hr with end- over-end rotation. Subsequently samples were collected by centrifugation at 3000 x g for 30 seconds at 4oC. Beads were then washed 5 X with binding buffer. Two times SDS sample buffer was then added to the beads, then they were heated at 95oC for 5 min. and samples loaded on to low bis 8% (w/v) acrylamide gels (for detection of DNA- PKcs) or 10% (w/v) acrylamide gels for detection of other proteins. The buffer used for swelling as well as for binding and washing the dsDNA beads contained 25 mM

HEPES-NaOH pH 7.9, 50 mM KCl, 10 mM MgCl2, 1 mM DTT, 5% (v/v) glycerol, 0.5 mM EDTA, and 0.25 mM ethylene glycol tetraacetic acid (EGTA).

2.15 Drug treatment

DNA damaging agents were solubilized, stored and used as described below. Doxorubicin (Sigma-Aldrich) was solubilized as a 10 mM stock in DMSO and stored at - 20°C. Drug dilutions ranging from 0.1 µM - 5 µM were made in cell culture medium. Cells were treated with doxorubicin for 90 min. and then washed two times with PBS then fresh medium was added to the cells. Etoposide (Sigma-Aldrich) was solubilized as 40 mM stock in DMSO, stored at -20oC and used at a concentration range of 1-10 µM. Cells were treated with etoposide for 4 hours, washed with PBS two times then placed in fresh medium. Camptothecin (Sigma-Aldrich) was solubilized as a 10 mM stock in DMSO, stored at -20°C and used at a concentration range of 1- 60 nM. Cells were treated with camptothecin for 24hrs, then washed two times with PBS then placed in fresh media. Neocarzinostatin (Sigma-Aldrich) was diluted from the stock in cell culture medium and used at a concentration range of 10 - 30 ng/ml. Small molecule inhibitors of ATM (KU55933) and DNA-PKcs (NU7441) were from Tocris (Bristol, UK) and Selleck chemicals (USA), respectively. Both drugs were solubilized as 10 mM stocks in DMSO and used on cells at the indicated concentrations.

2.16 Ionizing radiation (IR) treatment

Cells were irradiated with IR using a Gammacell 1000 137Cs source (MDS Nordion, Ottawa, Canada) with a dose rate of 3.4 Gy/minute. All irradiation treatments were performed on cells in culture medium in 6 mm2 plates.

2.17 Clonogenic cell survival assay

Cells were harvested by treatment with Trypsin/EDTA and washed with PBS. Recovered cells were diluted in media, and cell numbers were determined using a hemocytometer. Depending on the dose of irradiation or drug treatment, different numbers of cells were plated, in triplicate, in 60 mm2 tissue culture dishes for each condition. Four ml of cell suspension was added to each tissue culture dish and cells o were incubated for approximately 7 days at 37 C under 5% CO2 in a humidified incubator to allow colonies of greater than 50 cells to form. Cells were fixed [3% (v/v) glacial acetic acid, 8% (v/v) methanol, 89% (v/v) water] for 5 minutes then stained using 0.2% (w/v) crystal violet in 10% (v/v) formalin for 5 min. Plates were washed 2-3 times with water and air dried. Colonies were counted using the ColCount system (version 4.3.5.1, Oxford OPTRONIX Ltd., Oxford, UK) and the surviving fraction was calculated using the formula: Plating efficiency (P.E) = # of colonies observed in untreated dish / # of cells seeded Surviving Fraction (S.F) = # of colonies counted / (# of cells seeded x P.E) X 100

2.18 Cell cycle analysis by Fluorescence Activate Cell Sorting (FACS)

Cells were harvested by treatment with Trypsin/EDTA solution as above. Cell suspensions were washed twice with PBS, and then centrifuged at 800 x g for 5 minutes, 4oC. Cells were then resuspended in 0.9% (w/v) NaCl and fixed by adding an equal volume of ice-cold 95% (v/v) ethanol, drop-wise. Fixed cells were then treated with 50 μg/mL propidium iodide (Sigma-Aldrich) to label DNA. RNase A (1 μg/mL) (Sigma-Aldrich) was added and cells incubated at 37oC for 30 min. Approximately 0.5 X

106 cells were provided for each analysis. Samples analyzed using a FACScan flow cytometer (Becton Dickinson) at the University of Calgary Flow Cytometry facility.

2.19 NHEJ reporter assay

HEK293 cells stably transfected with vectors containing the GFP coding region under the control of cytomegalovirus (CMV) promoter (a kind gift from Dr. Jeremy Stark, Beckman Research Institute, California) (Bennardo, Cheng et al. 2008) were seeded at 40% confluency. The following day cells were either left untransfected or transfected in OPTI - MEM medium (Invitrogen) with 5 μg ISceI expression plasmid (a gift from Dr. Jeremy Stark, as above) using Lipofectamine 2000 (Invitrogen) according to the manufacturers protocol. After 6 hr incubation, transfection reagent was removed and replaced with fresh medium. Cells were incubated for another 72 hrs then collected by addition of trypsin/EDTA, washed and resuspended in PBS. The GFP positive cell population was determined using a FACScan flow cytometer (Becton Dickinson) at the University of Calgary Flow Cytometry facility.

2.20 Cloning of Ku70 and Ku80 cDNA into baculovirus vector

Ku70 cDNA was cloned into the pFastbac1 (Invitrogen) vector and Ku80 was cloned into the pFastbac HTA (Invitrogen) vector which has an N-terminal hexa histidine tag and an AcTEVTM protease cleavage site. Both vectors were digested with BamH1 and Xho1 restriction enzymes. A list of the primers used for generating full length Ku70 and Ku80 and its C-terminal truncations is provided in Table 2-1 below. After sequence verification, plasmids were amplified by transforming into MAX Efficiency® DH5α™ competent cells (Invitrogen). Plasmids were then used to generate bacmids.

2.20.1 Polymerase chain reaction (PCR) reaction conditions

Table 2-3 The PCR conditions for cloning.

10 X Pfu enzyme buffer 5 µl 2.5 mM dNTP mix 4 µl Template DNA 100 ng Primer, N-terminal 0.2 µM Primer, C-terminal 0.2 µM Turbo Pfu enzyme 2.5 Units Double distilled water To make up volume 50 µl

PCR (BioRad T100™ Thermal cycler) run conditions:

Elongation time was varied on the basis of 1 min./1000 bp template.

2.21 Generation of recombinant bacmids

A vial (100 µl) of MAX Efficiency® DH10Bac™ competent cells was thawed on ice for each transformation. Plasmid DNA (~10 ng) was added to the cells and the sample was mixed gently without pipetting. Cells were incubated on ice for 30 min. Transformation was carried out by heat shock at 42oC for 60 seconds. Cells were again chilled on ice for 2 min. Nine hundred µl S.O.C medium [2% (w/v) tryptone, 0.5% (w/v)

yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM magnesium sulphate

(MgSO4,) and 20 mM glucose] was added to the cells and they were transferred to 15 ml round bottom polypropylene tubes and grown for 4 hours at 37oC, with shaking at 225 rpm. Ten-fold serial dilutions of the cells (10–1, 10–2) were prepared in S.O.C.

Medium. One hundred µl of undiluted and diluted cells were plated on LB agar plates containing 50 μg/mL kanamycin, 7 μg/mL gentamicin, 10 μg/mL tetracycline, 100 μg/mL Bluo-gal and 40 μg/mL IPTG. Plates were incubated at 37oC for 2 days. After two days, plates were screened for blue-white colonies. White colonies indicated successful transposition which was confirmed by PCR using M13 forward and reverse primers (see Table 2-2 for sequences of primers used). Phenotype of white colonies were verified by restreaking on fresh LB agar plates containing 50 μg/mL kanamycin, 7 μg/mL gentamicin, 10 μg/mL tetracycline, 100 μg/mL Bluo-gal (Invitrogen) and 40 μg/mL IPTG. Plates were incubated overnight at 37°C. A single colony with white phenotype was inoculated into liquid culture containing 50 μg/mL kanamycin, 7 μg/mL gentamicin, and 10 μg/mL tetracycline. Bacmids were isolated using the GeneJET plasmid miniprep kit (Thermo ScientificTM) with modifications. After cell lysis and centrifugation, supernatants were transferred into 0.7 volume of isopropanol to precipitate DNA. Bacmid DNA was collected by centrifugation, 10000 x g for 10 min. at RT. Supernatants were discarded and pellet washed with 70% (v/v) ethanol by inverting the pellet few times. DNA was centrifuged again, 10000 x g for 10 min. and the pellet air dried. Bacmids were then resuspended in autoclaved water and stored at -20oC. DNA concentrations were determined by abosorbance at A280 nm using Nanondrop 2000c (Thermo Scientific).

2.22 Baculovirus generation and amplification

Baculovirus were generated by transfecting bacmid, isolated above, into Sf9 insect cells. Log phase insect cells were used for transfection. Transfections were performed in T25 flasks. Cells were counted and 2X106 cells were seeded into flasks in Sf-900II serum free medium (Invitrogen) and cells were allowed to attach to the flask surface for 15 -20min. Transfection complex was prepared by adding 6 µl (500 ng/µl) bacmid to 200 µl insect cell medium. This was labeled as solution A. Then 16 µl of Cellfectin®II (Invitrogen) was added to the 200 µl insect cell medium and labeled as solution B. Both solutions were incubated at RT for up to 20 min. Solution A was then added to solution B and incubated for a further 15-20 min. After incubation, the mixture was carefully added to the cells in the flasks drop by drop. Cells were transferred to a 54

27oC incubator for 3-5 hrs. After that the transfection complex was removed and replaced with fresh cell culture medium. Cells were grown for 7 days and observed under a microscope for signs of virus infection throughout (i.e. by increase in cell diameter). At the end of the incubation period, the supernatant was collected, labeled as P1 stock and stored in sterile tubes at 4oC, protected from light. The P1 stock was subsequently used to amplify P2 and P3 baculovirus stocks for protein expression. Aliquots of P2 virus stocks were frozen and stored at -80oC. Viral titres were determined for each P3 baculovirus stock using the plaque assay. Plaque assays were carried out with serial dilutions ranging from 10-2 to 10-8 in Sf-900II serum free medium. One x 106 insect cells in 2 ml Sf-900II medium were plated in each well of a 6 well-35mm dish. Cells were allowed to settle for 1hr at RT. Medium was removed and replaced with 1 ml of appropriate virus dilutions to each well and incubated for one hour at RT. Sterile 4% low melting agarose was melted and diluted with Sf-900II medium to a final dilution of 1%. Diluted virus inoculums were removed and 1.5 ml of the 1% agarose/media mixture was added to each well. Cells were then incubated for 6 days at 27oC. Media was removed and cells stained with 0.5 ml of 1 mg/ml neutral red dye and incubated at RT for one hour. The dye was removed from plates, which were then allowed to dry and the plaques counted. Negative control plates contained no virus. The titre (pfu/ml) was calculated from - number of plaques X dilution factor X 1/ml of inoculum/well The titre for Ku70 and Ku80 constructs ranged from 1.1 -1.3 X 108 pfu/ml. For protein expression, a 1:1 ratio of Ku70 and Ku80 baculovirus P3 stocks was used to infect insect cells.

2.23 Protein expression and purification

Four hundred ml of Sf9 insect cells at 1X106 cells/ml, was co-infected with 1.5 ml of Ku70 and Ku80 (full length or C-terminal truncations) P3 baculovirus stock. Forty eight hrs was found to be the optimum time for Ku heterodimer expression. After this time, cells were collected by centrifugation at 4oC, 3000 rpm in a Beckman, Model - J6B centrifuge, then washed with ice-cold PBS and processed further. Insect cells were 55

resuspended in lysis buffer (50 mM NaH2PO4, pH 8, 300 mM NaCl, 10 mM imidazole, 0.2 mM PMSF, 0.2 µg/ml aprotinin, 0.2 µg/ml leupeptin, 0.2 µg/ml pepstatin) and sonicated (4 x 10 sec, power setting 4; Fisher Scientific Sonic Dismembrator Model 100, Fisher Scientific). Cell lysates were then centrifuged at 14,000 x g for 15 min., 4oC and supernatants separated from cell debris. The supernatant was then loaded onto a 5 ml HisTrap column (GE Healthcare), which was pre-equilibrated with at least 5 column volumes of lysis buffer. After loading, the column was washed with at least 5 column volumes of wash buffer (50 mM NaH2PO4, pH 8, 300 mM NaCl, 20 mM imidazole, 0.2 mM PMSF, 0.2 µg/ml aprotinin, 0.2 µg/ml leupeptin, 0.2 µg/ml pepstatin). Proteins were eluted in lysis buffer with a gradient of 10 - 250 mM imidazole, 70 fractions were collected. Eluted proteins containing Ku70/80 heterodimer were pooled and dialyzed overnight at 4oC against TB50 buffer [Tris-HCl, pH 8, 50 mM KCl, 0.2 mM EDTA, 5% (v/v) glycerol, 0.2 mM DTT, 0.2 mM PMSF, 0.2 µg/ml aprotinin, 0.2 µg/ml leupeptin, 0.2 µg/ml pepstatin], using Spectra/Por® 12-14 kDa molecular weight cutoff dialysis membrane. Next morning, the dialyzed protein was manually loaded onto diethylaminoethyl (DEAE) sepharose (GE Healthcare) beads that had been pre- equilibrated with TB50 binding buffer. After loading, the column was washed with at least 5 column volumes of TB50 buffer. Bound proteins were eluted with TB175 buffer [Tris-HCl, pH 8, 175 mM KCl, 0.2 mM EDTA, 5% (v/v) glycerol, 1 mM DTT, 0.2 mM PMSF, 0.2 µg/ml aprotinin, 0.2 µg/ml leupeptin, 0.2 µg/ml pepstatin] and with TB 750 buffer [Tris-HCl, pH 8, 750 mM KCl, 0.2 mM EDTA, 5% (v/v) glycerol, 1 mM DTT, 0.2 mM PMSF, 0.2 µg/ml aprotinin, 0.2 µg/ml leupeptin, 0.2 µg/ml pepstatin]. Fractions containing purified Ku70/80 heterodimer were pooled then dialyzed against TB 50 buffer [Tris-HCl, pH 8, 50 mM KCl, 0.2 mM EDTA, 5% (v/v) glycerol, 0.2 mM DTT, 0.2 mM PMSF, 0.2 µg/ml aprotinin, 0.2 µg/ml leupeptin, 0.2 µg/ml pepstatin]. Dialyzed protein was then loaded onto a 5 ml HiTrap Heparin column (GE Healthcare). After washing the column with at least 5 column volumes of TB50 buffer, bound protein was eluted with a gradient of 50 - 750 mM KCl. In some cases, additional columns were used to achieve optimal protein purity. These, included HiTrap™Q XL (GE Healthcare) and ssDNA cellulose (Sigma-Aldrich) columns. Protein bound to the HiTrap™Q column was eluted

with a gradient of TB buffer containing 50-750 mM KCl. For DNA cellulose purification, protein samples were loaded onto a 3 cm3 column of ssDNA cellulose beads and eluted sequentially with 5 ml TB buffer containing 100, 200, 300, 400, 500, 600, or 750 mM KCl. Chromatographic steps were carried out on a Biologic protein purification system (BioRad, Hercule, CA) at RT. Ku heterodimer containing fractions were determined by SDS-PAGE followed by Coomassie brilliant blue R250 staining after each column. Purified protein were concentrated to ~1 mg/ml concentration using 30 kDa molecular weight cutoff Vivaspin 6 centricon (GE Healthcare) devices, aliquoted and stored at - 80oC.

2.24 Purified DNA-PKcs

DNA-PKcs used to perform kinase activity assay, substrate phosphorylation, and biotin pull down assay was purified by Dr. Yaping Yu and Mrs. Shujuan Fang using the method described previously (Chan, Mody et al. 1996, Goodarzi and Lees-Miller 2004).

2.25 DNA structures used in the study

DNA oligonucleotides were obtained from IDT DNA technologies (IA, USA). Oligos were purified by high performance liquid chromatography (HPLC). Double stranded DNA was generated by annealing the complementary sequences using PCR. Oligos were heated at 95oC for 5 min. for 1 cycle, followed by 70 cycles of cooling at the rate of -1oC/ cycle. Annealing was done in TE buffer (10 mM Tris-HCl, pH 8, 50 mM NaCl, 1 mM EDTA). Annealed oligos were analyzed on an agarose gel and stored at - 20oC. Table 2-4 contains a list of DNA substrate used for EMSA, biotin pull down and DNA-PKcs kinase assays.

2.26 DNA-PKcs kinase assays using the p53 peptide substrate assay

Peptide substrate assays were carried out in buffer containing 25 mM HEPES-

NaOH pH 7.4, 75 mM KCl, 10 mM MgCl2, 1 mM DTT, 0.2 mM EGTA, 0.1 mM EDTA, 10

μg/mL sonicated calf thymus DNA, 0.25 mM synthetic peptide (PESQEAFADLWKK), 0.25 mM ATP containing 1 μCi/µl of [γ-32P] ATP (Perkin-Elmer Life Sciences), 30 ng (3.3nM) of DNA-PKcs and 10 ng (3.3 nM) of Ku70/80 in a 20 μL final volume (Lees- Miller, Sakaguchi et al. 1992). Reactions were incubated at 30oC for 5 min. Assays were stopped by the addition of an equal volume of 30% (v/v) acetic acid containing 5 mM cold ATP. Reaction mixtures were spotted and dried onto 2 cm x 2 cm P81 phosphocellulose paper (Whatman, Clifton, NJ) before being sequentially washed three times with 15% (v/v) acetic acid to remove free ATP. Washed phosphocellulose papers were analyzed by Cerenkov counting in a Beckman LS 6500 scintillation counter (Beckman Coulter, CA, USA). DNA-PK kinase activity was expressed as pmole phosphate incorporated per minute per μg of protein. Synthetic peptides were synthesized and purified by high-pressure liquid chromatography by the Alberta Peptide Institute (Edmonton, AB).

2.27 DNA-PKcs autophosphorylation determination using phosphospecific antibodies

Purified DNA-PKcs (48 nM, 450 ng) and Ku70/80 heterodimer [wild type and mutants (48 nM, 150ng)] were incubated in reaction buffer (50 mM HEPES–NaOH, pH

7.5, 75 mM KC1, 10 mM MgCl2, 0.05 mg/ml BSA, 1 mM DTT, 0.2 mM EGTA, 0.1 mM EDTA). Reactions were started by the addition of 0.25 mM unlabelled (non-radioactive) ATP. Calf thymus DNA was used at 10 μg/ml concentration whereas defined DNA substrates were used at the concentrations indicated in the figures. Reactions were performed at 30oC for 10 min. Reactions were stopped by adding 5X SDS sample buffer [0.25 M Tris-HCl pH 6.8, 10% (w/v) SDS, 50% (v/v) glycerol, 0.25% (w/v) bromophenol blue, 0.5M DTT) and heated in a 95oC heating block for 5 min. Samples were analyzed by SDS-PAGE on low bis 8 % acrylamide gels followed by immunoblotting as described above. Membranes were probed with phosphospecific and non-phosphospecific antibodies as indicated in the figures, using the conditions described in Table 2-5.

2.28 Biotin pull down assays

Biotinylated oligonucleotides (listed in Table 2-4) were used to determine the interaction between wild type and mutant Ku heterodimer and DNA-PKcs. Reactions were carried out in DNA-PK kinase assay buffer as described above, supplemented with 5% (v/v) glycerol and 0.05% (v/v) NP 40. Oligonucleotides were bound to Streptavidin MagneSphere® Paramagnetic Particles (Promega, WI, USA) at RT with end-over-end rotation for 10 min. Beads were then pulled down using a MagneSphere Technology Magnetic Separation Stand (Promega), and washed with reaction buffer once. Ku (150 ng) and DNA-PKcs (450 ng) were incubated with the beads for an additional 20 min. at RT with end-over-end rotation. Beads were then washed 3 X with reaction buffer supplemented with 0.1% (v/v) NP 40. Two X SDS sample buffer was added to the beads and samples were heated at 95oC in a heating block for 5 min. Samples were loaded onto low bis 8% acrylamide gels and immunoblotting performed as described above.

Table 2-4 List of DNA substrates used for DNA-PKcs kinase assay, biotin pull down assay, and EMSA.

Sequence and Representative Symbol

5’ AAGCTTGCATGCCTGCAGGTCGACC 3’ TTCGAACGTACGGACGTCCAGCTGG

5’ TTTTTTTTTTTTTTTAAGCTTGCATGCCTGCAGGTCGACC 3’ 3’ TTCGAACGTACGGACGTCCAGCTGG 5’

5’ AAGCTTGCATGCCTGCAGGTCGACCTTTTTTTTTTTTTTT 3’

3’ TTCGAACGTACGGACGTCCAGCTGG 5’

5’ AGCATTGACTGGCATCGTAGCATCC 3’ 3’ TCGTAACTGACCGTAGCATCGTAGG 5’

5’ TTTTTTTTTTTTTTTGGATGCTACGATGCCAGTCAATGCT 3’ 3’ CCTACGATGCTACGGTCAGTTACGATTTTTTTTTTTTTTT 5’

5’ GGATGCTACGATGCCAGTCAATGCTTTTTTTTTTTTTTTT 3’ 3’TTTTTTTTTTTTTTTCCTACGATGCTACGGTCAGTTACGA 5’

2.29 Electrophoretic mobility shift assay (EMSA)

EMSA were carried out with 6-fluorescein amidate (FAM) labelled deoxyoligonucleotides as described above. Varying amounts of Ku mutant proteins or BSA alone were incubated with DNA in buffer containing 25 mM HEPES pH 7.5, 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 10% (v/v) glycerol in 10 µl reaction volumes for 25 min.

at 25oC. Reaction mixtures were then loaded onto non-denaturing polyacrylamide gel [4.85 % (w/v) acrylamide, 0.1% (w/v) bis-acrylamide]. Gels were cast and run in Tris- glycine buffer (50 mM Tris, 400 mM glycine, 2.5 mM EDTA) for 35 min. at 100 volts. DNA was visualized by exposing the gel plates to fluorescence light using a Fujifilm LAS 4000 (Fujifilm, Tokyo, Japan). 6-FAM has an absorbance maximum of 492 nm and an emission maximum of 517 nm. Labelled DNA was protected from light while performing experiments.

2.30 Mass spectrometry analysis

HeLa whole cell extract was prepared using NET-N lysis buffer as described above. Lysates were diluted with NET buffer to adjust the detergent concentration to 0.25% (v/v) NP-40. From that, 2.5 mg lysate was incubated with 2 µg of purified GST- Ku70 (residues 536-609) or GST alone bound to the GST beads, for 3 hrs at 4oC with end-over-end rotation. Beads were then washed 4 X with binding buffer (50 mM Tris- HCl pH 7.5, 150 mM NaCl, 0.2 mM EDTA, 0.25% NP-40). Two times SDS sample buffer was added to the beads, and samples were heated for 5 min. at 95oC and loaded onto 10% acrylamide SDS-PAGE gels. Gels were stained with freshly prepared Coomassie brilliant blue R-250 for 30 min. at RT on a shaker and then destained. Putative interacting protein bands were cut out using a clean scalpel and sent for analysis. MS analysis was performed at the Southern Alberta Mass Spectrometry Facility at the University of Calgary.

2.31 Image quantitation and statistical analysis

Image quantitation carried out using Fuji Image J software. Unpaired Student’s t- test, two tailed, analysis was carried out using GraphPad Prism 6 software. P < 0.05 was used as a significance threshold for all tests unless otherwise indicated.

Table 2-5 List of antibodies, and the conditions, used for western blotting.

Protein Antibody/ Company Host Primary Seco- Catalog# antibody ndary Anti- body BRD4 ab128874 Abcam Rabbit 1:1000, o/n, 1:3000, 4oC RT 1hr DNA-PKcs DPK1 In house Rabbit 1:10,000 1:3000, o/n*, 4oC RT 1hr DNA-PKcs 42-27 In house Mouse 1:1000 o/n*, 1:3000, 4oC RT 1hr pS2056 DNA-PKcs Phosphospecific Abcam Rabbit 1:200, o/n, 1:3000, 4oC RT 1hr pT2609 DNA-PKcs Phosphospecific Abcam Mouse 1:500, o/n, 1:3000, 4oC RT 30min. pS2612 DNA-PKcs Phosphospecific Abcam Rabbit 1:1000, o/n, 1:3000, 4oC RT 30min. pT2647 DNA-PKcs Phosphospecific In house Sheep 10 µg/ml, 1:1000, o/n,4oC RT 1hr pT3950 DNA-PKcs Phosphospecific In house Rabbit 1:200, o/n, 1:3000, 4oC RT 1hr GST ab19585 Abcam Mouse 1:1000, o/n, 1:3000, 4oC RT 1hr Ku70 ab2620 Abcam Rabbit 1:2000, o/n, 1:3000, 4oC RT 1hr Ku70 N3H10, MS329PO Fisher Sci. Mouse 0.3 µg/ml, 1:3000, o/n, 4oC RT 1hr Ku80 ab33242 Abcam Rabbit 1:2000, o/n, 1:5000, 4oC RT 1hr Ku80 Ab3107 Abcam Mouse 1:3000, o/n, 1:3000, 4oC RT 1hr PP1 E9, sc-7482 Santa Cruz Mouse 1:200, o/n, 1:1500,

4oC RT 1hr PP1α N-19, sc-6105 Santa Cruz Goat 1:3000 o/n, 1:3000, 4oC RT 1hr PP1β ab53315 Abcam Rabbit 1:50,000 o/n, 1:3000, 4oC RT 1hr PP1γ 07-1218 Millipore Rabbit 1:1000, o/n, 1:3000, 4oC RT 1hr PP2A-A 05-657 Millipore Mouse 1:200, o/n, 1:3000, 4oC RT 1hr PP2A-C 610556 BD Mouse 1:1000, o/n, 1:3000, Transduction 4oC RT 1hr laboratories ™ PP6c A300-844A Bethyl Labs Rabbit 1:2000, o/n, 1:3000, 4oC RT 1hr MYPT A300-889A Bethyl Labs Rabbit 1:2000, o/n, 1:3000, 4oC RT 1hr Nucleolin ab70493 Abcam Rabbit 1:1000, o/n, 1:3000, 4oC RT 45 min. Nucleophosmin ab10530 Abcam Mouse 1:1000, o/n, 1:3000, 4oC RT 45 min.

*o/n indicates overnight

Chapter Three: Protein Phosphatases in non-homologous end joining

3.1 Introduction

Post-translational modifications such as phosphorylation, ubiquitination, SUMO- ylation and methylation of proteins plays an important role in many cellular processes. Of all these events, protein phosphorylation has been the most well-studied and characterized in eukaryotic cells. It involves the covalent transfer of a phosphate group from ATP, which confers negative charge to the protein. Protein phosphorylation can have many functions such as inducing conformational changes in the modified protein, creating a scaffold for the recruitment of additional proteins, or marking proteins for subsequent ubiquitination-mediated proteasomal degradation. The human genome is believed to encode 518 putative protein kinases, chief among them are the serine/threonine kinases (PSKs); which account for 428 out of the 518 genes, while the remaining 90 encode for protein tyrosine kinases (PTKs) (Lander, Linton et al. 2001, Venter, Adams et al. 2001, Manning, Whyte et al. 2002, Johnson and Hunter 2005). Analysis of 6600 phosphorylation sites on 2244 human proteins revealed that phosphoserine (pS), phosphothreonine (pT), and phosphotyrosine (pY) account for 86.4%, 11.8%, and 1.8%, respectively, of the phosphorylated amino acids in asynchronously growing HeLa cells (Olsen, Blagoev et al. 2006). There are ~147 human genes encoding for protein phosphatases. The vast majority of them, 90, encode for protein tyrosine phosphatases (Alonso, Sasin et al. 2004). Paradoxically, the number of genes encoding catalytic subunits for serine/threonine phosphatases is much smaller (~40 genes) (Moorhead, Trinkle-Mulcahy et al. 2007). These catalytic subunits do not possess high specificity towards their diverse substrates in vitro. In cells this limitation is overcome by associating with diverse regulatory subunits that modulate protein phosphatases substrate specificity and intracellular localization (Shi 2009). The most abundant protein phosphatases in animals belong to the protein phosphatase 1 (PP1) and protein phosphatase 2A (PP2A) families.

Table 3-1 Classification of human protein phosphatase.

Serine/Threonine Class Regulatory protein subunits phosphatase family PPP family PP1 >90

PP2A A, B (>30)

PP4 R1, R2, R3α/β PP5 None PP6 PP6R1, PP6R2, PP6R3 (SAPS 1-3) PP2B CaM, Regulatory B PP7 Unknown

PPM family PP2C Unknown

Classification of protein phosphatase and the number of known regulatory subunits (Moorhead, Trinkle-Mulcahy et al. 2007, Pereira, Vasconcelos et al. 2011).

3.1.1 Protein phosphatase 1 (PP1)

Protein phosphatase 1 (PP1, ~38 kDa) is an abundant serine ⁄ threonine protein phosphatase expressed in mammalian cells. The human genome contains three different genes that encode catalytic subunits of PP1: PP1α, PP1 β /δ and alternative

splicing generates splice variants PP1γ1 and PP1γ2 (Moorhead, Trinkle-Mulcahy et al. 2007). Apart from PP1γ2 whose expression is restricted to the testis, expression of PP1α, PP1β/δ and PP1γ1 is ubiquitous. The catalytic activity of PP1 is tightly regulated by its interaction with > 200 known targeting proteins (Bollen, Peti et al. 2010, Peti, Nairn et al. 2013). These proteins are responsible for both localization and substrate specificity of PP1c. Most PP1 regulatory proteins interact with PP1 via a primary PP1 binding motif, the RVxF motif, which generally conforms to the consensus sequence [K ⁄

R]1-2[V ⁄ I][x][F ⁄ W], where x is any residue other than Pro (Wakula, Beullens et al. 2003). Recent studies have identified additional PP1 docking sites, such as the S/GILK (Zagorska, Deak et al. 2010) and MyPhoNE motifs (Hendrickx, Beullens et al. 2009). However, most studies agree that a substantial number of PP1 regulatory subunits remain to be discovered.

3.1.1.1 PP1 in the DNA damage response

PP1 has been shown to dephosphorylate several proteins in response to DNA damage in cells. ATM kinase is maintained in an inactive state in unperturbed cells by the Repo-Man (Recruits PP1 onto mitotic chromatin at anaphase) – PP1γ complex. However, in response to DSBs, the complex dissociates from ATM leading to ATM kinase activation (Peng, Lewellyn et al. 2010). BRCA1 (breast cancer 1, early onset) binds PP1-α through its RVxF motif and disruption of this interaction leads to defects in HR (Winter, Bosnoyan-Collins et al. 2007, Yu, Pace et al. 2008). DNA damage- mediated PP1γ dephosphorylation of histone H3 p-T11 blocks transcription and promotes DNA repair (Shimada, Haruta et al. 2010). KAP1 (Kruppel –associated box protein 1) is phosphorylated at S824 by ATM in response to DSB induction. Repair of DSBs localizing at heterochromatin regions require KAP1 phosphorylation (Goodarzi, Noon et al. 2008). This phosphorylation of S824 is attenuated by PP1α and PP1β (Li, Lin et al. 2010).

3.1.2 Protein phosphatase 2A (PP2A)

PP2A plays an important role in a variety of cellular processes such as cell cycle, metabolism and DNA repair (Seshacharyulu, Pandey et al. 2013, Zheng, Kalev et al. 2015). PP2A is a serine/threonine protein phosphatase that is ubiquitous and abundantly expressed in cells. It has been estimated that PP2A constitutes ~1% of the total cellular protein (Ruediger, Van Wart Hood et al. 1991). PP2A exists in cells either

as heterodimer (PP2AD), consisting of an ~ 65 kDa scaffolding A subunit, known as PR65 or PPP2R1 and an ~36 kDa catalytic C subunit known as PP2A-C or PPP2C

(Kremmer, Ohst et al. 1997). A third, B subunit binds to the PP2AD heterodimer to form a heterotrimer (Figure 3-1). B subunits have been shown to regulate substrate specificity as well as localization of PP2A complexes. B subunits can be classified into four different families: B/B55/PR55/PPP2R2, B’/B56/PR61/PPP2R5, B’’/PR72/PPP2R3 and B’’’/PR93/Striatin (Moorhead, Trinkle-Mulcahy et al. 2007, Westermarck and Hahn 2008). Two isoforms of PP2A-A subunit are expressed - Aα and Aβ, by two distinct genes. Both isoforms share 86% sequence identity (Hemmings, Adams-Pearson et al. 1990). PP2A-Aα has been reported to be the predominant isoform in mammalian cells (Zhou, Pham et al. 2003). Similarly the PP2A-C subunit exists in two isoforms - Cα and Cβ, and is expressed by two distinct genes (Khew-Goodall and Hemmings 1988). Both isoforms are 309 amino acids long and share 97% sequence identity (Cohen 1989). PP2A-Cα has been reported to be the predominant isoform in most cells. The PP2A-A subunit consists of 15 non-identical repeated domains called HEAT repeats (Groves, Hanlon et al. 1999). It has been shown using mutagenesis and structural studies that N- terminal HEAT repeats 2-8 mediate binding of different B subunits whereas the PP2A-C subunit binds to C-terminal HEAT repeats 11-15 (Xu, Xing et al. 2006, Cho and Xu 2007). The PP2A-C C-terminal tail is uniquely conserved (304TPDYEL309) and this region has been shown to be subject to post-translational modification such as phosphorylation of Y307 as well as methylation at leucine 309 (Chen, Martin et al. 1992, Lee and Stock 1993).

Figure 3-1 PP2A complex composition.

See text for further details.

3.1.2.1 PP2A in DNA damage

Several proteins phosphorylated in the DNA damage response are dephosphorylated by PP2A. Studies conducted in our lab showed that cells treated with okadaic acid (OA) or fostriecin at concentrations which inhibit PP2A activity, adversely affect the reversible phosphorylation of DNA-PKcs (Douglas, Moorhead et al. 2001). PP2A associates with ATM in unirradiated cells, preventing its activation, but as soon as DNA damage occurs, PP2A dissociates from ATM resulting in autophosphorylation of S1981 and ATM activation (Goodarzi, Jonnalagadda et al. 2004). Overexpression of the PP2A-C subunit was shown to promote NHEJ through its interaction with the Ku heterodimer. It was suggested that interaction of PP2A with Ku heterodimer regulates the dephosphorylation of DNA-PKcs as well as Ku itself, which regulated DNA-PK complex formation (Wang, Gao et al. 2009). Another study, using a combination of OA, and PP2A-specific siRNA, showed that PP2A targeted ATR, Chk1 and cdc2 Y15 phosphorylation. This was shown to regulate the G2/M checkpoint in response to IR- induced DNA damage (Yan, Cao et al. 2010). Thus, PP2A seems to play a major role in the regulation of all three major protein kinases involved in the DDR, namely ATM, ATR and DNA-PKcs. PP2A also dephosphorylates γH2AX, which is phosphorylated at a conserved serine, S139 in response to DNA DSBs (Chowdhury, Keogh et al. 2005).

RPA32 is dephosphorylated by PP2A in cells recovering from hydroxyurea (HU)- induced genotoxic stress. Suppression of PP2A catalytic activity leads to increased HU sensitivity, in part due to persistent RPA32 phosphorylation (Feng, Wakeman et al. 2009). Dephosphorylation of T55 on p53 leads to its stabilization after DNA damage and this is mediated by the PP2AC–B56γ complex (Li, Cai et al. 2007, Shouse, Cai et al. 2008). PP2A also regulates the transcriptional activity of p53 by reversing the IR- induced phosphorylation of p53 at S37 and S15 (Dohoney, Guillerm et al. 2004).

Table 3-2 List of PP2A regulatory B subunits.

Gene Alternate name name PPP2R2A Bα PR55α PPP2R2B Bβ PR55β

PPP2R2C Bγ PR55γ

PPP2R2D Bδ PR55δ

PPP2R5A B′α PR61α

PPP2R5B B′β PR61β

PPP2R5C B′γ1 PR61γ1

B′γ2 PR61γ2 B′γ3 PR61γ3 PPP2R5D B′δ PR61δ

PPP2R5E B′ɛ PR61ɛ

PPP2R3A B′′α PR130

B′′β PR72 PPPR3B PR70/48

PPP2R4 PTPA PR53

STRN Striatin PR110

STRN3 SG2NA PR93

Table 3-2 describes the list of known PP2A B subunits (Eichhorn, Creyghton et al. 2009).

3.1.3 Protein phosphatase regulation of DNA-PKcs function

A previous study conducted in our lab showed that DNA-PKcs undergoes autophosphorylation-dependent protein kinase activity loss (Chan and Lees-Miller 1996). Later in vitro experiments showed that addition of purified PP1 or PP2A catalytic subunits to autophosphorylated DNA-PKcs restored kinase activity. Also, treatment of lymphoblastoid cells with protein phosphatase inhibitors OA or fostriecin caused a 50- 60% loss of DNA-PKcs kinase activity (Douglas, Moorhead et al. 2001). These studies suggested an important role of reversible protein phosphorylation in regulating the protein kinase activity of DNA-PKcs. Subsequent studies have shown that DNA-PKcs interacts with protein phosphatases PP5 and PP6. PP5 was shown to be required for pT2609 site dephosphorylation (Wechsler, Chen et al. 2004) whereas DNA-PKcs

interacted with PP6c along with its regulatory subunits PP6R1, PP6R2 and PP6R3 (Douglas, Zhong et al. 2010). PP6 dephosphorylates DNA-PKcs at pS3205 in mitosis (Douglas, Ye et al. 2014). However, the functional significance of PP6 interaction with DNA-PKcs in response to DSBs is still not known. All these studies suggested an important role for PPPs in DNA-PKcs kinase activity.

3.1.4 Bromodomain-containing protein 4 (BRD4)

BRD4, along with BRD2, BRD3 and BRDT constitute the BET (bromodomain and extra terminal) family of proteins. BRD4, and other BET family members, recognize acetylated lysine residues via two bromodomains (Belkina and Denis 2012). Most cases of nuclear protein in testis (NUT) midline carcinoma involve translocation of the BRD4 with NUT genes (French, Ramirez et al. 2008). Using a high-throughput, high-content quantitative microscopy assay multiplexed for early and late DDR endpoints, Floyd and colleagues focused on proteins that interact with and modify chromatin. They knocked out the proteins using the RNA interference (RNAi) technique. Cells were co-stained with γH2AX antibodies to measure early signalling events in the DDR, Hoechst 33342 to monitor cell-cycle progression and phospho-histone H3 to measure mitotic entry. The most pronounced increase in γH2AX foci number, size and intensity after IR was observed at 1 and 6 h after knockdown of BRD4 (Floyd, Pacold et al. 2013). This suggested that BRD4 plays a role in regulation of the DDR by affecting chromatin structure. Also it was shown that depletion of Brd4 lead to impairment of CSR without affecting DNA break generation. This was due to defective accumulation of 53BP1 and uracil DNA glycosylase at the switch regions (Stanlie, Yousif et al. 2014). Recently, BRD4 has emerged as a major target of BET inhibitors, a class of anti-cancer drugs currently being evaluated in clinical trials (Muller, Filippakopoulos et al. 2011).

3.2 Rational and Hypothesis

I tested the hypothesis that PP1 and PP2A regulate the function of DNA-PKcs in response to DNA DSBs.

3.2.1 Specific Aims

1. To determine whether there is an interaction between DNA-PKcs and the PP1 catalytic subunit and if so, determine which specific isoform/s of PP1 interact with DNA- PKcs.

2. To characterize the interaction between DNA-PKcs and PP2A and, using an NHEJ reporter assay, determine the function of this interaction in the DSB repair pathway.

3. To validate and characterize the results of a mass spectrometry screen to identify DNA-PKcs-interacting proteins in the absence and presence of DNA damage.

3.3 Results

Our initial studies were based on an observation made in Dr. Moorhead’s lab, that suggested a possible DNA-PKcs-PP1 interaction, based on an RVxF/W motif peptide displacement study (Moorhead, Trinkle-Mulcahy et al. 2008). Briefly, microcystins are cyclic heptapeptides produced by cyanobacteria that inhibit several PPPs with nanomolar affinity. Microcystin inhibits PPPs by covalently coupling to a highly conserved cysteine residue in the enzymes. To isolate PP1 interacting regulatory subunits, the reactive group of the N-methyldehydroalanine residue of microcystin that couples to the cysteine side chain of the protein phosphatase was attached to the linker molecule aminoethanethiol. This microcystin-aminoethanethiol was then directly coupled to a reactive Sepharose bead. Nuclear proteins were incubated with the beads and PP1 regulatory subunits eluted using the RVxF/W motif derived from the PP1 targeting subunits NIPP1 (Beullens, Van Eynde et al. 1999) and ZAP (ZAP3) (Ulke- Lemee, Trinkle-Mulcahy et al. 2007). Mass spectrometry analysis was carried out to identify putative PP1 interacting proteins and results were validated by SDS-PAGE

followed by western blot. In this study DNA-PKcs bound to the column and was eluted by the RXVF peptide, suggesting that the DNA-PKcs might be interacting with PP1 either directly or indirectly.

Figure 3-2 A potential PP1 binding site, GILK motif, in DNA-PKcs.

A). A region of the amino acid sequence of human DNA-PKcs (PKRDC) corresponding to residues 2799 - 2830 in the N-terminal domain was aligned with the amino acid sequences of DNA-PKcs from chimpanzee, rhesus macaque, mouse, rat, dog and cow using Clustal W2. Abbreviations for species names are shown on the left hand side. Accession numbers are indicated in parenthesis below: Hs; Homo sapiens (NP_008835.5), Pt; Pan troglodytes (XP_001147162.1), Mma; Macaca mulatta (XP_001100610.2), Mm; Mus musculus (NP_035289.2), Rn; Rattus norvegicus (XP_003751148.1), Cl; Canis lupus familiaris (NP_001006652.1), Bt; Bos taurus (NP_001243488.1). The solid line indicates the potential PP1 binding site (GILK/R) in DNA-PKcs, which was conserved across species. Symbol ‘:’ denotes similar amino acid, ‘*’ denotes identical amino acids, ‘.’ denotes weakly similar. Numbers on the top refer to residues in human DNA-

PKcs/PRKDC (accession number NP_008835.5). B) Demonstrates the location of putative PP1 binding motif on DNA-PKcs.The N-terminal region of DNA-PKcs, extending from residues 1–3022 contains multiple HEAT repeats and other α-helical regions. A LRR spans residues 1503–1602 and has been proposed to be involved in DNA binding. The FAT domain encompasses residues 3023–3470 and is followed by PI3K-like kinase catalytic region (residues 3719–4015). The FATC domain spans residues 4097–4128.

As a first step I carried out bioinformatics analysis of the DNA-PKcs protein sequence for the presence of an RVxF/W consensus motif. I found several residues weakly resembling the RVxF/W motif in DNA-PKcs. Closer examination revealed the presence of a G/SILK motif in DNA-PKcs protein sequence (Figure 3-2 A). PP1 has been shown to interact with its regulatory subunits via several other sequences and one such motif is G/SILK (Hendrickx, Beullens et al. 2009). The G/SILK motif in DNA-PKcs was conserved over several vertebrate species. This, along with several weakly resembling RVxF/W motif suggested a possibility of interaction between DNA-PKcs- PP1. This sequence localizes in the N-terminal HEAT repeat region of DNA-PKcs (Figure 3-2 B). To confirm this interaction, co-immunoprecipitation experiments were carried out using DNA-PKcs monoclonal antibody, 42-27, which recognizes a C-terminal epitope on DNA-PKcs (see Materials and Methods), followed by western blot with a PP1c antibody. As shown in Figure 3-3, the 42-27 antibody immunoprecipitated DNA-PKcs efficiently, but no interaction was observed with PP1c. Previous studies from our lab have shown that DNA-PKcs interacts with PP6 (Douglas, Zhong et al. 2010). To validate the co- immunoprecipitation technique, blots were probed for PP6 as a positive control. The DNA-PKcs-PP6 interaction was observed suggesting that the technique and co- immunoprecipitation conditions were optimum, at least for PP6 interaction. Lack of interaction observed with DNA-PKcs antibody alone cannot be the basis to rule out an interaction with PP1. Next, it was decided to use PP1 isoform specific antibodies to perform co-immunoprecipitation experiments and probe for DNA-PKcs. PP1c exists in three isoforms in cells: PP1-α, β and γ. We obtained PP1 isoform specific

antibodies (α and γ) from Dr. Moorhead’s lab and a PP1β isoform antibody from Abcam (see antibody Table 2-5). Antibody specificity was tested and validated (Figure 3-4).

Figure 3-3 Lack of evidence for an interaction between DNA-PKcs and PP1c.

Whole cell extracts were prepared from HEK293 cells using NET-N lysis buffer as described in Material and Methods. All extracts were treated with 10 U/mg benzonase to prevent DNA-mediated interactions, prior to immunoprecipitation. Where indicated, cells were either unirradiated (lanes 2 and 5), or irradiated (10 Gy) and harvested after 1 or 4 hours as indicated (lanes 3-4 and 6-7). Three mg whole cell extract was used for each immunoprecipitation. Extracts were incubated overnight at 4oC with either a monoclonal antibody (ab: 42-27) to DNA-PKcs or an equivalent amount of mouse IgG as a negative control. Lane 1 contained 50 µg of whole cell extract (input). Samples were run on a low bis-acrylamide/8% acrylamide SDS PAGE gel, transferred to nitrocellulose and developed by ECL as described in Materials and Methods. W.B (right hand side) indicates the antibodies used for western blotting of immunoprecipitates. For western blotting of DNA-PKcs, the rabbit polyclonal antibody DPK1 was used. Immunoblots were also

probed with an antibody to PP6c as a positive control (see text for details). Positions of molecular weight markers (in kDa) are indicated on the left hand side of the figure.

Figure 3-4 Western blotting to validate the specificity of the PP1 isoform-specific antibodies.

HEK 293 cells were either unirradiated (lanes 1, 2, and 4) or irradiated at 10 Gy and harvested after 1 hour (lanes 3, 5 and 6). Extracts were prepared by either NET-N lysis (lane 1) or hypotonic lysis with production of S10 (lanes 2 and 3) and P10 (lanes 4 and 5) fractions as well as the insoluble chromatin fraction (lane 6), as described in Materials and Methods. Lanes 7-9 contained 150 ng purified recombinant PP1 isoforms α, β, γ (a kind gift from Dr. Greg Moorhead) as positive controls. Samples were run on SDS PAGE and immunoblotted with antibodies to PP1α, PP1β or PP1γ as indicated. Positions of molecular weight markers (in kDa) are indicated on the left hand side of the figure.

PP1α was immunoprecipitated with the isoform specific antibody and, as seen in Figure 3-5, immunoprecipitation was successful. However western blotting showed no specific interaction with DNA-PKcs or the Ku heterodimer.

Figure 3-5 Lack of evidence for interaction of DNA-PKcs and Ku with the α isoform of PP1 (PP1 α).

Whole cell extracts were prepared from either unirradiated or irradiated HEK293 cells as described in Figure 3-3 and immunoprecipitated with either a monoclonal antibody to PP1α (obtained from Dr. Moorhead’s lab, lanes 5-7), or an equivalent amount of rabbit IgG (lanes 2-4) as a negative control. Lane 1 contained 50 µg of whole cell extract. Samples were run on a low bisacrylamide / 8% acrylamide SDS PAGE gel and probed with antibodies to DNA-PKcs, Ku and PP1α as indicated by W.B (right hand side of figure). Positions of molecular weight markers (in kDa) are indicated on the left hand side of the figure.

Figure 3-6 Lack of evidence for interaction of DNA-PKcs and Ku with the β isoform of PP1 (PP1β).

Immunoprecipitation reactions were carried out as in Figures 3-3 and 3-5 except extracts were immunoprecipitated with either a monoclonal antibody to PP1β (Abcam), or an equivalent amount of rabbit IgG as a negative control. W.B (right hand side) indicates the antibodies used for western blotting of 79

immunoprecipitates. Immunoblots were probed with an antibody to MYPT as a positive control (see text for details). Positions of molecular weight markers (in kDa) are indicated on the left hand side of the figure. Lane 2 in panel A contained 50 ng purified DNA-PKcs as a positive control.

Figure 3-7 Lack of evidence for an interaction between DNA-PKcs and Ku and the γ isoform of PP1 (PP1γ).

Immunoprecipitations were carried out as described in Figures 2 and 4 except that extracts were immunoprecipitated with either a monoclonal antibody to PP1γ (obtained from Dr. Moorhead’s lab, lanes 5-7), or an equivalent amount of rabbit IgG as a negative control (lanes 2-4). Lane 1 contained 50 µg input.

Co-immunoprecipitation with the PP1β isoform specific antibody showed no interaction between DNA-PKcs-PP1β either (Figure 3-6 A). As seen in Figure 3-6 B, immunoprecipitation was efficient. As a positive control for co-immunoprecipitation conditions, MYPT was probed using western blotting. The MYPT-PP1β interaction has

been extensively studied (Tanaka, Ito et al. 1998, Scotto-Lavino, Garcia-Diaz et al. 2010). No interaction between PP1β -Ku heterodimer was observed (Figure 3-6 B). Finally, PP1γ interaction with DNA-PKcs was determined using a PP1γ isoform specific antibody. As can be seen in Figure 3-7, the PP1γ antibody immunoprecipitated PP1γ efficiently but no interaction was observed with the Ku heterodimer. There was a band detected in western blot using the DNA-PKcs antibody but the results were inconsistent and co-immunoprecipitations were not reproducible. Based on these co- immunoprecipitation experiments, no conclusive evidence was found that DNA-PKcs interacts with any of the isoforms of PP1c. Moving forward, and in line with the objective of my PhD project, which was to identify and characterize DNA-PK interacting proteins, I decided to investigate the interaction between DNA-PKcs-PP2A. Our lab previously reported the interaction between DNA-PKcs-PP6, and in the same research article an interaction between DNA- PKcs-PP2A was observed in co-immunoprecipitation with a polyclonal antibody against DNA-PKcs, DPK1 (Douglas, Zhong et al. 2010). However, the focus of that study was to characterize the DNA-PKcs-PP6 interaction. As a first step I tried to reproduce the results using the DPK1 polyclonal antibody co-immunoprecipitation followed by western blotting. Figure 3-8 A shows that the DPK1 antibody immunoprecipitated DNA-PKcs efficiently and it also pulled down PP2A-A and PP2A-C strongly (Figure 3-8 B). This confirmed the previous findings that DNA-PKcs interacted with PP2A. Since DPK1 is a polyclonal antibody, I tried to reproduce these results with a monoclonal antibody to DNA-PKcs, 42-27. As seen in Figure 3-9, the 42-27 antibody immunoprecipitated DNA-PKcs but no interaction was observed with the PP2A complex. This lack of consistency between DNA-PKcs-PP2A interactions using polyclonal and monoclonal antibody was confounding. It should be noted that DPK1 and 42-27 antibodies recognize different epitopes on DNA-PKcs (see Materials and Methods, Figure 2-2). An explanation could be that DPK1, being a polyclonal antibody, could be interacting non-specifically with the PP2A complex. An alternative explanation could be that the 42-27 recognition epitope could be masking the DNA-PKcs-PP2A interaction site. Our lab had another

monoclonal antibody against DNA-PKcs, 18-2 which recognizes a different epitope. I planned to use that antibody to verify the results but unfortunately the cell stocks for the hybridoma were accidentally destroyed even before I started my PhD project.

Figure 3-8 PP2A-Aα and PP2A-Cα subunits interact with DNA-PKcs, as determined by immunoprecipitation with the DPK1 antibody.

Immunoprecipitations were carried out as described in the previous figures except that extracts were immunoprecipitated with either a polyclonal antibody to DNA-PKcs (DPK1), or an equivalent amount of non-immune rabbit serum (NIRS) as a negative control. All extracts were treated with 10

U/mg benzonase to prevent DNA-mediated interactions prior to immunoprecipitation. Where indicated, cells were either unirradiated (lanes 2 and 3 in panel A & lanes 3 and 4 in panel B), or irradiated (10 Gy) and harvested after 1, 2, 4 or 8 hours as indicated. Two mg whole cell extract was used for each immunoprecipitation. Western blotting (W.B) for DNA-PKcs was performed using mouse monoclonal antibody, 42-27. Lane 2 in the gel in panel B was purposely left blank.

I decided to co-immunoprecipitate PP2A-A and -C subunits and probe for an interaction with DNA-PKcs using western blotting. Despite several attempts I couldn’t find any commercially available PP2A antibody which immunoprecipitated PP2A-A or -C subunits efficiently. I decided to express flag-tagged PP2A-A subunit in HEK 293 cells and use a commercially available flag antibody (Sigma) to co-immunoprecipitate the PP2A-A subunit and probe for DNA-PKcs. In Figure 3-10, transiently transfected PP2A- A subunit was immunoprecipitated using the flag M2 antibody (Sigma) in the absence or presence of DNA damage. Transfection was successful, as the flag antibody immunoprecipitated PP2A-A and -C subunits. However only a faint DNA-PKcs cross- reacting band was observed, and no interaction with Ku heterodimer was observed.

Finally, the potential PP2A interaction with Ku heterodimer was determined by immunoprecipitating Ku. As can be observed in Figure 3-11, Ku heterodimer did not interact with PP2A in either the absence or presence of DNA damage. This is in contrast to the results reported previously which showed interaction between Ku and

PP2A-C (Wang, Gao et al. 2009). However, an important point to note is that in that study the authors overexpressed PP2A-C in cells. Interaction between endogenous proteins was not verified, which is odd considering both Ku and PP2A are highly abundant proteins in human cells.

Figure 3-9 Interaction of endogenous PP2A-Aα and PP2A-Cα with DNA-PKcs was not observed when DNA-PKcs was immunoprecipitated with the 42-27 monoclonal antibody.

Immunoprecipitations were carried out as described in the previous figures except extracts were immunoprecipitated with either a monoclonal antibody to DNA-PKcs (Ab 42-27) or an equivalent amount of mouse IgG as a negative control. Lane 1 contained input (50 µg whole cell extract).

Figure 3-10 Interaction of Flag-tagged PP2A-Aα and PP2A-Cα with DNA-PKcs was not observed when PP2A was immunoprecipitated with the Flag antibody.

Flag tagged PP2A-Aα or vector control plasmids were transfected into HEK293 cells using Lipofectamine®2000. Twenty four hours later cells were harvested and whole cell extracts were prepared using NET-N lysis buffer as described in Material and Methods. All extracts were treated with 10 U/mg benzonase to prevent DNA-mediated interactions prior to immunoprecipitation. Where indicated, cells were either unirradiated (lanes 3 - 6), or irradiated (10 Gy) and harvested after 1 or 4 hours as indicated. Two mg whole cell extract was used for each immunoprecipitation. Extracts were incubated for 4 hrs at 4oC with either monoclonal antibody Flag M2 or an equivalent amount of mouse IgG as a negative control. Lanes 1 and 2 contained input (50 µg whole cell extract).

Figure 3-11 Interaction of PP2A-Aα and PP2A-Cα with Ku heterodimer was not observed as determined by co-immunoprecipitation with the Ku 70.30 antibody.

Immunoprecipitations were carried out as described in previous figures except extracts were incubated with either a polyclonal antibody to the N- terminal of recombinant Ku70, Ku 70.30 (generated in house), or an equivalent amount of NIRS as a negative control.

The observations made above raise interesting questions as to why the PP2A interaction was only observed with the DPK1 polyclonal antibody but not with the 42-27 monoclonal antibody. As suggested before, one obvious difference is that both these antibodies recognize different epitopes on DNA-PKcs. Another alternative explanation is that the DPK1 antibody is interacting non-specifically with PP2A. To test this possibility co-immunoprecipitation with the DPK1 antibody was carried out using M059J and M059K cells which are DNA-PKcs deficient and proficient, respectively (Lees-Miller, Godbout et al. 1995). As can be observed in Figure 3-12, DPK1 immunoprecipitated DNA-PKcs in M059K cells but not in M059J cells. However, PP2A was pulled down in

both M059J and M059K cells suggesting the interaction was with the antibody and not with the DNA-PKcs protein. This was validated by probing for PP6c as positive control, PP6c immunoprecipitated with DNA-PKcs only in M059K cells and was absent in M059J cells. These finding raises the question whether the DPK1 antibody recognizes PP2A directly or indirectly. To address this, cell extracts from HEK 293 cells prepared on different days were taken and run on 10% acrylamide SDS-PAGE gels, transferred to nitrocellulose membrane and western blotted with DPK1 antibody (Figure 3-13 A). Few non-specific bands were observed but chief among them was a band in the ~ 65 kDa region which is where the PP2A-A subunit migrates on the gel.

Figure 3-12 PP2A- A α and PP2A-C α subunits interact nonspecifically with DNA- PKcs polyclonal antibody, DPK1.

Co-immunoprecipitation was performed with cell lysates prepared from M059K cells, which have normal levels of DNA-PKcs, or MO59J cells that lack DNA-PKcs protein expression, as indicated. Whole cell extracts were

prepared as described in the previous figures. Lanes 1 and 2 contained 50 µg extract (input) from M059K and M059J cells, respectively. Lane 3 was left blank. Two mg whole cell extract was used for immunoprecipitations using the DNA-PKcs polyclonal antibody DPK1 or non-immune rabbit serum (NRS) as indicated. Immunoprecipitations were carried out for 4 hrs. at 4oC. Samples were run on 8% acrylamide/ low bis acrylamide SDS PAGE gels and probed with monoclonal antibody 42-27 for DNA-PKcs or PP2A-A and C as indicated. Immunoblots were also probed with an antibody to PP6c as a positive control.

It has been observed before that knockdown of the PP2A-C subunit leads to down regulation of PP2A-A subunit and vice-versa (Silverstein, Barrow et al. 2002). To test whether the 65 kDa band was indeed the PP2A-A subunit, extracts with PP2A-C knockdown were run on a 10% acrylamide SDS-PAGE gel, transferred to nitrocellulose membrane and western blotted with DPK1 antibody. As can be in Figure 3-13 B, the 65 kDa cross-reacting band was observed only in control siRNA treated cells but disappears in cells treated with siRNA to PP2A-C. This suggested that DPK1 antibody cross reacted with PP2A-A subunit. Why does the DPK1 antibody recognize the PP2A- A subunit? An explanation could be that both DNA-PKcs and the PP2A-A subunit consists of HEAT repeats (Groves, Hanlon et al. 1999, Brewerton, Dore et al. 2004, Sibanda, Chirgadze et al. 2010), and the DPK1 antibody recognizes an epitope on the DNA-PKcs HEAT repeat region. Sequence alignment of the PP2A-A subunit and the DPK1 antibody epitope (DNA-PKcs residues 2018-2136) showed minor sequence conservation (Figure 3-14). It is not known whether this is enough to mediate cross reactivity with DPK1 antibody. This would require mutating these residues on PP2A-A subunit, expressing them in cells and western blotting with DPK1 antibody. Another way to validate this would be to run a purified GST-PP2A-A subunit on SDS-PAGE gel and performing western blotting with DPK1 antibody to detect cross-reacting bands. This area of investigation was not pursued further, but does suggest a plausible explanation for my finding that the DPK1 antibody cross-reacts with PP2A-A subunit.

Figure 3-13 The DNA-PKcs antibody, DPK1, detects a band at 65 kDa that corresponds to the PP2A-c subunit.

A). NETN lysates (50 µg each) from HEK293 cells, freshly prepared extracts (lanes 1 and 2) and old extracts (lanes 3 and 4) were loaded onto a 10% acrylamide SDS-PAGE gel and western blotting was performed with the DPK1 antibody. B). HEK293 cells were transfected with either control nonspecific siRNA or siRNA to PP2A-C subunit for 72 hrs. Whole cell extracts were prepared using NET-N lysis buffer, 50 µg of extract was loaded on to a 10% acrylamide SDS- PAGE gel and western blotting performed with the DPK1 antibody. Positions of molecular weight markers are shown on the left.

Figure 3-14 ClustalW2 alignment of the DPK1 antibody epitope (2018 – 2136) and the PP2A-Aα subunit showed minor sequence conservation.

The amino acid sequence of DNA-PKcs to which the DPK1 polyclonal antibody was raised (amino acids 2018 - 2136 of DNA-PKcs, accession number P78527.3) was aligned with the amino acid sequence of PP2A-Aα (NP_055040.2) using ClustalW2 software. Color coding was done using BioEdit software (version 7.1.11) where symbol ‘:’ denotes similar amino acid, ‘*’ denotes identical amino acids, ‘.’ denotes weakly similar.

The initial focus of my PhD project was to identify and characterize DNA-PK interacting proteins. Ms. Ruiqiong Ye in our lab was performing co-immunoprecipitation experiments with the 18-2 monoclonal antibody and optimizing conditions to detect DNA-PKcs-interacting proteins. Figure 3-15 shows the optimized conditions for co- immunoprecipitation. Samples, pre- and post-IR, along with negative control mouse IgG were sent for mass spectrometry analysis which was performed in the laboratory of Dr. Nick Morrice, Beatson Institute, Scotland. Significant hits obtained for DNA-PKcs interacting proteins are summarized in Table 3-3. Of note is that we did not observe any significant hits for any DNA repair proteins, which was surprising. Nonetheless positive controls i.e, (PP6 and its regulatory subunits) were observed in the mass spectrometry screen. This suggested that the conditions to identify DNA-PKcs interacting proteins were optimum. Based on the number of significant peptides observed for each protein, I decided to focus on BRD4, nucleolin and nucleophosmin for further investigation. As a first step, these interactions were validated by immunoprecipitation using the DNA-PKcs monoclonal antibody 42-27. Figure 3-16 shows that BRD4 and nucleophosmin did not interact with DNA-PKcs under these conditions whereas nucleolin was pulled down only in the presence of DNA. Co-immunoprecipitation conditions were optimum since PP6 interaction with DNA-PKcs was observed. In Figure 3-17A no interaction between DNA-PKcs and BRD4 was observed using DNA-PKcs polyclonal antibody DPK1, whereas the interaction between DNA- PKcs-BRD4 was observed using the 18-2 antibody (Figure 3-17B). Hence, the interaction observed with the 18-2 antibody was not reproducible with DNA-PKcs antibodies, DPK1 or 42-27. This raised the possibility of a non-specific interaction between the 18-2 antibody and BRD4. To test this hypothesis, co-immunoprecipitation experiment was performed with M059J and M059K cells.

Figure 3-15 Immunoprecipitation of DNA-PKcs with monoclonal antibody, 18-2, followed by silver staining and identification of interacting bands by mass spectrometry.

DNA-PKcs was immunoprecipitated from unirradiated (lane 5) or irradiated (10 Gy, 1 hour recovery) HeLa cells (lane 6) as described in Materials and Methods using DNA-PKcs monoclonal antibody 18-2. Samples were run on a 10% acrylamide SDS PAGE gel and silver staining was performed as described in Materials and Methods. Lane 1 contained broad range markers (Biorad), lane 2 contained 5 µg HeLa whole cell extract, lane 3 was intentionally left blank. The sample in lane 4 is a control reaction where the same amount of cell extract (15 mg) was immunoprecipitated with an amount of mouse IgG identical to the amount of immunoglobulin in the 18-2 sample as a negative control. This experiment was performed by Mrs. Ruiqiong Ye in the Lees-Miller lab.

Table 3-3 Mass spectrometry data to identify DNA-PKcs interacting proteins.

No. of peptides identified

S.No. Name of Protein M.W - I.R + I.R IgG (kDa)

1. DNA-PKcs 470 304 297 0

2. PP6c 35 7 7 0

3. PP6 ankyrin repeat 113 5 3 0 subunit

4. PP6R1 97 5 5 0

5. PP6R3 98 12 10 0

6. BRD4 152 30 32 0

7. Nucleolin 77 8 2 0

8. Nucleophosmin 33 3 2 0

9. Cyclin Y 39 5 8 0

10. SMG8 110 10 10 0

11. SMG9 58 5 5 0

Mass spectrometry was performed by Dr. Nick Morrice, Beatson Institute, Glasgow, Scotland. Mass spectrometry data was analyzed and proteins of interest were grouped according to the number of unique peptides for each protein. The table shows results from DNA-PKcs immunoprecipiated from unirradiated and irradiated cells as well as the IgG control. Peptides detected in the IgG sample were subtracted from results for DNA-PKcs immunoprecipitates.

Figure 3-16 BRD4, a major DNA-PKcs interacting protein identified by MS analysis, showed no interaction with DNA-PKcs immunoprecipitated using the 42- 27 monoclonal antibody.

Whole cell extracts were prepared from either unirradiated or irradiated (10 Gy IR, 1 hour recovery) HeLa cells by NETN lysis and either used directly (-) or treated with benzonase as described previously (indicated by +). DNA- PKcs was immunoprecipiated using the 42-27 monoclonal antibody (lanes 5- 8). Samples in lanes 3 and 4 show immunoprecipitates with an equivalent amount of mouse IgG as a negative control. Samples were run on low bisacrylamide/ 8% acrylamide SDS PAGE gels and immunoblots carried out as described in Materials and Methods. Lane 1 contained 50 µg extract (input) from HeLa cells. Lane 2 was left blank. Lanes 1,3-6 contained unirradiated samples wherease lanes 7 and 8 contained irradiated samples. Immunoprecipitations were performed in absence (lanes 3, 5, 7) or presence (lanes 4, 6, 8) of benzonase to avoid DNA-mediated protein interactions.

Figure 3-17 BRD4 immunoprecipitates with DNA-PKcs with the 18-2 antibody but not with the DPK1 antibody.

Whole cell extracts were prepared from unirradiated or irradiated HeLa cells as described in Materials and Methods. In panel A, 2 mg of extract was immunoprecipitated with either NIRS (lanes 3 and 4) or DNA-PKcs polyclonal antibody DPK1 (lanes 5-8). In panel B, immunorecipitations were carried out using DNA-PKcs monoclonal antibody 18-2 as indicated. Immunoblots were probed with antibodies to

DNA-PKcs and BRD4 as indicated. Positions of molecular weight markers are indicated on left hand side.

Figure 3-18 shows that the BRD4 cross-reacting band was observed in both M059J and M059K cells. This suggested that BRD4 was interacting with the 18-2 antibody non-specifically rather than with DNA-PKcs.

Figure 3-18 BRD4 interacts nonspecifically with DNA-PKcs monoclonal antibody, 18-2.

DNA-PKcs was immunoprecipitated from M059K cells (indicated by K*) that contain normal levels of DNA-PKcs, or M059J cells (indicated by J*) that lack DNA-PKcs (lanes 6 and 7). In lanes 4 and 5 extracts from M059K and J cells were immunoprecipiated with control IgG. Immunoblots were probed with antibodies to DNA-PKcs and BRD4 as indicated. Lanes 1 and 2 contained 50 µg extract (input) from M059K and M059J cells, respectively. Lane 3 was left blank.

3.4 Discussion

3.4.1 Co-immunoprecipitation to detect protein-protein interaction

In this part of my studies I tried to determine the role of protein phosphatases in the regulating the activity of DNA-PKcs in NHEJ. My initial studies were focused on trying to determine the interaction between PP1 and DNA-PKcs by performing co- immunoprecipitation with DNA-PKcs and PP1 isoform specific antibodies. However, I could not find any conclusive evidence for this interaction. Subsequently, I tried to determine the interaction between PP2A and DNA-PKcs by performing co- immunoprecipitation experiments. Initial results were encouraging as I observed the interaction between DNA-PKcs and PP2A using polyclonal antibody, DPK1 which recognizes an epitope in DNA-PKcs. However, further studies showed that this interaction was non-specific as PP2A was interacting with the DPK1 antibody itself, rather than with the DNA-PKcs protein. I then moved on to validate the mass spectrometry results conducted in our lab to identify DNA-PKcs interacting proteins. I focused on validating the interaction between DNA-PKcs and BRD4, nucleolin, nucleophosmin. DNA-PKcs and BRD4 interaction, similar to PP2A interaction, was found to be non-specific whereas evidence for interaction of DNA-PKcs with nucleolin and nucleophosmin was inconclusive. Protein-protein interaction forms the basis of various cellular processes. Many interactions are sometimes process specific such as Ku interaction with DNA-PKcs only in presence of DSB DNA ends or mediated by post-translational modification such as phosphorylation, SUMOylation, ubiquitination etc. These interactions can be detected by using different techniques but the most commonly used method is co- immunoprecipitation. When cells are lysed under non-denaturing conditions many protein-protein interactions are preserved. Using an antibody to target a protein of interest, its interacting partners in vivo can then be identified either by mass spectrometry or in the case of a specific protein, by western blotting. In principle the technique is straightforward, but as with any scientific experiment, results can be only

be interpreted in a meaningful way if proper controls are included (Golemis and Adams 2005). First and foremost the requirement for a successful co-immunoprecipitation is a highly specific antibody to the target protein, which in this case is DNA-PKcs. Our lab has been using polyclonal antibody DPK1, and monoclonal antibodies 42-27 and 18-2 for many years. In my studies I used DPK1 and 42-27 antibodies since the cells used to generate the 18-2 antibody were no longer available. Samples needed to be run on low bis 8% acrylamide SDS-PAGE gels in order to probe for DNA-PKcs by western blotting technique. These antibodies are highly specific against DNA-PKcs under these conditions, and only the band corresponding to DNA-PKcs is observed when samples are run on low bis 8% acrylamide SDS-PAGE gel (see antibody conditions in Table 2- 5). However, results seen in Figure 3-13A show that when this antibody is used to probe 10% acrylamide SDS-PAGE gel, the antibody detects several lower molecular weight bands. A major difference, apart from gel conditions, is the protein transfer method on to the membranes in western blotting. High molecular weight proteins such as DNA-PKcs require SDS in the transfer buffer whereas proteins with < 100 kDa molecular weight does not require SDS in transfer buffer. Buffer conditions which promotes DNA-PKcs transfer, are not suitable for low molecular weight protein transfer. This shows that antibodies need to be characterized under different conditions to examine their specificity. Another major consideration is western blot and immunoprecipitations are different techniques. In immunoprecipitations, the antibody recognizes proteins in their 3 dimensional structure whereas in western blot this is not case since SDS disrupts the protein’s structure. In my experiments both DPK1 and 42-27 efficiently immunoprecipitated DNA-PKcs. The second important point is that the target protein and its interacting partner should be expressed in sufficient amounts in cells. Its very hard to co-immunoprecipitate proteins that are expressed in a cell cycle specific manner or low abundance protein under endogenous conditions. Both PP2A and DNA-PKcs are highly abundant proteins in cells.

Third, its very important to optimize immunoprecipitation conditions such that not just the target protein but its interacting partner’s native configuration is preserved as well. In my experiments, I used NP40, a non-ionic detergent, to lyse the cells in 150 mM NaCl which is equivalent to the physiological salt concentration. These were not harsh conditions as can be observed by positive controls such as MYPT interaction with PP1β or DNA-PKcs interaction with PP6. Fourth, the co-immunoprecipitation technique works well if the protein-protein interaction is stable and strong such as in case of MYPT-PP1β (Tanaka, Ito et al. 1998), and XRCC4-LigaseIV (Critchlow, Bowater et al. 1997). It is not a very good technique to detect interactions that are weak and/or transient. Although I did not see any conclusive evidence that PP1 interacts with DNA-PKcs, it cannot be ruled out that PP1 plays a role in NHEJ or in regulating DNA-PKcs kinase activity. Indeed, bioinformatics analysis showed the presence of a putative GILK motif in DNA-PKcs, suggesting that DNA-PKcs might interact with PP1. These experiments do not rule out the possibility that PP1 could be regulating DNA-PKcs autophosphorylation by dephosphorylating it in response to DNA damage. Protein phosphatases have a very low affinity towards the substrate being dephosphorylated. Co-immunoprecipitation might not be a good technique in such cases. Another scenario is PP1 might be dephosphorylating DNA-PKcs only at the DSB site through one of its nuclear regulatory subunits such as PNUTS (Allen, Kwon et al. 1998). These regulatory subunits might bring DNA-PKcs and PP1 into close proximity only in the context of a DSB. In this scenario as well, co-immunoprecipitation might not be a suitable technique. Similar arguments could be made for nucleolin and nucleophosmin interaction with DNA-PKcs. Even though both these proteins are highly abundant in cells, I found no conclusive evidence regarding their interaction with DNA- PKcs. Fifth, a major control for co-immunprecipitation experiments is to use cells that lack the target protein, such as M059J, which are DNA-PKcs deficient cells and probe for interacting protein. This allows us to determine whether the interaction is truly with the target protein or with the antibody itself which means it’s a false positive. Using M059J cells, I found that PP2A was interacting non-specifically with the DPK1 antibody

rather than with DNA-PKcs protein. As a positive control, I probed for PP6 and this interaction was only observed in M059K, DNA-PKcs proficient cells, but not in M059J cells. This demonstrated that the PP2A interaction with DNA-PKcs was a false positive result. Using a similar experiment I also demonstrated that BRD4 interacted with 18-2 antibody but not with DNA-PKcs. Finally, another way of getting around the problem of antibody specificity would be express tagged protein in cells such as flag, myc, haemaglutinin (HA) etc. For example the tagged protein could be expressed in cells transiently or stably, and can be co-immunoprecipitated using the commercially available antibodies. I tried this using flag tagged PP2A-A subunit and pulled down PP2A-A using flag antibody (Sigma) and observed a faint DNA-PKcs cross reacting band. But a major caveat of using this approach is how physiologically relevant the observed interaciton could be. In cells, protein expression is controlled in space and time. Not all proteins are expressed at all times, for example proteins involved in cell cycle regulation such as polo like kinases (PLK) only peak during the G2/M transition (Golsteyn, Schultz et al. 1994). This regulation is lost when proteins are expressed constitutively under exogenous promoter. This would raise the possibility that the observed interaction could be a false positive. Since I carried out my experiments, our collaborator Dr Kathy Meek has managed to stably express GFP-tagged human DNA-PKcs in DNA-PKcs null V3 cells. Although the level of expression of human GFP-DNA-PKcs is lower than that of endogenous DNA-PKcs in HeLa or other mammalian cells, this raises the possibility of being able to immunoprecipitate GFP-tagged DNA-PKcs to identify interacting proteins, especially since the Chinese hamster ovary exome has been sequenced (Lewis, Liu et al. 2013). In the experiments carried out by Mrs Ye in our lab (described above), IgG coupled to beads was used as a negative control for immunoprecipitations. However, this did not control for proteins other than DNA-PKcs that interacted with the monoclonal antibodies used, thus confounding my results. Our lab has recently deleted DNA-PKcs from HeLa and HEK293 cells using clustered regularly interspaced short palindromic repeats (CRISPR) technologies. In the future, it might be possible to immunoprecipitate

100

DNA-PKcs using 42-27 and other antibodies used in my study but using DNA-PKcs null CRIPSR cells as a control. Attempts to express epitope tagged DNA-PKcs in human cells are also ongoing in the lab but the large size of DNA-PKcs (469kDa) continues to present problems for molecular cloning.

3.4.2 Protein phosphatases in DNA damage

The importance of protein phosphatases in regulating cellular processes is unambiguous. The experiments conducted above raise important questions as to how to investigate the role of protein phosphatases in the DNA damage response. All PPPs contain a similar catalytic domain, and in vitro are capable of dephosphorylating substrates with little to no specificity. But that is not the case in cells, where protein phosphatases show remarkable specificity. How then to study their role in the DNA DSB response? One of the most commonly used mechanisms is to observe pS139 γH2AX phosphorylation kinetics (Rogakou, Pilch et al. 1998). γH2AX phosphorylation has been shown to correlate well with DSB formation and its disappearance coincides with DSB resolution (Rogakou, Boon et al. 1999). The role of many proteins in the DSB response has been characterized through this mechanism, such as MDC1, 53BP1 etc [reviewed in (van Attikum and Gasser 2009)]. It should be possible to knockdown PP1 catalytic subunit and observe the effects on γH2AX phosphorylation status in a cell cycle specific manner. For example it has been shown that in G1/G0 phase cells, NHEJ is the predominant pathway to repair DSBs (Rothkamm, Kruger et al. 2003). Cells could be arrested in G0 phase by serum starvation followed by DSB induction by treating them with IR. Cells incubated for various time point post-IR could then be fixed, permeabilized and stained with γH2AX antibody. Using secondary antibody conjugated to a fluorophore, cells could then be analyzed for γH2AX foci resolution using immunofluorescence microscopy. A major caveat to this technique is that γH2AX phosphorylation is only an indirect measurement of DSB formation. It has previously been shown to be dephosphorylated by several phophatases such as PP2A, PP4, PP6 (Chowdhury, Keogh et al. 2005, Nakada, Chen et al. 2008, Douglas, Zhong et al. 2010). Also, knocking down the catalytic subunit of phosphatases could have several 101

unintended consequences. For example, it has been shown that inhibition of protein phosphatases by treating cells with calyculin A, or OA induces premature chromosome condensation (Gotoh, Asakawa et al. 1995). This problem could be solved by targeting phosphatase regulatory subunit such as PNUTS individually and then characterize their role in NHEJ. We carried out mass spectrometry screen to identify DNA-PKcs- interacting proteins but we did not observe any significant PP1 or PP2A regulatory subunit associating with DNA-PKcs using co-immunoprecipitation. As mentioned before this does not rule out the possibility of DNA-PKcs being dephosphorylated by PP1 or PP2A in NHEJ. The role of PP1 and PP2A in NHEJ could also be studied by using NHEJ reporter assays (Figure 3-19) (Bennardo, Cheng et al. 2008). In this assay, the GFP coding region is under control of a CMV promoter. The coding region and promoter are separated by an ISceI endonuclease cut site such that only when these two regions are ligated back together GFP protein is expressed. The DSB can be induced by transfecting the cells with ISceI plasmid. Expression of GFP protein can be quantitated by FACS analysis. It is possible to knockdown the gene of interest such as PP1 and PP2A catalytic subunits or its regulatory subunit by siRNA and perform this assay to understand their role in NHEJ. A caveat of this technique is that ISceI induced DSB is simple in nature, i.e there are no unligatable groups such as DNA hairpins, 3’ phosphate, or 5’ hydroxyl group are produced. This means that the end processing enzymes such as Artemis, PNKP, aprataxin etc. would not be required to clean up the ends before ligation. In case of Artemis, it is known that DNA-PKcs is required for its activity (Ma, Pannicke et al. 2002, Goodarzi, Yu et al. 2006). Therefore, it would be hard to decipher the role of protein phosphatases in regulating the end processing step.

102

Figure 3-19 NHEJ GFP reporter assay: transfection of 5µg ISce-I plasmid yields maximum possible number of GFP positive cell population.

NHEJ GFP reporter assays were carried out to optimize the concentration of ISce-I plasmid for transient transfection. HEK 293 cells stably transfected with GFP coding region under the control of CMV promoter were seeded at 50% confluency and 24hrs prior to transfection, penicillin/streptomycin free medium was added. 5 µg ISce-I plasmid was transfected using Lipofectamine 2000 (Invitrogen). 1ml fresh antibiotic free culture medium was added to the cells 6hrs after incubating the cells with the transfection reagent. Samples were prepared after 72 hr time point and flow cytometry analysis was done to observe GFP positive cell population. The experiment was repeated three times (n=3). A representative flow cytometry graph is shown on the right as described above.

Another approach that can be used to identify PP1 or PP2A substrates in NHEJ is substrate trapping technique that has been used successfully for protein tyrosine phosphatases (Blanchetot, Chagnon et al. 2005). In this technique, catalytically dead protein phosphatase is expressed in cells such that a phospho-substrate is able to bind the phosphatase but remains trapped inside the catalytic domain. Phosphatase along with its substrate can then be pulled-down and identified using mass spectrometry or western blotting. A potential pitfall is that there are reports which suggests that it is very challenging to express exogenous phosphatases in cells due to their complicated post- translational modifications (Baharians and Schonthal 1998). The in situ proximity ligation assay (PLA) enables detection of protein–protein interactions in cell lines and tissues (Soderberg, Gullberg et al. 2006). In PLA, cells are

103

grown on coverslips, then fixed prior to addition of the proximity probes. Two primary antibodies raised in different species are used to recognize the target antigens of interest. These are then detected by the addition of species-specific secondary antibodies each attached with a unique short DNA strand. If the PLA probes are in close proximity, the DNA strands can interact through a subsequent addition of two other circle-forming DNA oligonucleotides. Using fluorescent oligonucleotide probes, the interaction can then be detected by using immunofluorescence microscopy. Using phosphospecific antibodies to DNA-PKcs phosphorylation sites such as pS2056, pT2609 and another antibody to either one of the regulatory subunits to PP1 or PP2A or to the catalytic subunit themselves, the interaction could be detected post IR treatment. A major limitation of the technique is the specificity of phosphospecific or regular antibody to be used.

104

Chapter Four: The role of the Ku80 C- terminal region in non-homologous end joining

105

4.1 Introduction

The Ku heterodimer binds to dsDNA ends with high affinity (Mimori and Hardin 1986, Mimori, Hardin et al. 1986) and plays a central role in NHEJ. Ku consists of approximately 70 (Ku70) and 80 (Ku80) kDa subunits, both of which have been shown to contribute to DNA binding. Both Ku70 and Ku80 contain some common domains, and at the same time both contain some unique regions at the C-terminal (Figure 1-5). Initial studies to characterize the role of the Ku80 C-terminal region (CTR) demonstrated that deletion of this region did not cause a defect in heterodimerization of Ku70/80, nor did it affect the DNA binding activity of the Ku heterodimer (Singleton, Torres-Arzayus et al. 1999). The authors’ then transfected human Ku80 full length or Ku80 C-terminal truncation (amino acids 1-554) into Ku80 null xrs6 cells and performed clonogenic cell survival assays following IR treatment. Xrs6 cells expressing the human Ku80 C- terminal truncation mutant were as radiosensitive as Ku null xrs6 cells and full length Ku80 expression rescued this phenotype. By performing dsDNA cellulose pull down assays using extracts from xrs6 cells, followed by p53 peptide substrate phosphorylation assays, they found that truncation of the Ku80 CTR leads to a reduction in DNA-PKcs kinase activity (Singleton, Torres-Arzayus et al. 1999). Classical NHEJ plays a central role in V(D)J recombination which is responsible for the generation of antibody diversity. By transfecting a plasmid substrate which mimics the V(D)J recombination substrate, plus the RAG 1 and RAG2 endonucleases, into xrs6 cells, the authors sought to determine the role of the Ku80 CTR (amino acids 555-732) in V(D)J recombination. Analysis of the plasmid substrate revealed that xrs6 cells expressing the Ku80 C-terminal truncation (amino acids 1-544) showed profound defects in coding joint formation while the effect on signal joint formation was not significant. This phenotype was found to be similar to cells deficient in DNA-PKcs, further demonstrating that the Ku80 CTR played an important role in DNA-PKcs kinase activation (Singleton, Torres-Arzayus et al. 1999). In the same year, another study was carried out mapping protein-protein interactions in the DNA-PK complex (Gell and Jackson 1999). By expressing Ku70/80 as GST fusion proteins, the authors found that the extreme Ku80 C-terminal 12 amino 106

acids interacted directly with DNA-PKcs. They also proposed that these 12 amino acid residues were conserved only in Ku expressed in vertebrate organisms. Further support for this hypothesis came from a subsequent study by the same group demonstrating that the extreme Ku80 CTR was required for DNA-PKcs activity in xrs6 cells. In addition, they showed that substitution of conserved acidic amino acids in the extreme CTR was enough to disrupt the interaction between DNA-PKcs and Ku heterodimer (Falck, Coates et al. 2005). Based on these observations the authors proposed that the extreme Ku80 C-terminal 12 amino acids were required for DNA-PKcs activation and deletion of this region caused a radiosensitive phenotype.

Figure 4-1 NMR structure of the Ku80 CTR.

NMR analysis of the Ku80 CTR [(amino acids 566-732 (1RW2) and 592-709 (1Q2)] shows an α- helical region surrounded on either side by disordered regions. The Ku80 CTR has three distinct structural regions: a disordered region between amino acids 543 - 593, a helical bundle between amino acids 594 - 704, and a disordered region at the extreme C-terminal, between amino acids 705-732. PDB file 1RW2 (Zhang, Hu et al. 2004) (left panel) and 1Q2Z (right panel) (Harris, Esposito et al. 2004).

Limited proteolysis experiments demonstrated that the CTR of Ku80 did not show major conformational change/s in the absence or presence of DNA (Lehman, Hoelz et

107

al. 2008). If the extreme CTR of Ku80 mediates the activation of DNA-PKcs, and this region does not seem to undergo major conformational change in the absence or presence of DNA; then the question is why do DNA-PKcs and Ku interact only in the presence of DNA? It could be possible that this region is recruiting and stabilizing DNA- PKcs on DNA ends once Ku is bound to DNA ends. This has been supported by small angle X-ray scattering studies (SAXS) where it was shown that the Ku80 CTR extends away from DNA ends (Hammel, Yu et al. 2010). This model is also supported by a recent computational modeling study which suggests that the Ku80 CTR is close to the DNA binding cavity of the Ku heterodimer in the absence of DNA. But as soon as the Ku heterodimer binds to the DNA, the negative charge on the Ku80 CTR leads to this region getting exposed away from DSB end (Hu and Cucinotta 2011). Another possibility is that DNA-PKcs is making additional, as yet uncharacterized, contacts with the Ku heterodimer. This has been supported by observations made by another group where they showed that deletion of the entire Ku80 CTR (amino acids 598-732) did not abolish DNA-PKcs kinase activity (Weterings, Verkaik et al. 2009). Using YFP-tagged DNA-PKcs they showed that cells expressing Ku80 with C-terminal deletion (amino acids 1-569) were proficient in recruiting DNA- PKcs to UV laser induced DNA damage sites. They also showed by EMSA, that the Ku70/80 C-terminal truncated mutant interacted with purified DNA-PKcs as well as the XRCC4-ligaseIV complex. Then using dsDNA structures of 250 bp or 1000 bp length they showed that the Ku70/80 C-terminal truncated mutant was able to support DNA- PKcs kinase activity using autoradiography experiments (i.e. measuring total in vitro phosphorylation) as well as by probing with phosphospecific antibodies against individual DNA-PKcs phosphorylation sites (pS2056, pT2609 and pT2647). The authors observed an approximately 40% decrease in total phosphorylation of DNA-PKcs in their autoradiography experiments as well as a defect in phosphorylation of the T2647 site. It is worth mentioning that this study also found that xrs6 cells expressing a Ku80 C- terminal deletion mutant (amino acids 1-569) were radiosensitive as determined by clonogenic survival assays. This cannot be attributed to the deficiency in DNA-PKcs kinase activation alone. By performing in vitro endonuclease activity, the authors found

108

that the Ku70/80 C-terminal truncated mutant was unable to support 33 bp oligonucleotide hairpin opening activity by the Artemis endonuclease. This study concluded that the deletion of the Ku80 CTR does not abolish DNA-PKcs kinase activity, but that Ku70/80 lacking this region is unable to support the Artemis endonuclease activity (Weterings, Verkaik et al. 2009). The study by Weterings et.al. shows that the Ku80 CTR has a role in NHEJ and also suggested the possibility that the activation of DNA-PKcs kinase activity is more complicated than previously thought. However, the suggestion that the radiosensitive phenotype of Ku70/80 C-terminal truncated mutant is due to lack of Artemis endonuclease activity leaves certain unanswered questions. It has been shown previously that the Artemis endonuclease is required for repair of a subset (~10-15%) of IR-induced DSBs and these DSB’s mostly localize to heterochromatin (Riballo, Kuhne et al. 2004, Beucher, Birraux et al. 2009, Goodarzi, Jeggo et al. 2010). It has also been shown that DNA-PKcs is required for Artemis endonuclease recruitment and activation (Ma, Pannicke et al. 2002, Goodarzi, Yu et al. 2006). The phenotype shown by Artemis deficient cells, although radiosensitive, was not as severe as with DNA-PKcs deficient cells. If Ku80 C-terminal deletion expressing cells are defective in Artemis endonuclease activation, this should mean that the DSB repair defect phenotype in these cells should mirror defects in Artemis endonuclease deficient cells. However that is not the case, as Ku80 C-terminal deletion mutant expressing cells show a profound DSB repair defect as observed using γH2AX foci analysis (Falck, Coates et al. 2005). This suggests that the Ku80 CTR has additional roles in NHEJ. In line with this, recent research has been initiated to understand this role. One such study suggested the possibility that the Ku80 C-terminal could be forming a dimer with an adjacent Ku80 C-terminal (Bennett, Woods et al. 2012), which could possibly be playing a role in DNA DSB end synapsis. Also, it was shown that the Ku80 C-terminal might be regulating DNA-PKcs kinase activity based on the type of dsDNA structure. For example it was observed that a Ku80 C-terminal deletion mutant (amino acids 1- 550) was defective in its ability to activate DNA-PKcs kinase activity using 30 or 60 bp

109

dsDNA with 3’ or 5’ 4 nucleotide overhang ends. They also observed this defect using longer DNA structures such as 400 bp or > 5000 bp. This kinase activity was observed by analyzing p53 peptide substrate phosphorylation (Woods, Sears et al. 2015). However, an important point to remember is that these kinase activity assays were performed in the absence of salt such as NaCl or KCl so may not be physiologically relevant (discussed in detail in results section).

4.2 Rational and Hypothesis

The aim of my study was to characterize the role of Ku80 CTR in NHEJ, with particular focus on its role in recruitment and/or activation of DNA-PKcs kinase activity.

4.2.1 Specific aims

1. To determine the sensitivity of xrs6 cells expressing Ku80 C-terminal deletion to different DSB inducing agents such as IR, etoposide, doxorubicin, neocarzinostatin.

2. To test the activation of DNA-PKcs kinase activity in presence of Ku80 CTR mutants by analysing the DNA-PKcs autophosphorylation sites.

3. Using DNA pull-down assay, determine the interaction of DNA-PKcs with Ku70/ 80 C-terminal mutants.

110

4.3 Results

4.3.1 Bioinformatics analysis and GST-pull down assays

The Ku80 CTR has been suggested to be required for DNA-PKcs kinase activation (Singleton, Torres-Arzayus et al. 1999). It was also suggested that organisms that lack DNA-PKcs expression also lack the extreme Ku80 CTR (Gell and Jackson 1999). To test this, I gathered protein sequence of Ku80 from various organisms and performed sequence alignment using ClustalW2 software (hosted by European Bioinformatics Institute). As can be seen in Figure 4-2A, extreme CTR amino acids are not conserved in all the organisms (see Figure 4-2A legend for name of organisms). Some of the organisms in Figure 4-2A also do not code for a gene expressing DNA- PKcs such as Schizosaccharomyces pombe, Sj; Schizosaccharomyces japonicus, As; Aspergillus sojae, Ao; Aspergillus oryzae, At; Arabidopsis thaliana, Sc; Saccharomyces cerevisiae, Dm; Drosophila melanogaster, Ce; Caenorhabditis elegans. Further bioinformatics analysis to predict secondary structure showed that parts of Ku80 CTR are disordered, consistent with previous NMR studies (Harris, Esposito et al. 2004, Zhang, Hu et al. 2004) (Figure 4-2B). Next I wanted to characterize the interaction of Ku80 CTR with DNA-PKcs. For this I generated Ku80 C-terminal fragments 545-732, 592-732, 592-709, 592-718 as GST fusion proteins. Figure 4-3A shows the domains in full-length Ku80 and the length of Ku80 C-terminal fragments cloned into the GST vector. Figure 4-3B shows the purification of fragments using GST beads and verification of protein purity by running them on SDS-PAGE gel and staining them with Coomassie blue dye. Purified Ku80 C- terminal fragments were then used to carry out GST pull down assay to detect their interaction with purified DNA-PKcs. As can be seen in Figure 4-3C, GST fusion proteins containing Ku80 C-terminal fragments 545-732, the entire CTR and amino acids 592- 732 (i.e, C-terminal lacking the linker region) interacted with DNA-PKcs.

111

Figure 4-2 ClustalW2 alignment of the Ku80 CTR from different organisms demonstrates sequence conservation in higher eukaryotes but not in lower eukaryotes.

Panel A shows a sequence alignment of the CTR of Ku80 from various organisms (corresponding to residues 667-732 of human Ku80). The abbreviated name of the organism and the accession numbers (from http://www.ncbi.nlm.nih.gov/) are shown on the left hand side. The abbeviations used are as follows: Hm; Homo sapiens, Pa; Pongo Abelii, Mm; Mus musculus, Rn; Rattus norvegicus, Cg; Cricetulus griseus, Bt; Bos taurus, Gg; Gallus gallus, Xl; Xenopus laevis, Dr; Danio rerio, Sp; Schizosaccharomyces pombe, Sj; Schizosaccharomyces japonicus, As; Aspergillus sojae, Ao; Aspergillus oryzae, Dd; Dictoctylieum discoideum, At; Arabidopsis thaliana, Sc; Saccharomyces cerevisiae, Dm; Drosophila melanogaster, Ce; Caenorhabditis elegans.

112

Panel B shows the disorder profile of full-length human Ku80 protein as determined using PSIPRED software (hosted by University College London, Dept. of Computer Science). Filter represents masking of low complexity regions of amino acids, 5% FPR represents false positive rate.

Fragments lacking the extreme C-terminal residues, 592-709 and 592-718 showed no interaction with purified DNA-PKcs. This is in agreement with the previously published study characterizing the interaction of Ku heterodimer and DNA-PKcs (Gell and Jackson 1999). However, in Figure 4-3D, the interaction between GST-Ku80 C- terminal fragments and DNA-PKcs was not observed when pull down assay was carried out with HeLa whole cell extract.

113

4.3.2 Ku expression and cell cycle profile analysis of xrs6, hamster cells

I next wanted to characterize the role of Ku80 CTR in DSB repair in cells. For this we requested xrs6 cells expressing full-length human Ku80 or Ku80 C-terminal truncation (1-569) from Dr. David Chen’s group, University of Texas Southwestern Medical Center as published in (Weterings, Verkaik et al. 2009).

Figure 4-3 Fragments of the Ku80 CTR interact with purified DNA-PKcs in vitro.

114

Panel A shows the domain organization of full-length Ku80. Panel B shows a Coomassie stained SDS PAGE gel with 5 µg of purified GST alone (lane 2) or GST-Ku80 CTR fragments (lanes 3-6). Panel C shows results of an in vitro GST pull-down assay using Ku80 CTR fragments and purified DNA-PKcs. Lane 1 contained beads alone, lane 2 purified GST protein, lane 3 GST-Ku80

115

C-terminal residues (592-709), lane 4 GST-Ku80 C-terminal residues (592- 718), lane 5 GST-Ku80 C-terminal residues (592-732), lane 6 GST-Ku80 C- terminal residues (545-732). Samples in all lanes were incubated with purified DNA-PKcs. The figure shows results for a western blot for DNA-PKcs. GST pull-down assays were performed as described in Materials and Methods. Panel D shows results of a GST pull-down assay using Ku80 CTR fragments and HeLa whole cell extract. Lanes 1 and 2 contained HeLa WCE input from either unirradiated or irradiated cells, respectively, lane 3 contained beads alone incubated with WCE, Lane 4 purified GST protein incubated with WCE, lanes 5 and 8 contained GST-Ku80 C-terminal residues (592-718) incubated with WCE in absence or presence of DNA damage respectively, Lanes 6 and 9 contained GST-Ku80 C-terminal residues (592-732) incubated with unirradiated or irradiated WCE, lane 7 GST-Ku80 C-terminal residues (545- 732) incubated with unirradiated WCE.

I wanted to validate the expression of Ku in these cells before initiating any further studies. Since the expression of Ku is lower in rodent cells, I performed dsDNA cellulose pull down assays using xrs6 cell extracts which is based on the fact that Ku binds with high affinity towards dsDNA ends (Finnie, Gottlieb et al. 1995). As can be seen in Figure 4-4 xrs6 no Ku80 antibody cross reacting band was observed whereas bands were detected in xrs6 complemented with full-length Ku80 or complemented with Ku80 C-terminal truncation (1-569). Ku80 mutant migrates faster on the SDS-PAGE gel than the Ku80 full-length protein. The Ku80 antibody detected residues 419-440 residues (Abcam). To further validate this result, I stripped and reprobed the membrane with a Ku70 subunit antibody. It has been shown that Ku70/80 form an obligate heterodimer, and that deletion of Ku70 leads to destabilization of Ku80 and vice-versa (Nussenzweig, Chen et al. 1996, Ouyang, Nussenzweig et al. 1997). Xrs6 cells showed no detectable Ku70 whereas it was detected in xrs6 cells complemented with full-length Ku80 or Ku80 C-terminal truncation mutant (Figure 4-4 B).

116

Figure 4-4 Expression of Ku heterodimer in xrs6 cells and V3 cells verified by dsDNA cellulose pull-down assays.

Panel A and B shows results of western blotting to detect expression of the Ku heterodimer in, Ku or DNA-PKcs deficient hamster cells, (xrs6 and V3, respectively). Cell extract for pull-down assays was prepared using the S10/P10 method as described in the Materials and Methods section. For HeLa cells (lane 1) 100 µg extract was used whereas for hamster cells 250 µg extract was used. Lane 2 was intentionally left blank. Lanes 3, 4,and 5 contained xrs6 Ku null cells, and xrs6 complemented with full-length human Ku80 or Ku80 CTR (1-569), respectively. Lanes 6 and 7 contained DNA- PKcs null V3 cells or V3 cells complemented with full-length human DNA- PKcs, respectively. In panel A, the membrane was probed for Ku80. In panel B, the membrane was stripped and reprobed for Ku70.

Current models of DSB repair pathway choice suggest an important role for cell cycle phase in the process, NHEJ being the predominant pathway in G0/G1, and HR in late S/G2 phase (Rothkamm, Kruger et al. 2003, Shibata, Conrad et al. 2011). I performed FACS analysis to determine the percentage of cells in G1/S/ and G2 phases of cell cycle in xrs6 cells. Figure 4-5 depicts the distribution of xrs6 cells in different cell cycle phases. There was no major shift in cell cycle distribution in any of the three cell lines tested, although xrs6 Ku null cells showed slightly higher G2 phase cells. Ku80 full-length and Ku80 C-terminal truncation mutant expressing cells showed similar cell cycle profiles.

117

Figure 4-5 Xrs6 cells lacking Ku80 or complemented with Ku80 full-length or the Ku80 CTR mutant have similar cell cycle distribution profiles.

Asynchronously growing xrs6 cells or xrs6 cells complemented with Ku80 full- length or the Ku80 CTR mutant were analysed by FACS with propidium iodide staining. Percentage of cell population in G1/S/ and G2 is shown. Error bars represents mean ± S.D of three independent experiments.

4.3.3 Clonogenic cell survival assays

Xrs6 cells expressing the Ku80 C-terminal truncation mutant have been shown to be sensitive to IR treatment (Singleton, Torres-Arzayus et al. 1999, Weterings, Verkaik et al. 2009). To validate this and determine their sensitivity to various DSB inducing agents I performed clonogenic survival assays, Figure 4-6A. Initial experiments with IR treatment demonstrated that cells expressing Ku80 C-terminal truncation are as radiosensitive as Ku null cells. For comparison in Figure 4-6 B, I conducted experiments with V3, DNA-PKcs-deficient cells and V3 cells complemented with full-length human DNA-PKcs in parallel. As expected DNA-PKcs-deficient cells were extremely radiosensitive. These results demonstrates that Ku null cells, and Ku80 C-terminal truncation expressing cells are radiosensitive, which validates the previously reported results. Next I wanted to determine their sensitivity to other DSB inducing agents such

118

as neocarzinostatin, doxorubicin, and etoposide. Treatment of xrs6 cells, Figure 4-7A, with doxorubicin showed that Ku null cells were extremely sensitive the treatment whereas Ku80 C-terminal truncation cells showed intermediate sensitivity compared to Ku null and Ku80 full-length complemented cells. Figure 4-7B depicts that the Ku80 C- terminal truncation expressing cells were sensitive to neocarzinostatin treatment and so were Ku null cells, whereas in comparison, Ku80 full-length expressing cells were resistant to neocarzinostatin treatment. Finally, I tested the sensitivity of xrs6 cells to etoposide, as can be seen in Figure 4-7C, Ku null cells were extremely sensitive to the treatment whereas Ku80 C-terminal truncation cells showed no statistically significant compared to Ku80 full-length complemented cells.

Figure 4-6 Xrs6 cells expressing Ku80 (1-569) C-terminal truncation mutant are as radiosensitive as Ku null xrs6 cells.

119

In panel A, xrs6 cells complemented with full-length Ku80 or Ku80 (1-569) C- terminal truncation mutant were irradiated then incubated for 7 days. After 7 days, colony formation was observed and cells were fixed and stained with crystal violet as described in Materials and Methods. Statistically significant differences are indicated by the asterisks. Data shows the mean of three different experiments each carried out in triplicate. Statistical analysis was carried out with GraphPad Prism software version 6.0. The means of xrs6 and xrs6+Ku80 (1-569) for each individual dose were compared with xrs6+Ku80 individually using multiple comparison t-test. The difference between xrs6+Ku80 full-length was statistically different (p < 0.05) from results with xrs6 cells or xrs6+Ku80 (1-569). In panel B, DNA-PKcs-deficient V3 cells or V3 cells complemented with human DNA-PKcs were treated with IR for comparison. Experiments were carried out and analysed as in panel A. The difference in radiation sensitivity between DNA-PKcs null V3 cells and V3 cells complemented with full-length human DNA-PKcs was significant (p < 0.05) at all conditions tested.

120

Figure 4-7 Clonogenic survival assay of xrs6 cells to different types of double stand break inducing drugs.

121

Panel A: xrs6 cells (triangles), xrs6 cells stably expressing full-length Ku80 (open circles) or xrs cells stably expressing Ku80(1-569) (stars) were treated with doxorubicin for 1.5 hours at the concentrations shown. After 7 days, cells were fixed and colonied counted as in Figure 4-6. The figure shows the mean of three different experiments carried out in triplicate. Statistical analysis was carried out with GraphPad Prism software version 6.0. The means of xrs6 and xrs6+ku80 (1-569) for each individual dose were compared with xrs6+Ku80 independently using a multiple comparison t-test with p < 0.05 being considered a significant difference. Doxorubicin treatment of xrs6 cells stably expressing full-length Ku80 showed a statistically significant difference as compared to xrs6 Ku null cells and xrs cells stably expressing Ku80(1-569). Panel B: As in panel A, but cells were treated with neocarzinostatin for 1 hour at the concentrations indicated. Neocarzinostatin treatment of xrs6 cells stably expressing full-length Ku80 showed a statistically significant difference as compared to xrs6 Ku null cells and xrs cells stably expressing Ku80(1- 569). Panel C: As in panels A and B but cells were treated with etoposide for 4 hours at the concentrations indicated. Etoposide treatment of xrs6 cells stably expressing full-length Ku80 showed a statistically significant difference as compared to xrs6 Ku null cells, whereas xrs6 cells stably expressing Ku80 (1- 569) showed no significant difference.

In summary, xrs6 Ku null cells were sensitive to all three DSB inducing agents neocarzinostatin, doxorubicin, and etoposide, whereas xrs6 cells complemented with the Ku80 C-terminal truncation showed intermediate sensitivity to doxorubicin treatment,

122

were sensitive to neocarzinostatin treatment and showed no significant sensitivity to etoposide treatment. Xrs6 complemented with Ku80 full-length cDNA in comparison showed to resistance to all three DSB inducing agents. As mentioned earlier mammalian cells utilize two major pathways to repair DNA DSBs – NHEJ and HR. HR is active predominantly in late S and G2 cell cycle phase (Rothkamm, Kruger et al. 2003). It would be possible that the sensitivity to different DSB inducing agents could be due to defects in HR pathway. All the above mentioned experiments were carried out with asynchronous population of cells. To determine whether HR is functional in these xrs6 cells I treated them with camptothecin, a topoisomerase I inhibitor (Hsiang, Hertzberg et al. 1985). It has been demonstrated that camptothecin induces DNA damage by acting as a topoisomerase I catalytic poison, which plays an important role during DNA replication in S phase. When the replication machinery encounters the topoisomerase I blocked DNA, it collapses which generates a DNA DSB (Strumberg, Pilon et al. 2000). These DSB lesions are repaired by HR (Pommier, Redon et al. 2003). As can be seen in Figure 4-8 all three xrs6 cells showed resistance to camptothecin treatment, suggesting that the HR pathway is functional and may not be affected in these cells.

123

Figure 4-8 Xrs6 cells are not sensitive to camptothecin.

Xrs6 Ku null cells (triangles) as well as xrs6 cells expressing full-length Ku80 (open circles) and Ku80 (1-569) C-terminal truncation (stars) were treated with camptothecin for 24 hours at the concentrations shown. After 7 days, colonies were counted using the clonogenic survival assay.

4.3.4 Baculovirus expression and purification of Ku heterodimers

To understand the underlying mechanism of sensitivity to DSB inducing agents, I decided to clone the cDNA encoding Ku80 full-length (1-732), Ku80 with extreme C- terminal 14 amino acid deletion (1-718), and Ku80 C-terminal truncation (1-569) into the baculovirus expression system. Figure 4-9A and B depicts the schematics and procedure to generate baculovirus expression of Ku70/80 full-length and mutant heterodimers. As a first step, I cloned the Ku70 cDNA into the pFastbac1 vector which had no tag and Ku80 full-length and C-terminal mutants into pFastbacHTA vector which had an N-terminal hexahistidine tag for affinity purification. Figure 4-10 depicts the domain organization of Ku70 and Ku80 subunits. Hereafter, Ku70/80 full-length heterodimer is designated as Ku, whereas Ku70/80 (1-718) mutant is designated as Ku LH, so named because Ku80 extreme C-terminal 14 amino acids residues were truncated, and Ku70/80 (1-569) mutant as Ku core, as the entire Ku80 C-terminal was

124

truncated here. Figure 4-11A and B shows the Coomassie stained gel and western blots of purified Ku heterodimers, respectively. Please see Appendix A for details regarding the protein purification procedure and chromatograms.

Figure 4-9 Schematic of baculovirus cloning and protein expression.

[Figure taken from Bac to Bac® Baculovirus expression system manual (Invitrogen)].

125

Figure taken from Bac to Bac® Baculovirus expression system manual (Invitrogen).

126

Figure 4-10 Domain organization of full-length and mutant Ku70/80 heterodimer expressed and purified from insect cells.

Schematic showing the Ku70 and Ku80 full-length and C-terminal truncation mutants generated in this study. The N-terminal region of Ku70 (amino acids 1–33) is disordered. Ku70 contains an N-terminal von Willebrand domain (vWA) (amino acids 35–249), a core domain (amino acids 266–529) and a C- terminal SAP domain (amino acids 560–609), which is linked to the core domain via a disordered linker region (amino acids 536–559). Ku80 shows a similar domain organization with a vWA domain (amino acids 7–237), a core domain (amino acids 244–543) and a unique CTR (amino acids 544–732). Amino acids 544–593 are predicted to be disordered and are followed by a globular region (amino acids 594–704) followed by another disordered region (amino acids 705–732). Residues 718 - 732 in Ku80 have been shown to interact directly with DNA-PKcs. In subsequent experiments Ku represents Ku70/80 full-length heterodimer, Ku LH mutant represents Ku70/80 (1-718) and Ku core mutant represents Ku70/80 (1-569).

127

Figure 4-11 SDS PAGE and western blotting of final purified proteins.

Panel A: Ku represents Ku70/80 full-length, Ku LH represents Ku70/80 (1- 718), Ku core represents Ku70/80 (1-569). 1 µg of purified baculovirus expressed Ku, Ku LH, Ku core mutants was run on SDS PAGE gel and stained with Coomassie Blue. Molecular weight markers are shown on the left in kDa. One band was observed in Lane 4 Ku core mutant because the truncated Ku80 migration overlapped with Ku70 migration. Panel B: Western blot of samples shown in panel A. The blot was probed with an antibody to Ku80.

4.3.5 DNA-PKcs kinase activity and biotin pull down assays

Previous studies have shown that DNA-PKcs preferentially phosphorylates serine or threonine residue followed by glutamine (SQ/TQ) (Lees-Miller and Anderson 1991). Using a peptide substrate, PESQEAFADLWKK (Lees-Miller, Sakaguchi et al. 1992), derived from S15 phosphorylation site in p53, I tested the ability of Ku full-length and Ku mutant heterodimers to activate DNA-PKcs kinase activity in the presence of calf-thymus (CT) DNA. 128

Figure 4-12 Truncation of the C-terminal of Ku80 in the Ku70/80 heterodimer leads to reduction in DNA-PKcs kinase activity.

In panels A and B Ku represents Ku70/80 full-length, Ku LH represents Ku70/80 (1-718); Ku core represents Ku70/80 (1-569) heterodimer respectively. Panel A: 30 ng of purified DNA-PKcs and 10 ng of purified baculovirus expressed Ku70/80 heterodimer (full-length or mutant, 1:1 molar ratio) were incubated under standard assay conditions with 10 µg/ml calf thymus DNA and assayed for protein kinase activity using the p53 peptide assay as described in Materials and Methods. Kinase activity was expressed as pmole phosphate transferred per minute per reaction and is shown after normalization to activity in presence of DNA-PKcs plus full-length Ku.

129

Statistical analysis was carried out using GraphPad Prism software using one way ANOVA with Tukey’s multiple comparison method, p < 0.05 being considered significant (indicated by asterisks, ‘**’ p < 0.01, ‘*” p < 0.05). Panel B: 450 ng of DNA-PKcs was incubated alone or with 150 ng of baculovirus expressed Ku70/80 [Lane 1 DNA-PKcs alone, Lane 2 Ku, Lane 2 Ku LH, Lane 3 Ku core] under standard kinase assay conditions with 10 µg/ml calf-thymus DNA (CT-DNA) as in panel A. Samples were run on SDS PAGE, transferred to nitrocellulose and probed with antibodies to DNA-PKcs autophosphorylation sites or total DNA-PKcs as indicated on the right hand side. Samples in Lanes 5 and 6 were incubated with 2 µM NU7441 to inhibit DNA-PK kinase activity. The position of the 200 kDa molecular weight marker is shown on the left hand side.

As can be seen in Figure 4-12A, Ku full-length was able to activate DNA-PKcs efficiently but the Ku core mutant showed a statistically significant reduction, ~30%, in its ability to activate DNA-PKcs kinase activity. Surprisingly the Ku LH mutant did not show a statistically significant difference compared to Ku full-length. An interesting finding was that Ku80 C-terminal truncation did not abolish the DNA-PKcs kinase activation completely. As discussed before, DNA-PKcs is known to be phosphorylated on multiple site in vitro and in vivo (Chan, Chen et al. 2002, Douglas, Sapkota et al. 2002). Some of the well-characterized sites are referred to as the PQR cluster (residues 2023, 2029, 2041, 2053, 2056) (Cui, Yu et al. 2005) and the ABCDE cluster (residues 2609, 2612, 2620, 2624, 2638, 2647) (Ding, Reddy et al. 2003) where previous reports showed that phosphoablating mutants adversely affects DSB repair in cells. To determine whether any of these sites are affected specifically in Ku80 C-terminal deletion mutants I performed DNA-PKcs kinase activity assays (details in Materials and Methods) in the presence of CT-DNA and performed western blotting with phosphorylation site-specific antibodies. As can be seen in Figure 4-12B, the Ku core mutant showed significant reduction in phosphorylation of T3950, S2056, T2647 sites but the phosphorylation was not absent completely. In comparison, the Ku LH mutant showed only a minor reduction in phosphorylation signal compared to Ku full-length (Figure 4-12B). CT-DNA is prepared by dissolving the lyophilized powder in distilled water and sonicating the solution. This process generates a heterogeneous mix of

130

varying length of dsDNA strands. To test the ability of Ku80 C-terminal truncation mutants to activate DNA-PKcs kinase activity using defined DNA structure, I generated 25 bp blunt-ended dsDNA oligonucleotides. In Figure 4-13A, using 3’ FAM labelled DNA structure, I first tested the ability of Ku full-length and mutant heterodimers to bind DNA using EMSA. All three mutants bound to the 25 bp dsDNA structure but only Ku full- length and Ku LH mutant were able to activate DNA-PKcs kinase activity, Figure 4-13B. Next I wanted to determine the interaction of DNA-PKcs with Ku heterodimers.

Figure 4-13 The Ku mutants are able to bind 25 base pair (bp) blunt ended double strand (ds) DNA but showed a defect in their ability to interact with DNA-PKcs.

In panels A and B Ku represents Ku70/80 full-length, Ku LH represents Ku70/80 (1-718); Ku core represents Ku70/80 (1-569) heterodimer respectively. Panel A: EMSA analysis was carried out with FAM labeled 25 bp blunt ended dsDNA to determine DNA binding of Ku wild type and mutant heterodimer to

131

DNA. Two pmol DNA was used per reaction. Lane 1 contained BSA alone (0.05 mg/ml) as control, Lanes 2-4 contained increasing concentration of Ku incubated with DNA, Lanes 5-7 contained increasing concentration of Ku LH mutant incubated with DNA, Lanes 8-10 contained increasing concentration of Ku core mutant incubated with DNA. Panel B: Biotin pull-down assays were carried out using 3’ biotin labeled 25 bp blunt ended dsDNA to determine the interaction between DNA-PKcs and Ku wild type and mutant heterodimers. Two pmol DNA (bound to streptavidin coated magnetic beads) was incubated with 150 ng purified Ku70/80 heterodimer (full-length or mutants) as indicated. Beads were pulled down using a magnetic rack and washed once with binding buffer. To that 450 ng purified DNA-PKcs was added and incubated for 20 minutes at room temperature with end over end rotation. The beads were pulled down, washed and analyzed by SDS PAGE and western blot using antibodies to DNA-PKcs or Ku80 as indicated on the right hand side. Lanes 1 and 5 contained Ku full-length in absence or presence of DNA, Lanes 2 and 6 contained Ku LH mutant in absence or presence of DNA respectively, Lanes 3 and 7 contained Ku core mutant in absence or presence of DNA respectively. Lane 2 contained DNA-PKcs alone incubated with DNA. The experiment was carried out 3 times, representative western blots are shown.

For this I generated 25 bp blunt ended dsDNA structure with a 3’ biotin label to perform biotin pull-down assays. Using this technique, I found that Ku full-length heterodimer interacted with DNA-PKcs whereas Ku mutants did not show any interaction with DNA-PKcs. Further in Figure 4-14, I characterized the ability of Ku full- length and mutant heterodimers to activate DNA-PKcs kinase activity. The Ku core mutant showed a profound defect in DNA-PKcs kinase activation as observed using phosphospecific antibodies.

132

Figure 4-14 The Ku core mutant is defective in its ability to support DNA-PKcs autophosphorylation as determined with 25 bp blunt ended dsDNA.

Ku represents Ku70/80 full-length, Ku LH represents Ku70/80 (1-718); Ku core represents Ku70/80 (1-569) heterodimer respectively. Purified DNA- PKcs and baculovirus expressed Ku heterodimer (full-length or mutants) were incubated with 25 bp duplex DNA under kinase assay conditions as described in Materials and Methods. Autophosphorylation of DNA-PKcs was determined using by western blot using the antibodies indicated on the right hand side. 133

Experiments repeated 3 times, representative western blots are shown.

In the above experiments, a surprising result was the inability of the Ku LH mutant to interact with DNA-PKcs, considering that this mutant was able to activate DNA-PKcs kinase activity efficiently (Figure 4-13B). IR treatment generates DNA DSBs with complex ends such as DNA overhangs of varying lengths that terminate in 3’- phosphate, 5’-hydroxyl, and 3’-phosphoglycolate end groups (Hutchinson 1985, Povirk 2012). I wanted to determine whether 25 bp dsDNA with short 3’ and 5’ overhangs showed a similar defect as seen above. For this I generated 25 bp with 3’- or 5’- 15 nucleotide (nt.) overhangs to perform EMSA, biotin pull-down assays and kinase activity assays. For EMSA analysis, FAM-labelled DNA structures were generated such that both ends had 3’- and 5’- overhangs. As can be seen in Figure 4-15A Ku full-length and mutant heterodimers bound to the 25 bp dsDNA with 15 nt. 5’ overhang in EMSA analysis. In subsequent experiments, the DNA structures had a blunt biotin labelled end and a 15 nucleotide overhang end. To avoid any complication in interpreting the results, I blocked the biotin labelled end with streptavidin beads, then added Ku first and subsequently, incubated with DNA-PKcs. This prevented the binding of Ku to the blunt ends and allowed only the overhang ends for DNA-PK complex formation.

134

Figure 4-15 Ku mutants are able to bind 25 bp dsDNA with a 15 nucleotide 5’ overhang but showed a defect in their ability to interact with DNA-PKcs.

135

In panels A and B Ku represents Ku70/80 full-length, Ku LH represents Ku70/80 (1-718); Ku core represents Ku70/80 (1-569) heterodimer respectively. Panel A: EMSA was carried out as described in Figure 4-13A but using 25 bp dsDNA with a 15 nucleotide 5’ overhang. Panel B: Purified DNA-PKcs and Ku were incubated with Streptavidin coated magnetic beads loaded 25 bp duplex DNA with a 15 nucleotide 5’ overhang. DNA pull-down experiments were carried out as described in Figure 4-13B. Panel C: Quantitation of results shown in panel B. Results for DNA-PKcs in pull-downs with the Ku mutants were normalized with respect to the band observed in Ku full-length. Statistical analysis was carried out with GraphPad Prism using one way ANOVA with Tukey’s multiple compariosn method, p < 0.05 considered significant (‘***’ denotes p < 0.001, ‘****’ denotes p < 0.0001). Experiments repeated 3 times, representative western blots are shown.

Biotin labelled ss DNA was used a control to show that DNA-PK complex formation took place only on the dsDNA structures. Biotin pull down-assay showed that Ku full-length interacted with DNA-PKcs efficiently whereas Ku mutants interacted very weakly, Figure 4-15B. In Figure 4-15C, quantification of western blots using image J showed that there was statistically significant difference between Ku mutant heterodimers with respect to Ku full length heterodimer. In Figure 4-16, DNA-PKcs kinase activity was determined using phosphospecific antibodies, as described in Figure 4-14, and it was observed that Ku full-length and Ku LH mutant were able to activate DNA-PKcs kinase activity whereas Ku core mutant did not support DNA-PK autophosphorylation.

136

Figure 4-16 The Ku core mutant is defective in its ability to support DNA-PKcs autophosphorylation as determined using 25 bp dsDNA with a 15 nucleotide 5’ overhang.

Ku represents Ku70/80 full-length, Ku LH represents Ku70/80 (1-718); Ku core represents Ku70/80 (1-569) heterodimer respectively. Purified DNA- PKcs and baculovirus expressed Ku heterodimer (full-length or mutants) were incubated with 25 bp dsDNA with a 15 nucleotide 5’ overhang under kinase assay conditions as described in Materials and Methods. Autophosphorylation

137

of DNA-PKcs was determined using by western blot using the antibodies indicated on the right hand side. Experiments repeated 3 times, representative western blots are shown.

Figure 4-17 Ku mutants able to bind 25 bp dsDNA with a 15 nucleotide 3’ overhang but showed defect in interaction with DNA-PKcs.

138

In panels A and B Ku represents Ku70/80 full-length, Ku LH represents Ku70/80 (1-718); Ku core represents Ku70/80 (1-569) heterodimer respectively. Panel A: EMSA was carried out as described in Figure 4-13A but 25 bp dsDNA with a 15 nucleotide 3’ overhang. Panel B: Purified DNA-PKcs and Ku were incubated with Streptavidin coated magnetic beads loaded 25 bp duplex DNA with a 15 nucleotide 3’ overhang. DNA pull-down experiments were carried out as described in Figure 4-13B. Panel C: Quantitation of results shown in panel B. Results for DNA-PKcs in pull-downs with the Ku mutants were normalized with respect to the band observed in Ku full-length. Statistical analysis was carried out with GraphPad Prism using one-way ANOVA with Tukey’s multiple comparison method, p < 0.05 considered significant (‘**’ denotes p < 0.01). Experiments repeated 3 times, representative western blots are shown.

Similar to the 25 bp blunt ended dsDNA, Ku LH mutant was able to activate DNA-PKcs kinase activity but showed defect in interaction with DNA-PKcs. In Figure 4-17 and 4-18, similar observations were made with 25 bp dsDNA with a 15 nt. 3’ overhang.

139

Figure 4-18 Ku core mutant defective in its ability to support DNA-PKcs autophosphorylation as determined using 25 bp dsDNA with a 15 nucleotide 3’ overhang.

Ku represents Ku70/80 full-length, Ku LH represents Ku70/80 (1-718); Ku core represents Ku70/80 (1-569) heterodimer respectively. Purified DNA- PKcs and baculovirus expressed Ku heterodimer (full-length or mutants) were incubated with 25 bp dsDNA with a 15 nucleotide 3’ overhang under kinase assay conditions as described in Materials and Methods. Autophosphorylation

140

of DNA-PKcs was determined using by western blot using the antibodies indicated on the right hand side. Experiments repeated 3 times, representative western blots are shown.

Table 4-1 Summary of results.

DNA-PKcs autophosphorylation Protein DNA Structure DNA DNA-PKcs (determined using Binding interaction phosphospecific antibody) 25 bp blunt ended dsDNA +++ +++ +++

25 bp dsDNA with Ku a 15 nt 5’ overhang +++ +++ +++ 25 bp dsDNA with a 15 nt 3’ overhang +++ +++ +++ 25 bp blunt ended dsDNA +++ - ++ Ku LH 25 bp dsDNA with a 15 nt 5’ overhang +++ + ++ 25 bp dsDNA with a 15 nt 3’ overhang +++ + ++ 25 bp blunt ended dsDNA +++ - - Ku 25 bp dsDNA with core a 15 nt 5’ overhang +++ + - 25 bp dsDNA with a 15 nt 3’ overhang +++ + -

Ku represents Ku70/80 full-length, Ku LH represents Ku70/80 (1-718); Ku core represents Ku70/80 (1-569) heterodimer respectively. ‘+++’ indicates very strong, ‘++’ strong, ‘+’ Moderate, ‘-’ absent.

141

4.4 Discussion

Previous reports showed that the Ku80 CTR plays an important role in NHEJ and could potentially be important for DNA-PKcs kinase activity (Singleton, Torres-Arzayus et al. 1999). Xrs6 cells expressing Ku80 C-terminal truncations were found to be radiosensitive (Singleton, Torres-Arzayus et al. 1999, Weterings, Verkaik et al. 2009). In the present study I have tried to resolve the ambiguity of the role of Ku80 CTR in NHEJ. Protein sequence analysis showed that the Ku80 extreme CTR is conserved in higher eukaryotes but not in lower eukaryotes such as S. cerevisiae. It has been suggested that this region is conserved only in organisms that also express DNA-PKcs (Gell and Jackson 1999). Accordingly, a DNA-PKcs expressing gene has not been reported in organisms such as S. cerevisiae. However, a previous study has shown that deletion of yKu80 C-terminal also leads to defect in NHEJ in yeast, in which mutational analysis showed that this region was similar to the DNA-PKcs interaction motif in human Ku80 (Palmbos, Daley et al. 2005). This suggests that the Ku80 C-terminal plays an important role in NHEJ across species and its function is not just limited to activation of DNA-PKcs kinase. I further validated the role of extreme Ku80 C-terminal 14 amino acid residues in interaction with DNA-PKcs in vitro using purified proteins. As previously reported, deletion of Ku80 extreme C-terminal 14 amino acids lead to abolition of its interaction with DNA-PKcs, Figure 4-2C (Gell and Jackson 1999). However, I did not see this interaction with HeLa whole cell extract. It is possible that the endogenous Ku is already binding to the DNA-PKcs in whole cell extract. It is not known whether DNA-PKcs has higher affinity for Ku bound to DNA or just the Ku80 CTR alone. This could be tested by performing DNA-PKcs kinase activity experiments in the presence of Ku heterodimer and DNA structure and then adding the Ku80 C-terminal fragment in increasing amount to the reaction to determine whether or not this fragment inhibits DNA-PKcs activation. A potential limitation is that the Ku80 C-terminal fragment, instead of inhibiting the kinase activity, might start acting as a DNA-PKcs substrate since it has previously been shown that Ku80 is phosphorylated at S577, S580 and T715 in vitro by DNA-PKcs and

142

in vivo as well (Chan, Ye et al. 1999, Douglas, Gupta et al. 2005). This could complicate the interpretation of results. Clonogenic survival assays validated that xrs6 cells expressing the Ku80 C- terminal truncation are radiosensitive and in addition, they are also sensitive to other DSB inducing agents such as doxorubicin, and neocarzinostatin. However, these cells were resistant to another DSB inducing agent, etoposide. In comparison xrs6 Ku null cells were sensitive to all the DSB inducing agents mentioned above. This suggests that the Ku80 C-terminal mutant cells are not completely defective in carrying out the NHEJ process. Treatment of cells with IR or neocarzinostatin, a radiomimetic agent, generates multiple types of lesions such as dsDNA with 3’- or 5’- overhangs, or complex ends such as 3’- phosphoglycolate (Dedon and Goldberg 1992, Povirk 2012). There is a possibility that the deletion of Ku80 CTR could be affecting the end-processing step by different enzymes such as PNKP, or Artemis. This could also explain the lack of sensitivity of xrs6 cells expressing the Ku80 C-terminal truncation to etoposide. Etoposide traps topoisomerase II on the DNA via 5’ phosphotyrosyl linkage, thus preventing its re-ligation (Nitiss 2009). The initial step in repairing this type of lesion is proteasome-mediated degradation of the DNA bound protein adduct (Mao, Desai et al. 2001). This leaves only a fragment of peptide bound to the DNA which is then cleaved by the enzyme, tyrosyl-DNA phosphodiesterase 2 (TDP2) (Gomez-Herreros, Romero- Granados et al. 2013). Resulting DSBs can then be repaired by NHEJ. In the clonogenic experiments, xrs6 cells were found to be extremely sensitive to etoposide treatment whereas xrs6 cells expressing Ku80 C-terminal deletion showed no statistically significant difference compared to xrs6 cells expressing Ku80 full-length protein. This could potentially mean that Ku80 C-terminal deletion is not affecting the repair of etoposide generated DSBs. On the other hand, sensitivity to doxorubicin treatment is in the order Ku null < Ku80 C-terminal deletion < Ku80 full-length. Doxorubicin, like etoposide, induces DSBs by inhibiting the topoisomerase II mediated re-ligation of DSB (Nitiss 2009). However, there is major difference between doxorubicin and etoposide, it also generates ROS which activate ATM kinase signaling (Kurz, Douglas et al. 2004). ROS could potentially be generating complex DSB lesions, but it

143

has not been demonstrated directly. These hypotheses regarding etoposide and doxorubicin induced DSBs in xrs6 cells expressing Ku80 C-terminal deletion needs to be tested more rigorously. Biochemical analysis revealed that deletion of the Ku80 CTR leads only to partial abrogation of DNA-PKcs kinase activity in the presence of CT-DNA. As mentioned before, CT-DNA is a heterogenous mixture of various dsDNA molecules. It has been shown previously that DNA-PKcs kinase alone gets activated in the presence of DNA and this activation is differential, depending on the length of DNA, overhang ends and DNA hairpins. It was shown that the activity of DNA-PKcs kinase alone was strongly stimulated by 12 bp dsDNA with 3’ and 5’ unpaired ends, 22 bp ds blunt DNA and 12 bp dsDNA with 3’ unpaired ends showed medium activation whereas 12 bp ds blunt DNA and 12 bp dsDNA with 5’ unpaired ends were unable to stimulate DNA-PKcs kinase activity (Hammarsten, DeFazio et al. 2000). Also, it was shown that hairpin ended DNA was unable to stimulate DNA-PKcs kinase activity (Smider, Rathmell et al. 1998). A major point to remember regarding these studies is that these kinase activity experiments were carried out under no salt conditions. Previously our lab and others have shown that DNA-PKcs kinase on its own gets activated in the presence of DNA structures but this kinase activity is abrogated as soon as physiological salt concentration is used in the kinase buffer (75 - 120 mM NaCl or KCl) (Hammarsten and Chu 1998, Goodarzi, Yu et al. 2006). Addition of Ku to the reaction mixture stimulates DNA-PKcs kinase activity several fold under salt concentrations mentioned above. It would be interesting to repeat these findings using different DNA structures in absence or presence of Ku mutant heterodimers under physiological salt concentration. In my studies I have attempted to study the effect of defined DNA structures such as 25 bp ds blunt DNA, 25 bp dsDNA with 3’- or - 5’ overhangs. Using these structures, I found that the deletion of entire Ku80 CTR leads to severe defects in autophosphorylation of DNA-PKcs. However, deletion of Ku80 extreme C-terminal 14 amino acid residues did not affect the DNA-PKcs autophosphorylation significantly but abrogated its interaction with DNA-PKcs which was surprising. One interesting possibility could be that the Ku80 extreme C-terminal 14 amino acids are required for

144

stabilizing DNA-PKcs on DNA structures like 3’- or 5’ overhangs which require end processing by enzymes such as Artemis. This has been suggested previously, in that DNA-PKcs immunoprecipitated Artemis but the addition of Ku80 C-terminal peptide disrupted this interaction (Drouet, Frit et al. 2006). Studies from our lab have previously shown that DNA-PKcs needs to undergo an autophosphorylation-mediated conformational change in order to activate Artemis endonuclease activity (Goodarzi, Yu et al. 2006). Further studies are required to understand this. How relevant are these observations in vivo under cellular context? In the cell, DNA DSB repair takes place in the context of chromatin consisting of histones. Each nucleosome consists of a histone octamer - two copies each of H2A, H2B, H3 and H4 around which 147 base pair of DNA wraps around. Exactly how much DNA is present in the linker region between two nucleosomes varies under genomic context but studies have shown that it is around 30 bp, to sometimes 90 bp (Szerlong and Hansen 2011). In the scenario depicted in Figure 4-19, suppose if the DSB occurs midway through 30 bp linker region, this would yield 15 bp dsDNA. Ku and DNA-PKcs form a productive complex on over 25 bp dsDNA (West, Yaneva et al. 1998). This would mean DSBs would need to be modified by chromatin remodeling complexes. It is not known at this moment what length of DNA is generated by chromatin remodelers at DSB sites. Chromatin remodelers generally act by mechanisms such as repositioning of nucleosomes, ejecting the entire histone octamer, and/or exchanging histones (Liu, Yip et al. 2012). In the above mentioned scenario, to generate 25 bp dsDNA, the nucleosome must be displaced by at least one DNA helical turn. If chromatin remodelers act by displacing histone, in that case length of dsDNA generated would be much longer. For Ku full-length heterodimer it can cope with these types of DSB breaks as it can form active complex with DNA-PKcs. But as for Ku80 C-terminal deletion mutant, we know it’s not active on 25 bp dsDNA. Further studies need to be carried out to determine the ability of Ku80 C-terminal deletion mutants to activate DNA-PKcs using DNA structures longer than 25 bp.

145

Figure 4-19 DSB induction scenario in the context of chromatin.

Nucleosomes consists of histone octamer : H2A, H2B, H3 and H4. 147 bp of DNA helix wraps around histone octamer. Successive nucleosomes are linked by DNA in the range of ~ 30 bp, commonly, to sometimes 90 bp depending on the genomic region. The scenario depicted above hypothetically considers 30 bp linker DNA. For details see discussion. Model not to scale.

The first step of NHEJ is recognition of DSB ends by Ku70/80 heterodimer. Ku then interacts with DNA-PKcs to form the DNA-PK complex (Figure 4-20). DNA-PK then undergoes an autophosphorylation mediated conformational change. Autophosphorylation of DNA-PKcs leads to its dissociation from the DSB site. DNA- PKcs also recruits Artemis to the DSB site and activates its endonuclease activity, if required. Finally, Ku recruits XLF, XRCC4-ligaseIV complex ligate the DSB ends. Deletion of the Ku80 CTR leads to incomplete activation of DNA-PKcs kinase activity.

146

An interesting finding of this study is the potential role of the DNA structure itself along with the Ku80 C-terminal in activating DNA-PKcs kinase activity.

Figure 4-20 Ku80 C-terminal deletion leads to a defect in DNA-PKcs interaction and kinase activity, with an important role for DNA structure.

The diagram above depicts the current working model with respect to the role of Ku80 CTR in NHEJ. Ku is the central molecule in NHEJ, as it recognizes

147

the DSB ends and activate DNA-PKcs kinase activity. This step is important, as DNA-PKcs autophosphorylation is required for downstream processes such as Artemis endonuclease activity. My studies indicate an important role for Ku80 CTR in the activation of DNA-PKcs kinase activity and the DNA structure itself could be an important factor in this process. Role of Ku80 CTR in end processing and DSB ligation remains to be investigated thoroughly.

148

Chapter Five: Conclusions and Future Directions

149

The aim of my PhD thesis was to characterize DNA-PKcs interacting protein/s and understand the function of Ku80 CTR in NHEJ. In my first aim, I used immunoprecipitation against DNA-PKcs antibodies to detect any novel DNA-PKcs interacting partners. I first tried to determine the interaction between PP1 and DNA- PKcs and found no conclusive evidence for this interaction. Next I tried to determine the interaction between PP2A and DNA-PKcs. Initial results were encouraging; however, control experiments revealed that this interaction was non-specific and that PP2A was interacting with DNA-PKcs antibody itself. I then tried to validate the co- immunoprecipitation followed by mass spectrometry screen, performed to identify DNA- PKcs interacting proteins. However, I could not detect any novel DNA-PKcs interacting proteins. In my second aim, using clonogenic cell survival assays, I determined that xrs6 cells expressing Ku80 with C-terminal truncation are highly radiosensitive and are sensitive to other DSB inducing agents such as neocarzinostatin, and showed intermediate sensitivity to doxorubicin. However, in comparison, xrs6 Ku null cells were highly sensitive to all DSB inducing agents tested. This suggested that the deletion of Ku80 CTR does not lead to a complete defect in NHEJ. To better understand the mechanism behind this observation I cloned, expressed and purified Ku heterodimer from insect cells using baculovirus. I then conducted biochemical experiments using CT-DNA and defined DNA oligonucleotides to determine the ability of Ku80 CTR truncation mutant to support DNA-PKcs kinase activity, autophosphorylation and interaction. To my surprise, I observed two different results; in the case of CT-DNA I did not observe complete abrogation of DNA-PKcs kinase activity. Whereas using 25 bp blunt dsDNA ends I observed inability of Ku mutant heterodimer to support DNA-PKcs kinase activity. Similar results were observed with 25 bp dsDNA with a 15 nucleotide 3’- or 5’ overhang. The other surprising result was the ability of Ku LH mutant (lacking extreme C-terminal 14 amino acid residue) to activate DNA-PKcs kinase activity, but inability to interact with DNA-PKcs. The data obtained from my studies suggest an important role for Ku80 CTR using 25 bp blunt or overhang dsDNA structures.

150

There are some important questions that need to be addressed immediately and in the long term with respect to the role of the Ku80 CTR in NHEJ. The most important role of Ku in NHEJ is to recognize and bind DSB DNA ends. It is imperative to determine whether the deletion of Ku80 CTR affects its DNA binding affinity in any way. Data from EMSA analysis suggests that’s not to be the case, as both Ku wild type and mutants, bound the FAM labelled DNA. However, EMSA only provides a snapshot of DNA- protein interaction at any given time. To determine this interaction in real time, a label free technique such as surface plasmon resonance (SPR) needs to be performed to get quantitative data about association-, dissociation rates and binding constants, and the

KD for Ku-DNA interaction using 25 bp blunt dsDNA structure. Ku wild type has been shown to associate with dsDNA structures longer than 18 bp with strong affinity and dissociate very slowly. This suggests a strong possibility that in cells Ku bind the DSB with high affinity and protects them from nuclease digestion. This has been supported experimentally by in vitro studies using purified protein. Studies showed that Ku protects dsDNA from nucleolytic digestion by both Mre11 and Exo1 (Sun, Lee et al. 2012). It would be interesting to determine the association and dissociation rates of Ku mutant on 25 bp blunt dsDNA using SPR. This study is already in progress in collaboration with Mr. George Korza at the University of Connecticut, USA. The importance of dissociation rate of Ku mutants could be tested in vitro as mentioned above. For example, it is possible to perform experiments to test mutant Ku ability to protect DSB ends from digestion by Exo1 nuclease using labelled DNA structure. Another study that’s been planned, utilizing SPR, is to determine the interaction between DNA-PKcs and the Ku-DNA complex using 25 bp blunt or overhang dsDNA structures. As can be recalled from the biotin pull down experiments, Ku80 CTR mutants showed no interaction with DNA-PKcs using 25 bp blunt dsDNA but interacted weakly with 25 bp, 3’ or 5’ overhang dsDNA structures. This suggests the possibility that the Ku80 CTR might be stabilizing DNA-PKcs over blunt DNA more efficiently than on DNA structures with overhangs. It has been observed previously that DNA-PKcs alone, show higher activity with dsDNA with 3’ or 5’ overhangs (Hammarsten, DeFazio et al. 2000, Martensson and Hammarsten 2002). It was suggested that there is a region in

151

DNA-PKcs which might be binding the dsDNA with overhangs efficiently. However these studies were conducted with no salt and in absence of Ku. It is possible that under physiological salt concentration, Ku80 CTR is mimicking the DNA strands and stabilizing the DNA-PKcs on to the blunt DNA structures. This has been supported by bioinformatics analysis that the Ku80 CTR has several negatively charged amino acid residues (Fig.5.1). And experimentally by the observation that substitution of these negatively charged residues with alanine was enough to abrogate the DNA-PKcs kinase activation (Falck, Coates et al. 2005).

Figure 5-1 Schematic depicting the possible role of the Ku80 CTR in the activation of DNA-PKcs kinase activity by dsDNA with blunt end structure.

Right: Ku heterodimer bound to the blunt ended dsDNA (Red is Ku80, orange is Ku70, blue indicates the Ku80 CTR). Left: Model of DNA-PKcs kinase activation by DNA ends as discussed in (Hammarsten, DeFazio et al. 2000).

Also, in line with this prediction, the negatively charged amino acids in Ku80 CTR are probably interacting with the positively charged region/s in DNA-PKcs. Mapping the region of Ku80 CTR interaction site within DNA-PKcs is another key question. These hypothesis needs to be tested and verified experimentally. We are in the process of performing experiments to determine the affinity of DNA-PKcs towards 25 bp blunt ended dsDNA bound Ku using SPR. Subsequently, we intend to extend these studies to cover different DNA structures such as 3’- or 5’ overhang dsDNA.

152

As mentioned above, using CT-DNA, even the deletion of entire Ku80 CTR did not abolish DNA-PKcs activity but reduced it by ~30%. Whereas in presence of 25 bp ds DNA structure, Ku80 CTR deletion mutant was unable to activate DNA-PKcs kinase activity. The question then is how to reconcile these two observation. In future, I plan to use longer DNA structures such as 35 bp or 45 bp dsDNA and determine their ability to activate DNA-PKcs kinase activity in presence of Ku80 CTR mutants. Both DNA-PKcs autophosphorylation assays, using phosphospecific antibodies, and p53 peptide substrate assays need to be performed. These studies can be extended to study the ability of DNA-PKcs to activate Artemis endonuclease using various structures such as 5’- or 3’ overhang or hairpin ended DNA in presence of Ku80 CTR deletion mutants. Previous studies have demonstrated that an autophosphorylation induced conformational change in DNA-PKcs structure is required to activate Artemis endonuclease activation (Goodarzi, Yu et al. 2006). It would be interesting to determine whether Ku70/80 lacking the extreme C-terminal 14 amino acids can activate Artemis endonuclease activity. The reason being that this mutant was able to activate DNA-PKcs kinase activity under all conditions tested, but was found to be defective in terms of interacting with DNA-PKcs. It could be tested that whether the structural change induced by DNA-PKcs autophosphorylation is different than the one induced by Ku80 extreme C-terminal 14 amino acids. Are these two events mutually exclusive or interdependent? Ku has been suggested to play a role in DNA DSB end synapsis by studies conducted using atomic force microscopy (Cary, Peterson et al. 1997, Pang, Yoo et al. 1997). Also another study using chemical cross-linking suggested the possibility that the Ku80 CTR is capable of forming dimer and higher order structures. These studies can be performed using purified Ku mutant heterodimers and their ability to mediate DNA end synapsis characterized. AFM was also used to show that Ku is capable of moving along DNA molecule, as Ku was found in internal regions on longer pieces of DNA. It will be important to determine how this property is affected by truncation of Ku80 CTR and also what is the significance (Fig. 5.2)? In light of new data suggesting XRCC4 and XLF filament formation in cells, leads to the question what becomes of Ku at the DSB

153

site (Reid, Keegan et al. 2015). We know from previous studies that the Ku80 CTR is dispensable for interaction with XRCC4 (Costantini, Woodbine et al. 2007) and XLF (Yano, Morotomi-Yano et al. 2011). But it’s not clear where the Ku80 CTR fits in in the XRCC4/XLF filament model. As discussed before, Ku is required for the recruitment of both XRCC4 and XLF, but we do not know whether it dissociates from the DNA ends once they are recruited, stays at the ends or moves inwards to make space for these proteins to bind. Also, what role, if any, does Ku80 CTR have in the XRCC4, XLF filament formation? Also, it needs to be determined whether Ku80 CTR has any role in mediating the interaction and recruitment of newly identified NHEJ factor, PAXX.

Figure 5-2 Schematic depicting the Ku heterodimer bound to a DSB in the presence of XRCC4 and XLF filaments.

A) In this scenario, XRCC4, XLF filaments bridge DSB ends over Ku heterodimer. In B) XRCC4, XLF filaments bridge DSB ends, with Ku translocating inwards on the DNA. Where Ku80 CTR fits in these two models remains to be determined.

Another aspect of NHEJ which is very intriguing is the speed with which the majority of DSBs are repaired in cells, considering the enormous 3 billion base pairs of the human genome. It has been shown that upon irradiation of cells, more than half of all DSBs induced are repaired within 2hrs in G1 phase cells (Goodarzi, Noon et al. 2008). What is the speed of NHEJ in cells expressing Ku80 CTR truncation? This hypothesis could be tested by knocking out Ku in human fibroblasts using CRISPR /Cas technique (Cong, Ran et al. 2013) and then generating stable cell lines expressing Ku80 CTR

154

truncation. We could then grow these cells and arrest them in G0/G1 phase by serum starvation or contact inhibition, in the case of fibroblasts. We could then irradiate the cells, and observe the γH2AX foci at several different time points such 0, 30 min., 2 hrs, 8 hrs, 12 hrs and 24 hrs and compare the number of foci and the kinetics of foci disappearance in cells expressing full length Ku80 or Ku80 CTR truncation. However, a major complication is the lack of human cells defective in Ku expression and also the inability to knockout Ku in existing human cell lines. It has been shown previously that the knockout of Ku in human cells leads to cellular lethality possibility due to telomere defects (Li, Nelsen et al. 2002, Wang, Ghosh et al. 2009). A potential way to overcome this problem is, instead of generating a Ku knockout and then trying to add back Ku80 CTR, using CRISPR to knock in a stop codon near the Ku80 C-terminal. Once generated, this model system could be a very useful tool to understand the function of the Ku80 C-terminal, not just in DSB repair but other cellular functions as well (Fig.1.6). Current systems of using hamster cells expressing the Ku80 CTR truncation has limitations such as their lower doubling time due to which a high percentage of hamster cells are in S and G2 phase (Fig. 4.4). Also, all my efforts to synchronize the hamster cells in G1 phase were futile as they died upon reaching full confluency or withdrawal of serum. Last, but certainly not the least, is how Ku80 C-terminal truncation affects its other cellular functions. As mentioned previously, Ku heterodimer is a highly abundant protein in cells and it has several different functions. One particular function that needs to be tested is, whether or not Ku80 CTR truncation affects its role in telomere biology. For all its function in DSB repair, knockout of Ku in human somatic cells leads to cell death due to telomeric defects (Wang, Ghosh et al. 2009). It is possible to test this system by generating TRF2-/-, Ku80-/- knockout mouse cells. Knockout of TRF2-/- has been shown to cause telomeric fusion (Okamoto, Bartocci et al. 2013), which is mediated by Ku dependent NHEJ (Deng, Guo et al. 2009). As a first step we could add back Ku full length or Ku80 CTR truncation into these cells and determine the telomere fusion events in each cells.

155

The Ku heterodimer plays a central role in NHEJ, by sensing the DSB ends and activating the DNA-PKcs kinase activity. It has been a long-standing question as to how exactly Ku perform this function as these two proteins only associate in presence of DNA. But what is clear is that inhibition of DNA-PKcs kinase activity has been shown to adversely affect DSB repair in cells (Kurimasa, Kumano et al. 1999). Based on this, clinical trials are being conducted with the DNA-PKcs kinase inhibitor to treat cancer patients (Davidson, Amrein et al. 2013). At the same time recent studies suggesting Ku independent activation of DNA-PKcs in mitosis are emerging. This is an active area of investigation, of our lab and several others (Jette and Lees-Miller 2015). This raises the question, would it be prudent to design a DNA-PKcs inhibitor which inhibits all its function including in mitosis. If so, would it not cause harmful side effects in cancer patients? After all a major challenge in cancer treatment is to reduce harmful side effects. It becomes important for us to understand the mechanism of activation of DNA- PKcs in both these pathways separately. If possible, design inhibitors which specifically inhibits DNA-PKcs kinase activity in DSB repair, leaving its function in mitosis untouched. It is easier said than done, but that’s the challenge that needs to be overcome in order to treat the cancer patients successfully with a better quality of life.

156

References Ahel, I., U. Rass, S. F. El-Khamisy, S. Katyal, P. M. Clements, P. J. McKinnon, K. W. Caldecott and S. C. West (2006). "The neurodegenerative disease protein aprataxin resolves abortive DNA ligation intermediates." Nature 443(7112): 713-716. Ahnesorg, P., P. Smith and S. P. Jackson (2006). "XLF interacts with the XRCC4-DNA ligase IV complex to promote DNA nonhomologous end-joining." Cell 124(2): 301-313. Allen, P. B., Y. G. Kwon, A. C. Nairn and P. Greengard (1998). "Isolation and characterization of PNUTS, a putative protein phosphatase 1 nuclear targeting subunit." J Biol Chem 273(7): 4089-4095. Alonso, A., J. Sasin, N. Bottini, I. Friedberg, I. Friedberg, A. Osterman, A. Godzik, T. Hunter, J. Dixon and T. Mustelin (2004). "Protein tyrosine phosphatases in the human genome." Cell 117(6): 699-711. Andres, S. N., M. Modesti, C. J. Tsai, G. Chu and M. S. Junop (2007). "Crystal structure of human XLF: a twist in nonhomologous DNA end-joining." Mol Cell 28(6): 1093-1101. Andres, S. N., A. Vergnes, D. Ristic, C. Wyman, M. Modesti and M. Junop (2012). "A human XRCC4-XLF complex bridges DNA." Nucleic Acids Res 40(4): 1868-1878. Aravind, L. and E. V. Koonin (2000). "SAP - a putative DNA-binding motif involved in chromosomal organization." Trends Biochem Sci 25(3): 112-114. Arosio, D., S. Cui, C. Ortega, M. Chovanec, S. Di Marco, G. Baldini, A. Falaschi and A. Vindigni (2002). "Studies on the mode of Ku interaction with DNA." J Biol Chem 277(12): 9741-9748. Baharians, Z. and A. H. Schonthal (1998). "Autoregulation of protein phosphatase type 2A expression." J Biol Chem 273(30): 19019-19024. Baretic, D. and R. L. Williams (2014). "PIKKs--the solenoid nest where partners and kinases meet." Curr Opin Struct Biol 29: 134-142. Bekker-Jensen, S., C. Lukas, R. Kitagawa, F. Melander, M. B. Kastan, J. Bartek and J. Lukas (2006). "Spatial organization of the mammalian genome surveillance machinery in response to DNA strand breaks." J Cell Biol 173(2): 195-206. Belkina, A. C. and G. V. Denis (2012). "BET domain co-regulators in obesity, inflammation and cancer." Nat Rev Cancer 12(7): 465-477. Benedict, C. L., S. Gilfillan, T. H. Thai and J. F. Kearney (2000). "Terminal deoxynucleotidyl transferase and repertoire development." Immunol Rev 175: 150-157. Bennardo, N., A. Cheng, N. Huang and J. M. Stark (2008). "Alternative-NHEJ is a mechanistically distinct pathway of mammalian chromosome break repair." PLoS Genet 4(6): e1000110. Bennett, S. M., D. S. Woods, K. S. Pawelczak and J. J. Turchi (2012). "Multiple protein- protein interactions within the DNA-PK complex are mediated by the C-terminus of Ku 80." Int J Biochem Mol Biol 3(1): 36-45. Bertocci, B., A. De Smet, J. C. Weill and C. A. Reynaud (2006). "Nonoverlapping functions of DNA polymerases mu, lambda, and terminal deoxynucleotidyltransferase during immunoglobulin V(D)J recombination in vivo." Immunity 25(1): 31-41. Beucher, A., J. Birraux, L. Tchouandong, O. Barton, A. Shibata, S. Conrad, A. A. Goodarzi, A. Krempler, P. A. Jeggo and M. Lobrich (2009). "ATM and Artemis promote

157

homologous recombination of radiation-induced DNA double-strand breaks in G2." EMBO J 28(21): 3413-3427. Beullens, M., A. Van Eynde, V. Vulsteke, J. Connor, S. Shenolikar, W. Stalmans and M. Bollen (1999). "Molecular determinants of nuclear protein phosphatase-1 regulation by NIPP-1." J Biol Chem 274(20): 14053-14061. Blanchetot, C., M. Chagnon, N. Dube, M. Halle and M. L. Tremblay (2005). "Substrate- trapping techniques in the identification of cellular PTP targets." Methods 35(1): 44-53. Blier, P. R., A. J. Griffith, J. Craft and J. A. Hardin (1993). "Binding of Ku protein to DNA. Measurement of affinity for ends and demonstration of binding to nicks." J Biol Chem 268(10): 7594-7601. Bliss, T. M. and D. P. Lane (1997). "Ku selectively transfers between DNA molecules with homologous ends." J Biol Chem 272(9): 5765-5773. Block, W. D., Y. Yu, D. Merkle, J. L. Gifford, Q. Ding, K. Meek and S. P. Lees-Miller (2004). "Autophosphorylation-dependent remodeling of the DNA-dependent protein kinase catalytic subunit regulates ligation of DNA ends." Nucleic Acids Res 32(14): 4351-4357. Boboila, C., M. Jankovic, C. T. Yan, J. H. Wang, D. R. Wesemann, T. Zhang, A. Fazeli, L. Feldman, A. Nussenzweig, M. Nussenzweig and F. W. Alt (2010). "Alternative end- joining catalyzes robust IgH locus deletions and translocations in the combined absence of ligase 4 and Ku70." Proc Natl Acad Sci U S A 107(7): 3034-3039. Bollen, M., W. Peti, M. J. Ragusa and M. Beullens (2010). "The extended PP1 toolkit: designed to create specificity." Trends Biochem Sci 35(8): 450-458. Boulton, S. J. and S. P. Jackson (1996). "Identification of a Saccharomyces cerevisiae Ku80 homologue: roles in DNA double strand break rejoining and in telomeric maintenance." Nucleic Acids Res 24(23): 4639-4648. Branzei, D. and M. Foiani (2010). "Maintaining genome stability at the replication fork." Nat Rev Mol Cell Biol 11(3): 208-219. Brewerton, S. C., A. S. Dore, A. C. Drake, K. K. Leuther and T. L. Blundell (2004). "Structural analysis of DNA-PKcs: modelling of the repeat units and insights into the detailed molecular architecture." J Struct Biol 145(3): 295-306. Britton, S., J. Coates and S. P. Jackson (2013). "A new method for high-resolution imaging of Ku foci to decipher mechanisms of DNA double-strand break repair." J Cell Biol 202(3): 579-595. Brown, J. S., N. Lukashchuk, M. Sczaniecka-Clift, S. Britton, C. le Sage, P. Calsou, P. Beli, Y. Galanty and S. P. Jackson (2015). "Neddylation promotes ubiquitylation and release of Ku from DNA-damage sites." Cell Rep 11(5): 704-714. Bryans, M., M. C. Valenzano and T. D. Stamato (1999). "Absence of DNA ligase IV protein in XR-1 cells: evidence for stabilization by XRCC4." Mutat Res 433(1): 53-58. Buck, D., L. Malivert, R. de Chasseval, A. Barraud, M. C. Fondaneche, O. Sanal, A. Plebani, J. L. Stephan, M. Hufnagel, F. le Deist, A. Fischer, A. Durandy, J. P. de Villartay and P. Revy (2006). "Cernunnos, a novel nonhomologous end-joining factor, is mutated in human immunodeficiency with microcephaly." Cell 124(2): 287-299. Cantagrel, V., A. M. Lossi, S. Lisgo, C. Missirian, A. Borges, N. Philip, C. Fernandez, C. Cardoso, D. Figarella-Branger, A. Moncla, S. Lindsay, W. B. Dobyns and L. Villard

158

(2007). "Truncation of NHEJ1 in a patient with polymicrogyria." Hum Mutat 28(4): 356- 364. Carter, T., I. Vancurova, I. Sun, W. Lou and S. DeLeon (1990). "A DNA-activated protein kinase from HeLa cell nuclei." Mol Cell Biol 10(12): 6460-6471. Carter, T. H., C. R. Kopman and C. B. James (1988). "DNA-stimulated protein phosphorylation in HeLa whole cell and nuclear extracts." Biochem Biophys Res Commun 157(2): 535-540. Cary, R. B., S. R. Peterson, J. Wang, D. G. Bear, E. M. Bradbury and D. J. Chen (1997). "DNA looping by Ku and the DNA-dependent protein kinase." Proc Natl Acad Sci U S A 94(9): 4267-4272. Castello, A., B. Fischer, K. Eichelbaum, R. Horos, B. M. Beckmann, C. Strein, N. E. Davey, D. T. Humphreys, T. Preiss, L. M. Steinmetz, J. Krijgsveld and M. W. Hentze (2012). "Insights into RNA biology from an atlas of mammalian mRNA-binding proteins." Cell 149(6): 1393-1406. Chai, W., L. P. Ford, L. Lenertz, W. E. Wright and J. W. Shay (2002). "Human Ku70/80 associates physically with telomerase through interaction with hTERT." J Biol Chem 277(49): 47242-47247. Chan, D. W., B. P. Chen, S. Prithivirajsingh, A. Kurimasa, M. D. Story, J. Qin and D. J. Chen (2002). "Autophosphorylation of the DNA-dependent protein kinase catalytic subunit is required for rejoining of DNA double-strand breaks." Genes Dev 16(18): 2333-2338. Chan, D. W. and S. P. Lees-Miller (1996). "The DNA-dependent protein kinase is inactivated by autophosphorylation of the catalytic subunit." J Biol Chem 271(15): 8936- 8941. Chan, D. W., C. H. Mody, N. S. Ting and S. P. Lees-Miller (1996). "Purification and characterization of the double-stranded DNA-activated protein kinase, DNA-PK, from human placenta." Biochem Cell Biol 74(1): 67-73. Chan, D. W., R. Ye, C. J. Veillette and S. P. Lees-Miller (1999). "DNA-dependent protein kinase phosphorylation sites in Ku 70/80 heterodimer." Biochemistry 38(6): 1819-1828. Chen, B. P., N. Uematsu, J. Kobayashi, Y. Lerenthal, A. Krempler, H. Yajima, M. Lobrich, Y. Shiloh and D. J. Chen (2007). "Ataxia telangiectasia mutated (ATM) is essential for DNA-PKcs phosphorylations at the Thr-2609 cluster upon DNA double strand break." J Biol Chem 282(9): 6582-6587. Chen, J., B. L. Martin and D. L. Brautigan (1992). "Regulation of protein serine- threonine phosphatase type-2A by tyrosine phosphorylation." Science 257(5074): 1261- 1264. Chiu, C. Y., R. B. Cary, D. J. Chen, S. R. Peterson and P. L. Stewart (1998). "Cryo-EM imaging of the catalytic subunit of the DNA-dependent protein kinase." J Mol Biol 284(4): 1075-1081. Cho, U. S. and W. Xu (2007). "Crystal structure of a protein phosphatase 2A heterotrimeric holoenzyme." Nature 445(7123): 53-57. Chowdhury, D., M. C. Keogh, H. Ishii, C. L. Peterson, S. Buratowski and J. Lieberman (2005). "gamma-H2AX dephosphorylation by protein phosphatase 2A facilitates DNA double-strand break repair." Mol Cell 20(5): 801-809.

159

Ciccia, A. and S. J. Elledge (2010). "The DNA damage response: making it safe to play with knives." Mol Cell 40(2): 179-204. Clements, P. M., C. Breslin, E. D. Deeks, P. J. Byrd, L. Ju, P. Bieganowski, C. Brenner, M. C. Moreira, A. M. Taylor and K. W. Caldecott (2004). "The ataxia-oculomotor apraxia 1 gene product has a role distinct from ATM and interacts with the DNA strand break repair proteins XRCC1 and XRCC4." DNA Repair (Amst) 3(11): 1493-1502. Cohen, H. Y., S. Lavu, K. J. Bitterman, B. Hekking, T. A. Imahiyerobo, C. Miller, R. Frye, H. Ploegh, B. M. Kessler and D. A. Sinclair (2004). "Acetylation of the C terminus of Ku70 by CBP and PCAF controls Bax-mediated apoptosis." Mol Cell 13(5): 627-638. Cohen, P. (1989). "The structure and regulation of protein phosphatases." Annu Rev Biochem 58: 453-508. Cong, L., F. A. Ran, D. Cox, S. Lin, R. Barretto, N. Habib, P. D. Hsu, X. Wu, W. Jiang, L. A. Marraffini and F. Zhang (2013). "Multiplex genome engineering using CRISPR/Cas systems." Science 339(6121): 819-823. Cooper, M. P., A. Machwe, D. K. Orren, R. M. Brosh, D. Ramsden and V. A. Bohr (2000). "Ku complex interacts with and stimulates the Werner protein." Genes Dev 14(8): 907-912. Costantini, S., L. Woodbine, L. Andreoli, P. A. Jeggo and A. Vindigni (2007). "Interaction of the Ku heterodimer with the DNA ligase IV/Xrcc4 complex and its regulation by DNA- PK." DNA Repair (Amst) 6(6): 712-722. Craxton, A., J. Somers, D. Munnur, R. Jukes-Jones, K. Cain and M. Malewicz (2015). "XLS (c9orf142) is a new component of mammalian DNA double-stranded break repair." Cell Death Differ 22(6): 890-897. Critchlow, S. E., R. P. Bowater and S. P. Jackson (1997). "Mammalian DNA double- strand break repair protein XRCC4 interacts with DNA ligase IV." Curr Biol 7(8): 588- 598. Cui, X., Y. Yu, S. Gupta, Y. M. Cho, S. P. Lees-Miller and K. Meek (2005). "Autophosphorylation of DNA-dependent protein kinase regulates DNA end processing and may also alter double-strand break repair pathway choice." Mol Cell Biol 25(24): 10842-10852. d'Adda di Fagagna, F., M. P. Hande, W. M. Tong, D. Roth, P. M. Lansdorp, Z. Q. Wang and S. P. Jackson (2001). "Effects of DNA nonhomologous end-joining factors on telomere length and chromosomal stability in mammalian cells." Curr Biol 11(15): 1192- 1196. Daley, J. M., R. L. Laan, A. Suresh and T. E. Wilson (2005). "DNA joint dependence of pol X family polymerase action in nonhomologous end joining." J Biol Chem 280(32): 29030-29037. Davidson, D., L. Amrein, L. Panasci and R. Aloyz (2013). "Small Molecules, Inhibitors of DNA-PK, Targeting DNA Repair, and Beyond." Front Pharmacol 4: 5. Davis, A. J., K. J. Lee and D. J. Chen (2013). "The N-terminal region of the DNA- dependent protein kinase catalytic subunit is required for its DNA double-stranded break-mediated activation." J Biol Chem 288(10): 7037-7046. De Bont, R. and N. van Larebeke (2004). "Endogenous DNA damage in humans: a review of quantitative data." Mutagenesis 19(3): 169-185.

160

De Ioannes, P., S. Malu, P. Cortes and A. K. Aggarwal (2012). "Structural basis of DNA ligase IV-Artemis interaction in nonhomologous end-joining." Cell Rep 2(6): 1505-1512. de Vries, E., W. van Driel, W. G. Bergsma, A. C. Arnberg and P. C. van der Vliet (1989). "HeLa nuclear protein recognizing DNA termini and translocating on DNA forming a regular DNA-multimeric protein complex." J Mol Biol 208(1): 65-78. Dedon, P. C. and I. H. Goldberg (1992). "Influence of thiol structure on neocarzinostatin activation and expression of DNA damage." Biochemistry 31(7): 1909-1917. DeFazio, L. G., R. M. Stansel, J. D. Griffith and G. Chu (2002). "Synapsis of DNA ends by DNA-dependent protein kinase." EMBO J 21(12): 3192-3200. Deng, Y., X. Guo, D. O. Ferguson and S. Chang (2009). "Multiple roles for MRE11 at uncapped telomeres." Nature 460(7257): 914-918. Difilippantonio, M. J., J. Zhu, H. T. Chen, E. Meffre, M. C. Nussenzweig, E. E. Max, T. Ried and A. Nussenzweig (2000). "DNA repair protein Ku80 suppresses chromosomal aberrations and malignant transformation." Nature 404(6777): 510-514. Ding, Q., Y. V. Reddy, W. Wang, T. Woods, P. Douglas, D. A. Ramsden, S. P. Lees- Miller and K. Meek (2003). "Autophosphorylation of the catalytic subunit of the DNA- dependent protein kinase is required for efficient end processing during DNA double- strand break repair." Mol Cell Biol 23(16): 5836-5848. Dobbs, T. A., J. A. Tainer and S. P. Lees-Miller (2010). "A structural model for regulation of NHEJ by DNA-PKcs autophosphorylation." DNA Repair (Amst) 9(12): 1307-1314. Dohoney, K. M., C. Guillerm, C. Whiteford, C. Elbi, P. F. Lambert, G. L. Hager and J. N. Brady (2004). "Phosphorylation of p53 at serine 37 is important for transcriptional activity and regulation in response to DNA damage." Oncogene 23(1): 49-57. Doksani, Y. and T. de Lange (2014). "The role of double-strand break repair pathways at functional and dysfunctional telomeres." Cold Spring Harb Perspect Biol 6(12): a016576. Douglas, P., X. Cui, W. D. Block, Y. Yu, S. Gupta, Q. Ding, R. Ye, N. Morrice, S. P. Lees-Miller and K. Meek (2007). "The DNA-dependent protein kinase catalytic subunit is phosphorylated in vivo on threonine 3950, a highly conserved amino acid in the protein kinase domain." Mol Cell Biol 27(5): 1581-1591. Douglas, P., S. Gupta, N. Morrice, K. Meek and S. P. Lees-Miller (2005). "DNA-PK- dependent phosphorylation of Ku70/80 is not required for non-homologous end joining." DNA Repair (Amst) 4(9): 1006-1018. Douglas, P., G. B. Moorhead, R. Ye and S. P. Lees-Miller (2001). "Protein phosphatases regulate DNA-dependent protein kinase activity." J Biol Chem 276(22): 18992-18998. Douglas, P., G. P. Sapkota, N. Morrice, Y. Yu, A. A. Goodarzi, D. Merkle, K. Meek, D. R. Alessi and S. P. Lees-Miller (2002). "Identification of in vitro and in vivo phosphorylation sites in the catalytic subunit of the DNA-dependent protein kinase." Biochem J 368(Pt 1): 243-251. Douglas, P., R. Ye, L. Trinkle-Mulcahy, J. A. Neal, V. De Wever, N. A. Morrice, K. Meek and S. P. Lees-Miller (2014). "Polo-like kinase 1 (PLK1) and protein phosphatase 6 (PP6) regulate DNA-dependent protein kinase catalytic subunit (DNA-PKcs) phosphorylation in mitosis." Biosci Rep 34(3).

161

Douglas, P., J. Zhong, R. Ye, G. B. Moorhead, X. Xu and S. P. Lees-Miller (2010). "Protein phosphatase 6 interacts with the DNA-dependent protein kinase catalytic subunit and dephosphorylates gamma-H2AX." Mol Cell Biol 30(6): 1368-1381. Downs, J. A. and S. P. Jackson (2004). "A means to a DNA end: the many roles of Ku." Nat Rev Mol Cell Biol 5(5): 367-378. Drouet, J., C. Delteil, J. Lefrancois, P. Concannon, B. Salles and P. Calsou (2005). "DNA-dependent protein kinase and XRCC4-DNA ligase IV mobilization in the cell in response to DNA double strand breaks." J Biol Chem 280(8): 7060-7069. Drouet, J., P. Frit, C. Delteil, J. P. de Villartay, B. Salles and P. Calsou (2006). "Interplay between Ku, Artemis, and the DNA-dependent protein kinase catalytic subunit at DNA ends." J Biol Chem 281(38): 27784-27793. Dudley, D. D., J. Chaudhuri, C. H. Bassing and F. W. Alt (2005). "Mechanism and control of V(D)J recombination versus class switch recombination: similarities and differences." Adv Immunol 86: 43-112. Dueva, R. and G. Iliakis (2013). "Alternative pathways of non-homologous end joining (NHEJ) in genomic instability and cancer." Translational Cancer Research 2(3): 163- 177. Dvir, A., S. R. Peterson, M. W. Knuth, H. Lu and W. S. Dynan (1992). "Ku autoantigen is the regulatory component of a template-associated protein kinase that phosphorylates RNA polymerase II." Proc Natl Acad Sci U S A 89(24): 11920-11924. Dvir, A., L. Y. Stein, B. L. Calore and W. S. Dynan (1993). "Purification and characterization of a template-associated protein kinase that phosphorylates RNA polymerase II." J Biol Chem 268(14): 10440-10447. Dynan, W. S. and S. Yoo (1998). "Interaction of Ku protein and DNA-dependent protein kinase catalytic subunit with nucleic acids." Nucleic Acids Res 26(7): 1551-1559. Eichhorn, P. J., M. P. Creyghton and R. Bernards (2009). "Protein phosphatase 2A regulatory subunits and cancer." Biochim Biophys Acta 1795(1): 1-15. Ellenberger, T. and A. E. Tomkinson (2008). "Eukaryotic DNA ligases: structural and functional insights." Annu Rev Biochem 77: 313-338. Espejel, S., S. Franco, S. Rodriguez-Perales, S. D. Bouffler, J. C. Cigudosa and M. A. Blasco (2002). "Mammalian Ku86 mediates chromosomal fusions and apoptosis caused by critically short telomeres." EMBO J 21(9): 2207-2219. Falck, J., J. Coates and S. P. Jackson (2005). "Conserved modes of recruitment of ATM, ATR and DNA-PKcs to sites of DNA damage." Nature 434(7033): 605-611. Fell, V. L. and C. Schild-Poulter (2015). "The Ku heterodimer: function in DNA repair and beyond." Mutat Res Rev Mutat Res 763: 15-29. Feng, J., T. Wakeman, S. Yong, X. Wu, S. Kornbluth and X. F. Wang (2009). "Protein phosphatase 2A-dependent dephosphorylation of replication protein A is required for the repair of DNA breaks induced by replication stress." Mol Cell Biol 29(21): 5696- 5709. Feng, L. and J. Chen (2012). "The E3 ligase RNF8 regulates KU80 removal and NHEJ repair." Nat Struct Mol Biol 19(2): 201-206. Finnie, N. J., T. M. Gottlieb, T. Blunt, P. A. Jeggo and S. P. Jackson (1995). "DNA- dependent protein kinase activity is absent in xrs-6 cells: implications for site-specific

162

recombination and DNA double-strand break repair." Proc Natl Acad Sci U S A 92(1): 320-324. Fisher, T. S., A. K. Taggart and V. A. Zakian (2004). "Cell cycle-dependent regulation of yeast telomerase by Ku." Nat Struct Mol Biol 11(12): 1198-1205. Floyd, S. R., M. E. Pacold, Q. Huang, S. M. Clarke, F. C. Lam, I. G. Cannell, B. D. Bryson, J. Rameseder, M. J. Lee, E. J. Blake, A. Fydrych, R. Ho, B. A. Greenberger, G. C. Chen, A. Maffa, A. M. Del Rosario, D. E. Root, A. E. Carpenter, W. C. Hahn, D. M. Sabatini, C. C. Chen, F. M. White, J. E. Bradner and M. B. Yaffe (2013). "The bromodomain protein Brd4 insulates chromatin from DNA damage signalling." Nature 498(7453): 246-250. Frank, K. M., J. M. Sekiguchi, K. J. Seidl, W. Swat, G. A. Rathbun, H. L. Cheng, L. Davidson, L. Kangaloo and F. W. Alt (1998). "Late embryonic lethality and impaired V(D)J recombination in mice lacking DNA ligase IV." Nature 396(6707): 173-177. Frank, K. M., N. E. Sharpless, Y. Gao, J. M. Sekiguchi, D. O. Ferguson, C. Zhu, J. P. Manis, J. Horner, R. A. DePinho and F. W. Alt (2000). "DNA ligase IV deficiency in mice leads to defective neurogenesis and embryonic lethality via the p53 pathway." Mol Cell 5(6): 993-1002. French, C. A., C. L. Ramirez, J. Kolmakova, T. T. Hickman, M. J. Cameron, M. E. Thyne, J. L. Kutok, J. A. Toretsky, A. K. Tadavarthy, U. R. Kees, J. A. Fletcher and J. C. Aster (2008). "BRD-NUT oncoproteins: a family of closely related nuclear proteins that block epithelial differentiation and maintain the growth of carcinoma cells." Oncogene 27(15): 2237-2242. Gao, Y., J. Chaudhuri, C. Zhu, L. Davidson, D. T. Weaver and F. W. Alt (1998). "A targeted DNA-PKcs-null mutation reveals DNA-PK-independent functions for KU in V(D)J recombination." Immunity 9(3): 367-376. Garcia-Diaz, M., K. Bebenek, J. M. Krahn, L. Blanco, T. A. Kunkel and L. C. Pedersen (2004). "A structural solution for the DNA polymerase lambda-dependent repair of DNA gaps with minimal homology." Mol Cell 13(4): 561-572. Gell, D. and S. P. Jackson (1999). "Mapping of protein-protein interactions within the DNA-dependent protein kinase complex." Nucleic Acids Res 27(17): 3494-3502. Giffin, W., W. Gong, C. Schild-Poulter and R. J. Hache (1999). "Ku antigen-DNA conformation determines the activation of DNA-dependent protein kinase and DNA sequence-directed repression of mouse mammary tumor virus transcription." Mol Cell Biol 19(6): 4065-4078. Giffin, W., H. Torrance, D. J. Rodda, G. G. Prefontaine, L. Pope and R. J. Hache (1996). "Sequence-specific DNA binding by Ku autoantigen and its effects on transcription." Nature 380(6571): 265-268. Golemis, E. and P. D. Adams (2005). Protein-protein interactions : a molecular cloning manual. Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory Press. Golsteyn, R. M., S. J. Schultz, J. Bartek, A. Ziemiecki, T. Ried and E. A. Nigg (1994). "Cell cycle analysis and chromosomal localization of human Plk1, a putative homologue of the mitotic kinases Drosophila polo and Saccharomyces cerevisiae Cdc5." J Cell Sci 107 ( Pt 6): 1509-1517. Gomez-Herreros, F., R. Romero-Granados, Z. Zeng, A. Alvarez-Quilon, C. Quintero, L. Ju, L. Umans, L. Vermeire, D. Huylebroeck, K. W. Caldecott and F. Cortes-Ledesma

163

(2013). "TDP2-dependent non-homologous end-joining protects against topoisomerase II-induced DNA breaks and genome instability in cells and in vivo." PLoS Genet 9(3): e1003226. Goodarzi, A. A., P. Jeggo and M. Lobrich (2010). "The influence of heterochromatin on DNA double strand break repair: Getting the strong, silent type to relax." DNA Repair (Amst) 9(12): 1273-1282. Goodarzi, A. A. and P. A. Jeggo (2012). "Irradiation induced foci (IRIF) as a biomarker for radiosensitivity." Mutat Res 736(1-2): 39-47. Goodarzi, A. A., J. C. Jonnalagadda, P. Douglas, D. Young, R. Ye, G. B. Moorhead, S. P. Lees-Miller and K. K. Khanna (2004). "Autophosphorylation of ataxia-telangiectasia mutated is regulated by protein phosphatase 2A." EMBO J 23(22): 4451-4461. Goodarzi, A. A. and S. P. Lees-Miller (2004). "Biochemical characterization of the ataxia-telangiectasia mutated (ATM) protein from human cells." DNA Repair (Amst) 3(7): 753-767. Goodarzi, A. A., A. T. Noon, D. Deckbar, Y. Ziv, Y. Shiloh, M. Lobrich and P. A. Jeggo (2008). "ATM signaling facilitates repair of DNA double-strand breaks associated with heterochromatin." Mol Cell 31(2): 167-177. Goodarzi, A. A., Y. Yu, E. Riballo, P. Douglas, S. A. Walker, R. Ye, C. Harer, C. Marchetti, N. Morrice, P. A. Jeggo and S. P. Lees-Miller (2006). "DNA-PK autophosphorylation facilitates Artemis endonuclease activity." EMBO J 25(16): 3880- 3889. Goodwin, J. F., V. Kothari, J. M. Drake, S. Zhao, E. Dylgjeri, J. L. Dean, M. J. Schiewer, C. McNair, J. K. Jones, A. Aytes, M. S. Magee, A. E. Snook, Z. Zhu, R. B. Den, R. C. Birbe, L. G. Gomella, N. A. Graham, A. A. Vashisht, J. A. Wohlschlegel, T. G. Graeber, R. J. Karnes, M. Takhar, E. Davicioni, S. A. Tomlins, C. Abate-Shen, N. Sharifi, O. N. Witte, F. Y. Feng and K. E. Knudsen (2015). "DNA-PKcs-Mediated Transcriptional Regulation Drives Prostate Cancer Progression and Metastasis." Cancer Cell 28(1): 97- 113. Gotoh, E., Y. Asakawa and H. Kosaka (1995). "Inhibition of protein serine/threonine phosphatases directly induces premature chromosome condensation in mammalian somatic cells ." Biomedical Research 16(1): 63-68. Gottlieb, T. M. and S. P. Jackson (1993). "The DNA-dependent protein kinase: requirement for DNA ends and association with Ku antigen." Cell 72(1): 131-142. Grawunder, U., M. Wilm, X. Wu, P. Kulesza, T. E. Wilson, M. Mann and M. R. Lieber (1997). "Activity of DNA ligase IV stimulated by complex formation with XRCC4 protein in mammalian cells." Nature 388(6641): 492-495. Grawunder, U., D. Zimmer, S. Fugmann, K. Schwarz and M. R. Lieber (1998). "DNA ligase IV is essential for V(D)J recombination and DNA double-strand break repair in human precursor lymphocytes." Mol Cell 2(4): 477-484. Grawunder, U., D. Zimmer and M. R. Lieber (1998). "DNA ligase IV binds to XRCC4 via a motif located between rather than within its BRCT domains." Curr Biol 8(15): 873-876. Groves, M. R., N. Hanlon, P. Turowski, B. A. Hemmings and D. Barford (1999). "The structure of the protein phosphatase 2A PR65/A subunit reveals the conformation of its 15 tandemly repeated HEAT motifs." Cell 96(1): 99-110.

164

Grundy, G. J., S. L. Rulten, Z. Zeng, R. Arribas-Bosacoma, N. Iles, K. Manley, A. Oliver and K. W. Caldecott (2013). "APLF promotes the assembly and activity of nonhomologous end joining protein complexes." EMBO J 32(1): 112-125. Gu, J., H. Lu, B. Tippin, N. Shimazaki, M. F. Goodman and M. R. Lieber (2007). "XRCC4:DNA ligase IV can ligate incompatible DNA ends and can ligate across gaps." EMBO J 26(4): 1010-1023. Gu, J., H. Lu, A. G. Tsai, K. Schwarz and M. R. Lieber (2007). "Single-stranded DNA ligation and XLF-stimulated incompatible DNA end ligation by the XRCC4-DNA ligase IV complex: influence of terminal DNA sequence." Nucleic Acids Res 35(17): 5755- 5762. Gu, Y., S. Jin, Y. Gao, D. T. Weaver and F. W. Alt (1997). "Ku70-deficient embryonic stem cells have increased ionizing radiosensitivity, defective DNA end-binding activity, and inability to support V(D)J recombination." Proc Natl Acad Sci U S A 94(15): 8076- 8081. Guo, C., Y. Nakazawa, L. Woodbine, A. Bjorkman, M. Shimada, H. Fawcett, N. Jia, K. Ohyama, T. S. Li, Y. Nagayama, N. Mitsutake, Q. Pan-Hammarstrom, A. R. Gennery, A. R. Lehmann, P. A. Jeggo and T. Ogi (2015). "XRCC4 deficiency in human subjects causes a marked neurological phenotype but no overt immunodeficiency." J Allergy Clin Immunol 136(4): 1007-1017. Gupta, S. and K. Meek (2005). "The leucine rich region of DNA-PKcs contributes to its innate DNA affinity." Nucleic Acids Res 33(22): 6972-6981. Haines, B. B., C. J. Ryu and J. Chen (2006). "Recombination activating genes (RAG) in lymphoma development." Cell Cycle 5(9): 913-916. Hammarsten, O. and G. Chu (1998). "DNA-dependent protein kinase: DNA binding and activation in the absence of Ku." Proc Natl Acad Sci U S A 95(2): 525-530. Hammarsten, O., L. G. DeFazio and G. Chu (2000). "Activation of DNA-dependent protein kinase by single-stranded DNA ends." J Biol Chem 275(3): 1541-1550. Hammel, M., Y. Yu, S. Fang, S. P. Lees-Miller and J. A. Tainer (2010). "XLF regulates filament architecture of the XRCC4.ligase IV complex." Structure 18(11): 1431-1442. Hammel, M., Y. Yu, B. L. Mahaney, B. Cai, R. Ye, B. M. Phipps, R. P. Rambo, G. L. Hura, M. Pelikan, S. So, R. M. Abolfath, D. J. Chen, S. P. Lees-Miller and J. A. Tainer (2010). "Ku and DNA-dependent protein kinase dynamic conformations and assembly regulate DNA binding and the initial non-homologous end joining complex." J Biol Chem 285(2): 1414-1423. Harlow, E. and D. Lane (1999). Using antibodies : a laboratory manual. Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory Press. Harris, R., D. Esposito, A. Sankar, J. D. Maman, J. A. Hinks, L. H. Pearl and P. C. Driscoll (2004). "The 3D solution structure of the C-terminal region of Ku86 (Ku86CTR)." J Mol Biol 335(2): 573-582. Hartley, K. O., D. Gell, G. C. Smith, H. Zhang, N. Divecha, M. A. Connelly, A. Admon, S. P. Lees-Miller, C. W. Anderson and S. P. Jackson (1995). "DNA-dependent protein kinase catalytic subunit: a relative of phosphatidylinositol 3-kinase and the ataxia telangiectasia gene product." Cell 82(5): 849-856. Hemmings, B. A., C. Adams-Pearson, F. Maurer, P. Muller, J. Goris, W. Merlevede, J. Hofsteenge and S. R. Stone (1990). "alpha- and beta-forms of the 65-kDa subunit of

165

protein phosphatase 2A have a similar 39 amino acid repeating structure." Biochemistry 29(13): 3166-3173. Hendrickx, A., M. Beullens, H. Ceulemans, T. Den Abt, A. Van Eynde, E. Nicolaescu, B. Lesage and M. Bollen (2009). "Docking motif-guided mapping of the interactome of protein phosphatase-1." Chem Biol 16(4): 365-371. Hoeijmakers, J. H. (2009). "DNA damage, aging, and cancer." N Engl J Med 361(15): 1475-1485. Hsiang, Y. H., R. Hertzberg, S. Hecht and L. F. Liu (1985). "Camptothecin induces protein-linked DNA breaks via mammalian DNA topoisomerase I." J Biol Chem 260(27): 14873-14878. Hsu, H. L., D. Gilley, S. A. Galande, M. P. Hande, B. Allen, S. H. Kim, G. C. Li, J. Campisi, T. Kohwi-Shigematsu and D. J. Chen (2000). "Ku acts in a unique way at the mammalian telomere to prevent end joining." Genes Dev 14(22): 2807-2812. Hsu, H. L., S. M. Yannone and D. J. Chen (2002). "Defining interactions between DNA- PK and ligase IV/XRCC4." DNA Repair (Amst) 1(3): 225-235. Hu, S. and F. A. Cucinotta (2011). "Modelling the way Ku binds DNA." Radiat Prot Dosimetry 143(2-4): 196-201. Hutchinson, F. (1985). "Chemical changes induced in DNA by ionizing radiation." Prog Nucleic Acid Res Mol Biol 32: 115-154. Iles, N., S. Rulten, S. F. El-Khamisy and K. W. Caldecott (2007). "APLF (C2orf13) is a novel human protein involved in the cellular response to chromosomal DNA strand breaks." Mol Cell Biol 27(10): 3793-3803. Ismail, I. H., J. P. Gagne, M. M. Genois, H. Strickfaden, D. McDonald, Z. Xu, G. G. Poirier, J. Y. Masson and M. J. Hendzel (2015). "The RNF138 E3 ligase displaces Ku to promote DNA end resection and regulate DNA repair pathway choice." Nat Cell Biol. Jackson, S. P., J. J. MacDonald, S. Lees-Miller and R. Tjian (1990). "GC box binding induces phosphorylation of Sp1 by a DNA-dependent protein kinase." Cell 63(1): 155- 165. Jeggo, P. A. and L. M. Kemp (1983). "X-ray-sensitive mutants of Chinese hamster ovary cell line. Isolation and cross-sensitivity to other DNA-damaging agents." Mutat Res 112(6): 313-327. Jette, N. and S. P. Lees-Miller (2015). "The DNA-dependent protein kinase: A multifunctional protein kinase with roles in DNA double strand break repair and mitosis." Prog Biophys Mol Biol 117(2-3): 194-205. Jhappan, C., H. C. Morse, 3rd, R. D. Fleischmann, M. M. Gottesman and G. Merlino (1997). "DNA-PKcs: a T-cell tumour suppressor encoded at the mouse scid locus." Nat Genet 17(4): 483-486. Jiang, W., J. L. Crowe, X. Liu, S. Nakajima, Y. Wang, C. Li, B. J. Lee, R. L. Dubois, C. Liu, X. Yu, L. Lan and S. Zha (2015). "Differential phosphorylation of DNA-PKcs regulates the interplay between end-processing and end-ligation during nonhomologous end-joining." Mol Cell 58(1): 172-185. Jilani, A., D. Ramotar, C. Slack, C. Ong, X. M. Yang, S. W. Scherer and D. D. Lasko (1999). "Molecular cloning of the human gene, PNKP, encoding a polynucleotide kinase 3'-phosphatase and evidence for its role in repair of DNA strand breaks caused by oxidative damage." J Biol Chem 274(34): 24176-24186.

166

Jin, S., S. Kharbanda, B. Mayer, D. Kufe and D. T. Weaver (1997). "Binding of Ku and c-Abl at the kinase homology region of DNA-dependent protein kinase catalytic subunit." J Biol Chem 272(40): 24763-24766. Johnson, S. A. and T. Hunter (2005). "Kinomics: methods for deciphering the kinome." Nat Methods 2(1): 17-25. Junop, M. S., M. Modesti, A. Guarne, R. Ghirlando, M. Gellert and W. Yang (2000). "Crystal structure of the Xrcc4 DNA repair protein and implications for end joining." EMBO J 19(22): 5962-5970. Kanno, S., H. Kuzuoka, S. Sasao, Z. Hong, L. Lan, S. Nakajima and A. Yasui (2007). "A novel human AP endonuclease with conserved zinc-finger-like motifs involved in DNA strand break responses." EMBO J 26(8): 2094-2103. Keeney, S. (2008). "Spo11 and the Formation of DNA Double-Strand Breaks in Meiosis." Genome Dyn Stab 2: 81-123. Keith, C. T. and S. L. Schreiber (1995). "PIK-related kinases: DNA repair, recombination, and cell cycle checkpoints." Science 270(5233): 50-51. Kemp, L. M., S. G. Sedgwick and P. A. Jeggo (1984). "X-ray sensitive mutants of Chinese hamster ovary cells defective in double-strand break rejoining." Mutat Res 132(5-6): 189-196. Khew-Goodall, Y. and B. A. Hemmings (1988). "Tissue-specific expression of mRNAs encoding alpha- and beta-catalytic subunits of protein phosphatase 2A." FEBS Lett 238(2): 265-268. Kienker, L. J., E. K. Shin and K. Meek (2000). "Both V(D)J recombination and radioresistance require DNA-PK kinase activity, though minimal levels suffice for V(D)J recombination." Nucleic Acids Res 28(14): 2752-2761. Kinner, A., W. Wu, C. Staudt and G. Iliakis (2008). "Gamma-H2AX in recognition and signaling of DNA double-strand breaks in the context of chromatin." Nucleic Acids Res 36(17): 5678-5694. Koch, C. A., R. Agyei, S. Galicia, P. Metalnikov, P. O'Donnell, A. Starostine, M. Weinfeld and D. Durocher (2004). "Xrcc4 physically links DNA end processing by polynucleotide kinase to DNA ligation by DNA ligase IV." EMBO J 23(19): 3874-3885. Kong, X., Y. Shen, N. Jiang, X. Fei and J. Mi (2011). "Emerging roles of DNA-PK besides DNA repair." Cell Signal 23(8): 1273-1280. Kremmer, E., K. Ohst, J. Kiefer, N. Brewis and G. Walter (1997). "Separation of PP2A core enzyme and holoenzyme with monoclonal antibodies against the regulatory A subunit: abundant expression of both forms in cells." Mol Cell Biol 17(3): 1692-1701. Kurimasa, A., S. Kumano, N. V. Boubnov, M. D. Story, C. S. Tung, S. R. Peterson and D. J. Chen (1999). "Requirement for the kinase activity of human DNA-dependent protein kinase catalytic subunit in DNA strand break rejoining." Mol Cell Biol 19(5): 3877-3884. Kurz, E. U., P. Douglas and S. P. Lees-Miller (2004). "Doxorubicin activates ATM- dependent phosphorylation of multiple downstream targets in part through the generation of reactive oxygen species." J Biol Chem 279(51): 53272-53281. Lander, E. S., L. M. Linton, B. Birren, C. Nusbaum, M. C. Zody, J. Baldwin, K. Devon, K. Dewar, M. Doyle, W. FitzHugh, R. Funke, D. Gage, K. Harris, A. Heaford, J. Howland, L. Kann, J. Lehoczky, R. LeVine, P. McEwan, K. McKernan, J. Meldrim, J. P. Mesirov,

167

C. Miranda, W. Morris, J. Naylor, C. Raymond, M. Rosetti, R. Santos, A. Sheridan, C. Sougnez, N. Stange-Thomann, N. Stojanovic, A. Subramanian, D. Wyman, J. Rogers, J. Sulston, R. Ainscough, S. Beck, D. Bentley, J. Burton, C. Clee, N. Carter, A. Coulson, R. Deadman, P. Deloukas, A. Dunham, I. Dunham, R. Durbin, L. French, D. Grafham, S. Gregory, T. Hubbard, S. Humphray, A. Hunt, M. Jones, C. Lloyd, A. McMurray, L. Matthews, S. Mercer, S. Milne, J. C. Mullikin, A. Mungall, R. Plumb, M. Ross, R. Shownkeen, S. Sims, R. H. Waterston, R. K. Wilson, L. W. Hillier, J. D. McPherson, M. A. Marra, E. R. Mardis, L. A. Fulton, A. T. Chinwalla, K. H. Pepin, W. R. Gish, S. L. Chissoe, M. C. Wendl, K. D. Delehaunty, T. L. Miner, A. Delehaunty, J. B. Kramer, L. L. Cook, R. S. Fulton, D. L. Johnson, P. J. Minx, S. W. Clifton, T. Hawkins, E. Branscomb, P. Predki, P. Richardson, S. Wenning, T. Slezak, N. Doggett, J. F. Cheng, A. Olsen, S. Lucas, C. Elkin, E. Uberbacher, M. Frazier, R. A. Gibbs, D. M. Muzny, S. E. Scherer, J. B. Bouck, E. J. Sodergren, K. C. Worley, C. M. Rives, J. H. Gorrell, M. L. Metzker, S. L. Naylor, R. S. Kucherlapati, D. L. Nelson, G. M. Weinstock, Y. Sakaki, A. Fujiyama, M. Hattori, T. Yada, A. Toyoda, T. Itoh, C. Kawagoe, H. Watanabe, Y. Totoki, T. Taylor, J. Weissenbach, R. Heilig, W. Saurin, F. Artiguenave, P. Brottier, T. Bruls, E. Pelletier, C. Robert, P. Wincker, D. R. Smith, L. Doucette-Stamm, M. Rubenfield, K. Weinstock, H. M. Lee, J. Dubois, A. Rosenthal, M. Platzer, G. Nyakatura, S. Taudien, A. Rump, H. Yang, J. Yu, J. Wang, G. Huang, J. Gu, L. Hood, L. Rowen, A. Madan, S. Qin, R. W. Davis, N. A. Federspiel, A. P. Abola, M. J. Proctor, R. M. Myers, J. Schmutz, M. Dickson, J. Grimwood, D. R. Cox, M. V. Olson, R. Kaul, C. Raymond, N. Shimizu, K. Kawasaki, S. Minoshima, G. A. Evans, M. Athanasiou, R. Schultz, B. A. Roe, F. Chen, H. Pan, J. Ramser, H. Lehrach, R. Reinhardt, W. R. McCombie, M. de la Bastide, N. Dedhia, H. Blocker, K. Hornischer, G. Nordsiek, R. Agarwala, L. Aravind, J. A. Bailey, A. Bateman, S. Batzoglou, E. Birney, P. Bork, D. G. Brown, C. B. Burge, L. Cerutti, H. C. Chen, D. Church, M. Clamp, R. R. Copley, T. Doerks, S. R. Eddy, E. E. Eichler, T. S. Furey, J. Galagan, J. G. Gilbert, C. Harmon, Y. Hayashizaki, D. Haussler, H. Hermjakob, K. Hokamp, W. Jang, L. S. Johnson, T. A. Jones, S. Kasif, A. Kaspryzk, S. Kennedy, W. J. Kent, P. Kitts, E. V. Koonin, I. Korf, D. Kulp, D. Lancet, T. M. Lowe, A. McLysaght, T. Mikkelsen, J. V. Moran, N. Mulder, V. J. Pollara, C. P. Ponting, G. Schuler, J. Schultz, G. Slater, A. F. Smit, E. Stupka, J. Szustakowski, D. Thierry-Mieg, J. Thierry-Mieg, L. Wagner, J. Wallis, R. Wheeler, A. Williams, Y. I. Wolf, K. H. Wolfe, S. P. Yang, R. F. Yeh, F. Collins, M. S. Guyer, J. Peterson, A. Felsenfeld, K. A. Wetterstrand, A. Patrinos, M. J. Morgan, P. de Jong, J. J. Catanese, K. Osoegawa, H. Shizuya, S. Choi, Y. J. Chen and C. International Human Genome Sequencing (2001). "Initial sequencing and analysis of the human genome." Nature 409(6822): 860-921. Leahy, J. J., B. T. Golding, R. J. Griffin, I. R. Hardcastle, C. Richardson, L. Rigoreau and G. C. Smith (2004). "Identification of a highly potent and selective DNA-dependent protein kinase (DNA-PK) inhibitor (NU7441) by screening of chromenone libraries." Bioorg Med Chem Lett 14(24): 6083-6087. Lee, J. and J. Stock (1993). "Protein phosphatase 2A catalytic subunit is methyl- esterified at its carboxyl terminus by a novel methyltransferase." J Biol Chem 268(26): 19192-19195.

168

Lee, K. J., M. Jovanovic, D. Udayakumar, C. L. Bladen and W. S. Dynan (2004). "Identification of DNA-PKcs phosphorylation sites in XRCC4 and effects of mutations at these sites on DNA end joining in a cell-free system." DNA Repair (Amst) 3(3): 267-276. Lee, K. J., Y. F. Lin, H. Y. Chou, H. Yajima, K. R. Fattah, S. C. Lee and B. P. Chen (2011). "Involvement of DNA-dependent protein kinase in normal cell cycle progression through mitosis." J Biol Chem 286(14): 12796-12802. Lee, K. J., Z. F. Shang, Y. F. Lin, J. Sun, K. Morotomi-Yano, D. Saha and B. P. Chen (2015). "The Catalytic Subunit of DNA-Dependent Protein Kinase Coordinates with Polo-Like Kinase 1 to Facilitate Mitotic Entry." Neoplasia 17(4): 329-338. Lee, P. P., L. Woodbine, K. C. Gilmour, S. Bibi, C. M. Cale, P. J. Amrolia, P. A. Veys, E. G. Davies, P. A. Jeggo and A. Jones (2013). "The many faces of Artemis-deficient combined immunodeficiency - Two patients with DCLRE1C mutations and a systematic literature review of genotype-phenotype correlation." Clin Immunol 149(3): 464-474. Lees-Miller, S. P. and C. W. Anderson (1989). "The human double-stranded DNA- activated protein kinase phosphorylates the 90-kDa heat-shock protein, hsp90 alpha at two NH2-terminal threonine residues." J Biol Chem 264(29): 17275-17280. Lees-Miller, S. P. and C. W. Anderson (1991). "The DNA-activated protein kinase, DNA- PK: a potential coordinator of nuclear events." Cancer Cells 3(9): 341-346. Lees-Miller, S. P., Y. R. Chen and C. W. Anderson (1990). "Human cells contain a DNA- activated protein kinase that phosphorylates simian virus 40 T antigen, mouse p53, and the human Ku autoantigen." Mol Cell Biol 10(12): 6472-6481. Lees-Miller, S. P., R. Godbout, D. W. Chan, M. Weinfeld, R. S. Day, 3rd, G. M. Barron and J. Allalunis-Turner (1995). "Absence of p350 subunit of DNA-activated protein kinase from a radiosensitive human cell line." Science 267(5201): 1183-1185. Lees-Miller, S. P., K. Sakaguchi, S. J. Ullrich, E. Appella and C. W. Anderson (1992). "Human DNA-activated protein kinase phosphorylates serines 15 and 37 in the amino- terminal transactivation domain of human p53." Mol Cell Biol 12(11): 5041-5049. Lehman, J. A., D. J. Hoelz and J. J. Turchi (2008). "DNA-dependent conformational changes in the Ku heterodimer." Biochemistry 47(15): 4359-4368. Leuther, K. K., O. Hammarsten, R. D. Kornberg and G. Chu (1999). "Structure of DNA- dependent protein kinase: implications for its regulation by DNA." EMBO J 18(5): 1114- 1123. Lewis, N. E., X. Liu, Y. Li, H. Nagarajan, G. Yerganian, E. O'Brien, A. Bordbar, A. M. Roth, J. Rosenbloom, C. Bian, M. Xie, W. Chen, N. Li, D. Baycin-Hizal, H. Latif, J. Forster, M. J. Betenbaugh, I. Famili, X. Xu, J. Wang and B. O. Palsson (2013). "Genomic landscapes of Chinese hamster ovary cell lines as revealed by the Cricetulus griseus draft genome." Nat Biotechnol 31(8): 759-765. Li, B. and L. Comai (2001). "Requirements for the nucleolytic processing of DNA ends by the Werner syndrome protein-Ku70/80 complex." J Biol Chem 276(13): 9896-9902. Li, G., C. Nelsen and E. A. Hendrickson (2002). "Ku86 is essential in human somatic cells." Proc Natl Acad Sci U S A 99(2): 832-837. Li, H. H., X. Cai, G. P. Shouse, L. G. Piluso and X. Liu (2007). "A specific PP2A regulatory subunit, B56gamma, mediates DNA damage-induced dephosphorylation of p53 at Thr55." EMBO J 26(2): 402-411.

169

Li, S., S. Kanno, R. Watanabe, H. Ogiwara, T. Kohno, G. Watanabe, A. Yasui and M. R. Lieber (2011). "Polynucleotide kinase and aprataxin-like forkhead-associated protein (PALF) acts as both a single-stranded DNA endonuclease and a single-stranded DNA 3' exonuclease and can participate in DNA end joining in a biochemical system." J Biol Chem 286(42): 36368-36377. Li, X., H. H. Lin, H. Chen, X. Xu, H. M. Shih and D. K. Ann (2010). "SUMOylation of the transcriptional co-repressor KAP1 is regulated by the serine and threonine phosphatase PP1." Sci Signal 3(119): ra32. Li, Y., D. Y. Chirgadze, V. M. Bolanos-Garcia, B. L. Sibanda, O. R. Davies, P. Ahnesorg, S. P. Jackson and T. L. Blundell (2008). "Crystal structure of human XLF/Cernunnos reveals unexpected differences from XRCC4 with implications for NHEJ." EMBO J 27(1): 290-300. Li, Z., T. Otevrel, Y. Gao, H. L. Cheng, B. Seed, T. D. Stamato, G. E. Taccioli and F. W. Alt (1995). "The XRCC4 gene encodes a novel protein involved in DNA double-strand break repair and V(D)J recombination." Cell 83(7): 1079-1089. Lindahl, T. and D. E. Barnes (2000). "Repair of endogenous DNA damage." Cold Spring Harb Symp Quant Biol 65: 127-133. Liu, B., R. Yip and Z. Zhou (2012). "Chromatin remodeling, DNA damage repair and aging." Curr Genomics 13(7): 533-547. Lu, H., U. Pannicke, K. Schwarz and M. R. Lieber (2007). "Length-dependent binding of human XLF to DNA and stimulation of XRCC4.DNA ligase IV activity." J Biol Chem 282(15): 11155-11162. Ma, Y., U. Pannicke, H. Lu, D. Niewolik, K. Schwarz and M. R. Lieber (2005). "The DNA-dependent protein kinase catalytic subunit phosphorylation sites in human Artemis." J Biol Chem 280(40): 33839-33846. Ma, Y., U. Pannicke, K. Schwarz and M. R. Lieber (2002). "Hairpin opening and overhang processing by an Artemis/DNA-dependent protein kinase complex in nonhomologous end joining and V(D)J recombination." Cell 108(6): 781-794. Ma, Y., K. Schwarz and M. R. Lieber (2005). "The Artemis:DNA-PKcs endonuclease cleaves DNA loops, flaps, and gaps." DNA Repair (Amst) 4(7): 845-851. Macrae, C. J., R. D. McCulloch, J. Ylanko, D. Durocher and C. A. Koch (2008). "APLF (C2orf13) facilitates nonhomologous end-joining and undergoes ATM-dependent hyperphosphorylation following ionizing radiation." DNA Repair (Amst) 7(2): 292-302. Mahajan, K. N., S. A. Nick McElhinny, B. S. Mitchell and D. A. Ramsden (2002). "Association of DNA polymerase mu (pol mu) with Ku and ligase IV: role for pol mu in end-joining double-strand break repair." Mol Cell Biol 22(14): 5194-5202. Mahaney, B. L., M. Hammel, K. Meek, J. A. Tainer and S. P. Lees-Miller (2013). "XRCC4 and XLF form long helical protein filaments suitable for DNA end protection and alignment to facilitate DNA double strand break repair." Biochem Cell Biol 91(1): 31-41. Mahaney, B. L., K. Meek and S. P. Lees-Miller (2009). "Repair of ionizing radiation- induced DNA double-strand breaks by non-homologous end-joining." Biochem J 417(3): 639-650.

170

Maldonado, E., R. Shiekhattar, M. Sheldon, H. Cho, R. Drapkin, P. Rickert, E. Lees, C. W. Anderson, S. Linn and D. Reinberg (1996). "A human RNA polymerase II complex associated with SRB and DNA-repair proteins." Nature 381(6577): 86-89. Malu, S., P. De Ioannes, M. Kozlov, M. Greene, D. Francis, M. Hanna, J. Pena, C. R. Escalante, A. Kurosawa, H. Erdjument-Bromage, P. Tempst, N. Adachi, P. Vezzoni, A. Villa, A. K. Aggarwal and P. Cortes (2012). "Artemis C-terminal region facilitates V(D)J recombination through its interactions with DNA Ligase IV and DNA-PKcs." J Exp Med 209(5): 955-963. Manning, G., D. B. Whyte, R. Martinez, T. Hunter and S. Sudarsanam (2002). "The protein kinase complement of the human genome." Science 298(5600): 1912-1934. Mao, Y., S. D. Desai, C. Y. Ting, J. Hwang and L. F. Liu (2001). "26 S proteasome- mediated degradation of topoisomerase II cleavable complexes." J Biol Chem 276(44): 40652-40658. Mari, P. O., B. I. Florea, S. P. Persengiev, N. S. Verkaik, H. T. Bruggenwirth, M. Modesti, G. Giglia-Mari, K. Bezstarosti, J. A. Demmers, T. M. Luider, A. B. Houtsmuller and D. C. van Gent (2006). "Dynamic assembly of end-joining complexes requires interaction between Ku70/80 and XRCC4." Proc Natl Acad Sci U S A 103(49): 18597- 18602. Maringele, L. and D. Lydall (2002). "EXO1-dependent single-stranded DNA at telomeres activates subsets of DNA damage and spindle checkpoint pathways in budding yeast yku70Delta mutants." Genes Dev 16(15): 1919-1933. Martensson, S. and O. Hammarsten (2002). "DNA-dependent protein kinase catalytic subunit. Structural requirements for kinase activation by DNA ends." J Biol Chem 277(4): 3020-3029. Mathieu, A. L., E. Verronese, G. I. Rice, F. Fouyssac, Y. Bertrand, C. Picard, M. Chansel, J. E. Walter, L. D. Notarangelo, M. J. Butte, K. C. Nadeau, K. Csomos, D. J. Chen, K. Chen, A. Delgado, C. Rigal, C. Bardin, C. Schuetz, D. Moshous, H. Reumaux, F. Plenat, A. Phan, M. T. Zabot, B. Balme, S. Viel, J. Bienvenu, P. Cochat, M. van der Burg, C. Caux, E. H. Kemp, I. Rouvet, C. Malcus, J. F. Meritet, A. Lim, Y. J. Crow, N. Fabien, C. Menetrier-Caux, J. P. De Villartay, T. Walzer and A. Belot (2015). "PRKDC mutations associated with immunodeficiency, granuloma, and autoimmune regulator- dependent autoimmunity." J Allergy Clin Immunol 135(6): 1578-1588 e1575. McVey, M. and S. E. Lee (2008). "MMEJ repair of double-strand breaks (director's cut): deleted sequences and alternative endings." Trends Genet 24(11): 529-538. Meek, K., P. Douglas, X. Cui, Q. Ding and S. P. Lees-Miller (2007). "trans Autophosphorylation at DNA-dependent protein kinase's two major autophosphorylation site clusters facilitates end processing but not end joining." Mol Cell Biol 27(10): 3881- 3890. Meek, K., S. P. Lees-Miller and M. Modesti (2012). "N-terminal constraint activates the catalytic subunit of the DNA-dependent protein kinase in the absence of DNA or Ku." Nucleic Acids Res 40(7): 2964-2973. Mehrotra, P. V., D. Ahel, D. P. Ryan, R. Weston, N. Wiechens, R. Kraehenbuehl, T. Owen-Hughes and I. Ahel (2011). "DNA repair factor APLF is a histone chaperone." Mol Cell 41(1): 46-55.

171

Merkle, D., P. Douglas, G. B. Moorhead, Z. Leonenko, Y. Yu, D. Cramb, D. P. Bazett- Jones and S. P. Lees-Miller (2002). "The DNA-dependent protein kinase interacts with DNA to form a protein-DNA complex that is disrupted by phosphorylation." Biochemistry 41(42): 12706-12714. Mimitou, E. P. and L. S. Symington (2008). "Sae2, Exo1 and Sgs1 collaborate in DNA double-strand break processing." Nature 455(7214): 770-774. Mimitou, E. P. and L. S. Symington (2010). "Ku prevents Exo1 and Sgs1-dependent resection of DNA ends in the absence of a functional MRX complex or Sae2." EMBO J 29(19): 3358-3369. Mimori, T., M. Akizuki, H. Yamagata, S. Inada, S. Yoshida and M. Homma (1981). "Characterization of a high molecular weight acidic nuclear protein recognized by autoantibodies in sera from patients with polymyositis-scleroderma overlap." J Clin Invest 68(3): 611-620. Mimori, T. and J. A. Hardin (1986). "Mechanism of interaction between Ku protein and DNA." J Biol Chem 261(22): 10375-10379. Mimori, T., J. A. Hardin and J. A. Steitz (1986). "Characterization of the DNA-binding protein antigen Ku recognized by autoantibodies from patients with rheumatic disorders." J Biol Chem 261(5): 2274-2278. Mladenov, E. and G. Iliakis (2011). "Induction and repair of DNA double strand breaks: the increasing spectrum of non-homologous end joining pathways." Mutat Res 711(1-2): 61-72. Modesti, M., J. E. Hesse and M. Gellert (1999). "DNA binding of Xrcc4 protein is associated with V(D)J recombination but not with stimulation of DNA ligase IV activity." EMBO J 18(7): 2008-2018. Modesti, M., M. S. Junop, R. Ghirlando, M. van de Rakt, M. Gellert, W. Yang and R. Kanaar (2003). "Tetramerization and DNA ligase IV interaction of the DNA double- strand break repair protein XRCC4 are mutually exclusive." J Mol Biol 334(2): 215-228. Moorhead, G. B., L. Trinkle-Mulcahy, M. Nimick, V. De Wever, D. G. Campbell, R. Gourlay, Y. W. Lam and A. I. Lamond (2008). "Displacement affinity chromatography of protein phosphatase one (PP1) complexes." BMC Biochem 9: 28. Moorhead, G. B., L. Trinkle-Mulcahy and A. Ulke-Lemee (2007). "Emerging roles of nuclear protein phosphatases." Nat Rev Mol Cell Biol 8(3): 234-244. Mordes, D. A., G. G. Glick, R. Zhao and D. Cortez (2008). "TopBP1 activates ATR through ATRIP and a PIKK regulatory domain." Genes Dev 22(11): 1478-1489. Moshous, D., I. Callebaut, R. de Chasseval, B. Corneo, M. Cavazzana-Calvo, F. Le Deist, I. Tezcan, O. Sanal, Y. Bertrand, N. Philippe, A. Fischer and J. P. de Villartay (2001). "Artemis, a novel DNA double-strand break repair/V(D)J recombination protein, is mutated in human severe combined immune deficiency." Cell 105(2): 177-186. Moshous, D., C. Pannetier, R. Chasseval Rd, F. Deist Fl, M. Cavazzana-Calvo, S. Romana, E. Macintyre, D. Canioni, N. Brousse, A. Fischer, J. L. Casanova and J. P. Villartay (2003). "Partial T and B lymphocyte immunodeficiency and predisposition to lymphoma in patients with hypomorphic mutations in Artemis." J Clin Invest 111(3): 381- 387. Moynahan, M. E. and M. Jasin (2010). "Mitotic homologous recombination maintains genomic stability and suppresses tumorigenesis." Nat Rev Mol Cell Biol 11(3): 196-207.

172

Muller, S., P. Filippakopoulos and S. Knapp (2011). "Bromodomains as therapeutic targets." Expert Rev Mol Med 13: e29. Nakada, S., G. I. Chen, A. C. Gingras and D. Durocher (2008). "PP4 is a gamma H2AX phosphatase required for recovery from the DNA damage checkpoint." EMBO Rep 9(10): 1019-1026. Nick McElhinny, S. A., J. M. Havener, M. Garcia-Diaz, R. Juarez, K. Bebenek, B. L. Kee, L. Blanco, T. A. Kunkel and D. A. Ramsden (2005). "A gradient of template dependence defines distinct biological roles for family X polymerases in nonhomologous end joining." Mol Cell 19(3): 357-366. Nick McElhinny, S. A., C. M. Snowden, J. McCarville and D. A. Ramsden (2000). "Ku recruits the XRCC4-ligase IV complex to DNA ends." Mol Cell Biol 20(9): 2996-3003. Nitiss, J. L. (2009). "Targeting DNA topoisomerase II in cancer chemotherapy." Nat Rev Cancer 9(5): 338-350. Nussenzweig, A., C. Chen, V. da Costa Soares, M. Sanchez, K. Sokol, M. C. Nussenzweig and G. C. Li (1996). "Requirement for Ku80 in growth and immunoglobulin V(D)J recombination." Nature 382(6591): 551-555. Nussenzweig, A., K. Sokol, P. Burgman, L. Li and G. C. Li (1997). "Hypersensitivity of Ku80-deficient cell lines and mice to DNA damage: the effects of ionizing radiation on growth, survival, and development." Proc Natl Acad Sci U S A 94(25): 13588-13593. O'Connor, M. S., A. Safari, D. Liu, J. Qin and Z. Songyang (2004). "The human Rap1 protein complex and modulation of telomere length." J Biol Chem 279(27): 28585- 28591. O'Neill, T., A. J. Dwyer, Y. Ziv, D. W. Chan, S. P. Lees-Miller, R. H. Abraham, J. H. Lai, D. Hill, Y. Shiloh, L. C. Cantley and G. A. Rathbun (2000). "Utilization of oriented peptide libraries to identify substrate motifs selected by ATM." J Biol Chem 275(30): 22719-22727. Ochi, T., A. N. Blackford, J. Coates, S. Jhujh, S. Mehmood, N. Tamura, J. Travers, Q. Wu, V. M. Draviam, C. V. Robinson, T. L. Blundell and S. P. Jackson (2015). "DNA repair. PAXX, a paralog of XRCC4 and XLF, interacts with Ku to promote DNA double- strand break repair." Science 347(6218): 185-188. Ochi, T., B. L. Sibanda, Q. Wu, D. Y. Chirgadze, V. M. Bolanos-Garcia and T. L. Blundell (2010). "Structural biology of DNA repair: spatial organisation of the multicomponent complexes of nonhomologous end joining." J Nucleic Acids 2010. Ochi, T., Q. Wu and T. L. Blundell (2014). "The spatial organization of non-homologous end joining: from bridging to end joining." DNA Repair (Amst) 17: 98-109. Okamoto, K., C. Bartocci, I. Ouzounov, J. K. Diedrich, J. R. Yates, 3rd and E. L. Denchi (2013). "A two-step mechanism for TRF2-mediated chromosome-end protection." Nature 494(7438): 502-505. Olsen, J. V., B. Blagoev, F. Gnad, B. Macek, C. Kumar, P. Mortensen and M. Mann (2006). "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell 127(3): 635-648. Ouyang, H., A. Nussenzweig, A. Kurimasa, V. C. Soares, X. Li, C. Cordon-Cardo, W. Li, N. Cheong, M. Nussenzweig, G. Iliakis, D. J. Chen and G. C. Li (1997). "Ku70 is required for DNA repair but not for T cell antigen receptor gene recombination In vivo." J Exp Med 186(6): 921-929.

173

Palmbos, P. L., J. M. Daley and T. E. Wilson (2005). "Mutations of the Yku80 C terminus and Xrs2 FHA domain specifically block yeast nonhomologous end joining." Mol Cell Biol 25(24): 10782-10790. Pang, D., S. Yoo, W. S. Dynan, M. Jung and A. Dritschilo (1997). "Ku proteins join DNA fragments as shown by atomic force microscopy." Cancer Res 57(8): 1412-1415. Pankotai, T., C. Bonhomme, D. Chen and E. Soutoglou (2012). "DNAPKcs-dependent arrest of RNA polymerase II transcription in the presence of DNA breaks." Nat Struct Mol Biol 19(3): 276-282. Peng, A., A. L. Lewellyn, W. P. Schiemann and J. L. Maller (2010). "Repo-man controls a protein phosphatase 1-dependent threshold for DNA damage checkpoint activation." Curr Biol 20(5): 387-396. Pereira, S. R., V. M. Vasconcelos and A. Antunes (2011). "The phosphoprotein phosphatase family of Ser/Thr phosphatases as principal targets of naturally occurring toxins." Crit Rev Toxicol 41(2): 83-110. Pergola, F., M. Z. Zdzienicka and M. R. Lieber (1993). "V(D)J recombination in mammalian cell mutants defective in DNA double-strand break repair." Mol Cell Biol 13(6): 3464-3471. Perlot, T. and F. W. Alt (2008). "Cis-regulatory elements and epigenetic changes control genomic rearrangements of the IgH locus." Adv Immunol 99: 1-32. Peti, W., A. C. Nairn and R. Page (2013). "Structural basis for protein phosphatase 1 regulation and specificity." FEBS J 280(2): 596-611. Pommier, Y., C. Redon, V. A. Rao, J. A. Seiler, O. Sordet, H. Takemura, S. Antony, L. Meng, Z. Liao, G. Kohlhagen, H. Zhang and K. W. Kohn (2003). "Repair of and checkpoint response to topoisomerase I-mediated DNA damage." Mutat Res 532(1-2): 173-203. Porter, S. E., P. W. Greenwell, K. B. Ritchie and T. D. Petes (1996). "The DNA-binding protein Hdf1p (a putative Ku homologue) is required for maintaining normal telomere length in Saccharomyces cerevisiae." Nucleic Acids Res 24(4): 582-585. Postow, L. (2011). "Destroying the ring: Freeing DNA from Ku with ubiquitin." FEBS Lett 585(18): 2876-2882. Postow, L., C. Ghenoiu, E. M. Woo, A. N. Krutchinsky, B. T. Chait and H. Funabiki (2008). "Ku80 removal from DNA through double strand break-induced ubiquitylation." J Cell Biol 182(3): 467-479. Povirk, L. F. (2012). "Processing of damaged DNA ends for double-strand break repair in mammalian cells." ISRN Mol Biol 2012. Radhakrishnan, S. K., N. Jette and S. P. Lees-Miller (2014). "Non-homologous end joining: emerging themes and unanswered questions." DNA Repair (Amst) 17: 2-8. Ramsden, D. A. and M. Gellert (1998). "Ku protein stimulates DNA end joining by mammalian DNA ligases: a direct role for Ku in repair of DNA double-strand breaks." EMBO J 17(2): 609-614. Rasouli-Nia, A., F. Karimi-Busheri and M. Weinfeld (2004). "Stable down-regulation of human polynucleotide kinase enhances spontaneous mutation frequency and sensitizes cells to genotoxic agents." Proc Natl Acad Sci U S A 101(18): 6905-6910.

174

Reeves, W. H. (1985). "Use of monoclonal antibodies for the characterization of novel DNA-binding proteins recognized by human autoimmune sera." J Exp Med 161(1): 18- 39. Reid, D. A., S. Keegan, A. Leo-Macias, G. Watanabe, N. T. Strande, H. H. Chang, B. A. Oksuz, D. Fenyo, M. R. Lieber, D. A. Ramsden and E. Rothenberg (2015). "Organization and dynamics of the nonhomologous end-joining machinery during DNA double-strand break repair." Proc Natl Acad Sci U S A 112(20): E2575-2584. Riballo, E., S. E. Critchlow, S. H. Teo, A. J. Doherty, A. Priestley, B. Broughton, B. Kysela, H. Beamish, N. Plowman, C. F. Arlett, A. R. Lehmann, S. P. Jackson and P. A. Jeggo (1999). "Identification of a defect in DNA ligase IV in a radiosensitive leukaemia patient." Curr Biol 9(13): 699-702. Riballo, E., M. Kuhne, N. Rief, A. Doherty, G. C. Smith, M. J. Recio, C. Reis, K. Dahm, A. Fricke, A. Krempler, A. R. Parker, S. P. Jackson, A. Gennery, P. A. Jeggo and M. Lobrich (2004). "A pathway of double-strand break rejoining dependent upon ATM, Artemis, and proteins locating to gamma-H2AX foci." Mol Cell 16(5): 715-724. Riballo, E., L. Woodbine, T. Stiff, S. A. Walker, A. A. Goodarzi and P. A. Jeggo (2009). "XLF-Cernunnos promotes DNA ligase IV-XRCC4 re-adenylation following ligation." Nucleic Acids Res 37(2): 482-492. Ribes-Zamora, A., S. M. Indiviglio, I. Mihalek, C. L. Williams and A. A. Bertuch (2013). "TRF2 interaction with Ku heterotetramerization interface gives insight into c-NHEJ prevention at human telomeres." Cell Rep 5(1): 194-206. Rivera-Calzada, A., J. D. Maman, L. Spagnolo, L. H. Pearl and O. Llorca (2005). "Three-dimensional structure and regulation of the DNA-dependent protein kinase catalytic subunit (DNA-PKcs)." Structure 13(2): 243-255. Rivera-Calzada, A., L. Spagnolo, L. H. Pearl and O. Llorca (2007). "Structural model of full-length human Ku70-Ku80 heterodimer and its recognition of DNA and DNA-PKcs." EMBO Rep 8(1): 56-62. Roberts, S. A. and D. A. Ramsden (2007). "Loading of the nonhomologous end joining factor, Ku, on protein-occluded DNA ends." J Biol Chem 282(14): 10605-10613. Roberts, S. A., N. Strande, M. D. Burkhalter, C. Strom, J. M. Havener, P. Hasty and D. A. Ramsden (2010). "Ku is a 5'-dRP/AP lyase that excises nucleotide damage near broken ends." Nature 464(7292): 1214-1217. Rogakou, E. P., C. Boon, C. Redon and W. M. Bonner (1999). "Megabase chromatin domains involved in DNA double-strand breaks in vivo." J Cell Biol 146(5): 905-916. Rogakou, E. P., D. R. Pilch, A. H. Orr, V. S. Ivanova and W. M. Bonner (1998). "DNA double-stranded breaks induce histone H2AX phosphorylation on serine 139." J Biol Chem 273(10): 5858-5868. Ropars, V., P. Drevet, P. Legrand, S. Baconnais, J. Amram, G. Faure, J. A. Marquez, O. Pietrement, R. Guerois, I. Callebaut, E. Le Cam, P. Revy, J. P. de Villartay and J. B. Charbonnier (2011). "Structural characterization of filaments formed by human Xrcc4- Cernunnos/XLF complex involved in nonhomologous DNA end-joining." Proc Natl Acad Sci U S A 108(31): 12663-12668. Rothkamm, K., I. Kruger, L. H. Thompson and M. Lobrich (2003). "Pathways of DNA double-strand break repair during the mammalian cell cycle." Mol Cell Biol 23(16): 5706- 5715.

175

Ruediger, R., J. E. Van Wart Hood, M. Mumby and G. Walter (1991). "Constant expression and activity of protein phosphatase 2A in synchronized cells." Mol Cell Biol 11(8): 4282-4285. Sambrook, J., E. F. Fritsch and T. Maniatis (1989). Molecular cloning : a laboratory manual. Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory Press. Samper, E., F. A. Goytisolo, P. Slijepcevic, P. P. van Buul and M. A. Blasco (2000). "Mammalian Ku86 protein prevents telomeric fusions independently of the length of TTAGGG repeats and the G-strand overhang." EMBO Rep 1(3): 244-252. Sartori, A. A., C. Lukas, J. Coates, M. Mistrik, S. Fu, J. Bartek, R. Baer, J. Lukas and S. P. Jackson (2007). "Human CtIP promotes DNA end resection." Nature 450(7169): 509- 514. Sawada, M., P. Hayes and S. Matsuyama (2003). "Cytoprotective membrane- permeable peptides designed from the Bax-binding domain of Ku70." Nat Cell Biol 5(4): 352-357. Sawada, M., W. Sun, P. Hayes, K. Leskov, D. A. Boothman and S. Matsuyama (2003). "Ku70 suppresses the apoptotic translocation of Bax to mitochondria." Nat Cell Biol 5(4): 320-329. Schatz, D. G. (2004). "V(D)J recombination." Immunol Rev 200: 5-11. Scotto-Lavino, E., M. Garcia-Diaz, G. Du and M. A. Frohman (2010). "Basis for the isoform-specific interaction of myosin phosphatase subunits protein phosphatase 1c beta and myosin phosphatase targeting subunit 1." J Biol Chem 285(9): 6419-6424. Segal-Raz, H., G. Mass, K. Baranes-Bachar, Y. Lerenthal, S. Y. Wang, Y. M. Chung, S. Ziv-Lehrman, C. E. Strom, T. Helleday, M. C. Hu, D. J. Chen and Y. Shiloh (2011). "ATM-mediated phosphorylation of polynucleotide kinase/phosphatase is required for effective DNA double-strand break repair." EMBO Rep 12(7): 713-719. Sekiguchi, J., D. O. Ferguson, H. T. Chen, E. M. Yang, J. Earle, K. Frank, S. Whitlow, Y. Gu, Y. Xu, A. Nussenzweig and F. W. Alt (2001). "Genetic interactions between ATM and the nonhomologous end-joining factors in genomic stability and development." Proc Natl Acad Sci U S A 98(6): 3243-3248. Seshacharyulu, P., P. Pandey, K. Datta and S. K. Batra (2013). "Phosphatase: PP2A structural importance, regulation and its aberrant expression in cancer." Cancer Lett 335(1): 9-18. Shang, Z., L. Yu, Y. F. Lin, S. Matsunaga, C. Y. Shen and B. P. Chen (2014). "DNA- PKcs activates the Chk2-Brca1 pathway during mitosis to ensure chromosomal stability." Oncogenesis 3: e85. Shang, Z. F., B. Huang, Q. Z. Xu, S. M. Zhang, R. Fan, X. D. Liu, Y. Wang and P. K. Zhou (2010). "Inactivation of DNA-dependent protein kinase leads to spindle disruption and mitotic catastrophe with attenuated checkpoint protein 2 Phosphorylation in response to DNA damage." Cancer Res 70(9): 3657-3666. Shi, Y. (2009). "Serine/threonine phosphatases: mechanism through structure." Cell 139(3): 468-484. Shibata, A., S. Conrad, J. Birraux, V. Geuting, O. Barton, A. Ismail, A. Kakarougkas, K. Meek, G. Taucher-Scholz, M. Lobrich and P. A. Jeggo (2011). "Factors determining DNA double-strand break repair pathway choice in G2 phase." EMBO J 30(6): 1079- 1092.

176

Shimada, M., M. Haruta, H. Niida, K. Sawamoto and M. Nakanishi (2010). "Protein phosphatase 1gamma is responsible for dephosphorylation of histone H3 at Thr 11 after DNA damage." EMBO Rep 11(11): 883-889. Shouse, G. P., X. Cai and X. Liu (2008). "Serine 15 phosphorylation of p53 directs its interaction with B56gamma and the tumor suppressor activity of B56gamma-specific protein phosphatase 2A." Mol Cell Biol 28(1): 448-456. Sibanda, B. L., D. Y. Chirgadze and T. L. Blundell (2010). "Crystal structure of DNA- PKcs reveals a large open-ring cradle comprised of HEAT repeats." Nature 463(7277): 118-121. Sibanda, B. L., S. E. Critchlow, J. Begun, X. Y. Pei, S. P. Jackson, T. L. Blundell and L. Pellegrini (2001). "Crystal structure of an Xrcc4-DNA ligase IV complex." Nat Struct Biol 8(12): 1015-1019. Silverstein, A. M., C. A. Barrow, A. J. Davis and M. C. Mumby (2002). "Actions of PP2A on the MAP kinase pathway and apoptosis are mediated by distinct regulatory subunits." Proc Natl Acad Sci U S A 99(7): 4221-4226. Simsek, D. and M. Jasin (2010). "Alternative end-joining is suppressed by the canonical NHEJ component Xrcc4-ligase IV during chromosomal translocation formation." Nat Struct Mol Biol 17(4): 410-416. Singleton, B. K., A. Priestley, H. Steingrimsdottir, D. Gell, T. Blunt, S. P. Jackson, A. R. Lehmann and P. A. Jeggo (1997). "Molecular and biochemical characterization of xrs mutants defective in Ku80." Mol Cell Biol 17(3): 1264-1273. Singleton, B. K., M. I. Torres-Arzayus, S. T. Rottinghaus, G. E. Taccioli and P. A. Jeggo (1999). "The C terminus of Ku80 activates the DNA-dependent protein kinase catalytic subunit." Mol Cell Biol 19(5): 3267-3277. Smider, V., W. K. Rathmell, G. Brown, S. Lewis and G. Chu (1998). "Failure of hairpin- ended and nicked DNA To activate DNA-dependent protein kinase: implications for V(D)J recombination." Mol Cell Biol 18(11): 6853-6858. Smith, G. C. and S. P. Jackson (1999). "The DNA-dependent protein kinase." Genes Dev 13(8): 916-934. Soderberg, O., M. Gullberg, M. Jarvius, K. Ridderstrale, K. J. Leuchowius, J. Jarvius, K. Wester, P. Hydbring, F. Bahram, L. G. Larsson and U. Landegren (2006). "Direct observation of individual endogenous protein complexes in situ by proximity ligation." Nat Methods 3(12): 995-1000. Song, K., D. Jung, Y. Jung, S. G. Lee and I. Lee (2000). "Interaction of human Ku70 with TRF2." FEBS Lett 481(1): 81-85. Spagnolo, L., A. Rivera-Calzada, L. H. Pearl and O. Llorca (2006). "Three-dimensional structure of the human DNA-PKcs/Ku70/Ku80 complex assembled on DNA and its implications for DNA DSB repair." Mol Cell 22(4): 511-519. Stanlie, A., A. S. Yousif, H. Akiyama, T. Honjo and N. A. Begum (2014). "Chromatin reader Brd4 functions in Ig class switching as a repair complex adaptor of nonhomologous end-joining." Mol Cell 55(1): 97-110. Stellwagen, A. E., Z. W. Haimberger, J. R. Veatch and D. E. Gottschling (2003). "Ku interacts with telomerase RNA to promote telomere addition at native and broken chromosome ends." Genes Dev 17(19): 2384-2395.

177

Stiff, T., M. O'Driscoll, N. Rief, K. Iwabuchi, M. Lobrich and P. A. Jeggo (2004). "ATM and DNA-PK function redundantly to phosphorylate H2AX after exposure to ionizing radiation." Cancer Res 64(7): 2390-2396. Strande, N., S. A. Roberts, S. Oh, E. A. Hendrickson and D. A. Ramsden (2012). "Specificity of the dRP/AP lyase of Ku promotes nonhomologous end joining (NHEJ) fidelity at damaged ends." J Biol Chem 287(17): 13686-13693. Strumberg, D., A. A. Pilon, M. Smith, R. Hickey, L. Malkas and Y. Pommier (2000). "Conversion of topoisomerase I cleavage complexes on the leading strand of ribosomal DNA into 5'-phosphorylated DNA double-strand breaks by replication runoff." Mol Cell Biol 20(11): 3977-3987. Sun, J., K. J. Lee, A. J. Davis and D. J. Chen (2012). "Human Ku70/80 protein blocks exonuclease 1-mediated DNA resection in the presence of human Mre11 or Mre11/Rad50 protein complex." J Biol Chem 287(7): 4936-4945. Szerlong, H. J. and J. C. Hansen (2011). "Nucleosome distribution and linker DNA: connecting nuclear function to dynamic chromatin structure." Biochem Cell Biol 89(1): 24-34. Taccioli, G. E., A. G. Amatucci, H. J. Beamish, D. Gell, X. H. Xiang, M. I. Torres Arzayus, A. Priestley, S. P. Jackson, A. Marshak Rothstein, P. A. Jeggo and V. L. Herrera (1998). "Targeted disruption of the catalytic subunit of the DNA-PK gene in mice confers severe combined immunodeficiency and radiosensitivity." Immunity 9(3): 355-366. Taccioli, G. E., T. M. Gottlieb, T. Blunt, A. Priestley, J. Demengeot, R. Mizuta, A. R. Lehmann, F. W. Alt, S. P. Jackson and P. A. Jeggo (1994). "Ku80: product of the XRCC5 gene and its role in DNA repair and V(D)J recombination." Science 265(5177): 1442-1445. Taccioli, G. E., G. Rathbun, E. Oltz, T. Stamato, P. A. Jeggo and F. W. Alt (1993). "Impairment of V(D)J recombination in double-strand break repair mutants." Science 260(5105): 207-210. Tanaka, J., M. Ito, J. Feng, K. Ichikawa, T. Hamaguchi, M. Nakamura, D. J. Hartshorne and T. Nakano (1998). "Interaction of myosin phosphatase target subunit 1 with the catalytic subunit of type 1 protein phosphatase." Biochemistry 37(47): 16697-16703. Ting, N. S., Y. Yu, B. Pohorelic, S. P. Lees-Miller and T. L. Beattie (2005). "Human Ku70/80 interacts directly with hTR, the RNA component of human telomerase." Nucleic Acids Res 33(7): 2090-2098. Torrance, H., W. Giffin, D. J. Rodda, L. Pope and R. J. Hache (1998). "Sequence- specific binding of Ku autoantigen to single-stranded DNA." J Biol Chem 273(33): 20810-20819. Tsai, C. J., S. A. Kim and G. Chu (2007). "Cernunnos/XLF promotes the ligation of mismatched and noncohesive DNA ends." Proc Natl Acad Sci U S A 104(19): 7851- 7856. Tu, W. Z., B. Li, B. Huang, Y. Wang, X. D. Liu, H. Guan, S. M. Zhang, Y. Tang, W. Q. Rang and P. K. Zhou (2013). "gammaH2AX foci formation in the absence of DNA damage: mitotic H2AX phosphorylation is mediated by the DNA-PKcs/CHK2 pathway." FEBS Lett 587(21): 3437-3443.

178

Turul, T., I. Tezcan and O. Sanal (2011). "Cernunnos deficiency: a case report." J Investig Allergol Clin Immunol 21(4): 313-316. Uematsu, N., E. Weterings, K. Yano, K. Morotomi-Yano, B. Jakob, G. Taucher-Scholz, P. O. Mari, D. C. van Gent, B. P. Chen and D. J. Chen (2007). "Autophosphorylation of DNA-PKCS regulates its dynamics at DNA double-strand breaks." J Cell Biol 177(2): 219-229. Ulke-Lemee, A., L. Trinkle-Mulcahy, S. Chaulk, N. K. Bernstein, N. Morrice, M. Glover, A. I. Lamond and G. B. Moorhead (2007). "The nuclear PP1 interacting protein ZAP3 (ZAP) is a putative nucleoside kinase that complexes with SAM68, CIA, NF110/45, and HNRNP-G." Biochim Biophys Acta 1774(10): 1339-1350. van Attikum, H. and S. M. Gasser (2009). "Crosstalk between histone modifications during the DNA damage response." Trends Cell Biol 19(5): 207-217. van der Burg, M., L. R. van Veelen, N. S. Verkaik, W. W. Wiegant, N. G. Hartwig, B. H. Barendregt, L. Brugmans, A. Raams, N. G. Jaspers, M. Z. Zdzienicka, J. J. van Dongen and D. C. van Gent (2006). "A new type of radiosensitive T-B-NK+ severe combined immunodeficiency caused by a LIG4 mutation." J Clin Invest 116(1): 137-145. Venter, J. C., M. D. Adams, E. W. Myers, P. W. Li, R. J. Mural, G. G. Sutton, H. O. Smith, M. Yandell, C. A. Evans, R. A. Holt, J. D. Gocayne, P. Amanatides, R. M. Ballew, D. H. Huson, J. R. Wortman, Q. Zhang, C. D. Kodira, X. H. Zheng, L. Chen, M. Skupski, G. Subramanian, P. D. Thomas, J. Zhang, G. L. Gabor Miklos, C. Nelson, S. Broder, A. G. Clark, J. Nadeau, V. A. McKusick, N. Zinder, A. J. Levine, R. J. Roberts, M. Simon, C. Slayman, M. Hunkapiller, R. Bolanos, A. Delcher, I. Dew, D. Fasulo, M. Flanigan, L. Florea, A. Halpern, S. Hannenhalli, S. Kravitz, S. Levy, C. Mobarry, K. Reinert, K. Remington, J. Abu-Threideh, E. Beasley, K. Biddick, V. Bonazzi, R. Brandon, M. Cargill, I. Chandramouliswaran, R. Charlab, K. Chaturvedi, Z. Deng, V. Di Francesco, P. Dunn, K. Eilbeck, C. Evangelista, A. E. Gabrielian, W. Gan, W. Ge, F. Gong, Z. Gu, P. Guan, T. J. Heiman, M. E. Higgins, R. R. Ji, Z. Ke, K. A. Ketchum, Z. Lai, Y. Lei, Z. Li, J. Li, Y. Liang, X. Lin, F. Lu, G. V. Merkulov, N. Milshina, H. M. Moore, A. K. Naik, V. A. Narayan, B. Neelam, D. Nusskern, D. B. Rusch, S. Salzberg, W. Shao, B. Shue, J. Sun, Z. Wang, A. Wang, X. Wang, J. Wang, M. Wei, R. Wides, C. Xiao, C. Yan, A. Yao, J. Ye, M. Zhan, W. Zhang, H. Zhang, Q. Zhao, L. Zheng, F. Zhong, W. Zhong, S. Zhu, S. Zhao, D. Gilbert, S. Baumhueter, G. Spier, C. Carter, A. Cravchik, T. Woodage, F. Ali, H. An, A. Awe, D. Baldwin, H. Baden, M. Barnstead, I. Barrow, K. Beeson, D. Busam, A. Carver, A. Center, M. L. Cheng, L. Curry, S. Danaher, L. Davenport, R. Desilets, S. Dietz, K. Dodson, L. Doup, S. Ferriera, N. Garg, A. Gluecksmann, B. Hart, J. Haynes, C. Haynes, C. Heiner, S. Hladun, D. Hostin, J. Houck, T. Howland, C. Ibegwam, J. Johnson, F. Kalush, L. Kline, S. Koduru, A. Love, F. Mann, D. May, S. McCawley, T. McIntosh, I. McMullen, M. Moy, L. Moy, B. Murphy, K. Nelson, C. Pfannkoch, E. Pratts, V. Puri, H. Qureshi, M. Reardon, R. Rodriguez, Y. H. Rogers, D. Romblad, B. Ruhfel, R. Scott, C. Sitter, M. Smallwood, E. Stewart, R. Strong, E. Suh, R. Thomas, N. N. Tint, S. Tse, C. Vech, G. Wang, J. Wetter, S. Williams, M. Williams, S. Windsor, E. Winn-Deen, K. Wolfe, J. Zaveri, K. Zaveri, J. F. Abril, R. Guigo, M. J. Campbell, K. V. Sjolander, B. Karlak, A. Kejariwal, H. Mi, B. Lazareva, T. Hatton, A. Narechania, K. Diemer, A. Muruganujan, N. Guo, S. Sato, V. Bafna, S. Istrail, R. Lippert, R. Schwartz, B. Walenz, S. Yooseph, D. Allen, A. Basu, J. Baxendale, L. Blick, M. Caminha, J. Carnes-Stine, P.

179

Caulk, Y. H. Chiang, M. Coyne, C. Dahlke, A. Mays, M. Dombroski, M. Donnelly, D. Ely, S. Esparham, C. Fosler, H. Gire, S. Glanowski, K. Glasser, A. Glodek, M. Gorokhov, K. Graham, B. Gropman, M. Harris, J. Heil, S. Henderson, J. Hoover, D. Jennings, C. Jordan, J. Jordan, J. Kasha, L. Kagan, C. Kraft, A. Levitsky, M. Lewis, X. Liu, J. Lopez, D. Ma, W. Majoros, J. McDaniel, S. Murphy, M. Newman, T. Nguyen, N. Nguyen, M. Nodell, S. Pan, J. Peck, M. Peterson, W. Rowe, R. Sanders, J. Scott, M. Simpson, T. Smith, A. Sprague, T. Stockwell, R. Turner, E. Venter, M. Wang, M. Wen, D. Wu, M. Wu, A. Xia, A. Zandieh and X. Zhu (2001). "The sequence of the human genome." Science 291(5507): 1304-1351. Wakula, P., M. Beullens, H. Ceulemans, W. Stalmans and M. Bollen (2003). "Degeneracy and function of the ubiquitous RVXF motif that mediates binding to protein phosphatase-1." J Biol Chem 278(21): 18817-18823. Walker, A. I., T. Hunt, R. J. Jackson and C. W. Anderson (1985). "Double-stranded DNA induces the phosphorylation of several proteins including the 90 000 mol. wt. heat- shock protein in animal cell extracts." EMBO J 4(1): 139-145. Walker, J. R., R. A. Corpina and J. Goldberg (2001). "Structure of the Ku heterodimer bound to DNA and its implications for double-strand break repair." Nature 412(6847): 607-614. Wang, C. and S. P. Lees-Miller (2013). "Detection and repair of ionizing radiation- induced DNA double strand breaks: new developments in nonhomologous end joining." Int J Radiat Oncol Biol Phys 86(3): 440-449. Wang, D. and H. S. Sul (1995). "Upstream stimulatory factors bind to insulin response sequence of the fatty acid synthase promoter. USF1 is regulated." J Biol Chem 270(48): 28716-28722. Wang, D. and H. S. Sul (1997). "Upstream stimulatory factor binding to the E-box at -65 is required for insulin regulation of the fatty acid synthase promoter." J Biol Chem 272(42): 26367-26374. Wang, Q., F. Gao, T. Wang, T. Flagg and X. Deng (2009). "A nonhomologous end- joining pathway is required for protein phosphatase 2A promotion of DNA double-strand break repair." Neoplasia 11(10): 1012-1021. Wang, Y., G. Ghosh and E. A. Hendrickson (2009). "Ku86 represses lethal telomere deletion events in human somatic cells." Proc Natl Acad Sci U S A 106(30): 12430- 12435. Wang, Y. G., C. Nnakwe, W. S. Lane, M. Modesti and K. M. Frank (2004). "Phosphorylation and regulation of DNA ligase IV stability by DNA-dependent protein kinase." J Biol Chem 279(36): 37282-37290. Waters, C. A., N. T. Strande, D. W. Wyatt, J. M. Pryor and D. A. Ramsden (2014). "Nonhomologous end joining: a good solution for bad ends." DNA Repair (Amst) 17: 39- 51. Wechsler, T., B. P. Chen, R. Harper, K. Morotomi-Yano, B. C. Huang, K. Meek, J. E. Cleaver, D. J. Chen and M. Wabl (2004). "DNA-PKcs function regulated specifically by protein phosphatase 5." Proc Natl Acad Sci U S A 101(5): 1247-1252. Wei, Y. F., P. Robins, K. Carter, K. Caldecott, D. J. Pappin, G. L. Yu, R. P. Wang, B. K. Shell, R. A. Nash, P. Schar and et al. (1995). "Molecular cloning and expression of

180

human cDNAs encoding a novel DNA ligase IV and DNA ligase III, an enzyme active in DNA repair and recombination." Mol Cell Biol 15(6): 3206-3216. West, R. B., M. Yaneva and M. R. Lieber (1998). "Productive and nonproductive complexes of Ku and DNA-dependent protein kinase at DNA termini." Mol Cell Biol 18(10): 5908-5920. Westermarck, J. and W. C. Hahn (2008). "Multiple pathways regulated by the tumor suppressor PP2A in transformation." Trends Mol Med 14(4): 152-160. Weterings, E. and D. J. Chen (2007). "DNA-dependent protein kinase in nonhomologous end joining: a lock with multiple keys?" J Cell Biol 179(2): 183-186. Weterings, E., N. S. Verkaik, H. T. Bruggenwirth, J. H. Hoeijmakers and D. C. van Gent (2003). "The role of DNA dependent protein kinase in synapsis of DNA ends." Nucleic Acids Res 31(24): 7238-7246. Weterings, E., N. S. Verkaik, G. Keijzers, B. I. Florea, S. Y. Wang, L. G. Ortega, N. Uematsu, D. J. Chen and D. C. van Gent (2009). "The Ku80 carboxy terminus stimulates joining and artemis-mediated processing of DNA ends." Mol Cell Biol 29(5): 1134-1142. Whitmore, G. F., A. J. Varghese and S. Gulyas (1989). "Cell cycle responses of two X- ray sensitive mutants defective in DNA repair." Int J Radiat Biol 56(5): 657-665. Williams, D. R., K. J. Lee, J. Shi, D. J. Chen and P. L. Stewart (2008). "Cryo-EM structure of the DNA-dependent protein kinase catalytic subunit at subnanometer resolution reveals alpha helices and insight into DNA binding." Structure 16(3): 468-477. Williams, G. J., M. Hammel, S. K. Radhakrishnan, D. Ramsden, S. P. Lees-Miller and J. A. Tainer (2014). "Structural insights into NHEJ: building up an integrated picture of the dynamic DSB repair super complex, one component and interaction at a time." DNA Repair (Amst) 17: 110-120. Winter, S. L., L. Bosnoyan-Collins, D. Pinnaduwage and I. L. Andrulis (2007). "The interaction of PP1 with BRCA1 and analysis of their expression in breast tumors." BMC Cancer 7: 85. Wold, M. S. (1997). "Replication protein A: a heterotrimeric, single-stranded DNA- binding protein required for eukaryotic DNA metabolism." Annu Rev Biochem 66: 61-92. Wong, R. H., I. Chang, C. S. Hudak, S. Hyun, H. Y. Kwan and H. S. Sul (2009). "A role of DNA-PK for the metabolic gene regulation in response to insulin." Cell 136(6): 1056- 1072. Woodbine, L., A. R. Gennery and P. A. Jeggo (2014). "The clinical impact of deficiency in DNA non-homologous end-joining." DNA Repair (Amst) 16: 84-96. Woodbine, L., J. A. Neal, N. K. Sasi, M. Shimada, K. Deem, H. Coleman, W. B. Dobyns, T. Ogi, K. Meek, E. G. Davies and P. A. Jeggo (2013). "PRKDC mutations in a SCID patient with profound neurological abnormalities." J Clin Invest 123(7): 2969-2980. Woods, D. S., C. R. Sears and J. J. Turchi (2015). "Recognition of DNA Termini by the C-Terminal Region of the Ku80 and the DNA-Dependent Protein Kinase Catalytic Subunit." PLoS One 10(5): e0127321. Wu, P. Y., P. Frit, S. Meesala, S. Dauvillier, M. Modesti, S. N. Andres, Y. Huang, J. Sekiguchi, P. Calsou, B. Salles and M. S. Junop (2009). "Structural and functional interaction between the human DNA repair proteins DNA ligase IV and XRCC4." Mol Cell Biol 29(11): 3163-3172.

181

Wu, W., M. Wang, T. Mussfeldt and G. Iliakis (2008). "Enhanced use of backup pathways of NHEJ in G2 in Chinese hamster mutant cells with defects in the classical pathway of NHEJ." Radiat Res 170(4): 512-520. Wu, X. and M. R. Lieber (1996). "Protein-protein and protein-DNA interaction regions within the DNA end-binding protein Ku70-Ku86." Mol Cell Biol 16(9): 5186-5193. Xing, M., M. Yang, W. Huo, F. Feng, L. Wei, W. Jiang, S. Ning, Z. Yan, W. Li, Q. Wang, M. Hou, C. Dong, R. Guo, G. Gao, J. Ji, S. Zha, L. Lan, H. Liang and D. Xu (2015). "Interactome analysis identifies a new paralogue of XRCC4 in non-homologous end joining DNA repair pathway." Nat Commun 6: 6233. Xu, Y., Y. Xing, Y. Chen, Y. Chao, Z. Lin, E. Fan, J. W. Yu, S. Strack, P. D. Jeffrey and Y. Shi (2006). "Structure of the protein phosphatase 2A holoenzyme." Cell 127(6): 1239-1251. Yajima, H., K. J. Lee and B. P. Chen (2006). "ATR-dependent phosphorylation of DNA- dependent protein kinase catalytic subunit in response to UV-induced replication stress." Mol Cell Biol 26(20): 7520-7528. Yan, Y., P. T. Cao, P. M. Greer, E. S. Nagengast, R. H. Kolb, M. C. Mumby and K. H. Cowan (2010). "Protein phosphatase 2A has an essential role in the activation of gamma-irradiation-induced G2/M checkpoint response." Oncogene 29(30): 4317-4329. Yaneva, M., T. Kowalewski and M. R. Lieber (1997). "Interaction of DNA-dependent protein kinase with DNA and with Ku: biochemical and atomic-force microscopy studies." EMBO J 16(16): 5098-5112. Yano, K. and D. J. Chen (2008). "Live cell imaging of XLF and XRCC4 reveals a novel view of protein assembly in the non-homologous end-joining pathway." Cell Cycle 7(10): 1321-1325. Yano, K., K. Morotomi-Yano, K. J. Lee and D. J. Chen (2011). "Functional significance of the interaction with Ku in DNA double-strand break recognition of XLF." FEBS Lett 585(6): 841-846. Yano, K., K. Morotomi-Yano, S. Y. Wang, N. Uematsu, K. J. Lee, A. Asaithamby, E. Weterings and D. J. Chen (2008). "Ku recruits XLF to DNA double-strand breaks." EMBO Rep 9(1): 91-96. Yoo, S. and W. S. Dynan (1998). "Characterization of the RNA binding properties of Ku protein." Biochemistry 37(5): 1336-1343. Yoo, S. and W. S. Dynan (1999). "Geometry of a complex formed by double strand break repair proteins at a single DNA end: recruitment of DNA-PKcs induces inward translocation of Ku protein." Nucleic Acids Res 27(24): 4679-4686. Yu, Y., B. L. Mahaney, K. Yano, R. Ye, S. Fang, P. Douglas, D. J. Chen and S. P. Lees- Miller (2008). "DNA-PK and ATM phosphorylation sites in XLF/Cernunnos are not required for repair of DNA double strand breaks." DNA Repair (Amst) 7(10): 1680-1692. Yu, Y., W. Wang, Q. Ding, R. Ye, D. Chen, D. Merkle, D. Schriemer, K. Meek and S. P. Lees-Miller (2003). "DNA-PK phosphorylation sites in XRCC4 are not required for survival after radiation or for V(D)J recombination." DNA Repair (Amst) 2(11): 1239- 1252. Yu, Y. M., S. M. Pace, S. R. Allen, C. X. Deng and L. C. Hsu (2008). "A PP1-binding motif present in BRCA1 plays a role in its DNA repair function." Int J Biol Sci 4(6): 352- 361.

182

Yurchenko, V., Z. Xue and M. J. Sadofsky (2006). "SUMO modification of human XRCC4 regulates its localization and function in DNA double-strand break repair." Mol Cell Biol 26(5): 1786-1794. Zagorska, A., M. Deak, D. G. Campbell, S. Banerjee, M. Hirano, S. Aizawa, A. R. Prescott and D. R. Alessi (2010). "New roles for the LKB1-NUAK pathway in controlling myosin phosphatase complexes and cell adhesion." Sci Signal 3(115): ra25. Zhang, S., H. Yajima, H. Huynh, J. Zheng, E. Callen, H. T. Chen, N. Wong, S. Bunting, Y. F. Lin, M. Li, K. J. Lee, M. Story, E. Gapud, B. P. Sleckman, A. Nussenzweig, C. C. Zhang, D. J. Chen and B. P. Chen (2011). "Congenital bone marrow failure in DNA- PKcs mutant mice associated with deficiencies in DNA repair." J Cell Biol 193(2): 295- 305. Zhang, Z., W. Hu, L. Cano, T. D. Lee, D. J. Chen and Y. Chen (2004). "Solution structure of the C-terminal domain of Ku80 suggests important sites for protein-protein interactions." Structure 12(3): 495-502. Zhao, Y., H. D. Thomas, M. A. Batey, I. G. Cowell, C. J. Richardson, R. J. Griffin, A. H. Calvert, D. R. Newell, G. C. Smith and N. J. Curtin (2006). "Preclinical evaluation of a potent novel DNA-dependent protein kinase inhibitor NU7441." Cancer Res 66(10): 5354-5362. Zheng, X. F., P. Kalev and D. Chowdhury (2015). "Emerging role of protein phosphatases changes the landscape of phospho-signaling in DNA damage response." DNA Repair (Amst) 32: 58-65. Zhou, J., H. T. Pham, R. Ruediger and G. Walter (2003). "Characterization of the Aalpha and Abeta subunit isoforms of protein phosphatase 2A: differences in expression, subunit interaction, and evolution." Biochem J 369(Pt 2): 387-398. Zhu, C., M. A. Bogue, D. S. Lim, P. Hasty and D. B. Roth (1996). "Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates." Cell 86(3): 379-389. Zolner, A. E., I. Abdou, R. Ye, R. S. Mani, M. Fanta, Y. Yu, P. Douglas, N. Tahbaz, S. Fang, T. Dobbs, C. Wang, N. Morrice, M. J. Hendzel, M. Weinfeld and S. P. Lees-Miller (2011). "Phosphorylation of polynucleotide kinase/ phosphatase by DNA-dependent protein kinase and ataxia-telangiectasia mutated regulates its association with sites of DNA damage." Nucleic Acids Res 39(21): 9224-9237.

183

APPENDIX

184

APPENDIX A: Purification of Ku heterodimers from insect cells using baculovirus system.

Figure A-1 i shows the successful cloning of Ku70 and Ku80 cDNA into the corresponding vectors. These cDNAs were then used to generate bacmid by a transposition event in DH10bac cells. Figure A-1 ii and iii shows the successful generation of Ku70 and Ku80 full-length and mutant bacmids which were verified by PCR as explained in figure legend. These bacmids were then transfected into the SF9 insect cells and amplified further by two additional rounds of transfection in insect cells, as explained in Materials and Methods. The 3 rounds of baculovirus amplification generated high titre of virus expressing Ku70 and Ku80 bacmids. The P3 virus stock were used for protein expression and purification. As explained above, Ku70 and Ku80 cDNAs were generated in separate vectors but they were co-transfected into the insect cells for protein expression and purification. Figure A-2-8 depict the chromatograms and Coomassie staining of SDS-PAGE gels run during protein purification. Since Ku80 full-length and mutants were cloned into the histidine tagged vector, the initial column for protein purification used was a Histidine trap column (GE Healthcare). The eluted fractions were analysed for impurities and only the fractions containing Ku heterodimers were combined together and purified further by DEAE and Heparin columns.

185

Figure A-1 Generation of plasmids containing Ku70 and Ku80 cDNAs and generation of bacmids containing Ku70 and Ku80 for expression in insect cells.

Panel i) Ku70 cDNA was cloned into the pFastbac1 vector whereas the Ku80 cDNA and the C-terminal truncation were cloned into the pFastbac HTA

186

vector which has an N-terminal hexa histidine tag. Cloning was verified by double digestion with BamH1 and Xho1 restriction enzymes. Further verification was done by sequencing the plasmids. Panel ii) Recombinant bacmids were generated by transposition of the Ku70 and Ku80 cDNA in DH10 Bac™ cells individually. White colonies were grown in S.O.C medium, bacmids were isolated and PCR was performed using M13 forward and reverse primers (see Table 2-2 for primer sequences). As a control, blue colonies were grown, bacmids were isolated and PCR was performed. A successful transposition event would show a PCR band corresponding to 2300 bp + the size of the insert, which in this case was 4127 bp for Ku70, and 4626 bp for Ku80. The arrow indicates the 300 bp sequence obtained only with bacmids isolated from blue colonies but not with bacmids from white colonies (see text for details) suggesting successful transposition. Panel iii), arrows indicate bands suggesting succesful transposition of Ku80 C-terminal truncation mutants [4584 bp for Ku80 (1-718) and 4137 bp for Ku80 (1-569)] into the bacmid.

A detailed procedure is provided in Materials and Methods section. It was however, noted that, Ku full-length heterodimer required additional 2 columns Mono Q (GE Healthcare) and ssDNA cellulose, due to the large amounts of contaminating impurities. Ku LH and - core mutants however did not need an additional column. Figure 4-11 A shows the final purified heterodimers which were validated in Figure 4-11 B by western blotting with a Ku80 subunit antibody. The next step was to use the proteins to characterize in vitro their ability to bind DNA substrates, activate DNA-PKcs kinase activity and their ability to interact with DNA-PKcs using biotin pull down assays.

187

Figure A-2 Purification of Ku full-length heterodimer on a His trap (Ni2+-NTA) column followed by a DEAE column.

Panel i) shows the chromatogram of the insect cell lysate passed through a His-Trap column. Panel ii) and iii) show Coomassie stained gels of fractions from the His-Trap column containing the Ku heterodimer. In panel iv), pooled fractions from the His-Trap column were passed through a DEAE column. Fractions containing the Ku heterodimer were identified by Coomassie staining of the gel. See Materials and Methods for details.

188

Figure A-3 Purification of Ku full-length heterodimer on a heparin column.

Panel i) shows the chromatogram from purification of Ku heterodimer containing fractions from the DEAE column over a heparin-HiTrap column. Panels ii) and iii) show the Coomassie stained gels of the resulting fractions from the heparin column. See Materials and Methods for details.

189

Figure A-4 Purification of Ku full-length heterodimer over a Mono Q column, followed by a single stranded DNA cellulose column.

Panel i) shows the chromatogram showing elution of Ku containing fractions from a Mono Q column. Panel ii) shows the Coomassie stained gel of fractions containing Ku heterodimer after the Mono Q column. Panel iii) shows the fractions containing purified Ku heterodimer eluting from the ssDNA cellulose column. See Materials and Methods for details.

190

Figure A-5 Purification of the Ku70/80 LH mutant heterodimer using His trap and DEAE columns.

Panel i) shows the chromatogram of insect cell lysate passed through His trap column. Panel ii) and iii) shows the Coomassie stained gel of fractions from the His-trap column to observe the fractions containing Ku C-terminal truncated heterodimer. In panel iv) pooled fractions from His trap column was passed through DEAE column. Fractions containing Ku heterodimer were identified by Coomassie staining of gel. See Materials and Methods for details.

191

Figure A-6 Purification of the Ku70/80 LH mutant heterodimer over a heparin column.

Panel i) shows the chromatogram from purification of Ku C-terminal truncated heterodimer containing fractions from the DEAE column over a heparin- HiTrap column. Panels ii) and iii) show the Coomassie stained gels of the resulting fractions from the heparin column. See Materials and Methods for details.

192

Figure A-7 Purification of the Ku70/80 core mutant using His trap and DEAE.

193

Figure A-8 Purification of Ku70/80 core mutant heterodimer was purified using heparin.

194

License Number 3760990846767 License date Dec 02, 2015 Licensed content publisher Elsevier Licensed content publication DNA Repair Non-homologous end joining: Licensed content title Emerging themes and unanswered questions Sarvan Kumar Radhakrishnan, Licensed content author Nicholas Jette, Susan P. Lees-Miller Licensed content date May 2014 Licensed content volume number 17 Licensed content issue number n/a Number of pages 7 Type of Use reuse in a thesis/dissertation Portion figures/tables/illustrations Number of figures/tables/illustrations 1 Format both print and electronic Are you the author of this Elsevier Yes article? Will you be translating? No Original figure numbers Fig.1 A tale of a ‘tail’ – Understanding the Title of your thesis/dissertation role of Ku80 C-terminal region in nonhomologous end joining Expected completion date Dec 2015 Estimated size (number of pages) 200 Elsevier VAT number GB 494 6272 12 Permissions price 0.00 CAD VAT/Local Sales Tax 0.00 CAD / 0.00 GBP Total 0.00 CAD

195