Canadian Journal of Physiology and Pharmacology
Protective Effect of Trillium Tschonoskii Maxim Saponin on CCl4-induced Acute Liver Injury of Rats through Apoptosis Inhibition
Journal: Canadian Journal of Physiology and Pharmacology
Manuscript ID cjpp-2016-0228.R1
Manuscript Type: Article
Date Submitted by the Author: 27-May-2016
Complete List of Authors: Wu, Hao; Hubei University for Nationalities, College of Science and TechnologyDraft Qiu, Yong; Hubei University for Nationalities, College of Medicine Shu, Ziyang; Wuhan Sports University, College of Health Science Zhang, Xu; Wuhan Sports University, College of Health Science Li, Renpeng; Hubei University for Nationalities, College of Science and Technology Liu, Su; Affiliated Hospital of Hubei University for Nationalities Chen, Longquan; Hubei University for Nationalities, College of Medicine Liu, Hong; Hubei University for Nationalities, College of Medicine Chen, Ning; Wuhan Sports University, College of Health Science
Trillium tschonoskii Maxim (TTM), liver injury, hepatomegaly, inflammatory Keyword: factor, apoptosis
https://mc06.manuscriptcentral.com/cjpp-pubs Page 1 of 28 Canadian Journal of Physiology and Pharmacology
Manuscript type: Original paper
Protective Effect of Trillium Tschonoskii Maxim Saponin on CCl 4-induced
Acute Liver Injury of Rats through Apoptosis Inhibition
Hao Wu 1, 2, #, Yong Qiu 2, #, Ziyang Shu 3, Xu Zhang 3, Renpeng Li 1, Su Liu 4, Longquan Chen 2, Hong Liu 2, *, Ning Chen 3, *
1College of Science and Technology, Hubei University for Nationalities, Enshi 445000, China 2College of Medicine, Hubei University for Nationalities, Enshi 445000, China 3Hubei Key Laboratory of Sport Training and Monitoring, College of Health Science, Wuhan Sports University, Wuhan 430079, China 4Affiliated Hospital of Hubei UniversityDraft for Nationalities, Enshi 445000, China
Running title: TTM against liver injury #These authors contributed equally to this project.
*Corresponding author: Ning Chen, PhD, Professor of Biochemistry College of Health Science, Wuhan Sports University, Wuhan 430079, China Tel: 86 27 67846140 Fax: 86 27 67846140 E mail: [email protected]
Hong Liu, Professor of Pharmacology School of Medicine, Hubei University for Nationalties, Enshi 445000, China Tel: 86 718 8437479 Fax: 86 718 8437479 E mail: [email protected]
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 2 of 28
Abstract
In order to explore hepatoprotective role and underlying mechanisms of TTM, 36 rats were randomly divided into control, CCl 4 induced liver injury model, and DDB and low, moderate and high dose TTM treatment groups. After CCl 4 induced model establishment, the rats from
DDB and TTM groups were administrated with DDB at 0.2 g/kg ⋅d and TTM at 0.1, 0.5 and
1.0 g/kg ⋅d, while the rats from control and model groups were administrated with saline.
Upon 5 days treatments, all rats were sacrificed for determining serum ALT and AST levels and liver index, examining histopathological changes in liver through HE and TUNEL staining, and evaluating TNF α and IL 6 mRNA expression by RT PCR, and Caspase 3,
Bcl 2 and Bax expression by WesternDraft blot. Results indicated that CCl 4 could induce acute liver injury and abnormal liver function in rats with obvious hepatomegaly, increased liver index, high ALT and AST levels, up regulated TNF α and IL 6, and overexpressed Bax and
Caspase 3. However, DDB and TTM could execute protective role in CCl 4 induced liver injury in rats through reducing ALT and AST levels, rescuing hepatomegaly, down regulating inflammatory factors and inhibiting hepatocyte apoptosis in a dose dependent manner. Therefore, TTM has obvious protective role in CCl 4 induced liver injury of rats through inhibiting hepatocyte apoptosis.
Key words: Trillium tschonoskii Maxim (TTM), liver injury, hepatomegaly, inflammatory factor, apoptosis.
https://mc06.manuscriptcentral.com/cjpp-pubs Page 3 of 28 Canadian Journal of Physiology and Pharmacology
Introduction
Liver plays an important role in metabolism and detoxification in human body. It is also
one of the organs sensitive to a series of stimuli such as trauma, viral infection, autoimmune
disease and other exogenous materials including drugs, alcohol and toxins, thus resulting in
its acute or chronic damage (Shi et al. 2014; Wang et al. 2007). Severe acute liver injury
could result in life threatening clinical problems such as jaundice, serious blood coagulation
disorders and high death rate (Bernal et al. 2010). At the same time, the long term
accumulated liver injury also can lead to liver fibrosis, cirrhosis and hepatocellular carcinoma
(HCC), so it is very important for the prevention of liver injury (Dong et al. 2016). Although there is an increasing drug demand Draftfor the protection of the liver, modern medicine is still lack of reliable liver protective drugs (Lu et al. 2016), and severe acute liver injury is still a
great challenge in the field of clinical medicine (Auzinger and Wendon 2008).
During long application history in China, Chinese herbs or natural products have
obvious treatment efficacy for a series of diseases with little side effects and low cost (Kou
and Chen 2012; Kou et al. 2013; Kou et al. 2015; Zhang et al. 2014). Therefore, more and
more people are exploring a novel strategy for the prevention and treatment of liver diseases
through Chinese herbs (Akhter et al. 2015; Yan et al. 2015).
Trillium tschonoskii Maxim (TTM), a pharmacologically important medicinal plant
containing steroidal saponins and alkaloids from Liliaceae, is widely distributed in central
and western China (Li et al. 2005; Zhang et al. 2013). Its dried rhizome and root have
medicinal roles in promoting blood circulation and stanching bleeding, detoxification,
tranquilizing and allaying excitement, so that it is usually used for the treatment of
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 4 of 28
hypertension, neurasthenia, dizziness, headache, traumatic injury and bleeding as well as a series of liver disorders (Fu 1992). TTM is honored as one of four magical herbs from Tujia nationality due to its obvious curative effects for a series of diseases. However, as it’s a kind of medicinal plant from the minority in China, its clinical application is limited in the regions of Tujia and Miao nationalities without extension all over the China.
According to previous reports, saponins from several herbs are known to induce apoptosis in cancer cells and are proposed to be promising modulators of drug resistance.
Paris saponin VII extracted from T. tschonoskii can reverse multidrug resistance of adriamycin resistant MCF 7/ADR cells via P glycoprotein inhibition and apoptosis augmentation (Li et al. 2014), inhibitDraft metastasis by modulating matrix metalloproteinases in colorectal cancer cells (Fan et al. 2015 b) and reduce migration and invasion in human A549 lung cancer cells (Fan et al. 2015 a). The saponin TTB2 isolated from T. tschonoskii Maxim can exert anticancer effects and may be a potential candidate for the development of anticancer drugs (Huang and Zou 2015). The true incidence of phytotherapy related hepatotoxicity and its pathogenic mechanisms are largely unknown (Tarantino et al. 2009). It is important to increase the awareness of both clinicians and patients about the potential dangers of herbal remedies. Meanwhile, the role of TTM in liver disorders and underlying mechanisms are also not fully understood. In order to further confirm its treatment efficacy and extend its clinical application, we established CCl 4 induced acute liver injury model in rats to explore its protective roles and underlying mechanisms for diseases associated with acute liver injury.
https://mc06.manuscriptcentral.com/cjpp-pubs Page 5 of 28 Canadian Journal of Physiology and Pharmacology
Materials and methods
The preparation of TTM saponin
TTM provided by Specimen Center of Hubei University for Nationalities was smashed
after dried in 60 °C constant temperature oven, then sequentially immersed in 75% alcohol
for 2 hours and completed ethanol reflux extraction for three times. The alcohol extract after
filtration was concentrated to 1 g/mL for future use. The saponin in TTM extract was
analyzed by high performance liquid chromatography to reveal total saponin of 18.54%.
Animal grouping and drug administration
The healthy male rats with body weights of 180 220 g were ordered from Hubei Research Center of Laboratory AnimalsDraft (License number: 2015 0018). All rats were
randomly divided into 6 groups including control group, CCl 4 induced acute liver injury
model group, biphenyl dimethyl dicarboxylate (DDB) group at the dose of 0.2 g/kg ⋅d, and
TTM groups at low, moderate and high dosages (0.1, 0.5 and 1.0 g/kg ⋅d), respectively. Six
rats were in each group. All rats were subjected to adaptive feeding with regular feeds for 1
week. The rats were subjected to diet restriction for 12 h prior to model establishment. The
rats from the control group were subjected to subcutaneous injection of peanut oil at the dose
of 5 mL/kg, while the rats from other groups were subjected to the administration of peanut
oil mixed with 25% CCl 4 at the dose of 5 mL/kg (equal to 2 g/kg for CCl 4) for the
establishment of acute liver injury model. After model establishment, the rats from treatment
groups were administrated with DDB and TTM at the designed dosages through gavage twice
a day with an interval of 12 h for 5 successive days. The diets of the rats were restricted
except water after the last drug administration. Twenty four hours later, the rats were
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 6 of 28
anesthetized with 10% chloraldurate, and blood and liver tissue samples were harvested for analysis.
Liver index determination
The body weight of each rat was measured prior to being sacrificed. Similarly, the wet weight of rat liver was measured after sacrificed. The liver index = liver weight/rat body weight × 100%.
Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) level measurement
Blood samples of the rats after last drug administration for 12 h were harvested in a common anticoagulant tube, and thenDraft subjected to the centrifugation at the speed of 1000 ×g for 5 min. The supernatant was collected, and then serum ALT and AST levels were determined by immunity transmission turbidity method using commercially available assay kits (Mindray Bio medical Electronics Co., Ltd, Shenzhen, China) in an automatic biochemical analyzer (BS 800M, Mindray Bio medical Electronics Co., Ltd, Shenzhen,
China).
Real-time polymerase chain reaction (RT-PCR) detection
Approximately 0.1 g liver tissue was subjected to complete homogenate. Total RNA was extracted using Trizon reagent (Invitrogen, USA) following manufacturer’s instructions and then reversely transcribed into cDNA. The mRNA expression levels of IL 6 and TNF α were determined through fluorescence quantitative RT PCR. The forward and reversed primers for
IL 6 were 5’ GCTCTCCGCAAGAGACTTCCA 3’ and
5’ GGTCTGTTGTGGGTGGTATCC 3’, respectively. The forward and reversed primers for
https://mc06.manuscriptcentral.com/cjpp-pubs Page 7 of 28 Canadian Journal of Physiology and Pharmacology
TNF α were 5’ GGTGATTGGTCCCAACA 3’ and 5’ GTCTTTGAGATCCATGCC 3’,
respectively. The forward and reversed primers for β actin as the internal control were
5’ CACGATGGAGGGGCCGGACTCATC 3’ and
5’ TAAAGACCTCTATGCCAACACAGT 3’, respectively. The relative expression level of
IL 6 or TNF α was calculated by the ratio of IL 6 or TNF α to β actin.
Histology and immunohistochemistry
The small slice of liver tissue from each rat was subjected to the fixing by 4%
paraformaldehyde, regular embedding by paraffin, sectioning, hematoxylin eosin (HE)
staining and Ki67 staining (Abcam, Cambridge, USA), and the slides were observed for conventional morphological evaluationDraft under a light microscope (Nikon Eclipse TE2000 U, NIKON, Japan) and photographed at 100 × magnification.
Terminal-deoxynucleoitidyl transferase-mediated nick end labeling (TUNEL) staining
The sections of liver tissues were analyzed by terminal deoxynucleotidyl transferase
dUTP nick end labeling (TUNEL) assay using the in situ cell death detection kit (Roche
Diagnostics GmbH, Mannheim, Germany) according to the manufacturer’s instructions.
TUNEL positive cells were captured under a light microscope (Nikon Eclipse TE2000 U,
NIKON, Japan) and analyzed through Image pro plus 6.0 software (Media Cybernetics Inc.,
MD, USA).
Apoptosis-related protein expression evaluated by Western blot
Approximately 0.1 g of liver tissue after homogenizing was lysed with RIPA buffer
(Santa Cruz Biotechnology, Santa Cruz, CA) in the presence of PMSF (Beyotime Institute of
Biotechnology, Jiangsu, China) at the speed of 4000 ×g at 4 °C for 20 min. The collected
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 8 of 28
supernatant was added with loading buffer and boiled at 95 °C water batch for 5 min. Then,
20 g total protein was separated on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE), and transferred to PVDF membrane. The membrane was blocked with 5% skim milk at room temperature for 3 h. The targeted protein on the membrane was probed with primary antibody such as Caspase 3, Bax or Bcl 2 (Cell
Signaling Technology, USA, 1:1000) at 4 °C overnight. The membrane was then washed with TBS T buffer for three times with 15 min in each time. Sequentially, the membrane was incubated with secondary antibody, HRP labeled anti rabbit IgG (Cell Signaling Technology,
USA, 1:30000) for 2 h, and washed with TBS T buffer for three times. Then, the chemiluminescence agent was incubatedDraft with the membrane in dark room for 2 min and the protein probed by primary antibody in the membrane was imaged. The β actin was used as an internal reference. The data were analyzed by the software Quantity one 4.6.1 (Bio Rad
Software Inc., California, USA).
Statistical analysis
All data were expressed as mean ± standard deviation (M ± SD). All statistical analyses were conducted using SPSS19.0 software (SPSS, Inc., Chicago, USA) and GraphPad Prism
6.0 (GraphPad Software, Inc., San Diego, USA) through ANOVA with post hoc tests. The significant difference and very significant difference were considered at P < 0.05 and P <
0.01, respectively.
Results
TTM rescues CCl 4-induced acute liver injury
https://mc06.manuscriptcentral.com/cjpp-pubs Page 9 of 28 Canadian Journal of Physiology and Pharmacology
Serum ALT and AST levels, as the golden biomarkers for liver damage, are
well accepted indicators to evaluate the severity of liver injury (Shi et al. 2014). In order to
validate the treatment efficacy of TTM on acute liver injury, we established the rat model
with CCl 4 induced acute liver injury to explore the treatment efficacy of TTM. Compared
with the control group, the levels of serum ALT and AST in the model group revealed an
obvious increase ( P < 0.01 and P < 0.05, respectively), indicating that the establishment of
CCl 4 induced acute liver injury model was successful. In contrast, after treatment with DDB
and TTM, the serum ALT levels of the rats treated with DDB and TTM at low, moderate and
high dosages revealed a very significant reduction ( P < 0.01); the serum AST levels of the rats treated with DDB and high doseDraft TTM exhibited a significant decrease ( P < 0.05), indicating that TTM treatment can decrease serum ALT and AST levels in a dose dependent
manner (Figures 1A and 1B).
TTM inhibits CCl 4-induced hepatomegaly and liver index
In order to explore the effect of TTM on CCl 4 induced histopathological change of liver
tissues in rats, we compared fresh liver tissues of the rats from various treatments. As shown
in Figure 2A, the rats from CCl 4 induced model group revealed obvious hepatomegaly when
compared with the rats from control group and treatment groups. Subjected to the treatments
with DDB and TTM, the hepatomegaly of the rats exhibited an obvious inhibition when
compared with that of the CCl 4 induced model rats, suggesting that both DDB and TTM have
obvious protective roles in CCl 4 induced hepatomegaly.
Liver index reflects liver pathological changes and nutritional status in the body (Chen
1993). Based on the results of liver index, its significant difference between model group and
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 10 of 28
control group was observed ( P < 0.01), suggesting that CCl 4 could result in hepatomegaly, while the treatment with BBD and TTM at various dosages could inhibit CCl 4 induced hepatomegaly in rats (Figure 2B).
In addition, the liver tissues were examined with HE staining. As shown in Figure 2C, normal liver lobule structure and liver cells in rats from normal control group were observed.
In contrast, in the CCl 4 induced model group, diffused edema, necrosis and inflammatory cell infiltration in liver tissues were observed. However, the treatments with DDB and TTM at various dosages could rescue the liver damage with the significant reduction of diffused edema, necrosis and inflammatory cell infiltration in liver tissues when compared with the model group. Moreover, the protectionDraft of TTM on liver tissues revealed an obvious dose dependent manner.
TTM reduces inflammatory factors for CCl 4-induced acute liver injury
TNF α and IL 6 are two important pro inflammatory factors causing cell inflammation and death (Diehl 2000; Schmich et al. 2011; Tilg 2001). Then, we examined the mRNA expression of both factors through RT PCR. Results indicated that acute liver injury induced by CCl 4 could result in an obvious increase of TNF α and IL 6 ( P < 0.05, and P < 0.01, respectively) (Figures 3A and 3B). On the other hand, after treatment with DDB and TTM at various dosages, the expression of TNF α and IL 6 in DDB and TTM groups revealed an obvious reduction. Therefore, TTM can alleviate inflammatory response of liver cells to execute the protective function for liver.
TTM inhibits apoptosis of liver cells induced by CCl 4
https://mc06.manuscriptcentral.com/cjpp-pubs Page 11 of 28 Canadian Journal of Physiology and Pharmacology
In order to further understand the protective mechanism of TTM for acute liver injury,
the cell apoptosis in liver tissues from the rats subjected to CCl 4 induction and DDB and
TTM treatments at various dosages were examined through TUNEL staining. Compared with
normal control group, a large number of cell apoptosis in liver tissues due to the CCl 4
induction in the model group was observed (Figure 4A); in contrast, subjected to the
treatments with DDB and TMM at moderate and high dosages, the apoptotic cell number
revealed a significantly decrease and the reduced apoptosis of liver cells exhibited as a
dose dependent manner for TTM (Figure 4B). Similarly, compared with the normal control
group, CCl 4 induced liver tissues revealed an obviously increased Caspase 3 and Bax and reduced Bcl 2; on the other hand, theDraft treatments with DDB and TTM at moderate and high dosages could result in the down regulation of Caspase 3 and the up regulation of Bcl 2
when compared with those in CCl 4 induced liver injury model group (Figure 4C). Therefore,
the protective role of TTM in acute liver injury should be correlated with the inhibition of
liver cell apoptosis.
Discussion
The mechanisms of the diseases with acute liver injury are very complex. Current reports
are mainly focused on oxidative stress, inflammation and apoptosis (Abouzied et al. 2016;
Chan et al. 2014; Schmich et al. 2011). The CCl 4 induced acute liver injury rat model is well
accepted, which can result in substantial liver cell damage and liver dysfunction (Masuda
2006; Weber et al. 2003). Once CCl 4 is absorbed by the body, it can activate liver
cytochrome (P450) to generate trichloromethyl free radicals (CC 3•) and peroxide
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 12 of 28
trichloromethyl free radicals (CCl 3O2•), thus attacking phospholipid molecules on cell membrane of liver, increasing cell membrane permeability, and finally leading to liver cell swelling, necrosis, and symptoms of acute liver injury (LeSage et al. 1999; Weber et al.
2003).
In the present study, we utilize CCl 4 induced rat model with acute liver injury to clarify the treatment efficacy of TTM and underlying mechanisms. The administration of TTM at various dosages for model rats with acute liver injury by lavage for five days can reduce the levels of serum ALT and AST and liver index, and down regulate the expression of TNF α and IL 6. HE staining revealed that TTM treatment could alleviate inflammatory necrosis of liver tissues, and present an obvious protectiveDraft effect on liver damage. It is well known that the liver has strong capacity of regeneration and recovery (Kim and
Kim 2013). Therefore, we suspect TTM protection against acute liver injury may be due to the promotion from liver cell regeneration. In our study, compared with CCl 4 model group, the expression of Ki67 revealed an obvious increase after the treatment with DDB; in contrast, no obvious expression of Ki67 was observed in liver tissues from the rats treated with TTM at various dosages (Figure 5), suggesting that the protective effect of TTM on acute liver injury may be not correlated with the regeneration of liver cells.
Mitochondrial apoptotic pathway is one of the major pathways of apoptosis. Bcl 2 protein family plays a vital role in mitochondrial apoptotic pathway (Tischner et al. 2010).
Bax, Bcl 2, and Bcl 2 protein family can promote or inhibit the release of cytokines and other apoptotic factors through changing the mitochondrial outer membrane permeability (Rosse et al. 1998). Cytochrome C could mediate the activity of Caspase 3, and the activated Caspase 3
https://mc06.manuscriptcentral.com/cjpp-pubs Page 13 of 28 Canadian Journal of Physiology and Pharmacology
can induce cell apoptosis (Cusack et al. 2013). In the present study, CCl 4 induced liver cell
apoptosis could be obviously alleviated in the presence of TTM treatment under the
examination by TUNEL staining; similarly, based on the analysis of Western blot, TTM
could reduce the expression of cleaved Caspase 3 and Bax, and improve the expression of
Bcl 2, thus further verifying the inhibitory role of TTM in apoptosis of liver cells for the
protection of acute liver injury. However, apoptotic cell death can be also associated with
mitochondrial membrane depolarization and cytochrome C release. The exposure of
hepatocytes to hepatototoxic substances may result in increased ROS production and
mitochondrial damage, and is balanced by the presence of antioxidant substances. Therefore, circulating levels of cytochrome Draft C, gamma glutamyl transferase, triglycerides and unconjugated bilirubin, as well as Bcl 2 in overweight/obese patients is highly associated
with non alcoholic fatty liver diseases (Tarantino et al. 2011 a; Tarantino et al. 2011 b).
Whether TTM can inhibit the release of cytochrome C, alleviate the production of ROS,
reduce the damage of mitochondria, and be benefit for non alcoholic fatty liver diseases
needs to be further explored. As the crosstalk between apoptosis and autophagy for
maintaining cellular hemostasis in a series of diseases (Chen and Karantza 2011; Chen and
Karantza Wadsworth 2009; Fan et al. 2016), whether TTM can execute the prevention and
treatment of CCl 4 induced acute liver injury through the functional status of autophagy also
needs to be further explored.
In conclusion, TTM has a protective effect against acute liver injury through reducing
liver cell apoptosis rather than promoting liver cell proliferation. This study provides the
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 14 of 28
experimental basis for TTM application in acute liver injury to extend its application fields as a novel drug against acute liver injury.
Draft
https://mc06.manuscriptcentral.com/cjpp-pubs Page 15 of 28 Canadian Journal of Physiology and Pharmacology
Acknowledgements
This study was finically supported by grants from Hubei Province Scientific Research
Foundation (D200729005), Chutian Scholar Program from Education Department of Hubei
Province, Hubei Superior Discipline Groups of Physical Education and Health Promotion and
Innovative Start up Foundation from Wuhan Sports University to NC. The authors would like
to express their gratitude to the School of Basic Medical Sciences from Wuhan University for
providing a partial experimental platform.
Conflict of interest All authors have declared no conflictDraft of interest associated with this project.
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 16 of 28
References
Abouzied, M.M., Eltahir, H.M., Taye, A., and Abdelrahman, M.S. 2016. Experimental
evidence for the therapeutic potential of tempol in the treatment of acute liver injury.
Mol. Cell. Biochem. 411 (1 2): 107 115. doi: 10.1007/s11010 015 2572 2.
Akhter, S., Rahman, M.A., Aklima, J., Hasan, M.R., and Chowdhury, J.M. 2015.
Antioxidative Role of Hatikana (Leea macrophylla Roxb.) Partially Improves the
Hepatic Damage Induced by CCl4 in Wistar Albino Rats. Biomed. Res. Int. 2015 :
356729. doi: 10.1155/2015/356729.
Auzinger, G., and Wendon, J. 2008. Intensive care management of acute liver failure. Curr. Opin. Crit. Care, 14 (2): 179 188.Draft doi: 10.1097/MCC.0b013e3282f6a450. Bernal, W., Auzinger, G., Dhawan, A., and Wendon, J. 2010. Acute liver failure. Lancet,
376 (9736): 190 201. doi: 10.1016/S0140 6736(10)60274 7.
Chan, C.C., Lee, K.C., Huang, Y.H., Chou, C.K., Lin, H.C., and Lee, F.Y. 2014. Regulation
by resveratrol of the cellular factors mediating liver damage and regeneration after
acute toxic liver injury. J. Gastroenterol. Hepatol. 29 (3): 603 613. doi:
10.1111/jgh.12366.
Chen, N., and Karantza, V. 2011. Autophagy as a therapeutic target in cancer. Cancer Biol.
Ther. 11 (2): 157 168.
Chen, N., and Karantza Wadsworth, V. 2009. Role and regulation of autophagy in cancer.
Biochim. Biophys. Acta, 1793 (9): 1516 1523. doi: 10.1016/j.bbamcr.2008.12.013.
Chen, Q. 1993. Chinese pharmacological research methods. China Traditional Chinese
Medicine Publishing House, Beijing. pp. 951 953.
https://mc06.manuscriptcentral.com/cjpp-pubs Page 17 of 28 Canadian Journal of Physiology and Pharmacology
Cusack, C.L., Swahari, V., Hampton Henley, W., Michael Ramsey, J., and Deshmukh, M.
2013. Distinct pathways mediate axon degeneration during apoptosis and
axon specific pruning. Nat. Commun. 4: 1876. doi: 10.1038/ncomms2910.
Diehl, A.M. 2000. Cytokine regulation of liver injury and repair. Immunol. Rev. 174 :
160 171.
Dong, Y., Liu, Y., Kou, X., Jing, Y., Sun, K., Sheng, D., Yu, G., Yu, D., Zhao, Q., Zhao, X.,
Li, R., Wu, M., and Wei, L. 2016. The protective or damaging effect of Tumor
necrosis factor alpha in acute liver injury is concentration dependent. Cell Biosci. 6: 8.
doi: 10.1186/s13578 016 0074 x. Fan, J., Kou, X., Jia, S., Yang, X., Yang,Draft Y., and Chen, N. 2016. Autophagy as a Potential Target for Sarcopenia. J. Cell. Physiol. 231 (7): 1450 1459. doi: 10.1002/jcp.25260.
Fan, L., Li, Y., Sun, Y., Han, J., Yue, Z., Meng, J., Zhang, X., Zhang, F., and Mei, Q. 2015 a.
Paris Saponin VII Inhibits the Migration and Invasion in Human A549 Lung Cancer
Cells. Phytother. Res. 29 (9): 1366 1372. doi: 10.1002/ptr.5389.
Fan, L., Li, Y., Sun, Y., Yue, Z., Meng, J., Zhang, X., Zhang, R., Zhang, D., Zhang, F., and
Mei, Q. 2015 b. Paris saponin VII inhibits metastasis by modulating matrix
metalloproteinases in colorectal cancer cells. Mol. Med. Rep. 11 (1): 705 711. doi:
10.3892/mmr.2014.2728.
Fu, L. 1992. Plant China plant red data book: rare and endangered Plants. Science Publishing
House Press, Beijing.
Huang, W., and Zou, K. 2015. Cytotoxicity of the saponin TTB2 on Ewing sarcoma cells.
Exp. Ther. Med. 10 (2): 625 628. doi: 10.3892/etm.2015.2544.
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 18 of 28
Kim, T.Y., and Kim, D.J. 2013. Acute on chronic liver failure. Clin. Mol. Hepatol. 19(4):
349 359. doi: 10.3350/cmh.2013.19.4.349.
Kou, X., and Chen, N. 2012. Pharmacological potential of ampelopsin in Rattan tea. Food
Science and Human Wellness, 1(1): 14 18.
Kou, X., Kirberger, M., Yang, Y., and Chen, N. 2013. Natural products for cancer prevention
associated with Nrf2 ARE pathway. Food Science and Human Wellness, 2(1): 22 28.
Kou, X., Li, J., Bian, J., Yang, Y., Yang, X., Fan, J., Jia, S., and Chen, N. 2015. Ampelopsin
attenuates 6 OHDA induced neurotoxicity by regulating GSK 3β/NRF2/ARE
signaling. J. Funct. Foods, 19 : 765 774. LeSage, G.D., Benedetti, A., Glaser,Draft S., Marucci, L., Tretjak, Z., Caligiuri, A., Rodgers, R., Phinizy, J.L., Baiocchi, L., Francis, H., Lasater, J., Ugili, L., and Alpini, G. 1999.
Acute carbon tetrachloride feeding selectively damages large, but not small,
cholangiocytes from normal rat liver. Hepatology, 29 (2): 307 319. doi:
10.1002/hep.510290242.
Li, Q., Xiao, M., Guo, L., Wang, L., Tang, L., Xu, Y., Yan, F., and Chen, F. 2005. Genetic
diversity and genetic structure of an endangered species, Trillium tschonoskii.
Biochem. Genet. 43 (7 8): 445 458. doi: 10.1007/s10528 005 6782 2.
Li, Y., Fan, L., Sun, Y., Miao, X., Zhang, F., Meng, J., Han, J., Zhang, D., Zhang, R., Yue, Z.,
and Mei, Q. 2014. Paris saponin VII from trillium tschonoskii reverses multidrug
resistance of adriamycin resistant MCF 7/ADR cells via P glycoprotein inhibition and
apoptosis augmentation. J. Ethnopharmacol. 154 (3): 728 734. doi:
10.1016/j.jep.2014.04.049.
https://mc06.manuscriptcentral.com/cjpp-pubs Page 19 of 28 Canadian Journal of Physiology and Pharmacology
Lu, Y., Hu, D., Ma, S., Zhao, X., Wang, S., Wei, G., Wang, X., Wen, A., and Wang, J. 2016.
Protective effect of wedelolactone against CCl4 induced acute liver injury in mice. Int.
Immunopharmacol. 34 : 44 52. doi: 10.1016/j.intimp.2016.02.003.
Masuda, Y. 2006. Learning toxicology from carbon tetrachloride induced hepatotoxicity.
Yakugaku Zasshi, 126 (10): 885 899.
Rosse, T., Olivier, R., Monney, L., Rager, M., Conus, S., Fellay, I., Jansen, B., and Borner, C.
1998. Bcl 2 prolongs cell survival after Bax induced release of cytochrome c. Nature,
391 (6666): 496 499. doi: 10.1038/35160.
Schmich, K., Schlatter, R., Corazza, N., Sa Ferreira, K., Ederer, M., Brunner, T., Borner, C., and Merfort, I. 2011. TumorDraft necrosis factor alpha sensitizes primary murine hepatocytes to Fas/CD95 induced apoptosis in a Bim and Bid dependent manner.
Hepatology, 53 (1): 282 292. doi: 10.1002/hep.23987.
Shi, H., Liu, X., Tang, G., Liu, H., Zhang, Y., Zhang, B., Zhao, X., and Wang, W. 2014.
Ethanol extract of Portulaca Oleracea L. reduced the carbon tetrachloride induced
liver injury in mice involving enhancement of NF kappaB activity. Am. J. Transl. Res.
6(6): 746 755.
Tarantino, G., Colao, A., Capone, D., Conca, P., Tarantino, M., Grimaldi, E., Chianese, D.,
Finelli, C., Contaldo, F., Scopacasa, F., and Savastano, S. 2011 a. Circulating levels of
cytochrome C, gamma glutamyl transferase, triglycerides and unconjugated bilirubin
in overweight/obese patients with non alcoholic fatty liver disease. J. Biol. Regul.
Homeost. Agents, 25 (1): 47 56.
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 20 of 28
Tarantino, G., Pezzullo, M.G., di Minno, M.N., Milone, F., Pezzullo, L.S., Milone, M., and
Capone, D. 2009. Drug induced liver injury due to "natural products" used for weight
loss: a case report. World J. Gastroenterol. 15 (19): 2414 2417.
Tarantino, G., Scopacasa, F., Colao, A., Capone, D., Tarantino, M., Grimaldi, E., and
Savastano, S. 2011 b. Serum Bcl 2 concentrations in overweight obese subjects with
nonalcoholic fatty liver disease. World J. Gastroenterol. 17 (48): 5280 5288. doi:
10.3748/wjg.v17.i48.5280.
Tilg, H. 2001. Cytokines and liver diseases. Can. J. Gastroenterol. 15 (10): 661 668.
Tischner, D., Woess, C., Ottina, E., and Villunger, A. 2010. Bcl 2 regulated cell death signalling in the preventionDraft of autoimmunity. Cell Death Dis. 1: e48. doi: 10.1038/cddis.2010.27.
Wang, T., Shankar, K., Ronis, M.J., and Mehendale, H.M. 2007. Mechanisms and outcomes
of drug and toxicant induced liver toxicity in diabetes. Crit. Rev. Toxicol. 37 (5):
413 459. doi: 10.1080/10408440701215100.
Weber, L.W., Boll, M., and Stampfl, A. 2003. Hepatotoxicity and mechanism of action of
haloalkanes: carbon tetrachloride as a toxicological model. Crit. Rev. Toxicol. 33 (2):
105 136. doi: 10.1080/713611034.
Yan, J.Y., Ai, G., Zhang, X.J., Xu, H.J., and Huang, Z.M. 2015. Investigations of the total
flavonoids extracted from flowers of Abelmoschus manihot (L.) Medic against
alpha naphthylisothiocyanate induced cholestatic liver injury in rats. J.
Ethnopharmacol. 172 : 202 213. doi: 10.1016/j.jep.2015.06.044.
https://mc06.manuscriptcentral.com/cjpp-pubs Page 21 of 28 Canadian Journal of Physiology and Pharmacology
Zhang, C.Y., Zhang, L., Yu, H.X., Bao, J.D., Sun, Z., and Lu, R.R. 2013. Curcumin inhibits
invasion and metastasis in K1 papillary thyroid cancer cells. Food Chem. 139 (1 4):
1021 1028. doi: 10.1016/j.foodchem.2013.02.016.
Zhang, S.F., Wang, X.L., Yang, X.Q., and Chen, N. 2014. Autophagy associated targeting
pathways of natural products during cancer treatment. Asian Pac. J. Cancer Prev.
15 (24): 10557 10563.
Draft
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 22 of 28
Figure legends
Figure 1. TTM rescued CCl 4 induced acute liver damage based on examination of ALT (A) and AST (B) levels. All data were expressed as Mean ± SD ( n = 6). #P < 0.05 and ## P < 0.01 compared with the control group; * P < 0.05 and ** P < 0.01 compared with CCl 4 induced acute liver injury model group.
Figure 2. TTM inhibited CCl 4 induced hepatomegaly (A) and reduced liver index (B) as well as alleviated CCl 4 induced cell necrosis or cell death (C) through the evaluation by HE staining. Draft
Figure 3. TTM reduced inflammatory responses from CCl 4 induced acute liver injury in rats through the determination of mRNA expression of TNF α (A) and IL 6 (B) by RT PCR. All data were expressed as Mean ± SD ( n = 3) from three independent experiments. #P < 0.05 and
## P < 0.01 compared with the control group; * P < 0.05 and ** P < 0.01 compared with the
CCl 4 model group.
Figure 4 . TTM executed hepatoprotection through inhibited apoptosis. TTM could obviously reduce liver cell apoptosis of rats induced by CCl 4 based on the TUNEL staining (A) and its statistical analysis (B). Similarly, TTM could result in down regulation of Bax and Caspase 3 and up regulation of Bcl 2 based on western blot analysis (C). ## P < 0.01 compared with the
* ** control group; P < 0.05 and P < 0.01 compared with the CCl 4 model group.
https://mc06.manuscriptcentral.com/cjpp-pubs Page 23 of 28 Canadian Journal of Physiology and Pharmacology
Figure 5. Effect of TTM on liver cell regeneration in the presence of CCl 4 induction.
Compared with the CCl4 induced model group, DDB could promote liver cell regeneration
but TTM at various dosages did not exhibit the promotion role in liver cell regeneration,
which was evaluated by Ki67 staining (A) and corresponding statistical analysis (B). ## P <
0.01 compared with the control group; ** P < 0.01 compared with the CCl 4 induced model
group.
Draft
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 24 of 28
Draft
Figure 1
86x64mm (300 x 300 DPI)
https://mc06.manuscriptcentral.com/cjpp-pubs Page 25 of 28 Canadian Journal of Physiology and Pharmacology
Draft
Figure 2
85x63mm (300 x 300 DPI)
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 26 of 28
Draft
Figure 3
86x64mm (300 x 300 DPI)
https://mc06.manuscriptcentral.com/cjpp-pubs Page 27 of 28 Canadian Journal of Physiology and Pharmacology
Draft
Figure 4
86x64mm (300 x 300 DPI)
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 28 of 28
Draft
Figure 5
86x64mm (300 x 300 DPI)
https://mc06.manuscriptcentral.com/cjpp-pubs