ROLE OF GSK3α IN SPERM FUNCTION AND MALE FERTILITY
A dissertation submitted
To Kent State University in partial
fulfillment of the requirements for the
degree of Doctor of Philosophy
by
Rahul Bhattacharjee
August 2018
© Copyright
All rights reserved
Except for previously published materials Dissertation written by
Rahul Bhattacharjee
B.Sc., Presidency College, Calcutta, India, 2009
M.Sc.,University of Calcutta, Calcutta, India, 2011
Ph.D., Kent State University, Kent, OH, USA, 2018
Approved by
Dr. Srinivasan Vijayaraghavan, Chair, Doctoral Dissertation Committee
Dr. Douglas W. Kline, Members, Doctoral Dissertation Committee
Dr. Gary Koski
Dr. Hamza Balci
Dr. Songping Huang
Accepted by
Dr. Laura G. Leff, Chair, Department of Biological Sciences
Dr. James L. Blank, Dean, College of Arts and Science
2 TABLE OF CONTENTS
TABLE OF CONTENTS……………………………………………………………..iii LIST OF FIGURES…………………………………………………………………...v LIST OF TABLES……………………………………………………………………viii ABBREVIATIONS………………………………………………………………...….ix ACKNOWLEDGEMENTS…………………………………………………………...xi CHAPTER 1: Introduction…………………………………………………………....1 1.1 Testis structure……………………………………………………...... 1 1.2 Spermatogenesis………………………………………………...…...3 1.3 Structure of Spermatozoa………………………………………...….5 1.3.1 Sperm Head………………………………………………...... 8 1.3.2 Sperm Flagellum………………………………………………9 1.4 Sperm membrane component…………………………………..….12 1.5 Sperm motility……………………………………………………...... 13 1.6 Role of Protein Phosphatases in sperm function……………..….15 1.6.1 Role of PP1γ2 in testis…………………………………..….16 1.6.2 PP1γ2 in sperm motility and epididymal sperm maturation………………………………………………..…..17 1.6.3 The regulators PPP1R2(I-2), PPP1R11(I-3), and PPP1R7(sds22) in sperm………………………………...... 18 1.7 Glycogen Synthase Kinase 3 (GSK3) …………………………….19 1.7.1 Phosphorylation of GSK3……………………………….…..20 1.7.2 GSK3 and sperm…………………………………………….22 1.7.3 Role of GSK3 in epididymal sperm maturation……….…..24 1.7.4 Isoform specific role of GSK3α and GSK3β………………25 CHAPTER 2: Materials and methods……...………………………………….…..27 CHAPTER 3: Results…..……………………………………………………………45 3.1.1 Aim 1A – Expression and localization of GSK3α and GKS3β in testis and sperm…………………………………………....45 Rationale…………………………………………………………...... 45
iii Result………………………………………………………………....46 Summary……………………………………………………………...52 3.1.2 Aim 1B – Global knockout of GSK3α causes male fertility…….....53 Rationale…………………………………………………………...…53 Result………………………………………………………………....54 Summary……………………………………………………………...70 3.1.3 Aim 1C – Isoform specific role of GSK3α in male fertility………....71 Rationale……………………………………………………………...71 Result ………………………………………………………………...72 Summary……………………………………………………………...81 3.2 Aim 2 – Biochemical properties of sperm lacking GSK3α………...82 Rationale……………………………………………………………...82 Result……………………………………………………………….....83 Summary……………………………………………………………...96 CHAPTER 4: Discussion…..……………………………………………………..…97 REFERENCES……………………………………………………………………...105
iv LIST OF FIGURES
Figure 1. Structure of testis ……………………………………………………………2
Figure 2. Spermatogenesis…………………………………………………………….4
Figure 3. General structure of mammalian spermatozoa…………………………...6
Figure 4. General features of sperm head……………………………………………7
Figure 5. Distribution of membranes, region and cytoplasmic layer……………….9
Figure 6. Structure of sperm flagellum, axoneme…………………………………..10
Figure 7. Progressive and hyperactive motility of mammalian sperm …………...14
Figure 8. GSK3 structure……………………………………………………………...20
Figure 9. The molecular mechanism by which phosphorylation
inhibits GSK3 ………………………………………………………………21
Figure 10. Activation inactivation cycle of PP1γ2and inhibitor I-2 involving
GSK3 and PKA……………………………………………………………23
Figure 11. Northern blot analysis of tissues and q-PCR analysis of
developmental testis mRNA to check Gsk3α and Gsk3β
expression ………………………………………………………………...47
Figure 12. Localization of GSK3α and Gsk3β in adult testis section……………..49
Figure 13. Localization of GSK3a and GSK3b within sperm……………………...51
Figure 14. Targeting strategy to generate Gsk3α conditional alleles…………….55
Figure 15. mRNA expression in wild type and Gsk3α KO mice…………………..56
Figure 16. Protein levels in wild type and Gsk3α KO mice ……………………….58
Figure 17. Immunocytochemistry of spermatozoa from wild type and
Gsk3α KO mice …………………………………………………………..59
v Figure 18. Immunohistological analysis of testis sections from wild type
and Gsk3α KO mice……………………………………………………….61
Figure 19. Immunohistological analysis of testis sections from wild type
and Gsk3α KO mice to show different stages of spermatogenesis….62
Figure 20. Morphological features of sperm from Gsk3α KO mice ……………….64
Figure 21. Mitochondrial structure of sperm from Gsk3α KO mice ……………….66
Figure 22. Acrosomal staining of sperm from Gsk3α KO mice…………………….67
Figure 23. Motility analysis of mature caudal sperm from Gsk3α KO and
WT animals…………………………………………………………………68
Figure 24. Schematic diagram showing expression of Stra8 starting from
primary spermatocytes onwards. Stra8-Cre mediated deletion of
floxed genes will occur in developing germ cells……………………….72
Figure 25. Mating scheme employed for generation of conditional deletion
of Gsk3α gene in developing germ cells………………………………...73
Figure 26. Western blot analysis of testis specific Gsk3α and Gsk3β KO…...…...74
Figure 27. Immunohistochemical analysis of testis specific Gsk3α and
Gsk3β KO……………………………………………………………………75
Figure 28. In vitro fertilization of WT and Gsk3α KO mice………………………….78
Figure 29. Catalytic activity of GSK3 in sperm from conditional Gsk3α and
Gsk3β knockout mice ……………………………………………………..80
Figure 30. Protein Phosphatase Activity and ATP Levels in Sperm from
Gsk3α KO Mice…………………………………………………………….84
Figure 31. ATP levels in sperm lacking GSK3 isoforms…………………………….87
vi Figure 32. Measurement of ATP and net nucleotide levels of Gsk3α KO
by HPLC method…………………………………………………………...88
Figure 33. Measurement of ATP and net nucleotide levels of bovine caput
and caudal sperm by HPLC method……………………………………..89
Figure 34. Tyrosine phosphorylation of sperm from Gsk3α KO mouse
compared to WT mouse…………………………………………………...90
Figure 35. Hexokinase activity measurement and Tyrosine phosphorylation
of sperm from WT, Gsk3α KO (global and testis specific) and
testis specific Gsk3β KO mice…………………………………………….92
Figure 36. Expression of MCT-2 and Basigin in WT and Gsk3α KO by
western blot and immunocytochemistry………………………………….94
Figure 37. Proposed model for role of Wnt signaling in epididymal
sperm maturation…………………………………………………………...95
Figure 38. Proposed model for the role of GSK3a in sperm function
and sperm motility…………………………………………………………104
vii LIST OF TABLES
Table 1. Primers used for genotyping………………………………………………...27
Table 2. List of antibodies……………………………………………………………...32
Table 3. Fertility of Gsk3α KO and Gsk3α (+/-) males……………………………...60
Table 4. Testis weight and sperm number of WT, Gsk3α (+/-) and
Gsk3α KO mice……………………………………………………………….63
Table 5. Sperm morphology of WT, Gsk3α (+/-) and Gsk3α KO mice…….……...65
Table 6. Testicular, Caput and Caudal sperm morphology of Gsk3α KO sperm...65
Table 7. Combined fertility table of WT, Gsk3α (+/-), global Gsk3α KO mice,
conditional testis specific Gsk3α and Gsk3β……………………………...77
viii ABBREVIATIONS
PP1y2 Protein Phosphatase gamma 2
PPP1R2(I2) Protein Phosphatase 1 Regulatory Inhibitor subunit 2
PPP1R11(I3) Protein Phosphatase 1 Regulatory Inhibitor subunit 11
PPP1R7(sds22) Protein Phosphatase 1 Regulatory inhibitor subunit 7
GSK3 Glycogen Synthase Kinase
AKAP A-Kinase Anchoring Protein
Pgk2 Phosphoglycerate kinase 2 sAC soluble Adenylate Cyclase
PKA Protein Kinase A cAMP Cyclic Adenosine Monophosphate
BSA Bovine Serum Albumin cDNA complementary DNA
ECL Enhanced Chemi-Luminescence
EDTA Ethylenediaminetetraacetic acid
PBS Phosphate Buffered Saline
PCR Polymerase Chain Reaction
PFA Paraformaldehyde
RT-PCR Reverse Transcriptase PCR
SDS Sodium Dodecyl Sulphate
SDS-PAGE SDS Polyacrylamide Gel Electrophoresis
Ser Serine
ix TBS Tris Buffered Saline
TCA Trichloroacetic acid
Thr Threonine
TPCK Tosyl Phenylalanyl Chloromethyl Ketone
TTBS Tween Tris Buffered Saline
Tyr Tyrosine
SSC Saline-Sodium Citrate Buffer
MOPS 3-(N-morpholino)propanesulfonic acid
x ACKNOWLEDGEMENTS
First and foremost, I want to express my heartfelt gratitude towards my mentor, Dr.
Srinivasan Vijayaraghavan, who is one of my greatest inspirations. I cannot thank him enough for keeping faith in me and for believing that I can successfully complete my project. Training under his mentorship and learning to critically analyze and evaluate experiments under his guidance was one of the best things that happened in my scientific career. He also instilled in me the qualities to become a humble and polite human being. I hope all the training and qualities imbibed from him will help me go a long way in my life and I can become a passionate scientist and a fine human being like him. This journey would not have been possible without his positive attitude and pep- talks.
I want to specially thank all my supervisory committee members, Dr. Douglas Kline, Dr.
Gary Koski and Dr. Hamza Balci. I am indebted to them for their precious time, constructive criticisms and positive inputs during my entire graduate studies. They have always motivated me to remain enthusiastic about my work and encouraged my ideas and opinions. It has been a privilege to train under fine scientific minds as them. Words are not enough to express my gratitude to Dr. Kline for helping me build my skills to maintain animal lines. He was always available for scientific discussions and I learnt a great deal about animal experiments from him. I also want to extend my thanks to Dr.
Songping Huang for serving as graduate faculty representative in my committee. They helped me improve my scientific writing skills and thinking. It was a great learning experience for me.
xi I would like to extend my gratitude to all my current and former lab members, for being so patient and supportive. I thoroughly enjoyed the scientific discussions that I often had with my lab members, and they helped me hone my scientific aptitude. I consider myself fortunate to be able to spend five years in a lab that felt like my second home. I want to thank Suranjana for being a great friend and confidante. We have survived the highs and lows of graduate student life together and it helped make our bond stronger. She has given unconditional support to me and my family during all the tough times I encountered. I thoroughly enjoyed the numerous thought provoking scientific discussions I had with her. I never realized science could be so much fun until I worked with her. She has instilled in me a great sense of professionalism and other qualities that helped me become a better human being.
I want to thank my family for their love, constant support and motivation. I want to start by thanking my parents, Mr. Amitava Bhattacharjee and Mrs. Jharna Bhattacharjee, for their unconditional love and support. This journey would not have been possible without their sacrifice, to provide me higher education, so that I can fulfil my dreams. I sincerely thank them for all the little things they have done for me. I would like to thank my wife
Dr.Sohini Roy. She was always by my side during my professional and personal challenges. She constantly pushed me to bring out the best in me. She always motivated me by saying that PhD is my dream and I must make it come true, no matter what challenges come our way. I hope I can continue to make them proud. A special thank you to my younger sister, Oindrila Bhattacharjee, for being more than a sister in my life. I also want to express my gratitude towards my father-in-law, Mr. Gour Roy, and my mother-in-law, Mrs. Shelly Roy, for their constant love and support. They have never
xii failed to be my side in testing times, always infusing in me positive attitude and praying for my well-being.
Last, but not the least, I want to thank my close friends here, in Kent. First, I would like to thank Sohini Dutta for her constant support. She could relate to all the highs and lows
I went through and was always there whenever I needed her. I want to deeply thank
Monica for giving me so many warm and fond memories, and that I am going to cherish all of them forever.
All of them have made unconditional sacrifices to help make my dream come true and see me smile. I thank them with all my heart and soul; they are the reason I could finish my dissertation. I owe them for what I am today, and it is only right that I share this credit with everyone who were a part of my journey.
xiii CHAPTER 1. Introduction
1.1 Testis structure.
Germ cell development leading to sperm production takes place in seminiferous tubules of testis. Testicular sperm first released into the rete testis then enter the epididymis.
Blood vessels, lymphatic vessels, and testosterone-producing Leydig cells are localized in the interstitial region between tubules. The seminiferous tubules are surrounded by the peritubular myoid cells (PTM) which help in sperm release towards rete testis and then to epididymis. Sertoli cells are present at the base of the seminiferous tubules.
Germ cells present at the basement of the seminiferous tubule epithelium, consist of immature and undifferentiated spermatogonial stem cells (SSCs)(1). Germ cells at different stages of development are always in contact with somatic Sertoli cells.
Between Sertoli cells adhesion junctions are present to form the blood-testis barrier
(BTB). Sertoli cells provide support for stem cell renewal and differentiation and also support for the developing sperm(2).
1 A.
B.
Figure 1: (A) Schematic diagram showing testis structure. (Reprinted from Knobil and
Neill’s physiology of Reproduction 4th edition, License number 4397130469280).
(B) Spermatogonial stem cell niche in seminiferous epithelium (Reprinted from Chapter
136, Spermatogenesis from Endocrinology: Adult and Pediatric by Kretser et al, License number 4396681382851)
2 1.2. Spermatogenesis
Spermatogenesis is a complex well-regulated process which depends on the proliferation and maturation of male germ cells from self-renewing stem cells. Stem cells maintain continuous supply of the germ cells which have the capability to form spermatozoa. The time required to complete a cycle of spermatogenesis varies from species to species: in mice it takes about 35 days whereas in humans it takes about 70 days. Differentiation and proliferation of spermatogonia is controlled by hormonal regulation. In humans spermatogonia are classified into types A and B according to nuclear chromatin patterns in histologic preparations. In mouse spermatogonia are designated as differentiated and undifferentiated (AS /Aal) based on their self-renewal capability. The undifferentiated Type A spermatogonia divides to form B spermatogonia which are the differentiating spermatogonia. Type B spermatogonia go through four more divisions to form primary spermatocytes and then secondary spermatocytes. In this stage spermatids are formed by completion of meiosis(3). Round haploid spermatids then go through a developmental process called spermiogenesis to form spermatozoa (Figure 2).
3
Figure 2. Sequence of germ cell types in human spermatogenesis commencing with a spermatogonium, progressing through an orderly sequence of cell proliferation and maturation, and terminating in a mature spermatozoon. Explanation of symbols: spermatogonia: type A dark (Ad), A pale (Ap), and B (B); primary spermatocytes: preleptotene (PL), leptotene (L), zygotene (Z), pachytene (P), and meiotic division (M); secondary spermatocyte (II), spermatids (Sa,
Sb1, Sb2, Sc, Sd1, Sd2); residual body (RB). (Reprinted from Chapter 136,
4 Spermatogenesis from Endocrinology :Adult and Pediatric by Kretser et al, License number 4396681382851)
1.3. Structure of Spermatozoa
Spermatozoa are the end product of spermatogenesis. They are produced in seminiferous tubules through mitosis, meiosis and post meiotic phases. Morphogenesis of spermatids into spermatozoa is characterized by nuclear condensation, flagellar and acrosome development. DNA in spermatozoa is packed tightly in the nucleus.
Spermatozoa are transcriptionally and translationally silent. Mammalian spermatozoa are immotile and are unable to fertilize eggs when released into the rete testis(4, 5).
They acquire motility and fertilizing capacity during their passage through the epididymis(6).
The sperm head and flagellum (tail) are joined by the connecting piece. The head is composed of the nucleus and acrosome. Acrosome contains hydrolytic enzymes which are released during fertilization. The flagellum or tail is divided into mid piece, principal piece, and end piece regions (Figure 3). The flagellum contains the microtubules called the axoneme. The axoneme is surrounded by outer dense fibers except in the end piece. The mid piece contains a tightly wrapped mitochondria surrounding the outer dense fibers. The principal piece contains the fibrous sheath surrounding the outer dense fibers. The end piece contains the axoneme devoid of the outer dense fibers and fibrous sheath. A plasma membrane encloses the sperm head and flagellum. Sizes and shapes of sperm vary in different species (Figure 4)(1).
5
Figure 3. General structure of mammalian spermatozoa. The head and flagellum of the sperm is attached by a connecting piece. The flagellum is divided into three regions; midpiece, principal piece and end piece. The midpiece is surrounded by mitochondrial sheath while the principal piece contains fibrous sheath. Sectional view of each of the segment is shown by arrows (Adapted from Knobil and Neill’s physiology of
Reproduction 4th edition, License number 4396690421942).
6
Figure 4. General features of sperm head from different species. The size and shape of sperm head is specific for every species. The head varies considerably from falciform to spatulate shaped. The major region of sperm head is acrosomal region or anterior head and post acrosomal region or posterior head. The acrosomal region of falciform shaped head is relatively smaller than spatulated head. The post acrosomal
7 region is not covered by the acrosome (Adapted from Knobil and Neill’s physiology of
Reproduction 4th edition, License number 4396690421942).
1.3.1. Sperm Head
The sperm head is divided into two regions; acrosomal region (anterior head) and post acrosomal region (posterior head). The acrosomal region is subdivided into marginal segment, principal segment and equatorial segment. The size and shape of the acrosomal region varies from species to species (Figure 4). The first two domains together are called acrosomal cap. The posterior ring is located between the head and the connecting piece. This domain forms a barrier between the cytoplasmic compartments of head and principal piece (Figure 5). Plasma membrane of flagellum is divided into mid piece region, principal piece region and end piece region. The annulus separates the mid piece and principal piece regions. Sperm acquire these membrane domains during spermatogenesis. Additional changes to the sperm membrane occur during epididymal maturation. Cytoplasmic droplets move from the base of the head through the midpiece until they shed from the flagellum (7, 8). During epididymal maturation changes also occur in the sperm head conferring them with the ability to bind and fertilize eggs (1).
8
Figure 5. Distribution of membranes, regions and cytoplasmic layer on a falciform shaped sperm head for (A) Sagittal section and (B) Frontal section. The cytoplasmic layer includes para acrosomal layer, subacrosomal layer and post acrosomal layer. The regions include apical segment and principal segment of the anterior acrosome, the equatorial segment and the post acrosomal segment (Adapted from Knobil and Neill’s physiology of Reproduction 4th edition, License number 4396690421942).
1.3.2. Sperm Flagellum
The axoneme consists of a nine plus two (9+2) arrangement of microtubules that extend from the connecting piece through the entire length of the flagellum (Figure 6). This
(9+2) structure is composed of 9 outer doublet microtubules and a doublet central microtubules(9). Dyneins are motor proteins that are bound at regular intervals along the microtubules. They generate sliding force through their ATPase activity which is responsible for flagellar beat in motile sperm.
9 In mammalian sperm two additional structures surround the axoneme: outer dense fibers (ODF) and the fibrous sheath (figures 3 and 6). The outer dense fibers are adjacent to the axoneme extending from the connecting piece to the posterior portion of the principal piece. The midpiece of sperm contains mitochondrial sheath which surrounds the outer dense fibers.
Figure 6: Connecting piece and proximal middle piece region of sperm flagellum.
Axoneme structure extends from connecting piece to distal tip of sperm flagellum. The axoneme is composed of (9+2) complex of microtubules. 9 outer doublet microtubules
10 and one central pair of singlet microtubules. (Reprinted from Knobil and Neill’s physiology of Reproduction 4th edition, License number 4396690421942).
Fibrous sheath surrounds the ODF in the principal piece (10, 11). The presence of the fibrous sheath is unique to spermatozoa of mammals and birds. This structure is close to the plasma membrane and is attached to the annulus. A cylindrical structure of fibrous sheath is formed by two longitudinal columns with the connection of circumferential ribs. The longitudinal columns are packed with filamentous structures
15-20 nm diameter. These columns run from peripheral to microtubule doublets 3 and 8 of axoneme. This fibrous sheath structure is highly resistant to acid solubilization. There are several key proteins located in the fibrous sheath. These include cAMP dependent protein kinase A (PRKA or PKA) anchoring proteins (AKAPs). Nearly half of the proteins in fibrous sheath isolated from mouse sperm is AKAP4(12, 13). There are also glycolytic enzymes like glyceraldehyde-3-phosphate dehydrogenase and hexokinase 1 present in the fibrous sheath(10, 11, 14).
The annulus is the intersection of sperm midpiece and the principal piece. The annulus forms an electron-dense structure in the spermatid phase during spermatogenesis as the axoneme begins to extend. At this stage, the annulus is associated with the chromatid body at the base of the flagellum. As the sperm tail elongates the annulus migrates distally along with the axoneme, towards its final position, with the ring-shaped chromatid body.
11 Biochemical components of the annulus such as Septin (SEPT) proteins have been identified in mouse, bovine and human. Septins are localized in the annulus and are named due to their presence in the “septin ring” in the yeast. Septins are associated with various cellular functions due to their interaction with tubulin or actin and considered as cytoskeletal proteins. Belonging to the GTPase superfamily, they consist of at least 14 septin genes, most of them known to be involved in male infertility and other diseases in humans. In sperm lacking SEPT4, a loose fibrous network replaces the annulus leading to an impairment of the kinesin-mediated intraflagellar transport. In this the axonemal 9 + 2 structure remains intact but the ability of the ATP driven dynein motor is impaired. The annulus also forms a barrier for membrane diffusion between the midpiece and the principal piece. SLC26A8, a member of the SLC26 family of anions transporters, is highly expressed in male germ cells. In both normal mouse and human spermatozoa, SLC26A8 is localized at the annulus(15). SLC26-A8 lacking sperm share structural defects similar to those found in sperm from SEPT4-null mice(16). The annulus helps the growing flagellum growth to align the mitochondria along the axoneme which then allows the annulus/septin ring to act as a scaffold to organize the fibrous sheath. Thus, the annulus is an important structural feature responsible for organization and in the formation of the barrier between the mid and principal piece.
1.4. Sperm membrane components
Ca2+ channel proteins (CATSPER) located in sperm membrane are responsible for Ca2+ homeostasis required for sperm function(17). The Catsper channel complex contains four α subunits (CATSPER 1,2,3,4) and three auxiliary subunits (Catsper beta, gamma
12 and delta). Voltage gated Ca2+ channels proteins are necessary for the regulation of
Ca2+ entry and is present in the plasma membrane of the principal piece region of mouse flagellum (18-20). Mice lacking any one of the Catspers are infertile due to lack of hyperactivation of spermatozoa that occurs during fertilization(21).
There are sugar transport facilitators predominantly expressed in testis and brain: one of them is GLUT8 (Slc2a8). Deletion of Slc2a8 results in reduction of ATP levels, motility and mitochondrial potential in sperm (15). Another protein, Basigin (BSG,
EMMPIRIN) is present in spermatozoa and is expressed during spermatogenesis. It is located primarily in the principal piece in immature caput epididymal spermatozoa.
Basigin moves to the middle piece of mature caudal epididymal spermatozoa(22).
Basigin is involved in cell-cell interactions and is also needed for the completion of spermatogenesis. Deletion of Bsg gene causes meiotic arrest (23, 24). Basigin in sperm interacts with H+-monocarboxylate co-transporters (MCT), MCT1 and MCT 2: transporters that move lactate and pyruvate out of or into cells. MCT2 is co-localized with Basigin in sperm. Basigin and MCT2 present in the principal piece in caput sperm move to the midpiece in caudal sperm. The reason and requirement for this movement occurring during sperm maturation is not known.
1.5. Sperm Motility
Spermatozoa display two types of motility: progressive motility and hyperactive motility.
Beating mode of sperm flagellum are different in the two types of motility: symmetrical waves with progressive motility and asymmetrical wave with hyperactive motility (Figure
7). Asymmetric waves during hyperactivation of sperm have high beat amplitude
13 resulting circular trajectories(25, 26). Hyperactivation occurs before fertilization of the egg(27, 28). The exact mechanism of hyperactivation is still not clear, however it is known that hyperactivation is mediated by Ca2+ signaling and is regulated by the events of capacitation that involves cAMP/ PKA, other protein kinases and protein phosphatases.
Figure 7: Progressive and hyperactive motility of mammalian sperm. Motility parameters are displayed in time lapse drawing. Activated or progressive motility is characteristics of uncapacitated sperm. Hyperactivated motility is observed in sperm incubated in capacitated conditions. Hyperactivated modes consist of less symmetrical flagellar bending and results in a path of the sperm that is less linear than that of activated sperm motility. (Reprinted from Knobil and Neill’s physiology of Reproduction
4th edition, License number 4396690616297).
.Calcium channels are involved in regulation of sperm intracellular Ca2+ levels during hyperactivation(29). CATSPER1 is located in principal piece of sperm CATSPER2 is also very similar to CATSPER1 and present in sperm flagellum. Catsper1 null mice shows
14 reduced progressive motility resulting male infertility. CATSPER1 null mice sperm fail to attain hyperactivation while having normal tyrosine phosphorylation which is associated with capacitation(18, 19). Phenotypes of Catsper2(-/-),Catsper 3(-/-) and Catsper 4(-/-) are indistinguishable from Catsper 1 null mice (21): males are infertility with sperm unable to undergo hyperactivation. Cyclic AMP is a key second messenger involved in the regulation of sperm motility. Cyclic AMP levels in sperm increase when the unique sperm adenylate cyclase is activated by bicarbonate. Cyclic AMP in turn activates Protein Kinase
A (PKA) which phosphorylates several still unidentified proteins at their Ser/ Thr residues.
Changes in phosphorylation of still unidentified sperm proteins are thought to involved in motility initiation and hyperactivation(29, 30).
1.6. Role of Protein Phosphatases in sperm function
In eukaryotes multiple genes encode for different isoforms for serine/threonine phosphatase PP1 which is encoded by a single gene named Glc7 in Saccharomyces cerevisiae. The four isoforms of PP1 are PP1a, PP1b, PP1γ1and PP1γ2. Sperm from non-mammalian species like Xenopus, sea urchin contain PP1γ1 or PP1a(31). All the
PP1 isoforms bear 90 % of similarity in their amino acid sequence and have overlapping substrate specificity. There are more than 70 regulatory protein which can bind to PP1 to regulate its functions. All somatic cells express PP1a, PP1b and PP1γ1. The two isoforms, PP1γ1 and PP1γ2, are alternatively spliced transcripts of a single gene,
Ppp1cc a splicing event that occurs only in mammals. Thus, while PP1γ1 is present,
PP1γ2 is absent in invertebrates, birds and amphibians. PP1γ2 is present in mammalian testis and sperm. There is no observable phenotype with the loss of PP1a
15 but targeted disruption of PP1b is embryonic lethal. Tissue specific deletion of PP1b showed its role in cardiac contractility and muscle development (31). Targeted disruption of Ppp1cc results in male infertility (32).
1.6.1. Role of PP1γ2 in testis
Alternative splicing of single gene (Ppp1cc) forms mRNA which translates into PP1γ1 and PP1γ2. The PP1γ (Ppp1cc) gene on mouse chromosome 5 is composed of eight exons. The transcript for PP1γ2 lacks intron 7 resulting in a 22 amino acid C-terminal tail resulting from exon 8 whereas PP1γ1 has an 8 amino acid sequence derived from an extended exon 7. The PP1γ2 protein is 39 kDa whereas PP1γ1 is 36 kDa easily distinguished by specific antibodies. PP1γ1 is expressed ubiquitously whereas PP1γ2 is testis specific. PP1γ1 is present in Sertoli cells while PP1γ2 is predominant in developing male germ cells and is also present in sperm.
The levels of PP1γ1, PP1a and PP1b do not change during postnatal testis development. Until postnatal day 10 Sertoli cells, Leydig cells, self-renewing germ cells and other somatic cells are present in testis. Expression of PP1γ2 mRNA coincides with the appearance of early pachytene spermatocytes. Its expression gradually increases during postnatal developing testis, coinciding with the onset and progress of spermatogenesis.
Targeted disruption of Ppp1cc gene eliminates the expression of both PP1γ1 and
PP1γ2. Males lacking Ppp1cc were infertile and showed defects in final stages of spermatogenesis (32, 33). In Ppp1cc KO female mice are normal. Sectional views of
16 the lumen from epididymis of Ppp1cc KO male mice show little or no spermatozoa. In principle this abnormality in spermatogenesis can be due to loss of either PP1γ1 or
PP1γ2 or both. Male fertility and spermatogenesis is restored when PP1γ2 is transgenically expressed in the null mice. Thus, transcription of PPP1cc gene producing
PP1γ2 is required only in developing spermatocytes and spermatids for normal male fertility. Further work in our lab showed that, PP1γ1 cannot replace PP1γ2 to support normal sperm function and male fertility (Dudiki et.al, manuscript under revision). These transgenic and knockout out approaches showed that PP1γ2 is indispensable and plays an isoform-specific role in sperm function and male fertility.
1.6.2. PP1γ2 in sperm motility and epididymal sperm maturation
The role for PP1γ2 in mature sperm motility and maturation was discovered before its requirement for spermatogenesis was described (34). Immotile caput sperm have higher PP1γ2 activity compared to caudal sperm. This raised the possibility that a reduction in PP1 activity is associated with active motility. It was shown that motility is initiated in immotile caput sperm treated with the PP1 inhibitors calyculin-A or okadaic acid(34). This observation shows that high phosphatase activity keeps motility in check in immotile caput sperm. It was therefore proposed that a reduction of PP1γ2 activity during epididymal sperm maturation is likely to be a part of the biochemical mechanism involved in the development and regulation of sperm motility.
17 1.6.3. The regulators PPP1R2(I-2), PPP1R11(I-3), and PPP1R7(sds22) in sperm
Inhibitor-1 and Inhibitor -2 (also known as PPP1R1 and R2) elute in two different column fractions during purification from rabbit skeletal muscle, hence their names
(35). Both are heat stable proteins and were the first identified protein inhibitors of PP1.
PPP1R1 is a potent inhibitor of PP1 when it is phosphorylated whereas PPP1R2 inhibits
PP1 activity only in its dephosphorylated form. PP1 present in its inactive form when bound to PPP1R2, can be activated in the presence of Mg-ATP and glycogen synthase
Kinase-3 (GSK-3) which shown to phosphorylate PPP1R2. Thus, inhibitor I2 is a substrate for GSK phosphorylation leading to activation of PP1. The presence of I2 in sperm along with identification of GSK3 (36). Biochemical assays showed the presence of PPP1R2 inhibitor in sperm.
The inhibitor PPP1R11 is another heat stable inhibitor of PP1 (37). PPP1R11 exhibits one of the characteristics of PPP1R2, where it is inhibitory in its dephosphorylated form (37). It was discovered as a PP1-binding protein by yeast two- hybrid screening (37). The gene for Ppp1r11 is within the t-complex (38), a region in the mouse chromosome associated with sperm motility defects and male infertility.
PPP1R7 was originally identified as a PP1 binding protein in S. pombe for its role in mitosis (39, 40). Later, an ortholog of PPP1R7 was identified in C. elegans genome
(41) and its homologue discovered in S. cerevisiae (42). Thereafter, orthologues of this yeast protein have been found in several organisms including mammals where it is ubiquitously expressed (42-45). It appears that PPP1R7 could either activate (39) or inhibit PP1 catalytic activity depending on the phospho-protein substrate used in the
18 assay (39, 42). Similar to PPP1R11, a smaller mRNA message for PPP1R7 was detected in testis (45). The proteins PP1γ2, PPP1R7, and PPP1R11 exist as a trimeric complex in extracts of bovine testis and caudal epididymal spermatozoa (46). Recent work in our laboratory showed that PP1γ2 activity is regulated by its inhibitors due to changes in the binding of its regulators during passage of sperm through the epididymis
(Goswami et.al, manuscript under review).
1.7. Glycogen synthase Kinase 3 (GSK3)
The enzyme GSK3, a serine/threonine protein kinase, was named GSK-3 as it was discovered after PKA and phosphorylase kinase (GSK-1 and GSK-2) along with two other GS kinases (GSK-4 and -5) based on relative elution from phosphocellulose chromatography of muscle extracts. Since then GSK3 has been found to be a key signaling component of a large number of cellular processes (47, 48). An array of functions attributed to GSK3 include insulin action, regulation of cell survival, apoptosis, embryonic development, Wnt/β-catenin and hedgehog signaling, and growth factor action. It is also a target for drug development due to involvement in several clinical disorders including cancer(49). GSK3 is expressed in virtually all mammalian tissues and is encoded by two genes that generate two related proteins: GSK3α and GSK3β.
GSK3α has a mass of 51 kDa, whereas GSK-3β is a protein of 47 kDa (Figure 8). The difference in size is due to a glycine-rich extension at the N-terminus of GSK-3α.
Homologues of GSK-3 exist in all eukaryotes examined to date and display a high degree of homology; isoforms from species as distant as flies and humans display
>90% sequence similarity within the kinase domain (47).
19
Figure 8: GSK3 generally prefers pre-phosphorylated substrates. Tyrosine phosphorylation is required for it activity. It is active in a resting cell inactivated by serine phosphorylation during cell activation (Adapted with permission from “GSK-3: tricks of the trade for a multi-tasking kinase”, Journal of Cell Science by Doble et al. License #
4396651264884).
1.7.1. Phosphorylation of GSK3
Unlike most protein kinases, GSK3 is constitutively active under resting conditions. In this constitutively active state, GSK3 is phosphorylated on Tyr279 (GSK3α) or Tyr216
(GSK3β), this phosphorylation is most likely catalyzed by GSK3 itself (auto- phosphorylation)(50). Since GSK3 is active under resting conditions, its regulation occurs through inhibition or retargeting of its activity. This inhibition of activity occurs via phosphorylation on Ser21 (GSK3α) or Ser9 (GSK3β)(51). Several protein kinases are able to phosphorylate these sites and thereby negatively regulate GSK3 activity (Figure
9), including PKB/Akt, a serine/threonine kinase located downstream of phosphatidyl- inositol 3-kinase (PI3K), and cyclic-AMP-dependent protein kinase (PKA) (52, 53).
Dephosphorylation of GSK3 can be accomplished by protein phosphatase 1 (PP1) or
20 protein phosphatase-2A (PP2A)(54, 55). Thus, two sets of protein kinases are integrated to regulate the actions of GSK3, those that directly phosphorylate GSK3 and those that prime its substrate. In some cases, a single protein kinase can serve both functions. For example, PKA is capable of both phosphorylating GSK3 and priming
GSK3 substrates.
Thus, the timing and location of these signaling enzymes may combine to contribute to the individualized control of the actions of GSK3 towards each substrate (56, 57). The constitutively active nature of GSK3 suggests that it may contribute to maintaining steady, resting conditions within a cellular compartment. In accordance with this idea, many GSK3 substrates, like transcription factors, are inhibited in their respective functions when phosphorylated by GSK3. Therefore, deactivation of GSK3 often leads to activation of its substrates.
Figure 9. The molecular mechanism by which phosphorylation inhibits GSK3. In the absence of insulin, growth factors or amino acids, GSK3 is fully active. In this state, substrates that already have a ‘priming phosphate’ bind to a specific pocket, aligning them in such a way that GSK3 can phosphorylate a serine or threonine located four residues amino- terminal to the priming phosphate. After agonist stimulation, GSK3 becomes phosphorylated at a serine residue near its amino terminus, which is serine 21
21 (Ser21) in GSK3α and Ser9 in GSK3β. This transforms the amino terminus into a
‘pseudosubstrate’ inhibitor, the phosphoserine occupying the same binding site as the priming phosphate of the substrate and blocking access to the active site. Arginine 96
(R96), R180 and lysine 205 (K205) are the key residues involved in binding the priming phosphate and the phosphorylated amino terminus. (PKB/AKT, protein kinase B.)
(Adapted by permission from Nature Reviews Mol Cell Biol for “The renaissance of
GSK3” by Cohen et al, License number 4396690842030).
1.7.2. GSK3 and sperm
Both GSK3α and GSK3β are present in mammalian spermatozoa. Immotile caput sperm contain six-fold higher GSK3 activity than motile caudal sperm (58). Serine phosphorylation of GSK3 increases significantly in sperm during their passage through the epididymis (34, 59). Stimulation of bovine sperm motility by isobutyl-methyl- xanthine, 2-chloro-2’-deoxyadenosine, or phosphatase inhibitor calyculin A, is accompanied by a dramatic increase GSK3 serine phosphorylation (34). In porcine sperm, a parallel increase in serine phosphorylation of GSK3 is observed after treatments that also induce a significant increase in porcine sperm motility parameters.
Therefore, a significant positive correlation among straight-line velocity (VAP), circular velocity (VCL), average velocity, rapid-speed spermatozoa (VSL), and GSK3 serine phosphorylation levels exists. Thus, GSK3 is involved in regulation of sperm motility. A constitutively active GSK3 may not only contribute to holding motility in check in caput sperm but its activity may also have a priming function essential for the subsequent steps of sperm maturation.
22
Sperm GSK3 was shown to activate PP1γ2, presumably by relieving inhibition by the protein phosphatase inhibitor I-2 (PPP1R2). GSK3 is also a substrate for PP1γ2, because its phosphorylation is elevated by protein phosphatase inhibitors (29, 31, 32).
PP2A, belonging to a family of conserved protein phosphatases, involved in a wide spectrum of cellular functions (33-35), is present in sperm (17, 28). Differential inhibition of PP1 and PP2A by pharmacological inhibitors suggests a role for PP2A in sperm capacitation and hyperactivation (36,37). An activation-inactivation cycle involving PKA, PP1γ2, and GSK3 is shown in Figure 10. Changes in the association of
PP1γ2 to I-2 and the other regulators sds22 and I-3 also occur during sperm maturation in the epididymis.
Figure 10. Activation-inactivation cycle of PP1γ2 and inhibitor I-2 involving GSK3 and PKA. Active GSK3 phosphorylates I-2 and activates PP1γ2 (I-2 when not phosphorylated binds and inhibits PP1γ2). GSK3 is phosphorylated and inhibited by kinases such as PKA. GSK3 and/or PKA could also affect the other PP1γ2 regulators sds22 and I-3.
23
1.7.3. Role for GSK3 in epididymal sperm maturation.
As mentioned above, GSK3 activity is more than four-fold higher in immotile caput compared to motile caudal epididymal sperm(60). New data further support the notion that GSK3 is a key enzyme involved in epididymal sperm maturation:
1) Association of the regulators of PP1γ2 in sperm (I-2 and I-3 and sds22) dramatically change in caudal compared to caput epididymal sperm (Goswami et al. Manuscript under review).
2) Binding of these regulators to PP1γ2 in caudal sperm from mice lacking GSK3 resemble wild type caput sperm, suggesting impaired sperm maturation (Goswami et al.
Manuscript under review)
3) Disruption of Wnt signaling in sperm affecting GSK3, results in decreased I-2 phosphorylation and increased PP1γ2 activity, impairs epididymal sperm maturation causing male infertility (61).
4) Deletion of sperm specific PP2B catalytic subunit or its regulatory subunit results in infertility due to impaired epididymal sperm maturation(62): GSK3 phosphorylation is significantly altered in sperm lacking PP2B.
5) Septin 4 (along with other septins) found in the sperm annulus required for terminal differentiation of sperm is a target of GSK3 phosphorylation. Loss of septin 4 impairs sperm maturation causing male infertility(61, 63-65). These findings strongly support that GSK3 is a critical component of the biochemical mechanisms responsible for epididymal sperm maturation and sperm function.
24 1.7.4. Isoform specific roles for Gsk3α and Gsk3β.
In most tissues, except in the developing embryo where loss of Gsk3β is lethal, the two
GSK3 isoforms are functionally interchangeable. The presence of one allele of either
Gsk3β or Gsk3α with GSK3 catalytic activity 25% of the total activity normally present is sufficient to maintain normal signaling and tissue functions (66).
GSK3α has several functions including its involvement in acute myeloid leukemia
(67), binding to the scaffold protein RACK1 (Receptor for Activated C-Kinase-1) as part of its regulation of the circadian clock (68), promotion of amyloid β-peptide production and senile plaque formation in models of Alzheimer’s disease (69-71), regulation of autophagy and age-related pathologies(72). GSK3α selectively modulates IL-1- mediated regulation of Th17 cells, an action that was attributed to inhibition by GSK3α of IL-1-induced activation of Akt and mTOR (73).
GSK3β selectively promotes activation of members of the STAT family of transcription factors (74), and GSK3β selectively phosphorylates Mcl-1, which promotes its degradation in apoptosis signaling (75). Evidence has begun to be obtained indicating differential actions of GSK3α and GSK3β in synaptic plasticity, as detected by measurements of long- term potentiation (LTP) and long-term depression (LTD). In
2007, inhibition of GSK3 by serine-phosphorylation was found to be necessary for, and induced by, LTP, whereas GSK3 promotes LTD (76-78). LTP was impaired in mice overexpressing GSK3β (76)and in mice expressing mutant GSK3β unable to be inhibited by serine-9-phosphorylation (79), and GSK3β was associated with receptors thought to be important in LTP(77). This all implied that GSK3β is an important regulator of synaptic plasticity, whereas a regulatory role for GSK3α was not specifically studied.
25 Additional differential actions of GSK3α and GSK3β in cell differentiation and proliferation, and cardiovascular development were comprehensively reviewed (80-82).
Altogether, there is growing evidence of differential actions of GSK3α and GSK3β.
In my study, using genetic approaches, we have tested requirement for each of the two
GSK3 isoforms in testis and sperm. Our data demonstrate an isoform-specific requirement for GSK3a during final stages of spermatogenesis and in mature sperm.
This requirement for GSK3a is unique compared to other tissues where the two isoforms of GSK3 are largely functionally interchangeable.
The aims for my thesis are:
Aim1a. Expression and localization of GSK3α and GSK3β in testis and sperm.
Aim1b. Ascertain the role of GSK3α in male fertility by target disruption of its genes.
Aim1c. Determine if there is an isoform specific requirement for Gsk3α in sperm.
Aim2. Study the biochemical properties of sperm lacking GSK3α.
26 CHAPTER 2. Materials and Methods
2.1. Mouse genomic DNA isolation
Mice ear punches were resuspended in 50μl of Alkali lysis buffer (25 mM NaOH and 2
o mM EDTA, pH 12.0 in ddH2O) and denatured at 95 C for 1 hr. After 1 hour, 50 μl of neutralizing buffer (40mM Tris-HCl, pH 5.0 in ddH2O) was added to the sample. The samples were centrifuged at 1000xg and the supernatant was collected for genotyping
PCR.
2.2. Primer list
Table 1. Primers used for genotyping.
Mouse line Primer sequence Band size WT allele
Forward: 5’GGGAGTTCTCCAGTCGTGAG-3’ 600bp Reverse: 5’-CTTGGCGTTAAGCTCCTGTC-3’
KO allele
Forward: 5’-GCCCAATTCCGATCATATTC-3’ Global Gsk3α KO Reverse: 5’-CTTGGCGTTAAGCTCCTGTC-3’ 200bp
Stra8 Cre
Forward: 5′-GTGCAAGCTGAACAACAGGA-3′ 199bp Reverse: 5’-AGGACACAGCATTGGAGTC-3’
27 Gsk3α Lox
Forward: 5’- WT:500bp Conditional CCCCCACCAAGTGATTTCACTGCTA-3’ LOX:600bp Gsk3α KO Reverse: 5’- CTTGAACCTTTTGTCCTGAAGAACC-3’ Stra8 Cre
Forward: 5′-GTGCAAGCTGAACAACAGGA-3′ Reverse: 5’-AGGACACAGCATTGGAGTC-3’ 199bp Gsk3β Lox Conditional Gsk3β KO Forward: 5’-GGGGCAACCTTAATTTCATT-3’ WT:880bp Reverse: 5’- LOX:1090bp TCTGGGCTATAGCTATCTAGTAACG-3’
28 2.3. Generation of Gsk3a Conditional KO Mice
The targeting construct for Gsk3a was created using a recombineering strategy. Briefly, a Roswell Park Cancer Institute (RPCI) bacterial artificial chromosome (BAC) clone containing the murine Gsk3a locus (RPCI-23 228E7), obtained from Children's Hospital of Oakland Research Institute, was transformed into EL350 cells. PCR was used to retrieve approximately 400-bp homology arms that flanked exons 2, 3, and 4 of Gsk3a by 5 kb on each side. Deletion of exon 2 has been shown to result in a nonfunctional kinase(83). After cloning homology arms into a retrieval vector
(pBluescript modified to contain a thymidine kinase cassette), this construct was transformed into the EL350 BAC-containing cells, and induced homologous recombination via gap repair, resulting in a 10-kb fragment of Gsk3a being retrieved into the pBluescript derivative. Next, mini-targeting vectors were created by introducing identical 34-bp loxP sites on both sides of a neomycin resistance cassette (neomycin phosphotransferase gene [NeoR]). The loxP/NeoR cassette was then introduced into gap repaired retrieval plasmids using a similar approach as described above for retrieving the Gsk3a fragment. Transformation of these constructs into bacteria with arabinose- inducible Cre allowed recombination, removing the NeoR cassette and one loxP site. An additional round of this cloning approach was used to introduce a second loxP/NeoR cassette, now flanked by FRT sites, on the 3′ side of exon 2. Plasmids were linearized with NotI, gel purified, and electroporated into mouse ES cells by the ES Cell and Transgenic Core Facility at the Research Institute at Nationwide Children's
Hospital. Targeted ES cells were grown in the presence of G418 (350 μg/ml) and FIAU
(5-iodo-2′-fluoro-2′-deoxy-arabinouridine; 200 nM) for the selection of cells that
29 contained correct gene targeting. Southern blotting of G418/FIAU-resistant clones revealed that 22 out of 156 colonies (14%) contained a correctly targeted Gsk3a floxed allele. Two clones were selected for injection into blastocysts, from which we obtained several male chimeric mice. These mice were mated to either ROSA26-FLPe mice, a well-characterized transgenic mouse that ubiquitously expresses Flp at high levels(84), resulting in the highly efficient removal of the NeoR cassette, or WT C57BL/6 females.
These genetically altered mice were obtained from Dr. Christopher Phiel(85).
2.4. Preparation of Mouse Testis Extracts
Testes from mice were homogenized in 1ml homogenization buffer with protease inhibitors (HB+; 10 mM Tris [pH 7.2] containing 1 mM EDTA, 1 mM EGTA, 10 mM benzamidine-HCl, 1 mM PMSF, 0.1 mM N-p-tosyl-l-phenylalanine chloromethyl ketone, and 0.1% [V/V] β-mercaptoethanol). The homogenates were centrifuged at 16 000
× g for 20 min at 4°C, and the supernatants were collected as testis extracts.
2.5. Mouse sperm isolation
The cauda epididymis and vas deferens from adult mice, aged 6–12 weeks, were isolated in PBS as previously described (86). The cauda epididymis was punctured with a 22-mm gauge needle and the sperm were allowed to swim out. Surgical scissors were also used to squeeze sperm out of the cauda and along the vas deferens. With occasional swirling, sperm were allowed to disperse into PBS for 5-10 min at 37ºC. The sperm suspension was transferred to micro-centrifuge tubes using a large-bore pipette
30 tip. Approximately 10µl of the suspension was diluted 20 times (1:20) in water for determination of sperm number using a Neubauer hemocytometer. To assess morphology, an aliquot of the sperm suspension was added to freshly prepared 4% PFA
(EM grade) in 1X PBS and incubated at 4ºC for 30 minutes. Fixed sperm were mounted on poly-L-lysine-coated slides and sealed with coverslips. Sperm were observed under
20X and 60X objectives in an Olympus 81 differential interference contrast microscope.
2.6. Mouse sperm extract preparation
Caudal epididymal sperm isolated in PBS or HTF media was centrifuged at 700 × g for
10 min at 4°C. The sperm pellet was resuspended in 1% SDS at a final concentration of
2 × 108 sperm/ml. The sperm suspension in 1% SDS was then boiled in a water bath for
5 min and centrifuged at 12 000 × g for 15 min at room temperature. The supernatant, called the whole sperm extract, was collected and used for Western blot analysis.
2.7. Isolation and Analysis of Sperm Morphology
For examination of morphology, sperm were resuspended in freshly prepared 4% PFA in 1× PBS and incubated at 4°C for 1 h. Fixed sperm were mounted on clean poly-L- lysine-coated slides and sealed with coverslips. Sperm morphology was observed under
20X and 60X objective lens with an Olympus 81 microscope using differential interference contrast.
31 2.8. Western Blot Analysis
Testes and sperm extracts were denatured by boiling with Laemmli buffer for 3 min. The proteins were separated by electrophoresis on 12% SDS-PAGE and transferred onto
Immobilon-P PVDF membranes (Millipore Corp.). Following transfer, nonspecific protein binding sites on the membrane were blocked by incubation with 5% nonfat dry milk diluted in TTBS (0.2 M Tris, pH 7.4, 1.5 M NaCl, 0.1% thimerosol and 0.5% Tween 20).
The blots were then incubated with primary antibody diluted in 5% nonfat dry milk in
TTBS. Following a brief wash with TTBS, the blots were incubated with the appropriate horseradish peroxidase-conjugated secondary antibody (1:5000; Jackson lab) for 1 h at room temperature. Blots were washed with TTBS twice for 15 min and twice for 5 min.
The blots were finally developed with enhanced chemiluminescence substrate (Thermo
Scientific Super Signal West Pico ECL).
2.9. List of Antibodies.
Table 2. Antibodies used in western blot, immunocytochemistry and immunohistochemistry are listed below.
Antibody name/Use Company/ Dilution Host Catalogue # 1:1000 GSK3α Cell Signaling (Western Blot) Rabbit (4337S) monoclonal
32 1:200 (Immunofluorescence)
GSK3β Cell Signaling 1:1000 Rabbit (9315S) (Western Blot) monoclonal
GSK3α Sigma 1:150 Rabbit (SAB4300292) (Immunofluorescence) Polyclonal
GSK3β Sigma 1:150 Rabbit (SAB4300287) (Immunofluorescence) Polyclonal Novous Biologicals 1:1000 GSK3β (NBP 47470) (Western Blot) Mouse 1:200 monoclonal (Immunofluorescence)
P-GSK3α/β Cell Signaling 1:1000 Rabbit (9331S) (Western Blot) monoclonal
Yenzym 1:5000 PP1γ2 (In house) (Western Blot) Rabbit monoclonal 1:2000 β-Actin Gene script (Western Blot) Mouse (A00702-200) monoclonal 1:5000 β-Tubulin Abcam (Western Blot) Rabbit (ab52901) Monoclonal 1:2000 Phospho-Tyrosine Milipore (Western Blot) Mouse (4G10) (05-321) monoclonal
1:1000 Hexokinase -1 Cell Signaling (Western Blot) Rabbit (2024S) monoclonal
GSK3α/β Thermo/Invitrogen 1:1000 Mouse (44-610) (Western blot) monoclonal
33 2.10. Sperm Motility Analysis
Within 10 min of isolation in 1× PBS media, as described above, caudal sperm were diluted to a concentration of 2 × 107 sperm/ml, and 25 μl of diluted sperm suspension was loaded using a large-bore pipette into a 20-100-μm Leja chamber slide, prewarmed to 37°C on a stage warmer. Sperm motility was analyzed with a computer-assisted sperm motility analyzer equipped with the CEROS sperm analysis system (software version 12.3; Hamilton Thorne Biosciences, Beverly, MA)(32, 86). For each chamber with the sperm sample, three to five random fields were recorded and analyzed using the following settings: 90 frames acquired at 60 frames/sec; minimum contrast of 30; minimum cell size at 4 pixels; default cell size at 13 pixels; static cell intensity of 60; low size gate of 0.17; high size gate of 2.26; low-intensity gate of 0.35; high-intensity gate of
1.84; minimum static elongation gate of 0; maximum static elongation gate of 90; minimum average path velocity (VAP) of 50 μ/sec; minimum path straightness (STR) of
50%; VAP cut off of 10 μ/sec; and straight line velocity cut off of 0 μ/sec. Motility was recorded independently for sperm collected from WT (n = 6) and Gsk3α−/− (n = 6) mice.
2.11. Histology of Testis Sections
Testes were fixed in Bouin Fixation Fluid (Harleco) for 6 h and washed in 70% ethanol to remove excess Bouin solution. Fixed testes were then processed by washing in a graded, increasing ethanol concentration (70%, 80%, 95%, and 100%) for 45 min each, and then permeabilized in CitriSolv (Fisher Scientific) for 30 min(32, 87). The processed testes were then embedded in paraffin, sectioned, and the 5-μm-thick sections were
34 transferred to poly-l-lysine-coated slides. Sections were stained with periodic acid-Schiff staining kit (Leica Biosystems) using the manufacturer's protocol. The slides were counterstained with Gill II hematoxylin for 3–4 min, rinsed again in running tap water for
5 min, dehydrated through two changes of 95% and 100% alcohol (2 min each), and finally cleared in two changes of xylene before addition of mounting medium.
2.12. Immunocytochemistry of Spermatozoa
Caudal epididymal spermatozoa in PBS were spun down at 700 × g for 10 min at 4°C.
The cells were fixed in 4% Paraformaldehyde (PFA), EM grade (Electron Microscopy
Sciences) at 4°C for 20 min, followed by permeabilization with 0.2% Triton-X (5 min).
Fixed spermatozoa were attached to poly-l-lysine-coated slides. The slides were washed three times with TTBS to remove excess PFA and incubated for 4 h at room temperature in a blocking solution containing 5% normal goat serum and 5% BSA in
TTBS at room temperature. The slides were then incubated overnight at 4°C with anti- primary antibody and then washed three times 5 min each with TTBS, followed by incubation with the appropriate secondary antibody conjugated to Cy3 (red) and Alexa fluor 488 (green) for 1 h at room temperature. The slides were then washed three times,
10 min each with TTBS, mounting medium was applied, and the sperm cells were examined by brightfield and fluorescence microscopy.
35 2.13. Mitochondrial Structure Assessment
Sperm were collected from C57BL6 WT and Gsk3a−/− mice and was resuspended in
PBS with a concentration of 1 × 107 sperm/ml. It was then incubated in 20 nm of
MitoTracker green (Molecular Probes) for 30 min at 37°C to stain the live mitochondria.
To counterstain the nucleus, samples were subsequently incubated in Hoechst dye
(Molecular Probes) for 20 min at 37°C in 1:1000 dilution. The samples where mounted on poly-l-lysine-coated slides and observed with an Olympus 1000 microscope.
2.14. RNA Isolation and cDNA Synthesis
Total RNA isolation from testis of WT, Gsk3α+/−, and Gsk3α−/− mice was performed using TriZol reagent (Sigma), phenol-chloroform extraction (Amresco), and isopropanol precipitation. The pellet was washed with 75% ethanol and dissolved in DEPC-treated water. The concentration of the RNA was measured in a Nanodrop ND-1000
Spectrophotometer (Nanodrop Technologies); 900 ng of RNA was used to prepare cDNA by following the QuantiTect Reverse Transcription Kit (Qiagen). The PCR analysis was done using 1 μg of cDNA prepared from RNA of testis of WT, heterozygous, and KO mice. The following primer sets were used: L 5′-
ACCCTTGGACAAAGGTGTTC-3′ (from exon 8/9 junction), and L 5′-
TCAGTCCTGGTGAACTGTCC-3′ (from exon 10) expected to produce an amplicon 300 bp in size.
36 2.15. Quantitative PCR
Quantitative PCR analysis of Gsk3α mRNA expression was done using the QuantiTect
SYBR Green RT-PCR Kit according to the manufacturer's protocol. Quantitative RT-
PCR (qRT-PCR) experiments were performed on the Rotor-Gene Q series. For SYBER green (Quanti-Tect SYBR Green RT-PCR Kit) qRT-PCR, average threshold cycles were determined from triplicate reactions. PCR reactions were carried out in a 25-μl volume for 5 min at 95°C for initial denaturing, followed by 35 cycles at 95°C for 5 sec and at
59°C for 20 sec. A housekeeping control gene, Gapdh, was used as an internal control.
Each primer set was first tested to determine optimal concentrations, and products were run on a 1% agarose gel to confirm the presence of the predicted amplification products. Data were analyzed by ΔCt method considering the average Ct values of each sample. Error bars indicate standard deviation or standard deviation normalized to a reference sample, as indicated in the legends accompanying the figures.
2.16. Northern Blot analysis
Mouse multiple mouse tissue Northern blot was obtained from Zyagen (Catalogue #
HN-MT-1). The membrane was soaked in DEPC treated water for 5 minutes followed by
5 minutes in 1 X SSC. Following this treatment, the membrane was pre-hybridized in 10 ml of Ultrahyb hybridization buffer (Ambion) in a hybridization bottle at 42°C for one hour. A full length cDNA probe for Gsk3α or Gsk3β was random primer labeled using
32P-dCTP (MP Biomed) and a Rediprime nicktranslation kit (GE Healthcare,
Piscataway, NJ). The radiolabelled probe was passed though Illustra NICK columns
(GE Healthcare) to remove unincorporated dCTP. The eluted probe was diluted in 10 ml
37 of hybridization buffer and added to the blot in a hybridization bottle. The blot was incubated overnight at 42°C, washed twice in 1 % SSC with 0.1 % SDS, twice in 0.5 %
SSC with 1 % SDS and twice in 0.1 % SSC with 1 % SDS. All the washes were at 42°C for 5 minutes. After washing, the moist membrane was wrapped in saran wrap and exposed to a phosphor-imager screen (Molecular Dynamics) and developed with
Typhoon scanner (GE Healthcare).
2.17. Immunohistochemistry
Testis from conditional GSK3α KO, conditional GSK3β KO and WT mice were collected and fixed in 4% PFA in PBS at 4°C for 6 hrs. The fixed testes were transferred to 75% ethanol and dehydrated, permeabilized, and embedded in paraffin using a Shandon
Tissue Processor (Thermo Electron Corp., Waltham, MA, USA). Multiple 5 µm-thick sections of the whole testis were attached to poly-L-lysine-coated slides, deparaffinized, and rehydrated using a standard procedure. Antigen retrieval was performed using
1XAntigen Retrieval Citra Solution (BioGenex, San Ramon, CA, USA). Sections immersed in Citra solution were microwaved 3 times for 2 minutes, with a cooling period of 1 minute between each heating cycle. Slides were incubated for 1 hour at room temperature in a blocking solution containing 10% normal goat serum (Jackson
Immuno-research laboratories, West Grove PA) in PBS. Slides were then incubated with primary antibodies for GSK3α and GSK3β (1:200) overnight at 4°C. Slides were washed three times with 1X PBS and incubated with the appropriate secondary antibody (1∶250) conjugated with Cy3 or Alexa-fluor (Jackson Immunoresearch laboratories, West Grove PA) for 2 hours at room temperature. The slides were washed
38 five times with PBS. Nuclei were labeled with Hoechst dye (Thermo Scientific Pierce,
Oregon, and USA). The slides were mounted with Prolong Diamond Antifade Mountant
(Thermo Scientific Pierce, Oregon, USA) mounting media, and examined using a Fluo
View 500 Confocal Fluorescence Microscope (Olympus, Melville, NY, USA). Control slides were processed in the same manner except that the primary antibody incubation was omitted.
2.18. Kinase activity assay (GSK3)
Sperm suspensions were centrifuged at 700g for 10 minutes at 4ºC and pellets were resuspended again in 1X RIPA lysis buffer supplemented with 0.1 % β- mercaptoethanol, 10 mM benzamidine, 1mM phenyl-methyl-sulfonyl fluoride (PMSF),
0.1 mM N-tosyl-L-lysyl chloromethyl ketone (TPCK), 1mM sodium orthovanadate, and
1nM calyculin A. Sperm suspended in the lysis buffer was incubated in ice for 30 minutes followed by centrifugation at 16,000g at 4°C for 20 minutes. The ensuing supernatant was collected and used for the GSK3 assay. GSK3 activity was measured by the amount of 32PO4 transferred from [32P] γ- adenosine triphosphate to phospho- glycogen synthase peptide-2 (GSK3 substrate, Millipore). The initial assay buffer contained 200 mM HEPES, 50 mM MgCl2, 8 µM DTT, 5 mM sodium ß- glycerophosphate, 0.4 mM ATP and 4 µCi of gamma-P32 ATP. 5 µl of this assay buffer was added with 5 µl each of previously prepared cell extract and GS2 peptide (1 mg/ml). GSK3 activity was also measured in the presence of 1mM LiCl. Lithium- sensitive kinase activity was considered to be due to GSK3 (88). The reaction mixture was incubated at 30°C water-bath for 15 min and the reaction was stopped by cooling
39 on ice for 10 minutes. 12-μL aliquot of the reaction mixture was applied to a phosphocellulose cation exchanger (P81; Whatman Inc, Clifton, NJ) paper cut into
1.5cm× 1.5cm squares and washed with 0.1% (vol/vol) phosphoric acid. After 3 washes
(5 minutes each) in phosphoric acid, the squares were placed into scintillation vials with
2 mL of distilled water and counted in a scintillation counter. Each of the reaction set was done in triplicate. The GSK3 activity was measured as follows:
Activity units/107 cells = (Lithium-sensitive cpm) x (Reaction vol/spot vol) / (sp. activity of
P32 ATP) x reaction time). All assays were conducted in triplicate and the means of 3 or more separate experiments are shown. The use of this procedure for GSK3 catalytic activity is reported(60).
2.19. ATP Assay
Cauda epididymal sperm were isolated in HTF medium as described above and sperm concentration determined. At the specified time points, triplicate 30-μl aliquots were diluted into 270 μl of boiling Tris-EDTA buffer (0.1 M Tris-HCl and 4 mM EDTA; pH
7.75) as described previously(89). The diluted suspensions were boiled for 5 min and then frozen in dry ice. The frozen samples were thawed and centrifuged at 15 000
× g for 5 min at 4°C. The supernatant was then diluted at least 1:10 using the Tris-
EDTA buffer and 100 μl of diluted sample was then utilized for quantifying ATP using the Bioluminescence Assay Kit CLS II (Roche Applied Science). Luminescence was measured in a Turner Biosystems 20/20 Luminometer.
40 To check effect of different substrate on ATP levels caudal sperm were isolated in PBS medium and then pelleted down at 700g for 10 minutes. The sperm pellet was then resuspended in TYH medium (pyruvate and lactate free) and incubated separately with
10mM glucose and 25mM lactate. After 2 hours incubation triplicates of aliquots were diluted 1:10 in boiling Tris-EDTA buffer (0.1 M Tris- HCl and 4 mM EDTA; pH 7.75). The samples were prepared as described previously(86). 100 µl of diluted sample was then used for quantifying ATP using the Bioluminescence Assay Kit CLS II (Roche Applied
Science) followed by measurement of luminescence in Luminometer (Turner
Biosystems 20/20).
2.20. Protein Phosphatase Assay
Caudal epididymal sperm resuspended in HB+ at a final concentration of 2 ×
108 sperm/ml were sonicated on ice with an ultrasonic cell disruptor (Q-Sonica) for three times at 10 sec each at 30% amplitude. The sonicate was centrifuged at 16 000 × g for
20 min at 4°C, and the supernatant was collected as the soluble fraction. The pellet
(insoluble fraction) was resuspended in an equal volume of HB+. The soluble and insoluble fractions of the sonicates were utilized for phosphatase enzyme activity measurement on the same day. Radiolabeled phosphorylase a was used as a substrate to measure the activity of PP1 by procedures previously reported(34). Aliquots of the fractions of sperm extracts were preincubated at 30°C for 15 min in either the presence or absence of protein phosphatase inhibitors. Purified protein phosphatase inhibitor-2 (I-
2) was used at a final concentration of 25 nM to inhibit PP1 or 2 nM okadaic acid final
41 concentration to selectively inhibit PP2A. Phosphorylase a was then added and the samples were further incubated at 30°C for 10 min. The reaction was terminated by addition of 10% trichloroacetic acid and centrifuged for 10 min at 12 000 × g.
Supernatants were quantitated for 32P released from phosphorylase a.
2.21. Hexokinase Assay
Sperm lysates were prepared by collecting sperm directly from the cauda epididymis into PBS media. The samples were centrifuged and the pellet was resuspended in modified RIPA media (1X RIPA; Millipore, 1M benzamidine, b-mercaptoethanol, Phenyl
Methyl Sulfonyl Chloride, 1mM activated sodium orthovanadate and 1 mM calyculin).
The resuspension was kept in ice for 30 minutes and was then centrifuged at 12000g for 15 minutes at 4°C. The supernatant was collected and used for the assay. 50µl of sample was added with 950 µl of assay solution containing 20mM Tris-HCl (pH 7.5), 20
+ mM MgCl2, 4mM EDTA, one unit/ml G6PDH, 10mM glucose, 0.6mM bNADP and 0.1%
Triton X-100. After 3 minutes of preincubation, hexokinase activity was initiated by addition of 4mM ATP. The final NADPH production was measured at 340nM by spectrophotometry after 12 minutes(66, 90). For the control assay, glucose was omitted.
2.22. In vitro fertilization (IVF)
2-3 months old C57Bl6 females were injected intra-peritoneally with 5 IU of pregnant mare's serum gonadotropin (PMSG) hormone. After exactly 52 hours the females were injected intra-peritoneally with 5 IU of Human chronic gonadotropin (hCG) hormone. In
42 the next morning, 3-6 months old C57BL6J WT, Gsk3α (+/-) and Gsk3α (-/-) male mice were sacrificed and caudal spermatozoa was isolated in HTF medium. The sperm then incubated for 1 hour in 5% CO2 and 37°C. 14 hours after hCG injection, the females were sacrificed, and the oviducts and ovaries were removed. The oviducts and ovaries were then immersed next to the drop of media overlaid with mineral oil. Using a dissecting needle, the ampulla was punctured to release the Cumulous Oocyte
Complexes (COCs) and the COCs were dragged from the mineral oil into 235μl drop of
HTF medium. After one hour from the capacitation in HTF media, 15μl of sperm collection were transferred into the drop containing COCs and incubated in 5% CO2 and 37°C for 4 hours. After 4 hours, the eggs were moved from the fertilization drop using a transfer pipette into 3 sequential wash drops and incubated again in 5% CO2 and 37°C overnight. In the next morning, the two cells stage embryos were counted to determine the number of eggs fertilized.
2.23. In vivo fertility test
All Gsk3α (global and conditional testis specific) KO and conditional testis specific
Gsk3βKO male mice were mated with wild-type C57BL6 females over a period of 4 to
10 weeks, and the number of offspring in each litter was recorded. C57BL6 females that failed to become pregnant were subsequently kept for 2 more weeks alone to confirm the absence of pregnancy.
43 2.24. Animal ethics statement
All wild-type and transgenic mice were housed and used at Kent State University with the approval of the Kent State University Institutional Animal Care and Use Committee following the appropriate laws, guidelines and policies and performed in accordance with the NIH and National Research Council's publication “Guide for Care and Use of
Laboratory Animals”.
2.25. Statistics
Statistical analyses were performed using the nonparametric one-way ANOVA and two- tailed unpaired t-test using the GraphPad Prism 6.03 (GraphPad Software Inc.). In all cases, differences between samples were considered significant for P values ≤ 0.05.
44 CHAPTER 3. Results
Part of this work has been previously published as Isoform specific requirement for
GSK3α in sperm for male fertility. Bhattacharjee R, Goswami S, Dey S, Gangoda M,
Brothag C, Eisa A, Woodgett J, Phiel C, Kline D, Vijayaraghavan S. Biol Reprod. 2018
Jan 29. doi: 10.1093/biolre/ioy020. License number 439327040273.
3.1.1. Aim 1A. Expression and localization of GSK3α and GSK3β in testis and sperm
Rationale.
It is well known that GSK3 is a key signaling enzyme in somatic cells. Our lab first showed presence of GSK3 in bovine sperm dates back to the year 1997. However,
Alternate transcripts for both GSK3 isoforms (Gsk3α and Gsk3β) are expressed at high levels in testes. My goal in this aim is to ascertain how the levels of these messages change in post-natal developing testis and during onset of spermatogenesis by northern blot and quantitative PCR of RNA from testis of 5 to 40 days old mice. Northern blot analysis and quantitative PCR will also be used to determine expression of these alternate transcripts in testis compared to other tissues, including brain. Also, expression pattern of the two isoforms in testis and sperm will be determined using immunofluorescence technique.
45 3.1.1.1. Expression of Gsk3α and Gsk3β in testis
We have previously shown that both isoforms of GSK3 are present in sperm (86).
Presence of the enzymes in rat testis is documented (91). However, expression and localization of the two isoforms in mouse testis is not known. We therefore determined mRNA expression of the two isoforms in mouse testis. Northern blot analysis of RNA from various mouse tissues was performed (Figures 11A, B). Messenger RNA for
GSK3α (2.8kb) is highest in testis and brain and present at lower levels in other tissues.
Messenger RNA for GSK3β at 7.8 kb is present in several tissues confirming earlier data (92). In addition, high levels of an mRNA of 1.7 kb is present exclusively in testis.
The reason for the 1.7 kb mRNA seen in testis is not known. qPCR analysis of mRNA expression of the two GSK3 isoforms was performed in post-natal developing testis
(Figures 11C, D). Levels of mRNA for both isoforms increased starting from 10-day post-natal testis reaching a maximum by day 25, coinciding with spermiogenesis and release of sperm into the lumen. This pattern of expression is seen for mRNAs for several testis and sperm proteins (93).
46
Figure 11: (A, B) Northern blot analysis of multiple mouse tissue RNA shows messages for GSK3αand β are highest in testis. (C, D) Quantitative PCR showing increasing Gsk3α and Gsk3β mRNA levels in postnatal developing testis. The results are represented as fold change after normalizing the Gsk3α and Gsk3β mRNA levels to
1 at 10 days. These data are representative of three independent experiments in triplicates, and error bars represent SE.
47 3.1.1.2. Localization of GSK3α and Gsk3β in adult testis section
Immunofluorescence was performed with sections of adult mouse testis probed with
GSK3α and GSK3β rabbit monoclonal antibodies (Figure 12 A-D). This staining showed
GSK3α expression predominantly in round and elongated spermatids and spermatozoa.
GSK3α was also present in Sertoli cells, seen as spoke like structures emanating from the periphery to the lumen (Figure 12A). Sertoli cells branch through germ cells at various stages of development (31, 32). GSK3β staining was not seen in Sertoli cells whereas it was present in spermatocytes and spermatids, (Figure 12B). Merged and magnified pictures show co-localization of GSK3α and GSK3β in spermatocytes and spermatids (Figures 12C, D). There is overlap in the spatial and temporal expression of the two GSK3 isoforms in testis especially during the final stages of sperm formation.
48
Figure 12: (A-D) Immunostaining of Wildtype testis section with GSK3α and GSK3β monoclonal antibodies. (A)GSK3β expression using GSK3b monoclonal antibody; (B)
GSK3α expression using GSK3α monoclonal antibody; (C) Merged picture showing overlapping expression of GSK3α and GSK3β in testis;(D) Zoomed picture showing overlapping expression of GSK3α and GSK3β during development of spermatozoa.
49 3.1.1.3. Localization of GSK3a and GSK3b within sperm
We performed immunocytological staining of sperm from WT mice with GSK3α and
GSK3β rabbit monoclonal antibodies. We found that GSK3α is localized to the acrosomal region in the head with staining in the tail. Tail staining is predominant in the mid-piece region. However, GSK3β was predominant in the equatorial and post acrosomal regions of the sperm head. GSK3β staining was absent or weak in the sperm mid-piece and the principal piece of the flagellum (Figure 13). Thus, Gsk3α and GSK3 distinct localization in sperm.
50
Figure 13: Immunofluorescence using GSK3α and GSK3β monoclonal antibody shows expression of GSK3α (13A) and GSK3β (13B) in Wild type sperm. For both 13A and B,
(I) Bright Field, (II) Hoechst/Nucleus, (III) Cyanine 3/GSK3α or GSK3β,(IV) Merged,(VI)
Zoomed and merged with Cyanine 3 to show the sperm head and Hoechst and (VII)
Zoomed and bright field merged with Cyanine 3 and Hoechst .GSK3α is present in the tail and acrosomal region in the head (showed by arrows in 13A-IV) . However, GSK3β is present in post acrosomal and equatorial region in head (showed by arrows in 13B-
IV).
51 Summary
• For GSK3α there is a 2.8 kb message abundant in testis and brain. This
expression is less in other tissues. For GSK3β, in addition to a ubiquitous
message (7.8 kb) in several tissues, there is an abundant and smaller sized
mRNA (1.7 kb) expressed specifically in testis.
• GSK3α and GSK3β is co-localized in spermatocytes and spermatids in WT
testis.
• Localization of GSK3α and GSK3β in WT sperm is distinct. GSK3α is
predominantly expressed in acrosomal region of sperm head and in sperm
flagellum. However, GSK3β is present in post acrosomal region and equatorial
region of sperm head.
52 3.1.2. Aim 1B. Ascertain the role of GSK3α in male fertility by target disruption of its genes
Part of this work has been previously published as Targeted disruption of glycogen synthase kinase 3A (GSK3A) in mice affects sperm motility resulting in male infertility.
Bhattacharjee R, Goswami S, Dudiki T, Popkie AP, Phiel CJ, Kline D, Vijayaraghavan
S. Biol Reprod. 2015 Mar;92(3):65. doi: 10.1095/biolreprod.114.124495. Epub 2015 Jan
7. PMID :25568307. License number 4393270184827.
Rationale.
A number of transgenic approaches have been used to examine the physiological role of GSK3 (47). GSK3β knock out is embryonic lethal (94). It was first reported that mice lacking GSK3α were normal and fertile (83). More recently, a serendipitous observation made during studies on the role of the Gsk3α in brain noted that males lacking Gsk3α were infertile (95). No data or analysis was presented in this paper. Following this we also came across a Ph.D. thesis with a similar observation of the requirement of Gsk3α for male fertility (85). Here too, the male infertility phenotype was not analyzed. My objective in this aim was to determine whether elimination of GSK3α affects male fertility and sperm function.
53 3.1.2.1. Targeted Disruption of Gsk3α
In order to create conditional knock out alleles of Gsk3α, homologous recombination was used to insert flanking loxP sites into the Gsk3α locus (Fig. 14). These mice were obtained from Dr.Christopher Phiel ( University of Colorado, Denver). The gene targeting strategy was designed to remove exons 2, 3, and 4 from Gsk3α. A doublet of lysine residues necessary for catalytic activity (Lys148/149 in Gsk3α) lies within exon 2 of both isoforms; therefore, loss of exons 2, 3, and 4 from Gsk3α was predicted to introduce premature stop codons in the mRNA, resulting in a truncated message and severely truncated protein if translated. It has been previously shown that the loss of exon 2 results in loss of detectable GSK3α protein(83). Chimeric mice were generated by injection of targeted ESC clones into C57BL/6 blastocysts. Chimeric males were mated to WT C57BL/6 females to generate heterozygous mice. Heterozygous Gsk3α
(+/loxP) mice were crossed with mice possessing the Sox2-Cre transgene, which expresses Cre throughout the epiblast, resulting in the effective removal of the floxed sequence in all tissues of the adult mice. Heterozygous Gsk3α males and females were crossed to obtain homozygous Gsk3α KO mice(86).
54 Figure 14. Targeting strategy to generate Gsk3α conditional alleles. The targeting construct was generated via recombineering to include loxP sites flanking exons 2, 3, and 4. Additionally, the downstream loxP site includes an adjacent PGK-NeoR cassette flanked by FRT sites to facilitate removal of this cassette by Flp recombinase. The hatched boxes represent homology arms used to retrieve Gsk3α from the BAC clone, and also represent the edges of Gsk3α homology in the targeting construct. HSV-TK was included outside of the Gsk3α homology region for negative selection against random integrations in the mouse genome. Two southern blot probes (black boxes) detect a 20.5 kb SpeI fragment in the WT allele, and either a 3.9 kb or 14.8 kb fragment in the PGK-NeoR floxed allele. Genotyping PCR primers using a common reverse primer (R) were designed to detect the WT allele (F1-R, 482 bp), PGK-NeoR floxed allele (F2-R, 330 bp), Flp deletion product (F1-R, 579 bp), and Cre deletion product (F3-
R, 252 bp).
55 3.1.2.2. GSK3 isoforms in sperm and testis of WT, Gsk3α (+/-) and Gsk3α KO mice
3.1.2.2.1. Expression of Gsk3α transcript in Gsk3α (+/-) and Gsk3α KO compared to WT.
Determination of mRNA levels for Gsk3α by quantitative PCR showed that the Gsk3α
(+/-) mRNA levels in testis were roughly one-half of that in WT testis (Figure 15). The mRNA for Gsk3α in testis of Gsk3α KO mice was drastically reduced. In both cases, the reduction was likely due to reduced stability of the truncated transcript arising from the mutant alleles lacking exons 2, 3, and 4.
Figure 15. mRNA expression in wild type and Gsk3α KO mice. Quantitative PCR analysis of RNA from testis of WT, Gsk3α (+/-) and KO mice shows drastically reduced levels of Gsk3α mRNA. The primers used in this experiment was from exon 8-9 junction
(L5’ACCCTTGGACAAAGGTGTTC3’) and exon 10 (R 5’TCAGTCCTGGTGAACTGTCC
3’). The results are represented as fold change after normalizing the Gsk3α mRNA levels with Gapdh mRNA. These data are representative of 3 independent experiments in triplicates and error bars represent the standard error (SE).
56
3.1.2.2.2. Validation of Gsk3α KO using western blot analysis of testis and sperm extracts
Western blots of testis extracts were probed with a monoclonal antibody that recognizes both GSK3 isoforms (Fig. 16A). As expected, GSK3α was not detectable in testis of
Gsk3α KO mice, while GSK3β was present at unaltered levels. Both GSK3 isoforms were present in WT and Gsk3α (+/-) sperm, whereas Gsk3α KO sperm contained only
GSK3β (Fig. 16B). It should also be noted that GSK3α protein levels were lower in
Gsk3α (+/-) compared to WT testis; however, protein levels in sperm were comparable to that in WT sperm. The levels of the sperm- and testis-specific PP1g2 were unaltered.
Immunoreactivity to beta-tubulin also showed equal protein loading.
Figure 16. Protein levels in wild type and Gsk3α KO mice (A, B) Western blot analysis of testis and sperm from wild type (+/+), Gsk3α Heterozygous (+/-) and Gsk3α
57 KO (-/-) showing absence of GSK3α in KO extracts compared to WT and Gsk3α (+/-).
PPP1CC2 levels in all the samples remain almost equal for both testis (A) and sperm
(B) extracts. The blot with testis extract was probed with beta tubulin antibody to demonstrate equal protein loading. Extract from 2 million sperm was loaded in each lane for the sperm blot.
3.1.2.2.3. Validation of Gsk3α KO using Immunocytochemistry
Immunocytochemistry of WT sperm showed the presence of GSK3α along the entire length of the principal and midpieces. Staining was also predominant in the acrosomal region of the sperm head. In contrast, staining was absent in sperm exposed only to the secondary antibody and in sperm from Gsk3α KO mice (Fig.17).
Figure 17. Immunocytochemistry of spermatozoa from wild type and Gsk3α KO mice. Brightfield and fluorescence immunocytochemistry of spermatozoa from WT
58 mouse. Sperm were labelled with rabbit polyclonal antibody against GSK3α as described in Materials and Methods. GSK3α was present in the acrosomal region of the head and in the entire length of flagellum including the mid-piece. There was not staining in sperm from Gsk3α KO. This result was representative of 5 independent obseravtions.
3.1.2.3. Fertility of Gsk3α KO and Gsk3α (+/-) males
Independent mating of 11 Gsk3α KO males with WT or Gsk3α (+/-) females for 4 weeks did not produce any offspring (Table 3). Gsk3α (+/-) males and females were fertile.
Homozygous Gsk3α KO females were also fertile: they were used in breeding for maintaining the Gsk3α KO line.
Table 3. Fertility table showing fertility status of Gsk3α KO mice compared to
Gsk3α (+/-) mice.
Number of Number of Number of
Lines males tested males fertile litters Average Fertility
for fertility(n) litter size Status
GSK3α KO 11 0 0 N/A Infertile
GSK3α (+/- 7 7 20 8 ± 1 Fertile
)
59 3.1.2.4. Gsk3α KO mice have normal spermatogenesis
Testis sections show that testis morphology was unaltered, and that spermatogenesis in
KO mice appeared to be normal compared to WT mice (Fig. 18, A-D). Cross section of seminiferous tubules from WT and Gsk3α KO testis showed normal morphology.
Moreover, stage IX tubule cross- sections of testis from WT and KO mice which represents round spermatids (Fig. 19) showed comparable numbers of spermatids
(mean numbers of spermatids were 80 for WT and 76 for KO). It thus appears that absence of GSK3α in testis does not affect spermatogenesis. Gsk3α KO mice appeared healthy, with normal body weight, and displayed no overt phenotype, except that Gsk3α
KO males were infertile. Testis weights and sperm numbers in Gsk3α (+/-) and Gsk3α
KO were comparable but reduced compared to Gsk3α WT mice (Table 4).
Figure 18. Immunohistological analysis of testis sections from wild type and
Gsk3α KO mice (A-D) Testis sections stained with hematoxilin show normal
60 morphology in Gsk3α KO (B, D) mice and apparently normal spermatogenesis as seen in WT mice (A, C).
Figure 19. Immunohistological analysis of testis sections from wild type and
Gsk3α KO mice to show different stages of spermatogenesis. Stage IX spermatids were identified by the absence of round spermatids. The arrows indicate presence of mature spermatids. For both WT and Gsk3α KO number of stage IX spermatids are similar. Scale bars indicate 100μm in both 20X and 40X.
61 Table 4. Testis weights and sperm number of WT, Gsk3α (+/-) and Gsk3α KO mice.
Mean Testis weight in Mean Sperm Number Mouse lines (mg) ×107
WT 108.3 ± 3.5a, n=5 4.5 ± 1.1, n=5
Gsk3α (+/-) 93.8 ± 5.3a, n=5 3.4 ± 0.6, n=5
Gsk3α KO 90.5 ± 10.5a, n=5 2.3 ± 0.6, n=5
Mean sperm number was obtained by taking average sperm number of 15 different mice. Values shown are means ± SEM (Standard Error of Means) from different determination. n denotes number of samples/groups. a, b, c denotes significantly different groups
3.1.2.5. Morphological defects in Gsk3α KO sperm
Caudal epididymal sperm from Gsk3α KO mice showed morphological defects.
Morphologically normal sperm were 61% and 39% in Gsk3α (+/-) and Gsk3α KO mice compared to 95% in WT mice. A higher proportion of abnormal sperm in Gsk3α KO mice were bent at the head/connecting piece junctions (Table 5, Fig. 20). Also, a proportion of these abnormal sperm with normal-looking heads were bent at the mid- and principal-piece junction (Table 5, Fig. 20). Next we wanted to see if these morphological abnormalities are present in testicular sperm or arise during epididymal sperm maturat as it has been in other protein knock out mice (31, 32, 96-100).
62 Morphological analysis of Gsk3α KO testicular, caput, and caudal sperm showed bent midpiece, and bent heads were present in epididymal, but not in testicular, sperm
(Table 6). Thus, normal looking testicular sperm acquire the morphological abnormalities during their passage through the epididymis.
Figure 20. Morphological features of sperm from Gsk3α KO mice. (A-C) A proportion of KO sperm were normal. (D-F) A hairpin bend at the mid- and principle- piece junction (C) was observed in some cases. Bent heads were also observed in a fraction of sperm from Gsk3α KO mice (D, E, F).
63 Table 5. Morphology of WT, Gsk3α (+/-) and Gsk3α KO mice.
Number of Normal sperm Sperm with sperm Mouse lines counted Bent mid- bent heads Normal (%) piece (%) (%)
600, n=6 a a a WT 95.83±0.79 4.2 ± 0.8 0
Gsk3α (+/-) 327, n=2 60.5 ± 3.1b 25.9 ± 2.3b 13.6 ± 3.5b
Gsk3α KO 286, n=2 38.7 ± 0.2c 31.9± 0.4b 29.4 ± 0.5c
Values shown are means ± SEM (Standard Error of Means) from different determination. n denotes number of samples/groups; a, b, c denotes significantly different groups.
Table 6. Testicular, Caput and Caudal sperm morphology of Gsk3α KO sperm.
Normal sperm Mouse line Number of sperm Sperm with bent Gsk3α KO counted heads (%) Bent mid-piece Normal (%) (%)
Testicular 202, n=3 89.6±0.9a 2±0.4a 8.4±2.8a
Caput 185, n=3 56.2±2.0b 13.7±0.7b 30.02±2.2b
Caudal 242, n=3 41.5±0.5b 28.8±1.7c 29.5±0.8b
Values shown are means ± SEM (Standard Error of Means) from different determination. n denotes number of samples/groups; a, b, c denotes significantly different groups.
64 3.1.2.6. Acrosome structure and mitochondria staining
We used MitoTracker staining to check the status of mitochondria in KO sperm.
MitoTracker green staining showed that Gsk3α KO sperm mitochondria appeared to be normal, and that the intensity of staining was comparable with WT (Fig. 21, A-D). Bent head morphology of Gsk3α KO sperm raised the possibility that acrosome structure of
Gsk3α KO sperm could be defective. Staining with acrosomal matrix protein sp56 showed no apparent defects in acrosomal structure of Gsk3α KO sperm, as they appeared as normal crescent shapes seen in WT sperm (Fig. 22, A–C).
Figure 21. Mitochondrial structure of sperm from Gsk3α KO mice. (J-M) Staining with MitoTracker green shows normal mitochondrial structure for Gsk3α KO (C, D) when compared with Wild type sperm (A, B).
65
Figure 22. Acrosomal staining of sperm from Gsk3α KO mice. (A-C)
Immunostaining of acrosome protein sp56 shows normal crescent moon-shaped structure for Gsk3α KO (B, C) sperm similar to WT sperm (A).
3.1.2.7. Motility is impaired in sperm from Gsk3α KO mice
Motility of sperm from WT and KO mice was assessed by a computerize motility analysis system (CASA). Sperm motility of Gsk3α KO mice was reduced compared to
Gsk3α (+/-) mice. All parameters of motility, including percent and progressive motility and velocity parameters, were significantly reduced in KO compared to WT sperm (Fig.
23). Velocity parameters, VAP (average path velocity), VSL (straight line velocity) and
VCL (curvilinear velocity,) of KO sperm were reduced to about 50% of that in WT
66 sperm. A notable feature of motility of KO sperm was the visibly reduced flagellar beat amplitude. Also, sperm from Gsk3α KO mice show rigid midpiece during progressive motility.
Figure 23. Motility analysis of mature caudal sperm from Gsk3α KO and WT animals. Computer assisted sperm analysis of freshly prepared cauda epididymal spermatozoa from adult (8-10 weeks old) WT and KO sperm. (A) Both percent motility and progressive motility in Gsk3α KO sperm were significantly decreased compared to
WT (B) There was alteration in the velocity parameters VAP (Average path velocity),
VSL (Straight line velocity) and VCL (curvilinear velocity). Mean values of all these
67 velocity parameters of KO mice were significantly lower than the WT control. The motility parameters were expressed as mean of n=3 ± Standard error of the Mean
(SEM). For each animal ≥ 8 non-overlapping fields were recorded for analysis. A two tailed unpaired t-test was used for analysis between the groups. The motility parameters were expressed as significant differences from WT control values observed. ** indicates significant difference (**p < 0.01 and *p<0.05).
68 Summary
In our previous work, we found that both isoforms of GSK3 are present in bovine and mouse sperm and that catalytic GSK3 activity correlates with motility of sperm from several species. Here I showed how expression of GSK3 occurs in testis. Both GSK3α and b are expressed in a similar manner in spermatocytes and spermatids. Localization of the two isoforms in sperm is distinct. GSK3α is present predominantly in sperm acrosomal region and sperm flagellum. Whereas, GSK3β expression is mainly in equatorial region and post acrosomal region in sperm head. Next, I examined the role of
Gsk3α in male fertility using a targeted gene knockout (KO) approach. The mutant mice are viable, but males are infertile, while fertility of females is unaffected. Testis weights of Gsk3α KO mice are normal and sperm are produced in reduced but normal numbers.
Spermatogenesis appears normal, while sperm motility parameters are impaired. In addition, the flagellar waveform is abnormal, characterized by low amplitude of flagellar beat with a rigid midpiece (see supplementary video file).
69 3.1.3. Aim 1C. Isoform specific role of Gsk3α in male fertility
Rationale.
The two isoforms, GSK3α and GSK3β, are encoded by distinct genes. In most tissues the two isoforms are functionally interchangeable, except in the developing embryo where GSK3β is essential. One functional allele of either of the two isoforms is sufficient to maintain normal tissue functions (101). So, it was surprising that loss of GSK3α alone caused infertility. The lack of substitution for GSK3β for the loss of GSK3α was surprising because there is overlapping spatio temporal expression of both isoforms in developing testis. It was possible that global loss of GSK3α could have caused changes that were unrelated to the requirement in sperm such as sperm development and changes in the male reproductive tracts. Moreover, we cannot rule out the possibility that loss of Gsk3β in sperm could have the same infertility phenotype as loss of Gsk3α.
In addition, we need to consider the possibility that GSK3 isoforms may be functionally interchangeable in sperm but that there is requirement for a higher threshold level of
GSK3 catalytic activity for normal sperm function. That is, loss of both alleles of Gsk3β or the loss of one allele of each of the two isoforms may also result in male infertility.
Conditional testis-specific knock out of the GSK3 isoforms was required to examine these possibilities. My goal in this aim was to test requirement for each of the two
GSK3 isoforms in testis and sperm using a Cre/Lox strategy where Gsk3α or Gsk3β can be selectively knocked out in developing germ cells in testis.
70 3.1.3.1. Condition knockout of GSK3α and GSK3β in in testis
A Cre-LoxP approach was used to inactivate each of GSK3 isoforms specifically in testicular germ cells (Figure 24) (102, 103). Mice with floxed Gsk3α or β alleles were crossed with mice expressing Cre directed by the Stra 8 promoter (Figure 25). Testis expression of Cre in Stra8-Cre mice is documented to occur in differentiating secondary spermatocytes onwards (32, 101).
Figure 24: Schematic diagram showing expression of Stra8 starting from primary spermatocytes onwards. Stra8-Cre mediated deletion of floxed genes will occur in developing germ cells.
71
Figure 25: Mating scheme employed for generation of conditional deletion of Gsk3α gene in developing germ cells.
3.1.3.2. Confirmation of testis specific Gsk3α and Gsk3β KO by western blot and immunohistochemical analysis
As anticipated, immunoblot analyses of testis and sperm extracts showed reduced levels of GSK3α or GSK3β in testis and their absence in sperm from conditional knock out mice (Figures 26A, B). Residual levels of GSK3 seen in immunoblots of testis extracts of conditional KO testis (Figure 26) are likely from somatic cells and spermatogonia. Levels of GSK3α and GSK3β were normal in all tissues of conditional
KO except in sperm where the respective GSK3 isoforms were absent. Lack of each of the respective GSK3 isoforms in developing germ cells in the conditional KO mice was
72 also verified by immunohistochemistry of testis sections (Figure 27). Gsk3α expression is restricted to Sertoli cells but absent in developing germ cells in conditional Gsk3α KO testis. Gsk3β expression is unaffected and is predominant in spermatocytes and spermatids in conditional Gsk3α KO testis. Gsk3α is present in elongated spermatids and spermatocytes in conditional Gsk3β KO testis. Gsk3β is absent in developing germ cells Gsk3β KO testis.
Figure 26: (A) Western blot results showing absence of GSK3α in Gsk3α conditional
KO sperm compared to wild type. When compared with different other tissues of conditional Gsk3α KO, sperm shows complete absence of GSK3α. (B) Western blot comparing conditional Gsk3β KO and wild type testis and sperm shows absence of
GSK3β in KO sperm sample while very less amount of GSK3β expression in testis.
When compared with other tissues of conditional Gsk3β KO sperm shows absence of
Gsk3β in sperm.
73
Figure 27. Immunofluorescence result shows less expression of GSK3α in developing spermatids while GSK3β is present in conditional Gsk3α KO testis section. For conditional
GSK3β KO there is no expression of GSK3β in seminiferous tubule of testis section confirming the complete knock down of GSK3β in germ cells.
74 3.1.3.3. Fertility of mice with testis specific KO of Gsk3α and β
We found that male mice lacking Gsk3α in testis [Gsk3α (-/ΔFl)] are infertile, similar to the global GSK3α null mice (Table 7). Except for male infertility there was no other observable phenotype in mice lacking GSK3α in testis. Mice lacking GSK3β in testis
[Gsk3α (+/+) Gsk3β(-/ΔFl)] were fertile. Mice lacking one allele of Gsk3α, Gsk3α (+/-)
Gsk3β (+/+), and mice lacking one allele each of Gsk3α and β [Gsk3α (+/-) Gsk3β (+/-)] were also fertile. Hence, male infertility results either from a global or testis-specific loss of GSK3α. Sperm from mice lacking GSK3α could not also fertilize in vitro (Figure 28).
In the IVF experiment WT, Gsk3α (+/-) and Gsk3α (-/-) were used. For each experiment, we used three C57/BL6 WT females with one male. The fertilization rate using C57/BL6
WT male was 91.7% with a total number of fertilized eggs 78 out of 85. The fertilization rates for Gsk3α (+/-) and Gsk3α (-/-) were 81.4% and 0% respectively. The total number of fertilized eggs using Gsk3α (+/-) male was 166 out of 204 while it was 0 out of 245 using Gsk3α (-/-) males. The IVF data shows that infertility of the GSK3α null male mice was not due to impaired sperm transport through the female reproductive tract(104).
75 Table 7. Fertility data of global Gsk3a KO, Testis specific Gsk3a KO, Testis specific
Gsk3b KO compared with WT mice. All transgenic mice were fertility tested within the range of 4-10 weeks.
76
Figure 28. In vitro fertilization data shows sperm from Gsk3α (-/-) are unable to fertilize eggs whereas Gsk3α (+/+) and Gsk3α (+/-) show normal fertilization rate. All the data represent mean ± standard error (n=3 males were used for each set). ***P <0.001, ****P
<0.0001 defines significant differences between the groups. Total number of fertilized eggs are mentioned in the figure. This experiment was done in collaboration with Alaa
Eisa, a graduate student in our laboratory.
77 3.1.3.4. Catalytic activity of GSK3 in sperm from conditional Gsk3α and Gsk3β knockout mice
Next, we considered the possibility that the requirement for GSK3a could be because of need for a net threshold GSK3 activity in sperm that GSK3b alone could not provide.
We measured GSK3 activity in extracts of sperm from mice lacking GSK3α, GSK3β or one allele each GSK3α and GSK3β. The activity was measured in sperm extracts using
GS peptide as substrate (60, 105). GSK3 activity was reduced to 50 percent in sperm lacking both alleles GSK3α, GSK3β and either of GSK3α and GSK3β. GSK3 activity in sperm from mice lacking one allele each was also reduce to 50% of that sperm from wild type mice (Figure 29). Thus, lowered total sperm GSK3 activity may be not responsible for infertility of sperm lacking GSK3α.
78
Figure 29: GSK3 activity assay shows significantly reduced activity when one or both alleles of Gsk3α or Gsk3β are absent. Levels were measured using GS2 peptide as a substrate. Lithium sensitive activity was considered due to GSK3. Unit activity is nMoles
2- 5 PO4 incorporated/min/10 sperm. Values are means ±SEM (n=3). **P <0.01 defines significant differences between the groups.
79 Summary
Using genetic approaches, we have tested requirement for each of the two GSK3 isoforms in testis and sperm. Both GSK3α and GSK3β are expressed at high levels in testis coincident with the onset of spermatogenesis. Mice harboring a conditional knock out of GSK3β in developing germ cells in testis are normal and fertile. By contrast, conditional knock out of GSK3α in developing testicular germ cells results in male infertility. Mice lacking one allele each of GSK3α and GSK3β, i.e. heterozygous for both isoforms, are fertile. In vivo fertilization status of Gsk3α KO mice was further validated by in vitro fertilization results. Despite overlapping expression and localization of the two isoforms in testis, GSK3β does not substitute for loss of GSK3α. GSK3α is essential and irreplaceable in testis and sperm.
80 3.2. Aim 2. Biochemical properties of sperm lacking GSK3α
Part of this work has been previously published as Isoform specific requirement for
GSK3α in sperm for male fertility. Bhattacharjee R et al, Biol Reprod. 2018 Jan 29. doi:
10.1093/biolre/ioy020. License number 439327040273 and Targeted disruption of glycogen synthase kinase 3A (GSK3A) in mice affects sperm motility resulting in male infertility. Bhattacharjee R et al Biol Reprod. 2015 Mar;92(3):65. doi:
10.1095/biolreprod.114.124495. Epub 2015 Jan 7. PMID :25568307. License number
4393270184827.
Rationale.
I have established the isoform specific requirement for sperm GSK3α in male fertility.
My goals in this aim were to determine how sperm function and metabolism are impaired in sperm lacking Gsk3α.
• Because sperm GSK3 activity is inversely proportional to PP1 activity, we wanted
to determine how protein phosphatase activity is altered in sperm from Gsk3α
null mice.
• Determine ATP levels and ascertain whether glycolysis and respiration were
affected in sperm lacking Gsk3α.
• To check status of tyrosine phosphorylation in sperm from Gsk3α null compared
to wild type mice. Tyrosine phosphorylation is considered a down-stream effect
of PKA during sperm capacitation.
• To determine if cAMP and PKA are altered in sperm from GSK3α null mice.
81 3.2.1. Protein Phosphatase Activity and ATP Levels in Sperm from Gsk3α KO
Mice
We first identified sperm GSK3 as an enzyme involved in activation of PP1g2 (34,
106).This activation was thought to involve phosphorylation of the protein phosphatase inhibitor PPP1R2 (inhibitor I-2) by GSK3. To determine if there was a relationship between GSK3α and protein phosphatase, we determined catalytic activity of protein phosphatase in sperm from Gsk3α KO mice. Protein phosphatase activity was measured using phosphorylase a as a substrate(34, 86). Data in Figure 30 show that total protein phosphatase (PP1, PP2A; Fig. 30A) and PP1 activities (Fig. 30B) in both the soluble and insoluble fractions of sperm sonicates from Gsk3α KO mice were significantly higher than in WT mice. This data was surprising because we expected that sperm PP1 activity to be low in the absence of GSK3.
82
Figure 30. Protein phosphatase activity levels. Total protein phosphatase activity (A) and PP1 activity (B) was measured both in supernatant (sup) and pellet (insoluble fraction) for equal sperm numbers (2×105). Details of the activity measured are described in Materials and Methods. A significant increase in both total and PP1 activity was observed in sperm from Gsk3α KO compared to Gsk3α (+/-) and WT mice. In A and B values expressed as percent of control WT are means ± SEM from three different experiments (n=3). A nonparametric one-way ANOVA was used for comparison of all groups. Significant differences compared to WT control (*p<0.05, **p<0.01).
83 3.2.2. ATP levels in sperm lacking GSK3 isoforms
We measured ATP levels in sperm from Gsk3α KO mice, because reduced energy production could be a cause for infertility. Sperm ATP levels were measured using a luciferase assay (89). The levels of ATP were measured with and without in the presence of substrates lactate or glucose. In presence of glucose it should promote glycolysis and ATP level should increase if there is no problem with glycolysis. The sperm re-suspended in TYH medium (Pyruvate and Lactate free) were incubated separately with 10mM Glucose or 25mM Lactate. After a 2 hours incubation ATP levels were measured in sperm extracts. ATP levels in Gsk3α KO sperm in the absence of exogenous substrate were reduced to nearly 50% of those in WT sperm (Fig. 31A). ATP levels in sperm lacking GSK3α rise in the presence of lactate but not with glucose as a metabolic substrate (Figure 31B) suggesting that ATP generation through glycolysis could be affected. Even the presence of glucose or lactate, ATP levels lower in KO compared to WT sperm (Figure 31B). ATP levels in sperm from mice lacking one allele each of GSK3α and β (Gsk3α +/- Gsk3β +/-) were comparable to levels in WT sperm
(Figure 31A). ATP levels in sperm lacking GSK3β were also unaltered (Figure 31A).
Thus, reduced of ATP levels were seen only in sperm lacking GSK3α. That was a
GSK3 isoform specific impairment of ATP production (104).
Reduced levels of ATP could result from its increased use and/or due to impairment in its production. In either of these cases the levels of ADP and AMP should be elevated when ATP levels are reduced. Levels of ATP determined by luciferase assay (Figure 31A) were further verified by quantitation of adenine nucleotides by HPLC
84 (Figure 32A). The levels of ADP and AMP were also measured. Contrary to expectation, both ADP and AMP levels were also lower in sperm from GSK3a null compared to wild type mice. That is, net adenine nucleotide levels were lower in sperm lacking GSK3α (Figure 32B). Lowered ATP along with low ADP and AMP levels has previously been documented in caput compared to caudal bovine epididymal sperm using radioactive method (107). We wished to confirm this result reported in 1975 now using HPLC for quantitation of adenine nucleotides. When compared to mature bovine caudal sperm, immature bovine caput sperm contained lower ATP (~8 vs 18 nmoles) and also lower net adenine nucleotide levels (~15 vs 30 nmoles) (Figure 33) verifying conclusions in the previously published papers in 1975 (108, 109). Thus, low ATP and net nucleotide levels in caudal sperm lacking GSK3a resemble caput epididymal sperm suggesting that metabolic activation during epididymal sperm maturation was impaired.
85
A. B.
Figure 31. (A) ATP levels in conditional Gsk3b KO is almost comparable to wildtype mouse, however in Gsk3αKO sperm the level is almost 50% less. (B) ATP assay using
WT and Gsk3α KO sperm after treatment with substrates. There is significant decrease in ATP levels of Gsk3α KO sperm in both control and 10mM glucose sample. However, after 25mM lactate treatment increase of ATP level in KO sperm is normal. Values expressed as percent of control are means from five different experiments (n=5). A nonparametric two-way ANOVA was used for comparison of all groups. *P <0.05, **P,
<0.01, ***P <0.001 defines significant differences between the groups.
86
Figure 32: (A) Comparison of ATP levels in genetically GSK3α/β disrupted mice spermatozoa. Sperm cells 1x108/ml was extracted using 0.05% chilled Perchloric acid and subsequently neutralized using KOH solution. All the data represent mean ± standard error (n=3). (B) Effect of deletion of Gsk3α gene on relative Nucleotide (Ntd)
Pool in mouse spermatozoa. All the data represent mean ± standard error (n=3).
Measurement of nuceotide levels using HPLC shown here and in Figure 21 below was performed in collaboration with Dr.Souvik Dey from our lab.
87
Figure 33. Comparison of ATP levels in bull caput and caudal spermatozoa and relative Nucleotide (Ntd) pool in bull caput and caudal spermatozoa. All the data represent mean ± standard error (n=4). **P, <0.01, ***P <0.001 defines significant differences between the groups.
3.2.3. Protein tyrosine phosphorylation in sperm from Gsk3α KO mice
Changes in global protein tyrosine phosphorylation accompanying sperm capacitation, occur in the presence of bicarbonate in the sperm suspension buffer (110, 111).The blot in Figure 34 shows that tyrosine phosphorylation detected by a phosphotyrosine- specific antibody was significantly less in Gsk3α KO sperm compared to WT sperm. The blots reprobed with beta- tubulin antibody show equal protein loading. Surprisingly, immunoreactivity of a tyrosine phosphorylated protein band around 120 kDa, thought to be hexokinase (112), is absent. Hexokinase is the enzyme that is involved in the first rate limiting step of glycolysis. Sperm hexokinase, which is constitutively tyrosine
88 phosphorylated, is often used as an internal loading control to denote equal protein loading (113).
Figure 34. Tyrosine phosphorylation of sperm from Gsk3α KO mouse compared to WT mouse. Western blots developed with anti-phosphotyrosine antibodies. Protein extracts from 2×106 sperm after without incubation (0 hr) or after one hour of incubation
(1 hr) incubation in HTF medium. In both cases decreases in phosphotyrosine levels for
Gsk3α KO compared to WT were observed. This blot was subsequently developed with anti-Beta Tubulin antibody to show equal protein loading. Each experiment was repeated three times with preparations from different animals producing similar results.
Lack of tyrosine phosphorylation of the band thought to be hexokinase is one of the striking features of sperm lacking GSK3α (86). Sperm from testis-specific KO of GSK3α lack hexokinase phosphorylation similar to sperm from mice globally lacking GSK3α
89 (Figure 35A). Hexokinase phosphorylation in sperm lacking GSK3β or sperm from mice lacking one allele each of GSK3α and β was unaltered and comparable to WT sperm
(104). Since hexokinase was not phosphorylated, we examined if its activity was affected in sperm that lacked GSK3α. Hexokinase activity in extracts of sperm lacking
GSK3α was 50% of that in WT sperm (Fig 35 B). Hexokinase activity in sperm devoid of
GSK3β was unaltered and comparable to WT sperm (104). These data along, with the data showing lower sperm ATP levels, suggest that glucose utilization could be impaired due to the absence of GSK3α in sperm.
Figure 35: (A) Western blot probed with anti-phosphotyrosine mouse monoclonal antibody (4G10) shows absence of hexokinase phosphorylation in testis specific Gsk3a
KO sperm sample, whereas it is present in testis specific Gsk3b KO sperm. Western blot with supernatant after 1X RIPA (modified) extraction from WT and global Gsk3α KO sperm shows absence of hexokinase phosphorylation in Gsk3aKO. When probed with anti-Hexokinase rabbit monoclonal antibody for control, it shows presence of
Hexokinase-1 in Gsk3a KO sperm. (B) Hexokinase activity measured in WT, Gsk3a KO and conditional Gsk3b KO sperm shows almost 60% less activity in Gsk3a KO sperm,
90 whereas in conditional Gsk3b KO hexokinase activity is almost same as wild type.
Values expressed as percent of control are means from five different experiments (n=5).
A nonparametric two-way ANOVA was used for comparison of all groups. *P <0.05 defines significant differences between the groups.
3.2.4. MCT-2 and Basigin expression in Gsk3a KO sperm
It is known that Septin 4 a component of the sperm annulus is a target of GSK3. The annulus is affected when Wnt signaling and GSK3 is disrupted in sperm (114). We started studies to determine how the annulus and localization of related proteins are affected. Two protein that move from the principal piece to the midpiece region bounded by the annulus are MCT-2 and Basigin. MCT-2 is a mono carboxylate transport protein which can transport pyruvate and lactate across the plasma membrane(115-119). Basigin is a membrane protein that binds to MCT2(22). In both
WT and Gsk3a KO sperm cell immunoreactivity for MCT-2 and Basigin were colocalized in midpiece region of caudal epididymal sperm (Figure 36 A, B). However, localization of Basigin in Gsk3a KO sperm extends below the annulus whereas in WT sperm it is present above and bounded by the annulus. of membrane diffusion barrier.
This observation is similar to Cyclin Y (like 1) or Ccny null mice (114). Ccnyl1 dependent LRP6 priming requires activation through epididymal Wnt ligands. Role of
Wnt signaling in sperm maturation is β-catenin independent (Figure 37). As a result of
Wnt signaling GSK3 is inhibited to promote sperm maturation. This further promotes septin 4 polymerization to maintain the annular protein diffusion barrier. We believe in
Gsk3a KO sperm Septin 4 polymerization is altered resulting diffused Basigin
91 expression from mid piece to principal piece through the annulus region (showed in arrows). Western blot analysis of sperm extracts (Figure 36 C, D) show presence of
MCT-2 and Basigin in WT and Gsk3a KO sperm. MCT-2 protein levels are less in
Gsk3a KO compared to WT sperm which also confirmed by ICC data. Interestingly phosphor-proteome comparison of WT and GSK3a knock out sperm shows that MCT-2 and Basigin are substrates of GSK3. How the altered levels and phosphorylation of
MCT2 and altered localization of MCT2 and Basigin affect sperm metabolism and function are being examined.
Figure 36. Immunofluorescence of WT (A) and Gsk3α KO (B) mice caudal spermatozoa with MCT-2 mouse monoclonal antibody and Basigin rabbit polyclonal. Both MCT-2
(shown in red) and Basigin (shown in green) colocalize at the midpiece of caudal sperm from WT and Gsk3α KO. Western blot done with WT and Gsk3α KO sperm shows presence of MCT-2 (C) and Basigin (D) in both sample. 6 million sperm was loaded for both WT and Gsk3α KO sperm samples. MCT-2 expression was little less in Gsk3α KO sperm compared to WT sperm.
92
Figure 37. Proposed model for role of Wnt signaling in epididymal sperm maturation.
(Adapted from Cell,Koch et al,2015, License number 4397131149977)
93 Summary
• Sperm ATP levels were lower in Gsk3α KO mice compared to wild-type animals.
• Net adenine nucleotide levels were low in caudal sperm lacking GSK3α
resembling immature caput epididymal sperm.
• Loss of GSK3α impairs sperm hexokinase activity which could be the reason for
the reduced ATP levels.
• Protein phosphatase PP1 gamma 2 protein levels were unaltered, but its catalytic
activity was elevated in KO sperm. Remarkably, tyrosine phosphorylation of
hexokinase and capacitation-associated changes in tyrosine phosphorylation of
proteins are absent or significantly lower in Gsk3α KO sperm.
• MCT-2 and Basigin colocalizes in midpiece region of WT and Gsk3α KO caudal
sperm. However, in Gsk3α KO sperm Basigin expression extends below annulus,
suggesting altered annulus diffusion barrier in Gsk3α KO sperm.
94 CHAPTER 4. Discussion
Testicular sperm undergoing maturation in the epididymis are terminally differentiated cells with little or no transcription and protein synthesis. Regulation of sperm function during their acquisition of motility and fertilizing ability in the epididymis and during fertilization of the egg in the female reproductive tract must involve changes in phosphorylation of pre-existing proteins. Cyclic AMP-mediated protein kinase activation is essential for activated and hyperactivated motility. Consequently, disruption of Cs of
PKA in testis and sperm, and of soluble adenylyl cyclase, the source of sperm cAMP, results in impaired sperm motility and male infertility. We now show that GSK3 is a key kinase essential for male gamete function and fertility(86, 104).
There are two conflicting accounts of the phenotype resulting from disruption of Gsk3α
(83, 95). It was first reported that homozygous null mice for Gsk3α display normal fertility(83). More recently, observations from Gsk3α KO mice, which were unexpectedly generated during attempts to affect a brain region-specific disruption, showed that male mice lacking Gsk3α are infertile (95). The male infertility phenotype in this report was not fully explored. The reasons for the discrepancy in the phenotypes observed in these two reports are not known. Generation of null mice in both these reports used the same
95 disruption strategy that should have resulted in the removal of exon 2 of Gsk3α. In the first report, deletion of exon 2 was accomplished with pCAGGS (chicken b-actin) CRE mice (95). It is possible that, in this study, there could have been incomplete CRE- mediated removal of Gsk3α in testes, accounting for the normal fertility of male mice that were thought to globally lack GSK3Α. Here, we conclusively show, using a targeted disruption strategy that removes exons 2, 3, and 4, that Gsk3α is essential for normal sperm function and male fertility.
The only obvious phenotype of the targeted KO of Gsk3α is male infertility. The most likely reason for this infertility is compromised sperm motility. In addition to reduced progressive motility and velocity parameters, sperm lacking Gsk3α have a markedly reduced flagellar beat. Activated and hyperactivated sperm motility characterized by high-amplitude flagellar beat are essential for penetration and fertilization of the egg(120, 121). A strikingly similar attenuated flagellar beat and impaired sperm hyperactivation was also seen in sperm lacking the sperm-specific Cs of PKA, Cαs
(122). Flagellar beat waveform features seen with Gsk3α null sperm were observed in membrane-permeabilized sperm activated in the presence of AMP and also in sperm lacking the nucleoside transport protein, Slc29a (ENT1)(123). Just as seen in Cαs KO mice, sperm lacking Gsk3α are also unable to fertilize eggs in vitro, due to impaired capacitation and their inability to undergo hyperactivation. Because testis morphology, spermatogenesis, and sperm numbers appear normal, it is unlikely that Sertoli or Leydig cell functions are compromised in Gsk3α KO mice. The major dysfunction in mice lacking Gsk3α is in gametes rather than in somatic cells in testis and other tissues. For definitive verification of this conclusion conditional spermatocyte cell-specific knockout
96 of Gsk3α and Gsk3β were done. In most tissues, except in the developing embryo where loss of Gsk3β is lethal, the two GSK3 isoforms are functionally interchangeable.
The presence of one allele of either Gsk3β or Gsk3α with GSK3 catalytic activity 25% of that normally present is sufficient to maintain signaling and tissue functions (124).
However, this is not true in case of sperm. We have conclusively shown that differentiating precursor sperm cells and mature sperm are unique in their requirement for GSK3a isoform for function. Lack of GSK3a, but not GSK3b, in differentiating spermatids and sperm results in male infertility. A possible reason for the lack of substitution of GSK3b for GSK3a could result from the isoforms having distinct spatio- temporal expression pattern. This possibility is unlikely in testis because both GSK3a and GSK3b share similar and overlapping expression and both isoforms are present in developing post-meiotic cells. However, localization of GSK3a within sperm is distinct suggesting specific binding or targeting proteins for this isoform. It is notable that lack of
GSK3b has no noticeable detrimental effect suggesting that GSK3a is able to compensate for the absence of GSK3b both in testis and sperm.
Morphology is normal in a majority of the sperm isolated from testis of Gsk3α KO mice; however, a significant proportion of sperm from null mice are bent at the midpiece/principal piece and head/connecting piece junctions (Table 5). This hairpin bend at the midpiece was also seen in sperm from sAC KO mice (125, 126) and mice lacking the PKA regulatory subunit 1A(127). Interestingly, in both these KO mouse lines, cAMP-mediated sperm PKA action is missing or lacking. Bends at the head are also seen in a majority of sperm from mice lacking SPEM1, a protein expressed in spermatids and localized in the sperm cytoplasmic droplet (96). Unlike Gsk3αKO, sperm
97 from the SPEM1 KO mice do not show bends at the sperm midpieces. Bends at the head connecting piece junctions are also seen in sperm from transgenic mice, where there are reduced levels of testis and sperm PPP1CC2(32, 128). It is possible that these bent head and midpiece morphological features could result from altered steady- state levels of sperm protein phosphorylation. Consistent with previous observations(96,
128), it is interesting that these morphological characteristics are present only in developing epididymal sperm but not in testicular sperm (Table 6). Moreover, although the proportions of bent heads are similar in both caput and caudal sperm, the proportion of sperm with bent midpieces is significantly higher in caudal compared to caput sperm
(Table 2). It is possible that bends at the head and midpieces could occur due to improper removal of the cytoplasmic droplets and/or due to mechanical shear during the passage of sperm through the epididymis. Staining of acrosome with antibodies against sp56 show that morphologically normal sperm and sperm with bent heads and midpieces from KO mice have normal-shaped acrosomes. Thus, acrosome biogenesis is normal in Gsk3α KO testis. This is in contrast to PICK1 KO mice, where sperm acrosomes are malformed. Moreover, mitochondria of sperm from Gsk3α KO mice also appear normal.
Reduced ATP levels in sperm lacking GSK3a is similar to sperm from targeted knock outs of testis soluble adenylyl cyclase or sperm specific PKA catalytic subunit where motility is compromised in mutant sperm (122). It is not known whether low ATP levels in GSK3a null sperm is a consequence of lowered motility. Sperm hexokinase is constitutively tyrosine phosphorylated, a finding we corroborated in the GSK3b null or heterozygous animals (129). However, we found hexokinase hypophosphorylated on
98 tyrosine in sperm lacking GSK3a. Sperm from GSK3α mice did not recover tyrosine phosphorylation after incubation for 1 hour in buffer supporting capacitation. The absence of hexokinase phosphorylation was also seen in sperm from t-complex mice,
Septin-4 KO, and Tat-1 KO mice (15, 16, 112). Interestingly both Septin 4 and Tat 1
(Slc26a8) are component of the annulus, the structure separating the mid piece from the principle piece (Figure 3). Septin 4 is a known target of GSK3(114).
How mouse sperm hexokinase is phosphorylated and what is the role of this phosphorylation in glycolysis and ATP production are not known (130-132).
Hexokinase activity in sperm lacking GSK3a is reduced to 50% of that in wild type sperm. It is possible that GSK3a is responsible for regulating hexokinase activity directly, or indirectly by influencing its phosphorylation. Further studies are required to determine how GSK3α is related to hexokinase phosphorylation in mouse sperm and what the role of annulus is in this phosphorylation.
Mouse spermatozoa from knock outs of both of the GSK3 isoforms (GSK3α KO and conditional GSK3β KO) contains significantly lower levels amount of cAMP (133).
However, this reduction is also seen in Gsk3α (+/-) Gsk3β (+/-) suggesting that unlike
ATP, alteration in cAMP levels do not occur in isoform dependent manner. The lesser intracellular titer of the cAMP is probably the reason behind the reduced PKA activity of these cells. Results from our lab (133) suggest that altered PP1 activity in sperm lacking
GSK3 could be due to decreased cAMP levels and PKA activity. This relationship between cAMP, PP1 and GSK3 activity was also confirmed in sperm lacking sAC. It is possible that PKA phosphorylates Thr320 of the carboxy terminus of PP1 and inhibits its
99 activity. Alternatively, PKA could be responsible for phosphorylating the protein regulators of sperm PP1γ2. Direct interaction between PKA and GSK3 and between
PP1 and GSK3 have been shown in previous studies in somatic while a possible interaction between PKA and PP1γ2 has been suggested in mouse spermatozoa (51,
55, 134, 135). Whether these three signaling enzymes form a trimeric complex or whether they form a complex mediated by one or more scaffolding proteins requires further investigation.
A significant observation in my study is that sperm maturation in the epididymis appears compromised in GSK3α knock out mice. ATP levels and levels of ADP and
AMP are all lower in caudal sperm (Figure 32) a situation observed in immature caput epididymal sperm (Figure 33). Recent study from our lab shows in Gsk3α KO sperm association of PP1g2 with its protein regulators is altered in a manner that partially resembles immature caput epididymal sperm (Suranjana Goswami Thesis). Unlike WT caudal sperm, PP1g2 is not associated with PPP1R7 in Gsk3α KO sperm. Finally, high activity levels of PP1g2 are similar to caput epididymal sperm (34, 136) . The change in association of PP1g2 with PPP1R7 is likely a cause for elevated PP1g2 catalytic activity in Gsk3α KO sperm(86). Thus, this data shows that active GSK3α, followed by its inactivation, is required for normal sperm maturation in the epididymis. Taken together, these data support a key role for GSK3 along with the other key signaling enzymes PKA and PP1g2 in development of motility and metabolism during sperm passage through the epididymis.
100 We suggest that GSK3a has isoform specific binding proteins in testis and spermatozoa. In recent study from our lab yeast two hybrid, pull down using recombinant enzyme, and immunoprecipitation was done to identify these GSK3a binding proteins in sperm. We used Y2H screen of the human testis cDNA using GSK3α and β as baits (Maria Freitas Thesis). About 2.7 x 106 clones each were screened for
GSK3α and β. A total of 48 and 18 different interactors were obtained in the screen for
GSK3α and β, respectively. Validation of the screen was the identification of βcatenin, a well-known GSK3 interactor (137-141). Interestingly one of the interactors identified was
LRP6. The Wnt receptor LRP6, which regulates GSK3 activity, is present in sperm(114).
GSK3(α and β) is downstream of Wnt signaling. Disruption of Wnt signaling and LRP6 function, among other biochemical effects alters GSK3 and PP1γ2 activities results in impaired epididymal sperm maturation and male infertility (114). At least three other proteins of potential interest are identified in the Y2H are Hsp90, Akap11 and LRR37A2.
The first two proteins have reported roles in sperm (62-64) while the LRR37A2 is of unknown function belonging to a leucine rich repeat family of proteins expressed in testis in rodents but also in areas of the brain of primates including human (65, 142).
Another potential GSK3α interactor, CENP-V(143), was identified by our collaborator Dr.
Christopher Phiel using Y2H screen of neonatal mouse brain cDNA. Preliminary data from our lab shows CENP-V, a microtubule associating protein, binds to GSK3α in sperm. Expression of CENP-V is highest in testis compared to other tissues. It’s expression, measured by qPCR, rises in post-natal developing testis, a pattern similar to GSK3α and other proteins expressed in post-meiotic germ cells. Recombinant CENP-
V binds to GSK3α in testis extracts. The N-terminus of GSK3a is highly conserved in
101 placental mammals. It is possible that specific binding is mediated through the conserved glycine rich N-terminus of GSK3a (144). These binding proteins may act as a scaffolding protein clustering GSK3a and its substrates.
In summary, this study demonstrates an isoform-specific requirement for GSK3a during final stages of spermatogenesis and in mature sperm. This requirement for
GSK3a is unique compared to other tissues where the two isoforms of GSK3 are largely functionally interchangeable. A proposed model for the role of GSK3a in sperm function is shown in Figure 25. Development of GSK3a-selective inhibitors may facilitate a male contraceptive. Identification of protein targets of GSK3a is also essential because mutations in these target proteins could be the basis for infertility due to impaired sperm function and maturation in the epididymis.
Figure 38. Proposed model for the role of GSK3a in sperm function and sperm motility.
102 References
1. Neill Ka. Physiology of Reproduction: Academic Press; 2015.
2. Skinner MK. Cell-cell interactions in the testis. Endocr Rev. 1991;12(1):45-77.
Epub 1991/02/01. doi: 10.1210/edrv-12-1-45. PubMed PMID: 2026122.
3. Griswold MD. Spermatogenesis: The Commitment to Meiosis. Physiol Rev.
2016;96(1):1-17. Epub 2015/11/06. doi: 10.1152/physrev.00013.2015. PubMed PMID:
26537427; PMCID: PMC4698398.
4. Yanagimachi R. Stability of the mammalian sperm nucleus. Zygote.
1994;2(4):383-4. Epub 1994/11/01. PubMed PMID: 8665175.
5. Yanagimachi R. Fertility of mammalian spermatozoa: its development and relativity. Zygote. 1994;2(4):371-2. Epub 1994/11/01. PubMed PMID: 8665172.
6. Austin CR. Observations on the penetration of the sperm in the mammalian egg.
Aust J Sci Res B. 1951;4(4):581-96. Epub 1951/11/01. PubMed PMID: 14895481.
7. Cooper TG. Cytoplasmic droplets: the good, the bad or just confusing? Hum
Reprod. 2005;20(1):9-11. Epub 2004/10/09. doi: 10.1093/humrep/deh555. PubMed
PMID: 15471925.
8. Cooper TG, Yeung CH, Fetic S, Sobhani A, Nieschlag E. Cytoplasmic droplets are normal structures of human sperm but are not well preserved by routine procedures for assessing sperm morphology. Hum Reprod. 2004;19(10):2283-8. Epub 2004/07/10. doi: 10.1093/humrep/deh410. PubMed PMID: 15242996.
9. Linck RW, Chemes H, Albertini DF. The axoneme: the propulsive engine of spermatozoa and cilia and associated ciliopathies leading to infertility. J Assist Reprod
103 Genet. 2016;33(2):141-56. Epub 2016/01/31. doi: 10.1007/s10815-016-0652-1.
PubMed PMID: 26825807; PMCID: PMC4759005.
10. Eddy EM. The scaffold role of the fibrous sheath. Soc Reprod Fertil Suppl.
2007;65:45-62. Epub 2007/07/25. PubMed PMID: 17644954.
11. Eddy EM, Toshimori K, O'Brien DA. Fibrous sheath of mammalian spermatozoa.
Microsc Res Tech. 2003;61(1):103-15. Epub 2003/04/03. doi: 10.1002/jemt.10320.
PubMed PMID: 12672126.
12. Brown PR, Miki K, Harper DB, Eddy EM. A-kinase anchoring protein 4 binding proteins in the fibrous sheath of the sperm flagellum. Biol Reprod. 2003;68(6):2241-8.
Epub 2003/02/28. doi: 10.1095/biolreprod.102.013466. PubMed PMID: 12606363.
13. Brown RL, Ord T, Moss SB, Williams CJ. A-kinase anchor proteins as potential regulators of protein kinase A function in oocytes. Biol Reprod. 2002;67(3):981-7. Epub
2002/08/24. PubMed PMID: 12193411.
14. Westhoff D, Kamp G. Glyceraldehyde 3-phosphate dehydrogenase is bound to the fibrous sheath of mammalian spermatozoa. J Cell Sci. 1997;110 ( Pt 15):1821-9.
Epub 1997/08/01. PubMed PMID: 9264469.
15. Toure A, Lhuillier P, Gossen JA, Kuil CW, Lhote D, Jegou B, Escalier D, Gacon
G. The testis anion transporter 1 (Slc26a8) is required for sperm terminal differentiation and male fertility in the mouse. Hum Mol Genet. 2007;16(15):1783-93. doi:
10.1093/hmg/ddm117. PubMed PMID: 17517695.
16. Kissel H, Georgescu MM, Larisch S, Manova K, Hunnicutt GR, Steller H. The
Sept4 septin locus is required for sperm terminal differentiation in mice. Dev Cell.
2005;8(3):353-64. doi: 10.1016/j.devcel.2005.01.021. PubMed PMID: 15737931.
104 17. Navarro B, Kirichok Y, Clapham DE. KSper, a pH-sensitive K+ current that controls sperm membrane potential. Proc Natl Acad Sci U S A. 2007;104(18):7688-92.
Epub 2007/04/27. doi: 10.1073/pnas.0702018104. PubMed PMID: 17460039; PMCID:
1855916.
18. Qi H, Moran MM, Navarro B, Chong JA, Krapivinsky G, Krapivinsky L, Kirichok Y,
Ramsey IS, Quill TA, Clapham DE. All four CatSper ion channel proteins are required for male fertility and sperm cell hyperactivated motility. Proc Natl Acad Sci U S A.
2007;104(4):1219-23. Epub 2007/01/18. doi: 10.1073/pnas.0610286104. PubMed
PMID: 17227845; PMCID: PMC1770895.
19. Sun XH, Zhu YY, Wang L, Liu HL, Ling Y, Li ZL, Sun LB. The Catsper channel and its roles in male fertility: a systematic review. Reprod Biol Endocrinol.
2017;15(1):65. Epub 2017/08/16. doi: 10.1186/s12958-017-0281-2. PubMed PMID:
28810916; PMCID: PMC5558725.
20. Carlson AE, Westenbroek RE, Quill T, Ren D, Clapham DE, Hille B, Garbers DL,
Babcock DF. CatSper1 required for evoked Ca2+ entry and control of flagellar function in sperm. Proc Natl Acad Sci U S A. 2003;100(25):14864-8. PubMed PMID: 14657352.
21. Ho K, Wolff CA, Suarez SS. CatSper-null mutant spermatozoa are unable to ascend beyond the oviductal reservoir. Reprod Fertil Dev. 2009;21(2):345-50. Epub
2009/02/13. PubMed PMID: 19210926.
22. Chen C, Maekawa M, Yamatoya K, Nozaki M, Ito C, Iwanaga T, Toshimori K.
Interaction between basigin and monocarboxylate transporter 2 in the mouse testes and spermatozoa. Asian J Androl. 2016;18(4):600-6. Epub 2015/07/25. doi: 10.4103/1008-
682X.157650. PubMed PMID: 26208397; PMCID: PMC4955187.
105 23. Bi J, Li Y, Sun F, Saalbach A, Klein C, Miller DJ, Hess R, Nowak RA. Basigin null mutant male mice are sterile and exhibit impaired interactions between germ cells and
Sertoli cells. Dev Biol. 2013;380(2):145-56. Epub 2013/06/04. doi:
10.1016/j.ydbio.2013.05.023. PubMed PMID: 23727514; PMCID: PMC3778672.
24. Chen L, Bi J, Nakai M, Bunick D, Couse JF, Korach KS, Nowak RA. Expression of basigin in reproductive tissues of estrogen receptor-{alpha} or -{beta} null mice.
Reproduction. 2010;139(6):1057-66. Epub 2010/04/15. doi: 10.1530/REP-10-0069.
PubMed PMID: 20388736; PMCID: PMC4778977.
25. Darszon A, Nishigaki T, Beltran C, Trevino CL. Calcium channels in the development, maturation, and function of spermatozoa. Physiol Rev. 2011;91(4):1305-
55. Epub 2011/10/21. doi: 10.1152/physrev.00028.2010. PubMed PMID: 22013213.
26. Zeng Y, Clark EN, Florman HM. Sperm membrane potential: hyperpolarization during capacitation regulates zona pellucida-dependent acrosomal secretion. Dev Biol.
1995;171(2):554-63. Epub 1995/10/01. doi: 10.1006/dbio.1995.1304. PubMed PMID:
7556936.
27. Evans JP, Florman HM. The state of the union: the cell biology of fertilization. Nat
Cell Biol. 2002;4 Suppl:s57-63. Epub 2002/12/14. doi: 10.1038/ncb-nm-fertilityS57.
PubMed PMID: 12479616.
28. Florman HM, Arnoult C, Kazam IG, Li C, O'Toole CM. A perspective on the control of mammalian fertilization by egg-activated ion channels in sperm: a tale of two channels. Biol Reprod. 1998;59(1):12-6. Epub 1998/07/23. PubMed PMID: 9674987.
29. Arnoult C, Zeng Y, Florman HM. ZP3-dependent activation of sperm cation channels regulates acrosomal secretion during mammalian fertilization. J Cell Biol.
106 1996;134(3):637-45. Epub 1996/08/01. PubMed PMID: 8707844; PMCID:
PMC2120933.
30. Arnoult C, Kazam IG, Visconti PE, Kopf GS, Villaz M, Florman HM. Control of the low voltage-activated calcium channel of mouse sperm by egg ZP3 and by membrane hyperpolarization during capacitation. Proc Natl Acad Sci U S A. 1999;96(12):6757-62.
Epub 1999/06/09. PubMed PMID: 10359785; PMCID: PMC21988.
31. Chakrabarti R, Kline D, Lu J, Orth J, Pilder S, Vijayaraghavan S. Analysis of
Ppp1cc-null mice suggests a role for PP1gamma2 in sperm morphogenesis. Biol
Reprod. 2007;76(6):992-1001. doi: 10.1095/biolreprod.106.058610. PubMed PMID:
17301292.
32. Sinha N, Puri P, Nairn AC, Vijayaraghavan S. Selective ablation of Ppp1cc gene in testicular germ cells causes oligo-teratozoospermia and infertility in mice. Biol
Reprod. 2013;89(5):128. Epub 2013/10/04. doi: 10.1095/biolreprod.113.110239.
PubMed PMID: 24089200.
33. Chakrabarti R, Kline D, Lu J, Orth J, Pilder S, Vijayaraghavan S. Analysis of
Ppp1cc-null mice suggests a role for PP1gamma2 in sperm morphogenesis. Biology of reproduction. 2007;76(6):992-1001. Epub 2007/02/16. doi:
10.1095/biolreprod.106.058610. PubMed PMID: 17301292.
34. Vijayaraghavan S, Stephens DT, Trautman K, Smith GD, Khatra B, da Cruz e
Silva EF, Greengard P. Sperm motility development in the epididymis is associated with decreased glycogen synthase kinase-3 and protein phosphatase 1 activity. Biology of reproduction. 1996;54(3):709-18. Epub 1996/03/01. PubMed PMID: 8835395.
107 35. Huang FL, Glinsmann WH. Separation and characterization of two phosphorylase phosphatase inhibitors from rabbit skeletal muscle. Eur J Biochem.
1976;70(2):419-26. Epub 1976/11/15. PubMed PMID: 188646.
36. Smith GD, Wolf DP, Trautman KC, da Cruz eSE, Greengard P, Vijayaraghavan
S. Primate sperm contain protein phosphatase 1, a biochemical mediator of motility. Biol
Reprod. 1996;54(3):719-27.
37. Zhang J, Zhang L, Zhao S, Lee EY. Identification and characterization of the human HCG V gene product as a novel inhibitor of protein phosphatase-1.
Biochemistry. 1998;37(47):16728-34. doi: 10.1021/bi981169g. PubMed PMID: 9843442.
38. Pilder SH, Lu J, Han Y, Hui L, Samant SA, Olugbemiga OO, Meyers KW, Cheng
L, Vijayaraghavan S. The molecular basis of "curlicue": a sperm motility abnormality linked to the sterility of t haplotype homozygous male mice. Soc Reprod Fertil Suppl.
2007;63:123-33. PubMed PMID: 17566267.
39. Ohkura H, Yanagida M. S. pombe gene sds22+ essential for a midmitotic transition encodes a leucine-rich repeat protein that positively modulates protein phosphatase-1. Cell. 1991;64(1):149-57. PubMed PMID: 1846086.
40. Stone EM, Yamano H, Kinoshita N, Yanagida M. Mitotic regulation of protein phosphatases by the fission yeast sds22 protein. Curr Biol. 1993;3(1):13-26. PubMed
PMID: 15335873.
41. Wilson R, Ainscough R, Anderson K, Baynes C, Berks M, Bonfield J, Burton J,
Connell M, Copsey T, Cooper J, et al. 2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans. Nature. 1994;368(6466):32-8. doi: 10.1038/368032a0.
PubMed PMID: 7906398.
108 42. MacKelvie SH, Andrews PD, Stark MJ. The Saccharomyces cerevisiae gene
SDS22 encodes a potential regulator of the mitotic function of yeast type 1 protein phosphatase. Mol Cell Biol. 1995;15(7):3777-85. PubMed PMID: 7791785; PMCID:
230616.
43. Ceulemans H, Van Eynde A, Perez-Callejon E, Beullens M, Stalmans W, Bollen
M. Structure and splice products of the human gene encoding sds22, a putative mitotic regulator of protein phosphatase-1. Eur J Biochem. 1999;262(1):36-42. PubMed PMID:
10231361.
44. Renouf S, Beullens M, Wera S, Van Eynde A, Sikela J, Stalmans W, Bollen M.
Molecular cloning of a human polypeptide related to yeast sds22, a regulator of protein phosphatase-1. FEBS Lett. 1995;375(1-2):75-8. PubMed PMID: 7498485.
45. Chun YS, Park JW, Kim GT, Shima H, Nagao M, Kim MS, Chung MH. A sds22 homolog that is associated with the testis-specific serine/threonine protein phosphatase
1gamma2 in rat testis. Biochem Biophys Res Commun. 2000;273(3):972-6. doi:
10.1006/bbrc.2000.3045. PubMed PMID: 10891357.
46. Cheng L, Pilder S, Nairn AC, Ramdas S, Vijayaraghavan S. PP1gamma2 and
PPP1R11 are parts of a multimeric complex in developing testicular germ cells in which their steady state levels are reciprocally related. PLoS One. 2009;4(3):e4861. doi:
10.1371/journal.pone.0004861. PubMed PMID: 19300506; PMCID: 2654099.
47. Kaidanovich-Beilin O, Woodgett JR. GSK-3: Functional Insights from Cell Biology and Animal Models. Front Mol Neurosci. 2011;4:40. Epub 2011/11/24. doi:
10.3389/fnmol.2011.00040. PubMed PMID: 22110425; PMCID: 3217193.
109 48. Medina M, Wandosell F. Deconstructing GSK-3: The Fine Regulation of Its
Activity. Int J Alzheimers Dis. 2011;2011:479249. Epub 2011/06/02. doi:
10.4061/2011/479249. PubMed PMID: 21629747; PMCID: 3100567.
49. Beurel E, Grieco SF, Jope RS. Glycogen synthase kinase-3 (GSK3): regulation, actions, and diseases. Pharmacol Ther. 2015;148:114-31. Epub 2014/12/02. doi:
10.1016/j.pharmthera.2014.11.016. PubMed PMID: 25435019; PMCID: PMC4340754.
50. Wang QM, Fiol CJ, DePaoli-Roach AA, Roach PJ. Glycogen synthase kinase-3 beta is a dual specificity kinase differentially regulated by tyrosine and serine/threonine phosphorylation. The Journal of biological chemistry. 1994;269(20):14566-74. Epub
1994/05/20. PubMed PMID: 7514173.
51. Fang X, Yu SX, Lu Y, Bast RC, Jr., Woodgett JR, Mills GB. Phosphorylation and inactivation of glycogen synthase kinase 3 by protein kinase A. Proc Natl Acad Sci U S
A. 2000;97(22):11960-5. Epub 2000/10/18. doi: 10.1073/pnas.220413597. PubMed
PMID: 11035810; PMCID: 17277.
52. Delcommenne M, Tan C, Gray V, Rue L, Woodgett J, Dedhar S.
Phosphoinositide-3-OH kinase-dependent regulation of glycogen synthase kinase 3 and protein kinase B/AKT by the integrin-linked kinase. Proc Natl Acad Sci U S A.
1998;95(19):11211-6. Epub 1998/09/16. PubMed PMID: 9736715; PMCID: 21621.
53. Zhang F, Phiel CJ, Spece L, Gurvich N, Klein PS. Inhibitory phosphorylation of glycogen synthase kinase-3 (GSK-3) in response to lithium. Evidence for autoregulation of GSK-3. The Journal of biological chemistry. 2003;278(35):33067-77. Epub
2003/06/11. doi: 10.1074/jbc.M212635200. PubMed PMID: 12796505.
110 54. Dajani R, Fraser E, Roe SM, Young N, Good V, Dale TC, Pearl LH. Crystal structure of glycogen synthase kinase 3 beta: structural basis for phosphate-primed substrate specificity and autoinhibition. Cell. 2001;105(6):721-32. Epub 2001/07/07.
PubMed PMID: 11440715.
55. Hernandez F, Langa E, Cuadros R, Avila J, Villanueva N. Regulation of GSK3 isoforms by phosphatases PP1 and PP2A. Mol Cell Biochem. 2010;344(1-2):211-5.
Epub 2010/07/24. doi: 10.1007/s11010-010-0544-0. PubMed PMID: 20652371.
56. ter Haar E, Coll JT, Austen DA, Hsiao HM, Swenson L, Jain J. Structure of
GSK3beta reveals a primed phosphorylation mechanism. Nature structural biology.
2001;8(7):593-6. Epub 2001/06/28. doi: 10.1038/89624. PubMed PMID: 11427888.
57. Thomas GM, Frame S, Goedert M, Nathke I, Polakis P, Cohen P. A GSK3- binding peptide from FRAT1 selectively inhibits the GSK3-catalysed phosphorylation of axin and beta-catenin. FEBS Lett. 1999;458(2):247-51. Epub 1999/09/11. PubMed
PMID: 10481074.
58. Somanath PR, Jack SL, Vijayaraghavan S. Changes in sperm glycogen synthase kinase-3 serine phosphorylation and activity accompany motility initiation and stimulation. J Androl. 2004;25(4):605-17. Epub 2004/06/30. PubMed PMID: 15223849.
59. Vijayaraghavan S, Mohan J, Gray F, Khatra B, and Carr D. A role for phosphoryaltion of glycogen synthase kinase-3alpha in bovine sperm motility regulation.
Biology of Reproduction. 2000;62:1647-54.
60. Somanath PR, Jack SL, Vijayaraghavan S. Changes in sperm glycogen synthase kinase-3 serine phosphorylation and activity accompany motility initiation and stimulation. J Androl. 2004;25(4):605-17. PubMed PMID: WOS:000222455000019.
111 61. Valenta T, Hausmann G, Basler K. The many faces and functions of beta- catenin. EMBO J. 2012;31(12):2714-36. Epub 2012/05/24. doi:
10.1038/emboj.2012.150. PubMed PMID: 22617422; PMCID: PMC3380220.
62. Li K, Xue Y, Chen A, Jiang Y, Xie H, Shi Q, Zhang S, Ni Y. Heat shock protein 90 has roles in intracellular calcium homeostasis, protein tyrosine phosphorylation regulation, and progesterone-responsive sperm function in human sperm. PLoS One.
2014;9(12):e115841. doi: 10.1371/journal.pone.0115841. PubMed PMID: 25541943;
PMCID: PMC4277372.
63. Reinton N, Collas P, Haugen TB, Skalhegg BS, Hansson V, Jahnsen T, Tasken
K. Localization of a novel human A-kinase-anchoring protein, hAKAP220, during spermatogenesis. Dev Biol. 2000;223(1):194-204. doi: 10.1006/dbio.2000.9725.
PubMed PMID: 10864471.
64. Whiting JL, Nygren PJ, Tunquist BJ, Langeberg LK, Seternes OM, Scott JD.
Protein Kinase A Opposes the Phosphorylation-dependent Recruitment of Glycogen
Synthase Kinase 3beta to A-kinase Anchoring Protein 220. J Biol Chem.
2015;290(32):19445-57. doi: 10.1074/jbc.M115.654822. PubMed PMID: 26088133;
PMCID: PMC4528109.
65. Giannuzzi G, Siswara P, Malig M, Marques-Bonet T, Program NCS, Mullikin JC,
Ventura M, Eichler EE. Evolutionary dynamism of the primate LRRC37 gene family.
Genome Res. 2013;23(1):46-59. doi: 10.1101/gr.138842.112. PubMed PMID:
23064749; PMCID: PMC3530683.
66. Nakamura N, Miranda-Vizuete A, Miki K, Mori C, Eddy EM. Cleavage of disulfide bonds in mouse spermatogenic cell-specific type 1 hexokinase isozyme is associated
112 with increased hexokinase activity and initiation of sperm motility. Biology of
Reproduction. 2008;79(3):537-45. doi: 10.1095/biolreprod.108.067561. PubMed PMID:
WOS:000258580000017.
67. Banerji V, Frumm SM, Ross KN, Li LS, Schinzel AC, Hahn CK, Kakoza RM,
Chow KT, Ross L, Alexe G, Tolliday N, Inguilizian H, Galinsky I, Stone RM, DeAngelo
DJ, Roti G, Aster JC, Hahn WC, Kung AL, Stegmaier K. The intersection of genetic and chemical genomic screens identifies GSK-3alpha as a target in human acute myeloid leukemia. J Clin Invest. 2012;122(3):935-47. Epub 2012/02/14. doi: 10.1172/JCI46465.
PubMed PMID: 22326953; PMCID: PMC3287215.
68. Zeidner LC, Buescher JL, Phiel CJ. A novel interaction between Glycogen
Synthase Kinase-3alpha (GSK-3alpha) and the scaffold protein Receptor for Activated
C-Kinase 1 (RACK1) regulates the circadian clock. Int J Biochem Mol Biol.
2011;2(4):318-27. Epub 2011/12/22. PubMed PMID: 22187666; PMCID: PMC3242428.
69. Phiel CJ, Wilson CA, Lee VM, Klein PS. GSK-3alpha regulates production of
Alzheimer's disease amyloid-beta peptides. Nature. 2003;423(6938):435-9. Epub
2003/05/23. doi: 10.1038/nature01640. PubMed PMID: 12761548.
70. Hurtado DE, Molina-Porcel L, Carroll JC, Macdonald C, Aboagye AK,
Trojanowski JQ, Lee VM. Selectively silencing GSK-3 isoforms reduces plaques and tangles in mouse models of Alzheimer's disease. J Neurosci. 2012;32(21):7392-402.
Epub 2012/05/25. doi: 10.1523/JNEUROSCI.0889-12.2012. PubMed PMID: 22623685;
PMCID: PMC3368584.
71. Ly PT, Wu Y, Zou H, Wang R, Zhou W, Kinoshita A, Zhang M, Yang Y, Cai F,
Woodgett J, Song W. Inhibition of GSK3beta-mediated BACE1 expression reduces
113 Alzheimer-associated phenotypes. J Clin Invest. 2013;123(1):224-35. Epub 2012/12/04. doi: 10.1172/JCI64516. PubMed PMID: 23202730; PMCID: PMC3533290.
72. Zhou J, Freeman TA, Ahmad F, Shang X, Mangano E, Gao E, Farber J, Wang Y,
Ma XL, Woodgett J, Vagnozzi RJ, Lal H, Force T. GSK-3alpha is a central regulator of age-related pathologies in mice. J Clin Invest. 2013;123(4):1821-32. Epub 2013/04/04. doi: 10.1172/JCI64398. PubMed PMID: 23549082; PMCID: PMC3613907.
73. Gulen MF, Bulek K, Xiao H, Yu M, Gao J, Sun L, Beurel E, Kaidanovich-Beilin O,
Fox PL, DiCorleto PE, Wang JA, Qin J, Wald DN, Woodgett JR, Jope RS, Carman J,
Dongre A, Li X. Inactivation of the enzyme GSK3alpha by the kinase IKKi promotes
AKT-mTOR signaling pathway that mediates interleukin-1-induced Th17 cell maintenance. Immunity. 2012;37(5):800-12. Epub 2012/11/13. doi:
10.1016/j.immuni.2012.08.019. PubMed PMID: 23142783; PMCID: PMC3512562.
74. Beurel E, Jope RS. Differential regulation of STAT family members by glycogen synthase kinase-3. J Biol Chem. 2008;283(32):21934-44. Epub 2008/06/14. doi:
10.1074/jbc.M802481200. PubMed PMID: 18550525; PMCID: PMC2494932.
75. Ding Q, He X, Hsu JM, Xia W, Chen CT, Li LY, Lee DF, Liu JC, Zhong Q, Wang
X, Hung MC. Degradation of Mcl-1 by beta-TrCP mediates glycogen synthase kinase 3- induced tumor suppression and chemosensitization. Mol Cell Biol. 2007;27(11):4006-
17. Epub 2007/03/28. doi: 10.1128/MCB.00620-06. PubMed PMID: 17387146; PMCID:
PMC1900029.
76. Hooper C, Markevich V, Plattner F, Killick R, Schofield E, Engel T, Hernandez F,
Anderton B, Rosenblum K, Bliss T, Cooke SF, Avila J, Lucas JJ, Giese KP, Stephenson
J, Lovestone S. Glycogen synthase kinase-3 inhibition is integral to long-term
114 potentiation. Eur J Neurosci. 2007;25(1):81-6. Epub 2007/01/24. doi: 10.1111/j.1460-
9568.2006.05245.x. PubMed PMID: 17241269.
77. Peineau S, Taghibiglou C, Bradley C, Wong TP, Liu L, Lu J, Lo E, Wu D, Saule
E, Bouschet T, Matthews P, Isaac JT, Bortolotto ZA, Wang YT, Collingridge GL. LTP inhibits LTD in the hippocampus via regulation of GSK3beta. Neuron. 2007;53(5):703-
17. Epub 2007/03/03. doi: 10.1016/j.neuron.2007.01.029. PubMed PMID: 17329210.
78. Zhu LQ, Wang SH, Liu D, Yin YY, Tian Q, Wang XC, Wang Q, Chen JG, Wang
JZ. Activation of glycogen synthase kinase-3 inhibits long-term potentiation with synapse-associated impairments. J Neurosci. 2007;27(45):12211-20. Epub 2007/11/09. doi: 10.1523/JNEUROSCI.3321-07.2007. PubMed PMID: 17989287.
79. Dewachter I, Ris L, Jaworski T, Seymour CM, Kremer A, Borghgraef P, De Vijver
H, Godaux E, Van Leuven F. GSK3beta, a centre-staged kinase in neuropsychiatric disorders, modulates long term memory by inhibitory phosphorylation at serine-9.
Neurobiol Dis. 2009;35(2):193-200. Epub 2009/04/22. doi: 10.1016/j.nbd.2009.04.003.
PubMed PMID: 19379814.
80. Force T, Woodgett JR. Unique and overlapping functions of GSK-3 isoforms in cell differentiation and proliferation and cardiovascular development. J Biol Chem.
2009;284(15):9643-7. Epub 2008/12/10. doi: 10.1074/jbc.R800077200. PubMed PMID:
19064989; PMCID: PMC2665084.
81. Cho J, Rameshwar P, Sadoshima J. Distinct roles of glycogen synthase kinase
(GSK)-3alpha and GSK-3beta in mediating cardiomyocyte differentiation in murine bone marrow-derived mesenchymal stem cells. J Biol Chem. 2009;284(52):36647-58. Epub
115 2009/10/28. doi: 10.1074/jbc.M109.019109. PubMed PMID: 19858210; PMCID:
PMC2794779.
82. Lal H, Zhou J, Ahmad F, Zaka R, Vagnozzi RJ, Decaul M, Woodgett J, Gao E,
Force T. Glycogen synthase kinase-3alpha limits ischemic injury, cardiac rupture, post- myocardial infarction remodeling and death. Circulation. 2012;125(1):65-75. Epub
2011/11/17. doi: 10.1161/CIRCULATIONAHA.111.050666. PubMed PMID: 22086876;
PMCID: PMC4365497.
83. MacAulay K, Doble BW, Patel S, Hansotia T, Sinclair EM, Drucker DJ, Nagy A,
Woodgett JR. Glycogen synthase kinase 3alpha-specific regulation of murine hepatic glycogen metabolism. Cell Metab. 2007;6(4):329-37. Epub 2007/10/03. doi:
10.1016/j.cmet.2007.08.013. PubMed PMID: 17908561.
84. Farley FW, Soriano P, Steffen LS, Dymecki SM. Widespread recombinase expression using FLPeR (flipper) mice. Genesis. 2000;28(3-4):106-10. Epub
2000/12/06. PubMed PMID: 11105051.
85. Popkie A. Glycogen Synthase Kinase-3 loss-of-function studies in Mus musculus and murine embryonic stem cells. Disserrtation, Ohio State University. 2011:1-179.
86. Bhattacharjee R, Goswami S, Dudiki T, Popkie AP, Phiel CJ, Kline D,
Vijayaraghavan S. Targeted disruption of glycogen synthase kinase 3A (GSK3A) in mice affects sperm motility resulting in male infertility. Biol Reprod. 2015;92(3):65. doi:
10.1095/biolreprod.114.124495. PubMed PMID: 25568307; PMCID: PMC4358024.
87. Sinha N, Pilder S, Vijayaraghavan S. Significant expression levels of transgenic
PPP1CC2 in testis and sperm are required to overcome the male infertility phenotype of
116 Ppp1cc null mice. PLoS One. 2012;7(10):e47623. Epub 2012/10/20. doi:
10.1371/journal.pone.0047623. PubMed PMID: 23082183; PMCID: PMC3474748.
88. Ryves WJ, Fryer L, Dale T, Harwood AJ. An assay for glycogen synthase kinase
3 (GSK-3) for use in crude cell extracts. Anal Biochem. 1998;264(1):124-7. doi:
10.1006/abio.1998.2832. PubMed PMID: 9784196.
89. Goodson SG, Qiu Y, Sutton KA, Xie G, Jia W, O'Brien DA. Metabolic substrates exhibit differential effects on functional parameters of mouse sperm capacitation. Biol
Reprod. 2012;87(3):75. Epub 2012/07/28. doi: 10.1095/biolreprod.112.102673. PubMed
PMID: 22837480; PMCID: PMC3464911.
90. Tsao TS, Burcelin R, Charron MJ. Regulation of hexokinase II gene expression by glucose flux in skeletal muscle. Journal of Biological Chemistry. 1996;271(25):14959-
63. PubMed PMID: WOS:A1996UT10600050.
91. Guo TB, Chan KC, Hakovirta H, Xiao Y, Toppari J, Mitchell AP, Salameh WA.
Evidence for a role of glycogen synthase kinase-3 beta in rodent spermatogenesis. J
Androl. 2003;24(3):332-42. PubMed PMID: WOS:000182827300006.
92. Yao HB, Shaw PC, Wong CC, Wan DC. Expression of glycogen synthase kinase-3 isoforms in mouse tissues and their transcription in the brain. J Chem
Neuroanat. 2002;23(4):291-7. PubMed PMID: 12048112.
93. Lau KF, Miller CCJ, Anderton BH, Shaw PC. Expression analysis of glycogen synthase kinase-3 in human tissues. Journal of Peptide Research. 1999;54(1):85-91. doi: DOI 10.1034/j.1399-3011.1999.00083.x. PubMed PMID: WOS:000081617800010.
94. Hoeflich KP, Luo J, Rubie EA, Tsao MS, Jin O, Woodgett JR. Requirement for glycogen synthase kinase-3beta in cell survival and NF-kappaB activation. Nature.
117 2000;406(6791):86-90. Epub 2000/07/14. doi: 10.1038/35017574. PubMed PMID:
10894547.
95. Maurin H, Lechat B, Dewachter I, Ris L, Louis JV, Borghgraef P, Devijver H,
Jaworski T, Van Leuven F. Neurological characterization of mice deficient in GSK3alpha highlight pleiotropic physiological functions in cognition and pathological activity as Tau kinase. Mol Brain. 2013;6:27. Epub 2013/05/28. doi: 10.1186/1756-6606-6-27. PubMed
PMID: 23705847; PMCID: 3671145.
96. Zheng H, Stratton CJ, Morozumi K, Jin J, Yanagimachi R, Yan W. Lack of
Spem1 causes aberrant cytoplasm removal, sperm deformation, and male infertility.
Proc Natl Acad Sci U S A. 2007;104(16):6852-7. Epub 2007/04/12. doi:
10.1073/pnas.0701669104. PubMed PMID: 17426145; PMCID: PMC1871874.
97. Andersen OM, Yeung CH, Vorum H, Wellner M, Andreassen TK, Erdmann B,
Mueller EC, Herz J, Otto A, Cooper TG, Willnow TE. Essential role of the apolipoprotein
E receptor-2 in sperm development. J Biol Chem. 2003;278(26):23989-95. Epub
2003/04/16. doi: 10.1074/jbc.M302157200. PubMed PMID: 12695510.
98. Olson GE, Winfrey VP, Hill KE, Burk RF. Sequential development of flagellar defects in spermatids and epididymal spermatozoa of selenium-deficient rats.
Reproduction. 2004;127(3):335-42. Epub 2004/03/16. doi: 10.1530/rep.1.00103.
PubMed PMID: 15016953.
99. Olson GE, Winfrey VP, Nagdas SK, Hill KE, Burk RF. Selenoprotein P is required for mouse sperm development. Biol Reprod. 2005;73(1):201-11. Epub 2005/03/04. doi:
10.1095/biolreprod.105.040360. PubMed PMID: 15744015.
118 100. Varmuza S, Jurisicova A, Okano K, Hudson J, Boekelheide K, Shipp EB.
Spermiogenesis is impaired in mice bearing a targeted mutation in the protein phosphatase 1cgamma gene. Dev Biol. 1999;205(1):98-110. Epub 1999/01/12. doi:
10.1006/dbio.1998.9100. PubMed PMID: 9882500.
101. Sadate-Ngatchou PI, Payne CJ, Dearth AT, Braun RE. Cre recombinase activity specific to postnatal, premeiotic male germ cells in transgenic mice. Genesis.
2008;46(12):738-42. doi: 10.1002/dvg.20437. PubMed PMID: 18850594; PMCID:
2837914.
102. Bao JQ, Ma HY, Schuster A, Lin YM, Yan W. Incomplete cre-mediated excision leads to phenotypic differences between Stra8-iCre; Mov10l1(lox/lox) and Stra8-iCre;
Mov10l1(lox/) mice. Genesis. 2013;51(7):481-90. doi: 10.1002/dvg.22389. PubMed
PMID: WOS:000321982400003.
103. Wu Q, Song R, Ortogero N, Zheng H, Evanoff R, Small CL, Griswold MD,
Namekawa SH, Royo H, Turner JM, Yan W. The RNase III enzyme DROSHA is essential for microRNA production and spermatogenesis. J Biol Chem.
2012;287(30):25173-90. doi: 10.1074/jbc.M112.362053. PubMed PMID: 22665486;
PMCID: 3408133.
104. Bhattacharjee R, Goswami S, Dey S, Gangoda M, Brothag C, Eisa A, Woodgett
J, Phiel C, Kline D, Vijayaraghavan S. Isoform specific requirement for GSK3alpha in sperm for male fertility. Biol Reprod. 2018. Epub 2018/02/01. doi: 10.1093/biolre/ioy020.
PubMed PMID: 29385396.
105. Markuns JF, Wojtaszewski JFP, Goodyear LJ. Insulin and exercise decrease glycogen synthase kinase-3 activity by different mechanisms in rat skeletal muscle.
119 Journal of Biological Chemistry. 1999;274(35):24896-900. doi: DOI
10.1074/jbc.274.35.24896. PubMed PMID: WOS:000082193400062.
106. Smith GD, Wolf DP, Trautman KC, Vijayaraghavan S. Motility potential of macaque epididymal sperm: the role of protein phosphatase and glycogen synthase kinase-3 activities. J Androl. 1999;20(1):47-53. Epub 1999/04/01. PubMed PMID:
10100473.
107. Hoskins DD, Munsterman D, Hall ML. Control of Bovine Sperm Glycolysis during
Epididymal Transit. Biology of Reproduction. 1975;12(5):566-72. doi: DOI
10.1095/biolreprod12.5.566. PubMed PMID: WOS:A1975BA39000006.
108. Hoskins DD, Hall ML, Munsterman D. Induction of motility in immature bovine spermatozoa by cyclic AMP phosphodiesterase inhibitors and seminal plasma. Biol
Reprod. 1975;13(2):168-76. Epub 1975/09/01. PubMed PMID: 177102.
109. Hoskins DD, Munsterman D, Hall ML. The control of bovine sperm glycolysis during epididymal transit. Biol Reprod. 1975;12(5):566-72. PubMed PMID: 175860.
110. Kalab P, Visconti P, Leclerc P, Kopf GS. p95, the major phosphotyrosine- containing protein in mouse spermatozoa, is a hexokinase with unique properties. J Biol
Chem. 1994;269(5):3810-7. Epub 1994/02/04. PubMed PMID: 7508920.
111. Visconti PE, Bailey JL, Moore GD, Pan D, Olds-Clarke P, Kopf GS. Capacitation of mouse spermatozoa. I. Correlation between the capacitation state and protein tyrosine phosphorylation. Development. 1995;121(4):1129-37. Epub 1995/04/01.
PubMed PMID: 7743926.
112. Olds-Clarke P, Pilder SH, Visconti PE, Moss SB, Orth JM, Kopf GS. Sperm from mice carrying two t haplotypes do not possess a tyrosine phosphorylated form of
120 hexokinase. Molecular reproduction and development. 1996;43(1):94-104. Epub
1996/01/01. doi: 10.1002/(SICI)1098-2795(199601)43:1<94::AID-MRD12>3.0.CO;2-4.
PubMed PMID: 8720118.
113. Visconti PE, Galantino-Homer H, Ning X, Moore GD, Valenzuela JP, Jorgez CJ,
Alvarez JG, Kopf GS. Cholesterol efflux-mediated signal transduction in mammalian sperm. beta-cyclodextrins initiate transmembrane signaling leading to an increase in protein tyrosine phosphorylation and capacitation. J Biol Chem. 1999;274(5):3235-42.
Epub 1999/01/23. PubMed PMID: 9915865.
114. Koch S, Acebron SP, Herbst J, Hatiboglu G, Niehrs C. Post-transcriptional Wnt
Signaling Governs Epididymal Sperm Maturation. Cell. 2015;163(5):1225-36. doi:
10.1016/j.cell.2015.10.029. PubMed PMID: 26590424.
115. Garcia CK, Brown MS, Pathak RK, Goldstein JL. cDNA cloning of MCT2, a second monocarboxylate transporter expressed in different cells than MCT1. J Biol
Chem. 1995;270(4):1843-9. Epub 1995/01/27. PubMed PMID: 7829520.
116. Boussouar F, Mauduit C, Tabone E, Pellerin L, Magistretti PJ, Benahmed M.
Developmental and hormonal regulation of the monocarboxylate transporter 2 (MCT2) expression in the mouse germ cells. Biol Reprod. 2003;69(3):1069-78. Epub
2003/05/30. doi: 10.1095/biolreprod.102.010074. PubMed PMID: 12773420.
117. Goddard I, Florin A, Mauduit C, Tabone E, Contard P, Bars R, Chuzel F,
Benahmed M. Alteration of lactate production and transport in the adult rat testis exposed in utero to flutamide. Mol Cell Endocrinol. 2003;206(1-2):137-46. Epub
2003/08/29. PubMed PMID: 12943996.
121 118. Nakai M, Chen L, Nowak RA. Tissue distribution of basigin and monocarboxylate transporter 1 in the adult male mouse: a study using the wild-type and basigin gene knockout mice. Anat Rec A Discov Mol Cell Evol Biol. 2006;288(5):527-35. Epub
2006/04/14. doi: 10.1002/ar.a.20320. PubMed PMID: 16612830; PMCID: PMC3739424.
119. Mannowetz N, Wandernoth P, Wennemuth G. Basigin interacts with both MCT1 and MCT2 in murine spermatozoa. J Cell Physiol. 2012;227(5):2154-62. Epub
2011/07/28. doi: 10.1002/jcp.22949. PubMed PMID: 21792931.
120. Suarez SS. Control of hyperactivation in sperm. Human reproduction update.
2008;14(6):647-57. Epub 2008/07/26. doi: 10.1093/humupd/dmn029. PubMed PMID:
18653675.
121. Suarez SS, Ho HC. Hyperactivation of mammalian sperm. Cell Mol Biol (Noisy- le-grand). 2003;49(3):351-6. Epub 2003/07/31. PubMed PMID: 12887087.
122. Nolan MA, Babcock DF, Wennemuth G, Brown W, Burton KA, McKnight GS.
Sperm-specific protein kinase A catalytic subunit Calpha2 orchestrates cAMP signaling for male fertility. Proceedings of the National Academy of Sciences of the United States of America. 2004;101(37):13483-8. Epub 2004/09/02. doi: 10.1073/pnas.0405580101.
PubMed PMID: 15340140; PMCID: 518783.
123. Burnett LA, Blais EM, Unadkat JD, Hille B, Tilley SL, Babcock DF. Testicular expression of Adora3i2 in Adora3 knockout mice reveals a role of mouse A3Ri2 and human A3Ri3 adenosine receptors in sperm. J Biol Chem. 2010;285(44):33662-70.
Epub 2010/08/25. doi: 10.1074/jbc.M110.156075. PubMed PMID: 20732875; PMCID:
PMC2962464.
122 124. McNeill H, Woodgett JR. When pathways collide: collaboration and connivance among signalling proteins in development. Nature reviews Molecular cell biology.
2010;11(6):404-13. doi: 10.1038/nrm2902. PubMed PMID: 20461097.
125. Hess KC, Jones BH, Marquez B, Chen Y, Ord TS, Kamenetsky M, Miyamoto C,
Zippin JH, Kopf GS, Suarez SS, Levin LR, Williams CJ, Buck J, Moss SB. The "soluble" adenylyl cyclase in sperm mediates multiple signaling events required for fertilization.
Dev Cell. 2005;9(2):249-59. Epub 2005/08/02. doi: 10.1016/j.devcel.2005.06.007.
PubMed PMID: 16054031; PMCID: PMC3082461.
126. Ijiri TW, Vadnais ML, Huang AP, Lin AM, Levin LR, Buck J, Gerton GL. Thiol changes during epididymal maturation: a link to flagellar angulation in mouse spermatozoa? Andrology. 2014;2(1):65-75. Epub 2013/11/21. doi: 10.1111/j.2047-
2927.2013.00147.x. PubMed PMID: 24254994; PMCID: PMC4253137.
127. Burton KA, McDermott DA, Wilkes D, Poulsen MN, Nolan MA, Goldstein M,
Basson CT, McKnight GS. Haploinsufficiency at the protein kinase A RI alpha gene locus leads to fertility defects in male mice and men. Mol Endocrinol. 2006;20(10):2504-
13. Epub 2006/05/27. doi: 10.1210/me.2006-0060. PubMed PMID: 16728532; PMCID:
PMC1850980.
128. Soler DC, Kadunganattil S, Ramdas S, Myers K, Roca J, Slaughter T, Pilder SH,
Vijayaraghavan S. Expression of transgenic PPP1CC2 in the testis of Ppp1cc-null mice rescues spermatid viability and spermiation but does not restore normal sperm tail ultrastructure, sperm motility, or fertility. Biol Reprod. 2009;81(2):343-52. Epub
2009/05/08. doi: 10.1095/biolreprod.109.076398. PubMed PMID: 19420386; PMCID:
PMC2849817.
123 129. Visconti PE, Ning X, Fornes MW, Alvarez JG, Stein P, Connors SA, Kopf GS.
Cholesterol efflux-mediated signal transduction in mammalian sperm: cholesterol release signals an increase in protein tyrosine phosphorylation during mouse sperm capacitation. Dev Biol. 1999;214(2):429-43. Epub 1999/10/20. doi:
10.1006/dbio.1999.9428. PubMed PMID: 10525345.
130. Nakamura N, Miranda-Vizuete A, Miki K, Mori C, Eddy EM. Cleavage of disulfide bonds in mouse spermatogenic cell-specific type 1 hexokinase isozyme is associated with increased hexokinase activity and initiation of sperm motility. Biol Reprod.
2008;79(3):537-45. Epub 2008/05/30. doi: 10.1095/biolreprod.108.067561. PubMed
PMID: 18509164; PMCID: 2710537.
131. Nakamura N, Shibata H, O'Brien DA, Mori C, Eddy EM. Spermatogenic cell- specific type 1 hexokinase is the predominant hexokinase in sperm. Molecular reproduction and development. 2008;75(4):632-40. Epub 2007/10/10. doi:
10.1002/mrd.20791. PubMed PMID: 17924400; PMCID: 2412836.
132. Travis AJ, Sui D, Riedel KD, Hofmann NR, Moss SB, Wilson JE, Kopf GS. A novel NH(2)-terminal, nonhydrophobic motif targets a male germ cell-specific hexokinase to the endoplasmic reticulum and plasma membrane. J Biol Chem.
1999;274(48):34467-75. Epub 1999/11/24. PubMed PMID: 10567428.
133. Dey S, Goswami S, Eisa A, Bhattacharjee R, Brothag C, Kline D, Vijayaraghavan
S. Cyclic AMP and glycogen synthase kinase 3 form a regulatory loop in spermatozoa.
J Cell Physiol. 2018. Epub 2018/03/27. doi: 10.1002/jcp.26557. PubMed PMID:
29574946.
124 134. Goto N, Harayama H. Calyculin A-sensitive protein phosphatases are involved in maintenance of progressive movement in mouse spermatozoa in vitro by suppression of autophosphorylation of protein kinase A. J Reprod Dev. 2009;55(3):327-34. Epub
2009/03/19. PubMed PMID: 19293561.
135. Tanji C, Yamamoto H, Yorioka N, Kohno N, Kikuchi K, Kikuchi A. A-kinase anchoring protein AKAP220 binds to glycogen synthase kinase-3beta (GSK-3beta ) and mediates protein kinase A-dependent inhibition of GSK-3beta. J Biol Chem.
2002;277(40):36955-61. Epub 2002/07/31. doi: 10.1074/jbc.M206210200. PubMed
PMID: 12147701.
136. Smith GD, Wolf DP, Trautman KC, Vijayaraghavan S. Motility potential of macaque epididymal sperm: the role of protein phosphatase and glycogen synthase kinase-3 activities. J Androl. 1999;20(1):47-53. PubMed PMID: 10100473.
137. Huang J, Guo X, Li W, Zhang H. Activation of Wnt/beta-catenin signalling via
GSK3 inhibitors direct differentiation of human adipose stem cells into functional hepatocytes. Sci Rep. 2017;7:40716. Epub 2017/01/18. doi: 10.1038/srep40716.
PubMed PMID: 28094799; PMCID: PMC5240561.
138. Wu D, Pan W. GSK3: a multifaceted kinase in Wnt signaling. Trends Biochem
Sci. 2010;35(3):161-8. Epub 2009/11/04. doi: 10.1016/j.tibs.2009.10.002. PubMed
PMID: 19884009; PMCID: PMC2834833.
139. Wu G, Huang H, Garcia Abreu J, He X. Inhibition of GSK3 phosphorylation of beta-catenin via phosphorylated PPPSPXS motifs of Wnt coreceptor LRP6. PLoS One.
2009;4(3):e4926. Epub 2009/03/19. doi: 10.1371/journal.pone.0004926. PubMed PMID:
19293931; PMCID: PMC2654145.
125 140. Doble BW, Patel S, Wood GA, Kockeritz LK, Woodgett JR. Functional redundancy of GSK-3alpha and GSK-3beta in Wnt/beta-catenin signaling shown by using an allelic series of embryonic stem cell lines. Dev Cell. 2007;12(6):957-71. Epub
2007/06/05. doi: 10.1016/j.devcel.2007.04.001. PubMed PMID: 17543867; PMCID:
PMC4485918.
141. Liu C, Li Y, Semenov M, Han C, Baeg GH, Tan Y, Zhang Z, Lin X, He X. Control of beta-catenin phosphorylation/degradation by a dual-kinase mechanism. Cell.
2002;108(6):837-47. Epub 2002/04/17. PubMed PMID: 11955436.
142. Bekpen C, Tastekin I, Siswara P, Akdis CA, Eichler EE. Primate segmental duplication creates novel promoters for the LRRC37 gene family within the 17q21.31 inversion polymorphism region. Genome Res. 2012;22(6):1050-8. doi:
10.1101/gr.134098.111. PubMed PMID: 22419166; PMCID: PMC3371713.
143. Honda Z, Suzuki T, Honda H. Identification of CENP-V as a novel microtubule- associating molecule that activates Src family kinases through SH3 domain interaction.
Genes Cells. 2009;14(12):1383-94. doi: 10.1111/j.1365-2443.2009.01355.x. PubMed
PMID: 19930468.
144. Azoulay-Alfaguter I, Yaffe Y, Licht-Murava A, Urbanska M, Jaworski J,
Pietrokovski S, Hirschberg K, Eldar-Finkelman H. Distinct molecular regulation of glycogen synthase kinase-3alpha isozyme controlled by its N-terminal region: functional role in calcium/calpain signaling. The Journal of biological chemistry.
2011;286(15):13470-80. Epub 2011/01/27. doi: 10.1074/jbc.M110.127969. PubMed
PMID: 21266584; PMCID: 3075693.
126