Proceedings Asiahorcs 2013

Proceedings ASIAHORCs 2013

Topics: Bioresources for Food Functional Food Bioprocessing for Food and Food Technology Food Science Policy

Proceedings ASIAHORCs 2013

Topics: Bioresources for Food Functional Food Bioprocessing for Food and Food Technology Food Science Policy

Cataloging in Publication Data

Proceeding of ASIAHORCS/Siti Nuramaliati Prijono, Andria Agusta, Agus Triyono, Purwanto, Trina Fizzanty, Yopi, Kazuki Kanazawa, dan Zhengqiang Jiang (Ed.). – Jakarta: LIPI Press, 2014.

x + 435 hlm.; 17,6 x 25 cm

ISBN 978-979-799-806-6 1. ASIAHORCS 2. Food Sciences

664

Copy editor : Martinus Helmiawan Annisa Waharyudisti Proofreader : Sarwendah Puspita Dewi Layouter : Ariadni Siti Qomariyah

First Edition : November 2014

Published by: LIPI Press, member of Ikapi Jln. Gondangdia Lama 39, Menteng, Jakarta 10350 Phone: (021) 314 0228, 314 6942 Fax.: (021) 314 4591 E-mail: [email protected] PREFACE

The 5th ASIAHORCs Joint Symposium was held in Bali, Indonesia, during 27–28 November 2013 along with the 7th ASIAHORCs General Meeting. The symposium was attended by eight country delegates with more than 100 participants from ASIAHORCs member countries (Japan, Korea, P.R. China, Philippines, Malaysia, India, Indonesia and Thailand) The 5th ASIAHORCs Joint Symposium has been succesful in discussing and sharing information about Food Sciences and its related field. The plenary lectures were very enlightening and stimulating, delivered by distinguished keynote speakers, which include a former minister of Indonesia, and a senior scientist in food sciences from Japan. Along the 34 parallel oral presentations, there were 20 research exhibited in poster presentations focusing on four sub-themes covering Bioresources for Food, Functional Food, Bioprocessing Technology & Food Engineering, and Food Science Policy. The wide spectrum of the speeches and posters have broaden our understanding in scientific, philosophical, and regulation perspectives regarding the multi-dimensionality of circumstances and events that we are facing today on food sciences and its related fields. In general, the 5th ASIAHORCs Joint Symposium highlights some important issues that need to be resolved on Food Science and its related field in Asian countries. The sub-theme Bioresources for Food highlights three important points. First, rice is still the main carbohydrate source. We need to increase rice production in Asian countries by discovering new rice variety that resistant to the global climate change as well as durable at marginal area. Second, Asian countries should increase the quality and discover new variant of common agricultural commodities by using biotechnology approach, such as genetic modification. Third, Asian countries should explore their natural resources to find out, or popularize uncommon raw materials for food, for example research on development of tubers for carbohydrate alternative.

v vi

Meanwhile, parallel discussion in Functional Food sub-theme highlights the functional food researches which have several variants. The research could increase field of industries in conjunction with the social life and culture in Asian that starts to concern about health and the finest life style for developing health care environment. We do hope the research related to functional food can be established more in Asian nations, especially for developing the interest among Asian researchers. Furthermore, the research can widely stimulate all fields of industries and investors to take part in functional food research. As a result, the research will stimulate promising functional food product in the future. The sub-theme of Bioprocessing Technology and Food Engineering highlights the intervention of technology on food processing which is a key point to increase the quality of food. Application of appropriate technology can prolong the lifetime of food, especially for raw food materials which have a short lifetime. The technology is commonly knowns as preservation of food. The sub-theme of Food Science Policy focuses on the research, and implementation of research outputs from the Food Science area which would be difficult to execute without a strong support by good policies at national or regional level. A good food policy can protect and improve good food products in the market, giving more economic opportunities among countries, such as food commodity trade. Domestic food policy makers must link their country’s food system to the Asian and world commodity markets. We certainly hope this proceeding will adequately represent the true value of the event, so that those who did not have the opportunity to attend the 5th ASIAHORCs Joint Symposium will benefit as much as those who did. For the success of the 5th ASIAHORCs Joint Symposium, I would like to express my sincere gratitude for the support from Indonesian Institute of Sciences who hosted the event. The support has enabled us to enjoy the event in the beautiful setting of Bali, with its classic Eka Karya Botanical Gardens. The incoming 6th ASIAHORCs Joint Symposium, which we expect to be more stimulating, will be held in Bangkok, Thailand, in November 2014. We look forward to it.

Jakarta, June 2014

Prof. Dr. Lukman Hakim Chairman of LIPI Contents

Preface from Chairman of LIPI...... v Keynote Papers Protein Function-Modulating Activity of Food Factors and The Selective Removal at The Absorption Process in Gut Epithelium Kazuki Kanazawa...... 3 Food Policy and Sciences in Indonesia Siswono Yudo Husodo...... 19 Bioresources for Food Full Paper of Oral Presentations Genetic Resources of Male Sterility for Chilies Breeding Jutamas Kumchai and Maneechat Nikornpun...... 31 Fine mapping of QTL for cyanogenic potential in cassava storage root Sukhuman Whankaew, Supajit Sraphet, Opas Boonseng and Kanokporn Triwitayakorn...... 37 Rice Improvement Through Biotechnology to Anticipate Global Climate Change and Utilization of Suboptimal Lands Amy Estiati and Satya Nugroho...... 45 Tetraploid Plants from Interspecific Hybrids between Mungbean and Rice Bean Tanapon Chaisan, Prakit Somta, Peerasak Srinives, Sontichai Chanprame, Rangsarid Kaveeta1, Surapong Dumrongkitikule...... 59 Resistant Starch Formation of Rice from Different Varieties Worawikunya Kiatponglarp, Sunanta Tongta and Alain Buléon...... 71 Short Communication of Oral Presentations The Red Algae Sugar Platform for the Utilization of Marine Bioresources Kyoung Heon Kim, Eun Ju Yun...... 83 Posters Sintang Shrimp as a Protein Source from Freshwater “Steps Towards the Development” Djamhuriyah S. Said, N. Mayasari dan Triyanto...... 91 Potency Yam for Food Diversification and Other Uses in Indonesia Nurhayati and Supli Effendi Rahim...... 101

vii viii

Egg Production Trait of Indonesian Domestic Ducks Inferred from Analysis of an SNP Genotypes in The 5th Exon of Prolactin Gene Dwi Astuti and Siti N. Prijono...... 111 Production and Quality Improvement of Mud Crab (Scylla serrata) using Silvofishery to Increase Food Security and to Conserve the Mangrove Resource in Berau East Kalimantan Triyanto, Nirmalasari Idha Wijaya, Sutrisno, Ivana Yuniarti, Fajar Setiawan, Fajar Sumi Lestari,and Tri Widiyanto...... 117 Low-Fat Duck Meat Production Through Suplementation Seed Papaya (Carica papaya L.) as Feed Additive Rini Rachmatika, Supadmo, Zuprizal, Siti N. Prijono...... 127 Wild Tuber of Jalawure (Tacca leontopetaloides) is an Alternative to overcome Food Insufficiency of Society in Cikelet Subdistrict, South Garut Wardah and Dini Ariani...... 135 Functional Food Full Paper of Oral Presentations Mannanase from Isolated Marine Bacteria of Pari Island for Manno-oligosaccharides production Yopi, Apridah Cameliawati Djohan and Laksmi Ambarsari...... 149 Enzymatic production of xylo-oligosaccharide from agricultural wastes Zhengqiang Jiang, Qiaojuan Yan, Shaoqing Yang...... 161 Immunomodulating Effects of Polysaccharides from Edible Mushrooms in Japan Ken-ichiro Minato, and Akihiro Ohara...... 169 Effects of Consumption Timing on Gastric Emptying Rate and Bioavailability of Bilberry Anthocyanins Sakakibara H, Aoshima Y, Yamazaki S, and Shimoi K...... 177 Short Communication of Oral Presentations Functional Foods: Recent Research and Future Prospects Prasanna Vasu...... 187 Novel Cyclic Depsipeptides Exhibiting Multi-drug Resistance Reverting Activities Produced by Fusarium STrain Isolated from Potato in Korea Chan Lee...... 193 Posters Effects of Luteolin on Vascular Endothelium Exposed to Inflammatory Stimuli Michiko Yasuda, Kayoko Shimoi...... 199 ix

The Study of Expression of Seed-Spesific Transcription Factors Regulating Anthocyanin Biosynthesis in Indonesian Local Black Rice for Developing Black Rice as Functional Food Yekti Asih Purwestri, Lisa Novita Anggraeni, Rarastoeti Pratiwi, Rumiyati, Woro Anindito Sri Tunjung...... 205 Protective Effect of Epigallocatechin-3-gallate (EGCG) in Yeast Candida albicans and Candida Tropicalis Treated with Antifungal Nystatin or (+)-2,2’-Epicytoskyrin A Heddy Julistiono, Ruby Artanti, Andria Agusta, and Arif Nurkanto...... 211 Production of Lipase from Aspergillus oryzaevarviridis, Aspergillus awamory, and Aspergillus niger Apridah Cameliawati Djohan, Yopi and Heri Hermansyah...... 221 Bioprocessing for Food and Food Technology Full Paper of Oral Presentations Development of Flour Preparation Method Derived from Local Arrowroot (Maranta arundinacea) of Yogyakarta Miftakhussolikhah, Dini Ariani, Cici Darsih, Mukhamad Angwar, Haryadi...... 233 Rice Analog from Broken Rice (Oryza sativa l.) and Adlay (Coix lacryma-jobi L.) Lerjun M. Peñaflor and Arnold R. Elepaño...... 241 Optimization of Dextrinization Process of Corn Starch by Means of Twin Screw Extruder Using Response Surface Method Achmat Sarifudin and Alhussein M. Assiry...... 253 Development of a Dispersive Liquid-liquid Microextraction Method for the Spectrophotometric Determination of Nickel in Food Samples Shuo Wang and Jiale Li Junping Wang...... 267 Synthesis of Diacylglycerols from Monoacylglycerols and Oleic Acid through Lipase SMG1-Catalyzed Esterification Weifei Wang, Yang Xu, Yonghua Wang...... 279 Application of Plackett-Burman Design on the Sensory Analysis of Sweet potato-pineapple Wine with Probiotic Lactobacillus paracasei Domingo P. Lodevico and Roberta D. Lauzon...... 289 Short Communication of Oral Presentations Enhanced 1,3-Propanediol Production in Lactobacillus reuteri by Repeated Fedbatch Fermentation Subramanian Ramalingam, Pandiaraj Suppuram and Hema Venkatesan...... 303 Microbial Factory Technology for Production of Food Bio-chemicals using Renewable Biomass Yong-Cheol Park...... 313 Innovative Thermal and Non-thermal Treatments for Food Safety Dong-Hyun Kang...... 317 x

Posters Effect Of Purple Sweet Potato Extract (Ipomoea batatas L.) on the Antioxidant Activity and Nutritional Composition of Diabetes Cookies Based on White Sweet Potato Ervika Rahayu NH., Dini A., M. Angwar, Wiwin W., Suharwadji...... 325 Pasting Properties of Pedada (Sonneratia caseolaris) Fruit Flour and Wheat Flour Mixtures Jariyah, Simon, B.Widjanarko, Yunianta, Teti Estiasih, Peter A. Sopade...... 335 Risk Analysis for Staphylococcus aureus in Frozen Pork Meat in the Philippines using the Risk Ranger Tool Benjamin A. Gonzales, Efren R. Regpala...... 341 Food Science Policy Full Paper of Oral Presentations In Search for Ocean-Based Food Sustainability: RCO-LIPI Mission Zainal Arifin...... 355 Reveal About the Forgotten Potency Offood Germplasm other than Rice in Indonesia Supli Effendi Rahim and Nurhayati...... 365 Short Communication of Oral Presentations Food Policy to Bridge Political and Investment Barrier Among Countries by Innovative Support System in Asia Renu Agrawal...... 379 NRF and Life Sciences of Korea Joon Kim...... 383 Posters The Strategy of Indonesia Food Security in the Future Based on Potential Food Localization Ikha Prasetiyani...... 389 Appendix Committee...... 403 List of participants...... 409 Program...... 425 Photos...... 433 Keynote Papers

Protein Function-Modulating Activity of Food Factors and The Selective Removal at The Absorption Process in Gut Epithelium

Kazuki Kanazawa* School of Agriculture and Regional, KIBI International University

Abstract Human digestive tract can remove non-nutrients by selecting from nutrients in daily food. Nutrients are sugars, lipids and proteins that undergo decomposable catabolism and finally produce ATP energy. Vitamins and minerals, being essential in nutrient catabolism, are also nutrients. The nutrients are recognized by transporters in the epithelium and incorporated into the blood circulation, or are recognized by carrier proteins after incorporation by simple diffusion into epithelium. Contrarily, non-nutrients cannot produce ATP because they cannot undergo catabolism. If they are absorbed into the body, non-nutrients exist as the same chemical forms in foods. Chemicals that cannot undergo catabolism act randomly on biologically important components and exhibit diverse bioactivities, and then disrupt the homeostasis of the metabolism. To avoid the disruption, epithelium inactivates non-nutrients by undergoing conjugations with glucuronide or sulfate and excretes them to the lumen side. A slight amount of non-nutrients is excreted through urine after being incorporated and short circulation in the blood. The non-nutrients are recently expected to play important roles for prevention from degenerative disease. There are around 8,000 species of phenolics, about 25,000 terpenoids, 12,000 alkaloids, several sulfate-containing chemicals, and various kinds of dietary fibers. Among them, however, bioavailable substances for the health beneficial effects are limited in humans. Keywords: Bioavailability, functional food factors, non-nutrients, intestinal absorption, conjugation in epithelium, bioactivity

*Corresponding Author KIBI International University 370-1 Sareo, Shichi, Minami Awaji, 656-0484 Hyogo, JAPAN E-mail: [email protected]

Introduction Our food comprises nutrients and non-nutrients. Nutrients are sugars, lipids and proteins, that can undergo catabolism to decompose for the production of ATP energy. Vitamins and minerals are also nutrients because they help the catabolism. These nutrients can be recognized by metabolic enzyme proteins. Contrarily, non-nutrients are not recognized by the energy-metabolic enzymes, and cannot undergo catabolism and cannot produce ATP. The non-nutrients in our diet are around 8,000 species of phenolics, such as phenylpropanoids, flavonoids—further classified to the following subclasses flavones, flavonols, isoflavones, flavanones including chatechins, anthocyanins, and chalcones—and around 40 anthraquinones; about 25,000 terpenoids including terpenes, carotenoids, xanthophylls, and

3 4 Proceedings ASIAHORCS 2013

iridoids; 12,000 alkaloids, such as caffeine; several sulfate-containing chemicals, such as isothiocyanates and sulforaphane; and various kinds of dietary fibers. When incorporated into the body, the non-nutrients exhibit an intense action because they are not decomposed and circulated in the unchanged forms in our body. The unchanged forms of non-nutrients interact randomly with biologically important proteins and disturb the homeostasis of metabolism. Then, lives make selective removal of the non-nutrients in the epithelium. Most of non-nutrients undergo conjugation reactions which mask one of the functional groups with sulfate or glucuronide, and are immediately excreted into lumen side (Murota and Terao, 2003). A trace amount of the conjugated non-nutrients is transported into blood stream. The concentration of non-nutrients is very low, at the range of µM, in our body (Manach et al., 2005 and Williamson et al., 2005). Thus, the bioavailable substances to express health beneficial effects are limited in humans (Kanazawa, 2013). The better understanding of the fate of non-nutrients in intestines helps to find out bioavailable non-nutrients that can exhibit beneficial health effects (Kanazawa, 2011). These non-nutrients are the following 7 classes: 1) several capable compounds to exhibit bioactivity even at very low concentrations, 2) compounds that partly retain biofunctions after undergoing conjugations, 3) compounds which converted to a biofunctional forms by endogenous de- conjugation enzymes, 4) transformable compounds to highly bioavailable forms in intestines, 5) resistant compounds against conjugations, 6) compounds which forms remain unchanged after passing through the intestinal absorption process, and 7) dietary fibers which can interact with intestinal epithelial cells and transfer immune signals without absorption. In this review, the biofunctions of these seven bioavailable non-nutrients will be discussed. Protein function-modulating activity of non-nutrients. The biofunctions of bioavailable non-nutrients are classified into two activities, antioxidant potency and protein function-modulating activity (Kanazawa, 2008). The antioxidant potency has been well understood to be the scavenging activity of reactive oxygen species (ROS). Protein function-modulating activity is non-nutrients act on our biologically important proteins and dynamically modify the metabolic functions. Figure 1 shows a protein function-modulating activity of flavonoids (Fu- kuda et al., 2004). Human body cells possess aryl hydrocarbon receptor (AhR). Hydrophobic xenobiotics like dioxinin in our diets are easily incorporated into blood stream and enter the body cells. Body cells detect and bind the xenobiotics with AhR. They translocate to nucleus and bind at dioxin response element on DNA. This event makes expression several mRNAs, including cytochrome keynote papers 5

P450 monooxygenase (CYP) 1A1. CYP1A1 oxidizes the xenobiotics, and later, conjugation enzymes are induced and mask the oxidized position of xenobiotics with glucuronate or glutathione. Then, the masked xenobiotics are excreted through urine. However, the conjugation enzymes take 48 hours for the induc- tions although CYP1A1 is easily induced within 6 hours. There are around 40 hours of lag time. Oxidized form of xenobiotics is very unstable, and is a strong carcinogens that easily makes DNA adducts. Several flavones and flavonols can reversibly inhibit the transformation of AhR and also inhibit CYP1A1 activity reversibly, but not irreversibly. This indicates that flavonoids can gain time until conjugation enzymes would be induced, and partly prevent cancer.

Figure 1. Detoxifying system of carcinogens and preventing mechanisms of flavonoids in human body cells.

Examining flavonoids in the reversible inhibition, AhR and CYP were found in a super family of proteins that possessed the hydrophobic pocket of 14 x 12 x 5Å in the chemical size (Ashida et al., 2000) and favoured the similar size of hydrophobic chemicals (Kanazawa et al., 1998b), and that strongly required a co-planar structure (Kanazawa et al., 1999). Figure 2 shows co-planars and the chemical sizes. The most toxic dioxin 2,3,7,8-tetrachlorodibenzo b,e[ ][1,4] dioxin (TCDD) is a co-planar and 13.5 x 6 x 3.5Å in its chemical size. The chemical size and co-planar exactly fit in a hydrophobic pocket of AhR, and hereby TCDD acts as the strongest agonist for AhR irreversibly and produces the toxicity. On the other hand, one of flavones apigenin is 14.5 x 8 x 4 Å in the chemical size and co-planar like chemical since the 2,3 bond is a double bond. This size is a 6 Proceedings ASIAHORCS 2013

little larger in length than the hydrophobic pocket of AhR and CYP, and then apigenin enters the hydrophobic pockets reversibly—not irreversibly. Apigenin was the strongest antagonist against TCDD on AhR and CYP1A1, showing

the lowest IC50 value of 1.1 µM among various polyphenols (Kanazawa et al., 1998a; Ashida et al., 2000). Eriodictyol is a same-sized chemical with apigenin, but the 2,3 bond is single bond and then B ring bends over C ring and forms non-coplanar structure. Thus, eriodictyol was a weaker inhibitor than apigenin,

and its IC50 was 6.0 µM.

Figure 2. A comparison in characteristics of hydrophobic pockets of AhR and CYP1A1 with antagonistic co-planar chemicals.

Figure 3 putatively shows the protein function-modulating activity of co-planar polyphenols. A little smaller hydrophobic chemicals, such as dioxin, than the hydrophobic pocket of AhR, irreversibly enter into the pocket and produce the toxicity through activating the AhR as an agonist. If we would ingest co-planar polyphenols in vegetables, fruits or green tea, the co-planars could inhibit the approach of agonists by entering reversibly into the hydrophobic pocket (Kanazawa et al., 1998b). The inhibition of agonist approach prevents the generation of several diseases. The co-planar apigenin contains in vegetable leaves such as celery and parsley (Sakakibara et al., 2003). The similarly sized co-planars other than apigenin are flavone luteolin, flavonol quercetin and athraquinone emodine (Ashida, 2000). Luteolin is in broccoli, paprika and others. Quercetin is in onion, asparagus and okura, and much in green tea (Sakakibara et al., 2003). Emodin is in Chinese medicinal plants, such as rhubarb, aloe and buckthorn. keynote papers 7

Proteins that possess the similar hydrophobic pocket with AhR are suggested to be sodium channel protein (ENaC), histamine secretion-modulating protein, and others. Several flavonoids can act on these proteins and suppress partly the generation of diseases such as hypertension, nephritis and allergy (Aoi et al., 2004; Fujimura et al., 2007).

Figure 3. A putative preventing mechanisms ofco-planarlike polyphenols onseveral diseases induced by toxic agoniststhrough the protein function-modulating activity.

Selective removal of functional factors at the absorption process in gut epithelium. The non-nutrients dynamically modify the function of our endogenous proteins and may disturb the homeostasis of metabolism. Then, living organisms eliminate the non-nutrients at the absorption process in intestinal epithelium. Murota and Terao (2003) show that the dietary phenolics are immediately masked on one of the functional groups with sulfate or glucuronide and changed to water-soluble chemicals in the intestinal epithelial cells. This is a conjugation reaction for non-nutrients. The water-soluble phenolics are immediately excreted into limen side with multidrug resistance-associated protein 2, and a very small amount is transported into blood circulation with multidrug resistance-associated protein 1. Subsequently, the levels of non-nutrients in blood are usually less than 1 µM (Hollman et al. 1997; Manach et al., 2005; Williamson and Manach, 2005). 8 Proceedings ASIAHORCS 2013

The levels in blood are independent of ingested amounts since they are regulated by conjugation enzymes like UDP-glucuronosyl transferases and phenol sulfo

transferases at below its Km values, which are the concentrations of non-nutrients that the enzymes express affinity on the substrates. The conjugated non-nutrients mostly fail the protein function-modulating activity, and dietary non-nutrients are generally low. Bioavailable functional factors after undergoing the selection in epithelium. The biofunctional non-nutrients after incorporated in our body are classified into 7 groups as shown in Introduction. The chemicals and their functions in every group are as follows: 1) Several capable compounds to exhibit bioactivity even at very low concentrations Epigallocatechingallate (EGCg) shown in Figure 4 contains in green tea at the highest concentration among foods. EGCg occurs in serum in the aglycone format of a few micromolar levels while most of other flavonoids are at below 1 µM (Nakagawa, et al.,2009) and exhibits bioactivity at relatively low concentrations as nanomolar level. Tachibana et al. (2004) and Fujimura et al. (2007) found that EGCg and its O-methyl derivatives can bind to 67-kD alaminin receptor at the concentration of 39.9 nM and is shown to have cancer-preventing and anti-allergic actions. Also, EGCg has been reported to promote the translocation of glucose transporter 4 in muscle cells of skeletal muscle and to inhibit the translocation in adipocytes, and results in modulating the serum glucose level, preventing diabetes and obesity by reducing hyperglycemia (Ueda et al., 2008).

Figure 4. Examples of bioavailable non-nutrients. keynote papers 9

Figure 5. Exhibiting mechanism of strong antioxidant potency in quercetin.

2) Compounds that partly retain biofunctions after undergoing conjugations The conjugation converts non-nutrients to water-soluble products and halt the protein function-modulating activity. However, antioxidant potency oc- casionally remains in such chemicals that possess an abundance of functional groups. For example, quercetin possesses 5 hydroxyls and catechol structure in B ring of 3’,4’-hydroxyls (see Figure 3). In B-ring catechol flavonoids, all of the bonds are forming, conjugating double bonds and easily release reducing agents, and di-quinone of the resulting form is stable. Then, catechol structure flavonoids can exhibit a strong antioxidant potency even at the low concentrations (Kanazawa et al. 2006). After it underwent conjugations, the ratio of the retained catechol structure is two third in the case of quercetin. In quercetin, 5 position hydroxyl is forming a 6-members ring with 4 quinone and hereby does not receive the conjugation. The other hydroxyls, 3’, 4’, 3, and 7, can be received by the masking reaction. Thus, the probability for the disappearing catechol structure is one third. Moon et al. (2000) report when humans intake quercetin, two third of the amounts of quercetin in blood exhibit antioxidant potency. Also, the dietary quercetin has been reported to prevent several cancers (Murakami, et al., 2008) and atherosclerosis (Kawai et al., 2008). The other flavonoids of gallate or catechol structure can also exhibit a strong antioxidant potency; catechins (Uekusa et al., 2007; Baba et al., 2007), anthocyanin delphinidin in egg plant and blueberries (see Figure 4) (Ichiyanagi et al., 2004), and eriodictyol in lemon (see Figure 2) (Miyake et al., 2000), and so on. 3) Compounds which converted to a biofunctional forms by endogenous de-conjugation enzymes Non-nutrients in our daily food circulate in blood stream, usually in the non-active conjugated forms after being absorbed. Non-active forms produce no side effects because they do not disturb homeostasis. However, non-active forms cannot play a preventing role on diseases. Quercetin and luteolin (see Figure 3) also circulate in blood as the conjugated forms under healthy conditions. Interestingly, generating abnormality like tumorigenesis, the inflam- 10 Proceedings ASIAHORCS 2013

matory cells leak β-glucuronidase, which is an enzyme for de-conjugation, and convert non-active forms of quercetin and luteolin to active aglycone forms (Shimoi and Nakayama, 2005). Then, the dietary quercetin or luteolin suppress the formation of precancerous lesion in rats (Oi et al., 2008). Thus, these flavonoids circulate as the non-active forms and produce no side effects under the healthy conditions. When some abnormal conditions generate, they are activated by de-conjugation enzymes and play a preventing role on inflammation tissue. 4) Transformable compounds to highly bioavailable forms in intestines Among non-nutrients that are contained as non-active forms in the diet, several can be converted to active forms in the intestinal flora of microorganisms or activated in the body after being absorbed. Isoflavones contained in soybean, carob, kudzu, and alfalfa, are well known to prevent osteoporosis and sex hormone-related cancers, such as prostate, uterus and breast cancer, by modulating the actions of sex hormones. Among the isoflavones, daidzein is metabolically converted to equol (Figure 6) by intestinal microorganisms. Equol is highly bioavailable and exhibits higher activity than the original isoflavone (Fujioka et al., 2004). Sesamolin and sesaminol in sesame oil are masked in their hydroxyls with methyl groups (Figure 6). The masked hydroxyls cannot exhibit any activity, and hereby the intestinal epithelium absorbs them into blood stream. In our body, the methyl masks are removed spontaneously or enzymatically and produce catechol structures. The catechol is the strong antioxidant as described above. Thus, sesame components play an antioxidant role in our body (Kanget al.1998; Sheng et al., 2007), and are frequently sold as a supplement in Japan.

Figure 6. Examples of non-nutrients that convert to active forms at the intestinal absorption process. keynote papers 11

5) Resistant compounds against conjugations In middle of Brazil, honey bees collect propolis materials mainly from Baccharis dracunculifolia containing an abundance of artepillin C (see Figure 4). While the target of conjugation enzyme is hydroxyl group, artepillin C possesses two hydrophobic prenyls at neighboring site. The hydrophobic prenyls interfere with an approach of conjugation enzyme because the active site of conjugation enzyme comprises with hydrophilic amino acids. Examining the absorption in intestinal epithelial cells, most artepillin C did not undergo the conjugations (Shimizu et al., 2004), and then exhibited the significant cancer-preventing effects in experimental animals (Shimizuet al., 2005a; Shimizu et al., 2005b) and humans (Ishikawa et al., 2012). Prenyl chemicals are abundant in plant kingdom. For example, grabridin in licorice (see Figure 4) (Ito et al., 2007) and miroesterol in kudzu (Cain, 1960) are also known to be highly bioavailable and to exhibit anti-inflammation activity and estrogen-like activity, respectively. 6) Compounds which remain unchanged in forms after passing through the intestinal absorption process Among non-nutrients, several alkaloids, polymethoxyl flavones, several sulfate-containing chemicals, and various terpenes are incorporated almost unchanged in the chemical forms, while the absorption rates are low. The example chemicals are shown in Figure 7. In one of alkaloids, caffeine, the functional groups are the target for conjugation enzymes but they have been already masked with methyls. Then, caffeine is incorporated into blood unchanged in form and exhibits the bioactivity. Many peoples feel relax and awake after drinking caffeine beverages, such as coffee and tea. Also, caffeine has been reported to inhibit the phosphorylation of proteinkinase B and cell proliferation and suppresses skin carcinogenesis (Hashimoto et al., 2004). Similarly, polymethoxy flavones being abundant in citrus fruits have been masked with methyl groups. A representative one is nobiletin (Figure 7) that is highly bioavailable being incorporated unchanged in form into body, and exhibits a remarkable function (Kohno et al., 2001). Also, sulfate-containing chemicals such as sulforaphane and isothiocyanates can be partly absorbed unchanged and are known to stimulate the detoxification pathway by activating the Nrf2-Keap1 system (Morimitsu et al., 2002). Carotenoids are in a tetraterpenoid family, and xanthophylls areoxygen- containing carotenoids. Dietary carotenoids such as β -carotene frequently decompose to retinoid through dioxygenase activity during the absorption process. On the other hand, xanthophylls are incorporated into blood mostly unchanged in the skeleton structure. For example, fucoxanthin in brown sea 12 Proceedings ASIAHORCS 2013

Figure 7. Examples of non-nutrients which mostly remain unchanged in forms after passing through intestinal epithelium.

algae is absorbed and circulated in blood only after hydrolysis of acetyl in the side chain to fucoxanthinol (Figure7) (Hashimoto et al., 2012). Fucoxanthin shows anti-carcinogenic (Das et al., 2005), anti-inflammation (Shiratori et al., 2005) and anti-obesity activity by inducing uncoupling protein 1 in the mitochondria of white adipose tissue (Maeda et al., 2005). The other xanthophylls can also exhibit the remarkable biofunctions. Con- sumption of astaxanthine (Figure 7) has been reported to reduce triglyceride level and increases HDL-cholesterol and adiponectin levels in humans (Yoshida et al., 2010). 7) Dietary fibers can interact with intestinal epithelial cells and transfer immune signals without absorption Polysaccharides in our diet are classified into sugars and fibers. Sugars can be digested, incorporated and can produce ATP energy in the body. Contrary, fibers cannot undergo the digestion and incorporation. In the dietary fibers, β-glucans in mushrooms interact with a membranous receptor of intestinal surface cells and affect on a signal transduction system involved in immune response. Thus, the dietary β-glucans can mitigate food-related allergy and prevent intestinal bowel diseases by suppressing the secretion of inflammatory cytokines. Their detailed mechanism is currently under investigation (Tanoue et al., 2008). keynote papers 13

One of Japanese traditional foods, brown sea alga Laminaria japonica, contains dietary fiber, F-type of polysulfated polysaccharide fucoidan. F-fucoidan does not undergo digestion, being different from the other types of fucoidan such as G-fucoidan and U-fucoidan. All of dosed F-fucoidan was excreted into feces 32 hours after the dose in mouse. In humans, no F-fucoidan and

Figure 8. Preventive mechanism of dietary F-fucoidan from cardiovascular diseases through interacting with intestinal epithelium and transferring a signal to blood. 14 Proceedings ASIAHORCS 2013

no fragments were detected in blood after ingested 400 mg/day/capita of F-fucoidan. The fucoidan shortened a de-aggregation time of aggregated platelet significantly in human volunteers (Renet al., 2013). Figure 8 shows the mechanism of dietary F-fucoidan to induce the de-aggregation of platelet. F-fucoidan interacts with epithelial surface proteins without incorporated into the cells, and transfers a signal to NADPH oxidase (NOX) 1 and dual oxidase (DUOX) 2. These enzymes produce hydrogen peroxide, which has

been known well to be one of signals to secret prostaglandin I2 (prostacyclin). The prostacyclin induces de-aggregation on aggregated platelet, and the anti-thrombosis activity probably prevents cardiovascular diseases such as atherosclerosis, hypertension, and cardiac infarction.

Conclusions Non-nutrients expect to be able to exhibit health beneficial effects on human health. However, most of them undergo the selective removal at intestinal absorption process and a re-excreted to feces without incorporation into the body. The better understanding of bioavailable of non-nutrients is to identify that they can escape the conjugations or retain the bioactivity after undergoing the conjugations. Several kinds of non-nutrients have been found to be bioavailable and chemo-preventive to degenerative diseases: various flavonoids, quercetin, luteolin, epigallocatechin gallate, isoflavone, and polymethoxyl flavonone like nobiletin; prenyl chemicals, such as artepillin C, grabridin and miroestrol; phenylpropanoids, such as sesamolin and sesaminol; one of alkaloids caffeine; sulfate-containing chemicals, such as sulforaphane and isothiocyanates; various terpenoids, particularly xanthophylls, such as fucoxanthin and astaxanthin; and dietary fibers such as β-glucans and F-fucoidan that modulate the immune response system on the intestinal surface without absorption.

References

Aoi, W., Niisato, N., Miyazaki, H., & Marunaka, Y. (2004). Flavonoid-induced reduction of ENaC expression in the kidney of Dahl salt-sensitive hypertensive rat. Biochemical and Biophysical Research Communications, 315, 892–896. Ashida, H., Yamashita, T., Fukuda, I., & Kanazawa, K. (2000). Flavones and flavonols at dietary levels inhibit a transformation of aryl hydrocarbon receptor induced by dioxin. FEBS Letters, 476, 213–217. Ashida, H. (2000). Suppressive effects of flavonoids on dioxintoxicity. Biofactors, 12, 201–206. Baba, S., Osakabe, N., Kato, Y., Natsume, M., Yasuda, A., Kido, T., Fukuda, K., Muto, Y., Kondo, K. (2007). Continuous intake of polyphenolic compounds containing cocoa power reduces LDL oxidative susceptibility and has beneficial effect son plasma HDL-cholesterol keynote papers 15

concentrations in humans. American Journal of Clinical Nutrition, (85), 709–717. Cain, J.C. (1960). Miroestrol: an estrogen from the plant Pueraria mirfica.Nature , 198, 774–777. Das, S.K., Hashimoto, T., Shimizu, K., Yoshida, T., Sakai, T., Sowa, Y., . . . Kanazawa, K. (2005). Fucoxanthin induces cell cycle arrest at G0/G1 phasein human colon carcinoma cells trough up-regulate ion of p21WAF1/Cip1. Biochimica et Biophysica Acta, 1726, 328–335. Fujimura, Y., Umeda, D., Yano, S., Maeda-Yamamoto, M., Yamada, K., & Tachibana H. (2007).The 67kDa lamin in receptor as a primary determinant of anti-allergic effects of O-methylated EGCG. Biochemical and Biophysical Research Communications, 364, 79–85 Fujioka, M., Uehara, M., Wu, J., Aldercreutz, H., Suzuki, K., Kanazawa, K., . . . Ishimi, Y. (2004). Equol, a metabolite of daidzein, inhibits bone loss in ovariectomized mice. Journal of Nutrition, 134, 2623–2627. Fukuda, I., Sakane, I., Yabushita, Y., Kodoi, R., Nishiumi, S., Kakuda, T., . . . Ashida, H. (2004). Pigments in green tea leaves (Camellia sinensis) suppress transformation of the aryl hydrocarbon receptor induced by dioxin. Journal of Agricultural and Food Chemistry, 52, 2499–2506. Hashimoto, T., He, Z. H., Ma, W. Y., Schmid, P. C., Bode, A. M., Yang, C. S., & Dong, Z. (2004). Caffeine inhibits cell proliferation by G0/G1 phase arrest in JB6 cells. Cancer Research, 64, 3344–3349. Hashimoto, T., Ozaki, Y., Mizuno, M., Yoshida, M., Nishitani, Y., Azuma, T., . . . Kanazawa, K. (2012). Pharmacokinetics of fucoxanthinol in human plasma after the oral administration of kombu extract. British Journal of Nutrition, 107, 1566–1569. Hollman, P.C.H., van Trijp, J.M.P., Buysma, M.N.C.P., v.d. Gaag, M.S., Mengelers, M.J.B., de Vrie, J.H.M., & Katan, M.B. (1997). Relative bioavailability of the antioxidant flavonoid quercetin from various foods in man. FEBS Letters, 418, 152–156. Ichiyanagi, T., Rahman, M.M., Kashiwada, Y., Ikeshiro, Y., Shida, Y., Hatano, Y., . . . Konishi, T. (2004). Absorption and metabolism of delphinidin3-O-β-D-glucopyranoside in rats. Free Radical Biology and Medicine, 36, 930–937. Ishikawa, H., Goto, M., Matsuura, N., Murakami, Y., Goto, C., Sakai, T., & Kanazawa, K. (2012). A pilot, randomized, placebo-controlled, double-blind phase IIa/biomarker study on effect of artepillin C-rich extract of brazillian Propolis in frequent colorectal adenoma polyp patients. Journal of American College Nutrition, 31, 327–337. Ito, C., Oi, N., Hashimoto, T., Nakabayashi, H., Aoki, F., Tominaga, Y., . . . Kanazawa K. (2007). Absorption of dietary licorice isoflavan glabridin to blood circulation in rats. Journal of Nutritional Science and Vitaminology, 53, 358–365. Kanazawa K., Yamashita T., Ashida H., & Danno G. (1998a), Antimutagenicity of flavones and flavonols to heterocyclic amines by specific and strong inhibition of the cytochrome P450 1A family. Bioscience, Biotechnology, and Biochemistry, 62, 970–977. Kanazawa, K., Ashida, H., & Danno, G. (1998b). Antimutagenic mechanism of flavonoids against a food-derived carcinogen, Trp-P-2, elucidated with the structure-activity relationships. In Osawa, T., Shibamoto, T., & Terao, J. (eds.) Functional Foods for Disease Prevention II: Medicinal Plants and other Foods, pp. 67–82. ACS Symposium Series vol. 702. Washington, D. C.: American Chemical Society. 16 Proceedings ASIAHORCS 2013

Kanazawa K., Ashida, H., & Danno, G. (1999). Comparison in metabolic activity of cytochrome P450 1A1 on heterocyclic amines between human and rat. Journal of Agricultural Food Chemistry, 47, 4956–4961. Kanazawa, K., Uehara, M., Yanagitani, H., & Hashimoto, T. (2006). Bioavailable flavonoids to suppress the formation of 8-OHdG in HepG2 cells. Archives of Biochemistry and Biophysics, 455, 197–203. Kanazawa, K. (2008). Finding bioavailable phytochemicals which express a beneficial effect on the health. In Shahidi, F., Ho C. T., Shibamoto, T., & Kanazawa, K. (Eds.) Food factors in health promotion and disease prevention, pp. 8–17. ACS Symposium Series vol. 993. Oxford: American Chemical Society, Washington, D.C., Oxford University Press. Kanazawa, K/ (2011). Bioavailability of non-nutrients for preventing lifestyle-related diseases. Trends in Food Science and Technology , 22, 655–659. Kanazawa K. (2013).Health beneficial effects of food factors can be applicable to humans?Journal of Clinical Biochemistry and Nutrition, 52, 185. Kang, M. H., Naito, M., Tsujihara, N., & Osawa, T. (1998). Sesamolin inhibits lipid peroxidation in rat liver and kidney. Journal of Nutrition, 128, 1018–1022. Kawai, Y., Nishikawa, T., Shiba, Y., Saito, S., Murota, K., Shibata, N., . . . Terao, J. (2008). Macrophage as a target of quercetin glucuronides in human atherosclerotic arteries. Journal of Biological Chemistry, 283, 9424–9434. Kohno, H., Yoshitani, S., Tsukio, Y., Murakami, A., Koshimizu, K., Yano, M., . . . Tanaka, T. (2001). Dietary administration of citrus nobiletin inhibits azoxymethane-induced colonic abberant crypt foci in rats. Life Sciences, 69, 901–913. Maeda, H., Hosokawa, M., Sashima, T., Funayama, K., & Miyashita, K. (2005). Fucoxanthin from edible sea weed, Undaria pinnatifida, shows antiobesity effect through UCP1 expression in white adipose tissues. Biochemical and Biophysical Research Communications, 332, 392–397. Manach, C., Williamson, G., Morand, C., Scalbert, A., & Rémésy, C. (2005). Bioavailability and bioefficacy of polyphenols in humans. I. Review of 97 bioavailability studies. American Journal of Clinical Nutrition, 81, (suppl.) 230S–242S. Miyake, Y., Shimoi, K., Kumazawa, S., Yamamoto, K., Kinae, N., Osawa, T. (2000). Identification and antioxidant activity of flavonoid metabolites in plasma and urine of eriocitrin-treated rats. Journal of Agricultural and Food Chemistry, (48), 3217–3224. Moon J. H., Nakata, R., Oshima, S., Inakuma, T., & Terao, J. (2000). Accumulation of quercetin conjugates in blood plasma after the short-term ingestion of onion by women. American Journal of Physiology. Regulatory, Integrative and Comparative Physiology, 279, R461–R467. Morimitsu, Y., Nakagawa, Y., Hayashi, K., Fujii, H., Kumagai, T., Nakamura, Y., . . . Uchida, K. (2002). A sulforaphane analogue that potently activates the Nrf2-dependent detoxification pathway. Journal of Biological Chemistry, 277, 3456–3463. Murakami, A., Ashida, H., & Terao, J. (2008). Multi targeted cancer prevention by quercetin. Cancer Letters, 269, 315–325. Murota K., & Terao, J. (2003). Antioxidative flavonoid quercetin: implication of its intestinal absorption and metabolism. Archives of Biochemistry and Biophysics, 417, 12–17. keynote papers 17

Nakagawa, K., Nakayama, K., Nakamura, M., Sookwong, P., Tsuduki T., Niino H., . . . Miyazawa, T. (2009). Effects of co-administration of tea epigallocatechin-3-gallate (EGCG) and caffeine on absorption and metabolism of EGCG in humans. Bioscience, Biotechnology and Biochemistry, 73, 2014–2017. Oi, N., Hashimoto, T., & Kanazawa, K. (2008). Metabolic conversion of dietary quercetin from its conjugate to active aglycone following the induction of hepatocarcinogenesis in Fisher 344 rats. Journal of Agricultural and Food Chemistry, 56, 577–583. Ren, R., Azuma, Y., Hashimoto, T., Nishitani, Y., Mizuno, M.,Ojima T., Yoshida M., Azuma T., & Kanazawa. K. (2013). Modulation of platelet aggregation-related eicosacoid production by dietary F-fucoidan from brown alga Laminaria japonica in humans. British Journal of Nutrition, 110, 880–890. Sakakibara, H., Nakagawa, S., Ashida, H., & Kanazawa, K. (2003). Simultaneous determination of all polyphenols in vegetables, fruits and teas. Journal of Agricultural Food Chemistry, 51, 571–581. Sheng, H., Hirose, Y., Hata, K., Zheng, Q., Kuno, T., Asano N., . . . Mori, H. (2007). Modify- ing effect of dietary sesaminol glucosides on the formation of azoxymethane-induced premalignant lesion of rat colon. Cancer Letters, 246, 63–68. Shimizu, K., Aashida, H., Matsuura, Y., & Kanazawa, K. (2004). Antioxidative Bioavailability of artepillin C in Brazilian propolis. Archives of Biochemistry and Biophysics, 424, 181–188. Shimizu, K., Das, S.K., Baba, M., Matsuura, Y., & Kanazawa, K. (2005a). Dietary artepillin C suppresses the formation of aberrant crypt foci induced by azoxymethane in mouse colon. Cancer Letters, 240, 135–142. Shimizu, K., Das, S. K., Hashimoto, T., Baba, M., Sowa Y., Yoshida T., . . . Kanazawa, K. (2005b). Artepillin C in Brazilian propolis induces G0/G1 arrest via stimulation of Cip1/ p21 expression in human colon cancer cells. Molecular Carcinogenesis, 44, 293–299. Shimoi, K., & Nakayama, T. (2005). Glucuronidase deconjugation in inflammation. Methods in Exzymology, 400, 263–272. Shiratori, K., Ohgami, K., IlievaI., Jin, X. H., Koyama, Y., Miyashita K., . . . Ohno, S. (2005). Effects of fucoxanthin on lipopolysaccharide-induced inflammation in vitro and in vivo. Experimental Eye Research, 81, 422–428. Tachibana, H., Koga, K., Fujimura, Y., & Yamada, K. (2004). A receptor for green tea polyphenol EGCG. Nature Structural & Molecular Biology, 11, 380–381. Tanoue, T., Nishitani, Y., Kanazawa, K., Hashimoto, T., & Mizuno, M. (2008). In vitro model to estimate gut inflammation using co-cultured Caco-2 and RAW264.7 cells.Biochemical Biophysical Research Communications, 374, 565–569. Ueda M., Nishiumi S., Nagayasu H., Fukuda I., Yoshida K., & Ashida, H. (2008). Epigallocat- echingallate promotes GLUT4 translocation in skeletal muscle. Biochemical and Biophysical Research Communications, 377, 286–290. Uekusa, Y., Kamihara, M., Nakayama, T. (2007). Dynamic behavior of tea catechins interacting with lipid membranes as determined by NMR spectroscopy. Journal of Agricultural and Food Chemistry, (55), 9986–9992. 18 Proceedings ASIAHORCS 2013

Williamson, G., & Manach, C. (2005). Bioavailability and bioefficacy of polyphenols in humans. II. Review of 93 intervention studies. American Journal of Clinical Nutrition, 81, (suppl.) 243S–255S. Yoshida, H., Yanai, H., Ito, K., Tomono, Y., Koikeda, T., Tsukahara, H., & Tada, N. (2010). Administration of natural astaxanthin increases serum HDL-cholesterol and adiponectin in subjects with mild hyperlipidemia. Atherosclerosis, 209, 520–523. Yoshizumi, M., Tsuchiya, K., Suzaki, Y., Kirima, K., Kyaw, M., Moon, J. H., . . . Tamaki, T. (2002). Quercetin glucuronide prevents VSMC hypertrophy by angiotensin II via the inhibition of JNK and AP-1 signaling pathway. Biochemical and Biophysical Research Communications, 293, 1458–1465. keynote papers 19

Food Policy and Sciences in Indonesia*

Siswono Yudo Husodo Board of Advisor, Indonesian Farmers’ Union

In some Asian countries, economic growths since the 1970s have been higher than those of the other parts of the world, starting from Japan, Taiwan, Hong Kong, Singapore, South Korea, to recently Malaysia and Thailand. At present, India, China and Indonesia are enjoying the ultimate growths. Goldman Sach, a business consulting agency has forecasted that in 2040, the sequential global economic rating will be China, US, India, Japan and Germany. Three of the five most powerful countries in global economy are Asian countries. Sixty percent of global population live in Asia. Asia will also be the global energy supply center of oil, gas and coal. The global economy center is no longer exclusive to European countries or the States, but has been shifting to Asia. Identifications towards the above have been reflected by some indicators. At present, the share market capitalization in Asia has reached 34% of all the share market value in the world, exceeding the value in the USA (33%) and Europe (27%). Meanwhile, two third of the foreign exchange reserve in the world are kept in central banks in Asia. In the calculation of purchasing-power parity (PPP), Asia has formed the biggest economy in the world (34%). Retail trading in Asia has also included one third of the retail selling in the entire world. Automotive selling, for example, has reached 35% of all recorded selling in the world. Mobile phone has reached 43% and energy has reached 35%. For food, Asia has influenced significantly to the international economic dynamism. China’s economics and India having one third of the global population, which grows fast, cause the China and India have more population with better welfare, and their people could eat more than before. Previously, in China there were people who have meals only once or twice a day, but now those people can have meal thrice a day, besides eating snacks. The increased meal portion per capita in many Asian countries cause was the food demand to grow much higher. This forum will give the opportunity to foreign researchers to understand the Indonesian agricultural problems and food policies. I would like to emphasize the unique conditions of the Indonesian agriculture. Despite of the fact that Indonesia has higher cultural heritage in terms of agriculture and local wisdom in different regions, the efforts to develop the Indonesian agriculture is not easy. Agriculture in Indonesia is unique because there is a span of thousands of

* Please do not use for quotation 20 Proceedings ASIAHORCS 2013

years of difference in civilizations; as from the uses of agricultural tools from the stone age in Papua to those who are living in modern age civilization with green houses, drip system irrigations, GMO seeds, embrio transfer, superior and hybrid seeds; being very much different from other countries that have equal level of agricultural technology. We are living in the world with high growth rate of population number. Every 13 years, the world’s population increases with 1 billion people. This phenomenon has been in progress without being supported by the agricultural land availability. According to FAO, the population growth rate has increased whilst the number of land per capita has decreased. Meaning, the world’s food stock will decrease. Furthermore, the food price increased from time to time. We do expect that there is a technological breakthrough that may result in increasing food production and can be applied rapidly in all countries. The utilization of seed and advance technology, in the agricultural and husbandry production activities having commenced from hybrids, genetics modifications, cloning and embryo transfer, need to promptly be socialized in many countries to accelerate production. If not, many countries will have food supply problems. Indonesia has deficit of food supply domestically, and food importation has continuously increased. With the ever increasingly food pricing, Indonesia has deficit in its food trading balance. If Indonesia is not able to increase its food production, Indonesia will continuously suffer from deficit in its food trading balance. For example, in 2011 agricultural trading balance has recorded a surplus amounting to 22.93 billion US dollar. The said number has only been supported by plantation subsector which has recorded a surplus trading balance amounting to 31.55 billion US dollar. This surplus has been eroded by the deficit in food planting trade subsector, which has a deficit of 6.3 billion US dollar, horticulture of 1.06 billion US dollar, as well as husbandry amounting to 2.19 billion US dollar. Whilst in 2012 the plantation sub-sector has recorded a trading balance surplus of 33.6 billion US dollar. This surplus was contrary with the deficit of food plantation trading subsector which was 6.7 billion dollar US, horticulture amounting to 1.3 billion dollar US, as well as husbandary amounting to 2.9 billion US dollar. Indonesia is a significant food importing country. Around 10 billion US dollar should be spent for food importation every year; at present, importing an average of 1.5 million ton of salt/year (50% of the national salt requirement), importing 70% of the soya bean national requirement, 12% of the corn requirement, 15% of nuts requirement, and importing 90% of the national requirement for garlic. Every year, Indonesia imports around 650,000 cattles, representing 30% of the national meat consumption. Seventy percents of the milk requirement is still keynote papers 21 being imported; whilst fruits importation, such as oranges, mandarins, apples, grapes, peers, and others are incessantly increased. According to GreenPool Commodities (Australia) analysis, Indonesia has become the biggest sugar importer in the world in 2013, shifting from China and Russia. Whilst in agriculture Indonesia actually has a good profile. According to World in Figures 2003 Edition issued by The Economist, Indonesia is the sixth biggest seeds/cereals producer in the world; the third biggest rice producer in the world after Cina and India; the sixth largest tea producer in the world; the fourth biggest coffee producer in the world; the third biggest caccao producer in the world after Ivory Coast and Ghana; the second palm oil producer in the world after Malaysia became the largest; the biggest white pepper producer in the world and the third biggest black pepper in the world; the biggest nutmeg fruit producer in the world; the second natural rubber producer in the world after Thailand; the fourth biggest ad rubber producer in the world if together with synthetic rubber; the biggest clove producer in the world. There are only a few countries owning superior potentials as many as Indonesia. For Indonesia, the main food problem is how to increase national production. Food problems has already become a serious world problem. Global food crisis has occurred time and again. However, science may eventually overcome it. Family Planning Program, especially the birth control, has also been successful, and food availability has also been maintained due to the food production technology development, which is significant mainly in terms of seeds and pest control. In view of the existing conditions, such as the increased food pricing, the MDG’s target for food, and the purpose of Rome Declaration in the Food Summit Conference (KTT Pangan) of 1996, it seems that the target will not be achieved. Previously, it was targeted by both forums that the number of global population who were suffering from starvation would be decreased from 800 million people in 2002; namely 280 million people in East Asia, 240 million in South East Asia, 180 million in Africa and 100 million in Latin America, and would become 400 million persons in 2015. Up till 2010, the number of persons who starved in the world had reached 1 billion, an increase from the conditions in 2002. Indonesian agricultural sector is closely related to two issues; namely food supply and poverty. There are varied points of views in Indonesia to respond matters above. However, I am of the opinion that Indonesia being a country with 240 million population, the fourth largest in the world; with high population growth rate, around 1.3% per year, less than two decades could have a position the third rating in the world, which has a large tropic agricultural land potential which should be able to produce food both for itself and the world. 22 Proceedings ASIAHORCS 2013

For Indonesia, increasing its food production is a must due to the fact that the consumption per capita is still low due to poverty and the increase in international food price. For the majority of the Indonesian society (60%), averagely using 40% of their livelihood budget for food, the increased food price will be much of a burden. Seventen percents of the poorest Indonesian people are not able to buy nutritive food. Compared to some other countries, the Indonesian peoples’ consumption level for protein is still low caused by the constraint of their knowledge and low economic power. At present, Indonesia’s milk consumption/capita/year of is 12.85 L; lower than that of Cambodia, which is 12.97 L and Bangladesh with 31.55 L, far below India which through its “white revolution”, has succeeded in improving the peoples’ consumption of milk/capita/year to 60 L. Indonesia’s consumption of meat per capita/year, which is 7.1 kg, is much under Malaysia, which is 43 kg and the Philippines which is 19 kg. Indonesia’s egg consumption per capita/year is still 6.4 kg, whilst Malaysia has reached 41.9 kg. Being a country with 75% of its region taken up by sea (5.8 million km²), the fish consumption is still low as well, not even reaching 26 kg/capita/year, under Malaysia which is 45 kg and far under Japan, which is 70 kg /capita/year; the highest in the world, making the Japanese reach the highest life expectation in the world. To make it possible for the Indonesian peoples to reach the consumption level as that of other countries in Asia it requires an additional food supply which is enormous in number. In this context, the agricultural sector is also expected to provide job opportunity and to increase the peoples’ welfare. The increased of food production is also a must for Indonesia, since the number of the middle class income families are drastically increasing. The World Bank has defined the middle class as those spending per capita per day an amount of 2– 20 US dollar. On the basis of the World Bank’s data, in 2003, the number of the Indonesian middle class people was only 37.7% of the population; in 2010, the number of the middle class people was 134 million people or 56.5% of the population. This number will always increase. The increase of the Indonesian middle class to date has multiplied the food importation significantly. The agricultural land availability will become the most important aspect determining the country capability to produce food. At present, the food agricultural land ratio per inhabitant, namely ratio between food agricultural land width to the number of population for Indonesia is classified as very low compared to many other countries; Indonesia is 358.5 m²/capita (only paddy field land) and 451.1 m²/capita (paddy field + dry land). Whilst, the ratio of land/capita of Thailand is 5,225.9 m²/capita, India is 1,590.6 m²/capita, China is 1,120.2 m²/capita and Vietnam is 959.9 m²/capita. keynote papers 23

Ironically, the agricultural land reduction is continously happened. The largest agricultural land conversion is for settlement/residential area development and industry. Town enlargement and industrial development occurs on nearly the entire regions of Java Island, the main food producer island. Conversion of agricultural land into different non-agricultural requirements is a reasonable matter because they are also needed. However, in Indonesian cases they are specific matter. Land utilization over here is imbalance. Eighty percents of Java Island, which is very fertile, has been cultivated intensively. Meanwhile, in Papua, having 43 million hectare of land (3⅓ times of Java Island), there are only 700 thousand hectares or a mere 1.5% of its total land which has been cultivated, even with less intensive method. Indonesia faces the poverty problem as well. In the past ten years, poverty rank has been less improving only. The main problem in the poverty eradication is to enhance the farmers’ income, due to the fact that the Indonesian society living under the poverty line, 60% of which is farmers. The farmers’ poverty has taken place rapidly due to decrease of the size of farmers’ land which has occurred continuously. The Agricultural Census of 2003 showed the number of small income farmers who were very small, namely farmers who control land less than 0.2 ha/families, and the landless farmers, namely those without land which is increasing significantly. If, in 1993, the number of small income farmers nationally were 10.9 million families, in Agricultural census of 2003, it has increased to 13.7 million families. The last Agriculture Census of 2013, which has not been announced yet, has an estimate of the number of the small farmer and the landless farmer which around 13 million families. The 2013 Agricultural Census has given a new hope because during the last 10 years, the number of farmers families has been decreasing by 5,04 million families, from 31.17 million in 2003 to 26.13 million in 2013. This was the first time the number of the farmers decresaed; around 500,000 families/year. Up until 2003 Agricultural Census, though the percentage of the farmers families compared to work force has decreased, the nominal amount has continuously increased. The Government needs to pay serious attention to this matter. The land/families narrowing process shall have to be ceased. Failure in this field will raise the poverty rate and cause difficulties to increase productivity and competitiveness. All countries which are sucessful in their agricultural fields, their farmers’ cultivated lands will be more in width from year to year. Indonesian agricultural land potentials are significant. Indonesia has 192 million hectare of land, with the tropical climate, making it possible to cultivate most parts of the said land for agriculture. The entire agricultural land potentials in Indonesia are 101 million ha in widths. The existing agricultural area according to Indonesian 24 Proceedings ASIAHORCS 2013

Statistic Bureau (BPS) is 47 million ha width. The agricultural reserve land is 54 million ha, which may be utilized into productive agricultural land, including plantations or woods-producing forests which are also beneficial ecologically or may become grasses or underbrush. The paddy field enlargement potentials are 19 million ha, having been used for other commodity 9 million ha; still available for paddy field 10 million ha (the largest area in Papua, West Borneo/Kalbar, East Borneo /Kaltim and Riau). Whilst the dry paddy field enlargement potentials are 5.1 million ha. To meet the food requirement for the additional population, which is 1.3%/year, more or less an additional 200 thousands new agricultural land is needed per year. To be able to become tropical food exporter, the new agricultural land required for food plants are 300 thousand ha/year. New agricultural land needs to be opened, with priority the utilizing of neglected lands in the form of underbrush, which become the nest of diseases. The said program needs to be accompanied by the increased productivity and efficiency to develop the competitiveness through agricultural mechanism, and increase the farmers land ownership which is still sufficient. The paddy field potentials provided which is adequate are area with a size of 10 million ha (the largest in Papua, West Borneo, East Borneo and Riau). Whilst the new agricultural land for plants will urge mechanism. I don’t prefer to copy the USA model, which a farmer owns a land more than 500 ha, even thousands of ha. It is more preferable to copy Brazil with 2–25 ha/farmer, the land processing of which uses wheel tractor of 50 HP. Intensive mechanization is difficult to be run in Java Island, but is able in Papua and Borneo. Agricultural cultivation outside Java Island, the land of which is vast, should have not imitated the pattern in Java Island. By utilizing science and technology, Indonesia is not only potential to self- contained, but also to become tropical agricultural crops exporter for tropical agricultural products in the world, simultaneously with its agro industry. Indonesia possesses huge potentials in the form of tropical agricultural land which is very large, the second largest in the world after Brazil. The circumferential equator is 40,000 km. From Sabang to Merauke, the length of is 8.000 km. Twenty percent of the equator lies in Indonesia, and the most part lies in Atlantic Ocean, Pacific, and Indian Oceans. Our competitors are Brazil and Colombia in Latin America. The equatorial territory in Africa is mostly in the desert. Science is a pre-requisite to gear the progress of the Indonesian agriculture. The technological utilization needs to be accelerated. For example, for CPO products, Indonesia has produced 47 derivatives with an added value amounting to extensively, far beyond Malaysia, which has succeeded in producing 100 derivative products. keynote papers 25

In addition to scientific and technological approaches, to achieve the said objectives above, the Government should provide optimal support through its policies in macro economics. Especially to control the liberalization process and global and regional trade practices which make farmers from different countries with different socio economic conditions and technological usage have to compete in the same market. If the efforts to increse domestic productivity failed, Indonesia will lose the opportunity to increse the farmers’ welfare and to enhance the human resources development in terms of quality, and a lot of foreign currencies has to be used for food importation. Indonesia intends to improve food production with two objectives. First, to meet the domestic requirement and second, to become exporting country of tropical food. Indonesia intends to become the global tropical food supplier. There are not many countries which have potentials to become major food product source for the world in the future, and Indonesia is one of them. Significant food product addition made by Indonesia would certainly participate in keeping the world’s food pricing stability in the long term. The global tropical food market has grown rapidly due to the fact that the world’s population has increased rapidly with 1 billion people for every 13 years. Indonesia has potentials to become the main exporting country for tropical agricultural products, such as rice, coffee, cacao, sugar cane, corns, rubber, white pepper, black pepper, nutmegs, edible palm oil, cloves, tea, atsyrical oil, rubber, tropical fruits and others with products and derivatives. The thing that I would like to emphasis is the need for political decision to make Indonesia the world main exporter country for tropical agricultural-products, including products of food, husbandry, fishery, horticulture, fruits and others, with agroindustry. This is necessarily supported by enhancing the production capacity and production process modernization. The modernization characteristic intended is the advanced technology to yield more production, in a shorter time, with better quality and a good meaning cheaper pricing.

Bioresources for Food

Full Paper of Oral Presentations

Genetic Resources of Male Sterility for Chilies Breeding

Jutamas Kumchai* and Maneechat Nikornpun Department of Plant Science and Natural Resources, Faculty of Agriculture, Chiang Mai University

Abstract Chili is an important vegetable crop of the family Solanaceae in Thailand. There are different varieties of chilies that vary according to shape, size, color, and region. Chilies are a self-pollinated crop. Heterosis in F1 hybrid progeny has been exploited and largely used in Thailand due to high yield, resistance to disease, wide adaptability, uniform economic characteristics and good quality. F1 hybrid seeds of chilies were produced by female lines and male lines (N/S MsMs, N msms and N/S Msms). The female lines were three male sterile lines (Smsms), which were developed by the Faculty of Agriculture at Chiang Mai University, and the other male sterile lines were collected by AVRDC-The World Vegetable Center East and Southeast Asia at Kasetsart University, Kamphaeng Saen Campus. The male sterility systems were presented in the crop facilitate easy and cheap hybrid seed production. For a successful hybrid seed production program, plant breeders need a suitable production area, congenial environment, and stable parents. The present review deals with the hybrid seeds of chilies by using male sterility, mostly in northern part of Thailand, particularly with respect to breeding methods, heterosis breeding, maintenance, and male sterile lines, as well as commercial approaches for hybrid seed production of chilies. Keywords: Breeding, chilies, heterosis, hybrid, male sterile

*Corresponding Author Chiang Mai, 50200, Thailand E-mail: [email protected]

Introduction Chilies originated in the tropical Americas and are distributed worldwide. They are very important vegetable crop that is plentiful in nutrition and pungency. Chilies are used fresh or dry and are processed in the chili powder, chili sauce and so on. (De, 2003). As demand and consumption of chilies grew, chilies became approximately 17% of total spice world trade (Ahmed dan Pandey, 2002). Almost all Thai people like this spicy food. Therefore, there are many varieties of chilies grown and distributed in Thailand, especially in the north and northeast parts.

Most chili seeds are F1 hybrids that were developed by private seed companies. Local and open-pollinated cultivars are widely used by Thai farmers. In the northern part of Thailand, a particular type of hot chili is widely grown for a special type of chili paste. Hot chili cultivars that are used for chili paste are different from local cultivars of hot chilies in other parts of the country. Almost all of the open-pollinated and some of the F1 hybrid cultivars are available. However, most

31 32 Proceedings ASIAHORCS 2013

farmers prefer to produce their own chili seeds rather than purchase from a seed

supplier. F1 hybrid seeds demand a high price. Therefore, farmers are reluctant to

purchase them. Male sterility is the best option to decrease the cost of F1 hybrid seed production (Berke, 1999). However, male sterile plants have low pungency and lack other characteristics that are required for hot chili cultivars (Wang et al., 2004). Male sterile (S) cytoplasm has been utilized for commercial hybrid development in South Korea, China, and India (Kumar et al., 2007). A major fertility restorer locus (Rf) is known to restore the fertility of S cytoplasm, but it is influenced by temperature and quantitative trait loci (QTLs) modifiers (Wang et al., 2004) and is conditioned by an additional partial restoration (pr) locus, which is suspected to be either tightly linked to Rf locus or is the third allele of Rf locus (Lee et al., 2008). There were a few stable nuclear cytoplasmic male sterile (CMS) lines In Capsicum spp. because the expressions of male sterility in CMS lines have been found to be temperature sensitive (Shifriss, 1997). Both genic male sterility and cytoplasmic genic male sterility have been used in the breeding and seed production of hybrid chilies (Zou et al., 2001; Fan and Liu, 2002; Yazawa et al., 2002). These studies aimed to correct, improve male sterile lines, and check genotype of hybrids and male line for future development of hybrid cultivars.

Materials and Methods Selection of a sterile cultivar. Seven chili accessions, KY10-3, KY14-1, KY14-2, KY 16, PJ5-3-1-1, PJ25-1-1 and PJ271-2-1 were developed by the Faculty of Agriculture at Chiang Mai University (Kumchai and Nikornpun, 2007), and 110 lines were developed by the Asian Vegetable Research and Development Center in Taiwan, which transferred these lines to Kasetsart University in Kampangsan. These were grown at the Faculty of Agriculture at Chiang Mai University in 2006–2007. F1 hybrid seed production and fertility scoring of F1 hybrids. Production of

an F1 hybrid crossed between male sterile as a female line and c line as male line was grown in 2006–2007. Parental lines and their hybrids are shown in Table 1. The pollen of open flowers was stained with 1% acetocarmine to score for pollen fertility (Pakozdi et al., 2002; Yoon et al., 2006). The red stain color and morphology of pollen indicating the viability of the pollen was the basis for classifying different genotypes. Bioresources for food 33

Table 1. Parental lines and F1 hybrids list.

Female accessions Male accessions F1 Hybrids KY10-3 PJ5-3-1-1 KY10-3×PJ5-3-1-1 KY14-1 PJ25-1-1 KY10-3×PJ25-1-1-1 KY14-2 PJ271-2-1 KY14-2×PJ5-3-1-1 KY 16-1 CA1038 KY14-2×PJ25-1-1-1 PEPAC30 CA1445-1 KY16-1×PJ5-3-1-1 PEPAC34-9 CA1448 KY16-1×PJ25-1-1-1 PEPAC36-11 CA1449-5 PEPAC30×PJ5-3-1-1 PEPAC36-17 CA1450-7 PEPAC34-9×PJ27-1-2-1 PEPAC36-19 CA1451 PEPAC36-11×CA1038 PEPAC38-16 PEPAC36-17×CA1448 PEPAC36-17×CA1450-7 PEPAC36-17×CA1451 PEPAC36-19×CA1449-5 PEPAC38×CA1445-1

Results and Discussion Selection of male sterile chillies. There are three male sterile chilies, KY10, KY14 and KY16 that were developed and improved by the Faculty of Agriculture at Chiang Mai University. Moreover, there were four male sterile lines, PEPAC30, PEPAC34, PEPAC36, PEPAC38 out of 110 lines from the Asian Vegetable Research and Development Center. Therefore, there were seven lines, 10 accession numbers were used as female parents for F1 hybrid seed production (Table 1).

Yield of F1 hybrids and their genotype expression. F1 hybrid seeds were separated into two groups. The purpose of the first one was to evaluate yield and compare it with male lines. It was found that the F1 hybrid line KY16-1× PJ5-3-1-1 showed the highest yield of 1,538 kg/0.16 hectare (rai). However, it was not significantly different from the PJ5-3-1-1 and PJ25-1-1-1. Moreover, it showed high heterosis when it was crossed with all females. The trend of combination between male lines, especially PJ5-3-1-1, represented a good combination for future production (see Table 2). Nikornpun et al. (2006) found that PJ5-3-1-1 gave the highest yield of 5.4 t/0.16 hectare and also showed higher capsaicin content than the F1 hybrids. However, KY14-1-1× PJ5-3-1-1 presented high heterosis as supported by the research of Nwofia et al. (2001) and Pandey et al. (2002). Conventional breeding with fertility scoring of pollen was used to identify genotypes of chili accession in Thailand (Nikornpun et al., 2009). The fertility scoring for F1 hybrids was classified according to pollen viability. The results indicated that there were three pollen groups. The first one was no pollen, which means that pollen was not available or non-functioning (Smsms), as 34 Proceedings ASIAHORCS 2013

Table 2. Yields, yield per plant and heterosis of F1 hybrids and male parents.

F1 hybrids and male Yields(kg/0.16hectare) Yield/plant(g) Heterosis parents KY16-1×PJ5-3-1-1 1,538.47 ab* 240.40 ab 11.76 KY14-2×PJ5-3-1-1 1,083.90 bc 169.40 bc -21.25 KY10-3×PJ5-3-1-1 1,081.13 bc 168.90 bc -21.48 KY10-3×PJ25-1-1-1 987.56 bc 154.30 bc -17.65 KY16-1×PJ25-1-1-1 905.39 bc 141.29 bc -17.65 KY14-2×PJ25-1-1-1 545.06 c 85.17 c -52.92 PJ5-3-1-1 1,376.87 b 215.10 b - PJ25-1-1-1 1,157.91 bc 180.90 bc -

* Means followed by the same letter in a row of yield and yield/plant were not significantly different by the LSD test at P≤0.05.

Table 3. The pollen fertility scoring of F1 hybrids and prospective genotypes of F1 hybrids and male parents. Pollen viability F1 hybrids and male Genotype (plant) parents Fertile Sterile Hybrid Male parent PEPAC30×PJ5-3-1-1 6 3+2(I) SMsMs:Smsms N/S Msms PEPAC34-9×PJ27-1-2-1 6 3 SMsMs:Smsms N/S Msms PEPAC36-11×CA1038 1 4 SMsms:Smsms N/S Msms PEPAC36-17×CA1448 10 0 SMsms N/S MsMs PEPAC36-17×CA1450-7 8 0 SMsms N/S MsMs PEPAC36-17×CA1451 0 3 Smsms Nmsms PEPAC36-19×CA1449-5 0 14 Smsms Nmsms PEPAC38×CA1445-1 0 30 Smsms Nmsms PJ5-3-1-1 10 - PJ27-1-2-1 30 - CA1038 13 -

(I) mean same plant with strained and unstained pollen divided in to three groups.

shown in Table 2 for PEPAC36-17×CA1451, PEPAC36-19×CA1449-5 and PEPAC38×CA1445-1. Therefore, genotype of male parents should be Nmsms. The second group was all the plant showed functional pollen (SMsms), which were PEPAC36-17×CA1448 and PEPAC36-17×CA1450-7. Therefore, genotype of male parents should be N/SMsMs. However, it could not guarantee that there were normal cytoplasm (N) or sterile cytoplasm (S). The last case, some plants presented normal pollen and some had no pollen (SMsMs:Smsms), which were PEPAC30×PJ5-3-1-1, PEPAC34-9×PJ27-1-2-1 and PEPAC36-11×CA1038. Therefore, genotypes of male parents were heterozygous (N/S Msms). However, Bioresources for food 35 this genotype could not identify that there were normal or sterile cytoplasm.

Payakhapaab et al. (2012) found that F1 hybrids showed no pollen in nine varieties whose male parents showed prospective genotypes of the Nrfrf or B line. Moreover, fertile pollens of hybrids in some plants and sterile ones in others appeared in four varieties whose male parents showed prospective genotypes of N/ SRfrf. The hybrids presented two varieties of fertile pollens, which meant that the male parents had male sterility-controlling genes in the nucleus of the N/SRfRf or C line. Nikornpun et al. (2009) found that accessions CA1445, CA1449, and CA1450 were suitable as maintainer lines.

Conclusions

Male sterility is very useful for plant breeding to produce F1 hybrid chili seeds as this trait helps researchers and farmers save time, money, and labor. The combination of F1 hybrids indicates that a female lines were male sterile lines (Smsms), which were very useful and there are many genotype of male lines such as normal or sterile cytoplasm with homozygous and heterozygous gene. Therefore, fertility scoring method was the basis and high facility for evaluating sterility pollen. These studies concluded that male sterility of male line can be distinguished into three groups: normal male fertile chilies (N/S MsMs), male sterile chilies (N msms), and male fertile chilies that are heterozygous in genotype of fertility restoration (N/S Msms), which can be used to enhance the purity of hybrid seeds. The chili varieties with the heterozygous male sterility controlling gene may be used as a C line for future breeding program.

Acknowledgement The Tropical Research and Development of Vegetables Center, Kasetsart University, Kampangsan for providing hot chilli genetic sources and Chiang Mai University for funding support for this research.

References Ahmed, Z., & Pandey, V. (2002). Heterosis and combining ability in diallel crosses of sweet pepper (Capsicum annuum L.). Vegetable Science, 29, 66–67. Berke, T.G. (1999). Hybrid seed production. In Capsicum annuum L. Vegetable Science, 29(1), 66–67. De, A. K. (2003). Capsicum: The genus capsicum. Medicinal and aromatic plants industrial profiles Vol.33. Taylor & Francis, London and New York. p. 275. Fan, Y. Q., & Liu, Y. (2002). ‘Jiyan 6’ a sweet pepper hybrid produced by male sterile lines. Acta Horticulturae Sinica, 29, 295. 36 Proceedings ASIAHORCS 2013

Kumar, S., Singh, V., Singh, M., Rai, S. K., Kumar S., Rai, M., & Kalloo, G. (2007). Genetics and distribution of fertility restoration associated RAPD markers in pepper (Capsicum annuum L.). Scientia Horticulturae, 111, 197–202.

Kumchai, J., & Nikornpun, M. (2007). Improvement of F1 hybrid chili using male sterility. Journal of Agriculture, 23(1), 17–24. Lee, J., Yoon, J. B., & Park, H. G. (2008). A CAPS marker associated with the partial restoration of cytoplasmic male sterility in chili pepper (Capsicum annuum L.). Molecular Breeding, 21, 95–104. Nikornpun, M., Chimonkol, C., Kumchai, J., & Boonyakiat, D. (2006). Varietal evaluation of

open-pollinated and F1 hybrid chili for Nam Prik Noom production. Agricultural Science Journal, 37(6) (Suppl), 215–218. Nikornpun, M., Kumchai, J., & Chimonkol,. C. (2009). Genetical evaluation and development of F1 hybrid chili by using male sterile genes. Khon Kaen Agriculture Journal, 37, 105–112. Nwofia, G.E., Echiemunor, I. J., & Eru-Obong E. E. (2001). Crossability relationships and heterosis in intra and interspecific hybrids of Capsicum.Journal of Sustainable Agriculture and the Environment, 3(2), 239–245. Pakozdi, K., Taller J., Alfoldi Z., & Hirata, Y. (2002). Pepper (Capsicum annuum L.) cytoplasmic male sterility. Journal of Central European Agriculture, 3(2), 149–157. Pandey, V., Ahmed, Z., & Kumar, N. (2002). Heterosis and combining in diallel crosses of sweet pepper (Capsicum annuum). Vegetable Science, 29(1), 66–67. Payakhapaab, S., Boonyakiat, D., & Nikornpun, M. (2012). Genetic evaluation and physicochemical properties of chillies (Capsicum annuum L.). Journal of Agricultural Science, 4(12), 253–260. Shifriss, C. (1997). Male sterility in pepper (Capsicum annuum L.). Euphytica, 93, 83–88. Wang, L., Zang, B., Daubeze, A. M., Huang, S. Guo, J., Mao, S., . . . Du, Y. (2004). QTL analysis of fertility restoration in cytoplasmic male sterile pepper. Agricultural Sciences in China, 109, 1058–1063. Yazawa, S., Yoneda, H., & Hosokawa, M. (2002). A new stable and available cytoplasmic male sterile line of Capsicum. Capsicum & Eggplant Newsletter, 21, 52–55. Yoon, J. B., Yang, D. C., Do, J. W., & Park, H. G. (2006). Overcoming two post-fertilization genetic barriers in interspecific hybridization betweenCapsicum annuum and C. baccatum for introgression of Anthracnose resistance. Breeding Science, 56, 31–38. Zou, X. X., Zhou, Q. C., Dai, X. Z., Ma, Y. Q., Li, X. F., Zhang, Z. Q., . . . Cheng, W. C. (2001). Breeding of ‘Xiang yan No.14’ by male sterility of pepper. Acta Horticulturae Sinica, 28, 278. Fine mapping of QTL for cyanogenic potential in cassava storage root

Sukhuman Whankaew 1*, Supajit Sraphet1, Opas Boonseng2 and Kanokporn Triwitayakorn1 1) Institute of Molecular Biosciences, Mahidol University 2Rayong Field Crops Research Center, Ministry of Agriculture and Cooperatives

Abstract Cassava is a cyanogenic crop which causes a serious problem to quality of life and environment. To gain knowledge on genes affecting cyanogenic potential (CNP) based on identified QTL underlying the trait and to validate potential molecular markers that are applicable in marker-assisted selection (MAS), this study aims to develop more tightly linked-markers to the QTL by fine mapping in order to increase power of QTL detection. With available cassava genome database, SSR markers were developed based on four scaffolds within the detected QTL and three interesting scaffolds containing genes in cyanogenesis pathway and genotyped with the mapping population. The QTL responded to CNP were analyzed with the CNP value, collected at Rayong and Lop Buri Provinces in 2009, and at Rayong Province in 2010. The results revealed the high density of QTL map which are effective for prediction of candidate genes and identification of trait-linked markers. The output of this study provides the opportunities to validate potential markers for selection of new cassava lines with low CNP in the breeding program. Keywords: Cassava, cyanogen content, high resolution mapping, microsatellites

*Corresponding Author 25/25 Phutthamonthon 4 Rd., Salaya, Nakhon Pathom 73170 Thailand E-mail: [email protected]

Introduction Cassava (Manihot esculenta Crantz) has been cultivated as an important food source, animal feed and industrial feedstock. World cassava production is expected to increase in order to sustain the industrial demand (Food and Agriculture Organization, 2012). In Asia, the utilization of cassava in industrial as biofuel has been the main driver of the 80 percent expansion in the cultivation. In Thailand, cassava is the world’s leading exporter (Food and Agriculture Organization, 2012). The increasing of the output demand lead to increasing of production. However, cassava is a cyanogenic crop, which can release hydrogen cyanide (HCN) (White et al., 1998). The presence of HCN during cell damage causes concerns about health effects such as acute intoxication, manifested as vomiting, dizziness, and so on. (Bokanga et al., 1994) and environmental toxicity (Dixon et al., 1994). Although HCN can be reduced to the safe levels by proper processing, it requires labor intensive and time, leading to economic and nutrient losses. In such case, released HCN still remains in environment (Dixon et al., 1994). Additionally,

37 38 Proceedings ASIAHORCS 2013

shortcut processing can yield toxic products (Bokanga et al., 1994). These cause a serious problem to environment and quality of life, especially in rural area. The level of cyanogenic potential (CNP) varies depended on variety and environment (Bokanga et al. 1994). Therefore, improved cassava cultivars for low CNP would be helpful. CNP is known as quantitative trait (Dixon et al., 1994). In such case, conventional breeding is not effective, but molecular breeding is expected to be more efficient, reliable and cost effective breeding approach (Xinyouet al., 2003; Collard et al., 2005). For molecular breeding, QTL mapping has been applies to identify trait-linked markers which can be used as marker-assisted selection (MAS). Moreover, it also provides better understanding on information of genes underlying the trait (Xinyou et al., 2003; Collard et al., 2005). Three key enzymes involved in the releasing of HCN, including cytochrome P450, linamarase and hydroxynitrile lyase have been characterized (Hughes, M. A. et al., 1992; Hughes, J. et al., 1994; White et al., 1998; Andersen et al., 2000). Even these enzymes have been well characterized to be involved in the releasing of HCN, they might not effect to the amount CNP, but the regulatory genes. Recently, five QTL of CNP have been identified from an SSR based linkage map (Whankaew et al.,. 2011). With available of cassava genome database, the information revealed that the cloned genes were not found in the QTL. In this study, fine mapping of the QTL regions was accomplished in order to narrow down the regions containing the potential genes and pinpoint closely linked-markers in order to select potential markers for safety cassava varieties selection. Nevertheless, fine mapping of regions containing genes involved in the releasing of HCN will also be fulfilled in order to provide more information about these genes.

Materials and Methods Plant material and CNP evaluation. Cassava variety ‘Hanatee’ (Thai local variety), exhibited low CNP and ‘Huay Bong 60’ (commercial variety), displaying high CNP were used as the parents to generate 200 of progenies used for the mapping population. For CNP evaluation, the storage roots of the population and its parents were measured at Rayong province in 2010 using picrate paper kit (Bradbury et al., 1999) as described in Whankaew et al., (2011). Fine mapping. QTL analysis has been updated from previous report (Whankaew et al., 2011) by increasing number of population from 100 to 200, and adding phenotypic data of evaluation at Rayong in 2010. The QTL mapping was done by JoinMap® 3.0 (van Ooijen & Voorrips 2001) and MapQTL® 4.0 (Van Ooijen et al., 2002) with phenotypic data evaluated in this study (at Rayong Province Bioresources for food 39 in 2010) and in previous study (at Rayong and Lop Buri Provinces in 2009). The identified QTL were blasted with cassava genome database “Phytozome”. Nucleotide sequences of scaffolds containing interesting QTL as well as genes involved in HCN production were used for SSR primer designed by “WebSat”. The SSR primers were synthesized and tested for amplification and polymorphism. Polymorphic primers were genotyped with the population as described in Whankaew et al., (2011). Finally, fine map was constructed using JoinMap® 3.0. Identification of tightly linked markers.Tightly linked markers were identified on fine map using three sets of phenotypic data evaluated in this study (at Rayong Province in 2010) and in previous study (at Rayong and Lop Buri Provinces in 2009) by MapQTL® 4.0.

Results and Discussion In 2011 QTL affecting CNP has been reported on linkage map of 100 F1 created by a cross between ‘Hanatee’ and ‘Huay Bong 60’, consisting of 303 SSR markers. Recently, additional markers have been developed (Sraphet et al., 2011) and therefore, the map was re-constructed by including more markers and number of samples to 200. The new linkage map increased the number of markers to 489 loci, relied on 23 linkage groups, and cover 1846.6 cM with an average interval distance of 6.1 cM. QTL affecting CNP evaluated at Rayong and Lop Buri Provinces in 2009 and at Rayong Province in 2010 were detected as shown in Table 1.

Table 1. Description of the QTL for cyanogenic potential in cassava. Years Locations QTL LG αg αc Loci LOD %PVE 2009 Rayong CN09R1 5 4.5 2.8 NS308 7.4 12.5 CN09R2 5 2.8 ESSRY54-CA141 7.2 13.4 CN09R3 6 2.9 EME502 3.8 3.1 CN09R4 11 3.2 SSRY219 5.8 9.5 CN09R5 16 3.2 CA76 4.5 7.5 CN09R6 16 3.2 SSRY103 5.5 9.0 Lop Buri CN09L1 6 4.5 2.9 CA46 4.4 12.5 CN09L2 11 3.2 SSRY219 3.2 7.8 2010 Rayong CN10R1 4 4.2 2.7 EME303-CA591 2.9 8.9

*LG = Linkage group αg = Genome wide significance threshold αc = Chromosome wide significance threshold LOD = Logarithm of odds %PVE = Percentage of phenotypic variation explained. 40 Proceedings ASIAHORCS 2013

With the established results, the significant loci for fine mapping were considered based on LOD score, percentage of phenotypic variation explained and significance of single marker analysis. The selected loci indicated the significance of single marker analysis is shown in Figure1. Each locus was blasted with cassava genome database and given the name of their scaffolds followed the name of markers. Four scaffolds relied on the peaks of CN09R1 (s10689), CN09R4 and CN09L2 (s00368), and CN09R6 (s07933) and within 2-LOD support (s05214) were selected for fine mapping. In addition, three scaffolds containing genes involving in CNP were also mapped in fine map that include s08265, s12341 and s07743 in which CYP79D2, linamarase and hydroxynitrile lyase, respectively were found. After fine mapping and QTL analysis, the high density of QTL map was generated (Figure 2). The fine map could narrow down the QTL regions. The rearrangement of marker loci resulted in changing of QTL on linkage group 5 from 2 to 1 QTL, as well as on linkage group 16 which pointed out the better loci to be focused on. For linkage group 11, the QTL peak was still relied on the same locus, made scaffold s00368 become more interested. Mapping scaffolds containing genes involving in CNP was successful, but no QTL was detected on those scaffolds, indicating that these genes might not directly affect to the amount of released HCN as the trait is controlled by multiple genes. The prediction of candidate genes on scaffolds s00368, s07933 and s10689, gene characterization, and validation of tightly linked markers responded to CNP is in the progress of investigation. Bioresources for food 41 The positions of selected QTL underlying cyanogenic potential for fine mapping. The mapping. fine for potential cyanogenic underlying QTL selected of positions The igure 1. igure significance of single marker analyzed in 2009 at Rayong and Lop Buri Provinces and in 2010 at 2010 in and Provinces Buri Lop and Rayong at 2009 in analyzed marker single of significance “/”. separated by on the left side of linkage group, shown are Province Rayong F 42 Proceedings ASIAHORCS 2013

Figure 2. The positions of QTL underlying cyanogenic potential on the fine map. The significance of single marker analyzed in 2009 at Rayong and Lop Buri provinces and in 2010 at Rayong Province are shown on the left side of the linkage group, separated by “/”.

CONCLUsions Fine mapping of relevance QTL regions is important in the identification of tightly linked markers to the target genes. In this study, the high density QTL map of CNP provides better tool for identification of the tightly linked markers which are useful for marker assisted selection, and also offers the opportunities to predict candidate genes affecting CNP which will give better understanding of genes and gene network involved in CNP. The information will also produces a huge benefit on selection of new cassava lines with low CNP in the breeding program. Bioresources for food 43

Acknowledgement This research was supported by National Research Council of Thailand in col- laborated with National Science Technology Development Agency (P-12-00849), and Thailand Research Fund (TRG5580002). Mahidol University and Rayong Field Crops Research Center are also acknowledged.

References Andersen, M. D., Busk, P. K., Svendsen, I., & Møller, B. L. (2000). Cytochromes P-450 from cassava (Manihot esculenta Crantz) catalyzing the first steps in the biosynthesis of the cyanogenic glucosides linamarin and lotaustralin: Cloning, functional expression in pichia pastoris, and substrate specificity of the isolated recombinant enzymes.Journal of Biological Chemistry, 275, 1966–1975. Bokanga, M., Ekanayake, I., Dixon, A., & Porto, M. (1994). Genotype-environment interactions for cyanogenic potential in cassava. Acta Horticulturae, 375, 131–140. Bradbury, M., Egan, S., & Bradbury, J. (1999). Picrate paper kits for determination of total cyanogens in cassava roots and all forms of cyanogens in cassava products. Journal of the Science of Food and Agriculture, 79, 593–601. Collard, B., Jahufer, M., Brouwer, J., & Pang, E. (2005). An introduction to markers, quantitative trait loci (QTL) mapping and marker-assisted selection for crop improvement: The basic concepts. Euphytica, 142, 169–196. Dixon, A., Asiedu, R., & Bokanga, M. (1994). Breeding of cassava for low cyanogenic potential: problems, progress and perspectives. Acta Horticulturae, 375, 153–161. Food and Agriculture Organization. (2012). Food outlook. In Global information and early warning system on food and agriculture. Hughes, J., Carvalho, F. J., & Hughes, M. A. (1994). Purification, characterization, and cloning of alpha-hydroxynitrile lyase from cassava (Manihot esculenta Crantz). Archives of Biochemistry and Biophysics, 311, 496–502. Hughes, M. A., Brown, K., Pancoro, A., Murray, B. S., Oxtoby, E., & Hughes, J. (1992). A molecular and biochemical analysis of the structure of the cyanogenic beta-glucosidase (linamarase) from cassava (Manihot esculenta Cranz). Archives of Biochemistry and Biophysics, 295, 273–279. Sraphet, S., Boonchanawiwat, A., Tangphatsornroung, S., Boonseng, O., Tabata, S., Lightfoot, D., et al., (2011). Development of simple sequence repeat markers and construction of genetic linkage map of cassava (Manihot esculenta Crantz). Theoritical and Applied Genetics, 122, 1161–1170. van Ooijen, J. W., Boer, M. P., Jansen, R. C., & Maliepaard, C. (2002). MapQTL 4.0, Software for the calculation of QTL position on genetic maps. Plant Research International, Wageningen. van Ooijen, J. W., & Voorrips, R. E. (2001). JoinMap 3.0. Software for the calculation of genetic linkage maps. Plant Research International, Wageningen. 44 Proceedings ASIAHORCS 2013

Whankaew, S., Poopear, S., Kanjanawattanawong, S., Tangphatsornruang, S., Boonseng, O., Lightfoot, D., et al., (2011). A genome scan for quantitative trait loci affecting cyanogenic potential of cassava root in an outbred population. BMC Genomics, 12, 266. White, W., Arias-Garzon, D., McMahon, J., & Sayre, R. (1998). Cyanogenesis in cassava. the role of hydroxynitrile lyase in root cyanide production. Plant Physiology, 116, 1219–1225. Xinyou, Y., Stam, P., Kropff, J., & Schapendonk, H. (2003). Crop modeling, QTL mapping, and their complementary role in plant breeding. Agronomy Journal, 95, 90–98. RIce Improvement Through Biotechnology to Anticipate Global Climate Change and Utilization of Suboptimal Lands

Amy Estiati and Satya Nugroho* Research Center for Biotechnology-Indonesian Institutes of Sciences

Abstract Shortage of rice is a particular concern in Indonesia as it prone to loses due to biotic and abiotic stresses. Population increase puts pressure on rice production with higher demand while forcing rice production areas to less arable lands. In the meantime, global climate change which causes unpredictable wet season and prolonged dry season results in the reduction of rice productivity. Therefore, maintaining high productivity of rice during stress periods by increasing tolerance (drought, high salt, shading, submergence and other associated biotic stresses) is a priority to Indonesia. In an attempt to improve rice performance in anticipation to the impact of global climate change and to utilize suboptimal lands, currently we are focusing on two different approaches. The first is on gene discovery to identify and isolate genes responsible for drought, high salinity and shading tolerances, which will be applied for future application to improve rice performance. The second is to develop rice varieties through biotechnology, resistance to diseases and pests, which is becoming more severe and unpredictable such as rice blast disease and rice tungro disease those caused by Pyricularia grisea (Cooke) and tungro virus, respectively and yellow stem borer (Scirpophaga incertulas Walker) which are threats to rice throughout its growth period. In this occasion, the attempts to isolate and identify genes from rice mutants responsible for drought and high salinity tolerance, and the development of stem borer resistance rice are being described. Two aproaches to study drought and high salt tolerant mechanisms in rice are taken in our attempt to understand and develop drought and salinity tolerant cultivars. The first is through the development and screening of rice insertional mutant population harboring Ds transposon and activation-tag followed by identification of interesting mutants and isolation of responsible genes. Another aproach is by isolating and overexpressing transcription factors known to be responsive to drought stresses in rice. The development of resistant varieties to the yellow stem borer, which is one of the most important pests limiting rice production, is hindered by the unavailability of resistant gene among rice varieties. Therefore, biotechnology aproach by overexpression of theBacillus thuringiensis Cry genes in rice is being developed and is being finalized by testing potential Bt lines in the confined field trials. Keywords: Rice, gene discovery, genetic engineering, stem borer, drought, salt, shading

*Corresponding Author Jln. Raya Bogor Km 46, Cibinong, Bogor 16911, Indonesia E-mail: [email protected]

Introduction Rice is one of the major sources of staple food. Mainly consumed in Asia, rice has become important also in many other parts of the world including America, Europe, Africa and Australia. Together with wheat and maize, rice supply more than 50% of all calories consumed by the entire human population. Every year

45 46 Proceedings ASIAHORCS 2013

there are 214 million ha, 154 million ha and 140 million ha areas harvested for wheat, rice and maize, respectively. Although only second in term of harvested area, according to International Rice Research Institute (IRRI) human consumption accounts for 85% of total production for rice, compared with 72% for wheat and 19% for maize. Rice is very important as source of food; currently it provides 21% of global human per capita energy and 15% of per capita protein. Additionally, rice also provides minerals, vitamins, and fiber. Although rice protein ranks high in nutritional quality among cereals, protein content is modest. Indonesians are among the world largest rice consumers, with the average consumption of 154 kg/capita/year, rice accounts for nearly 5% of calories and one-third or more of protein. With the increasing number of population, especially in the rice consuming areas which are mainly in the developing world with high population growth rate, rice consumption is expected to rise significantly. Therefore, rice production needs to be increased to keep up with the demand. However, despite its importance, rice production is facing serious problems from both biotic and abiotic stresses. Biotic stresses include those caused by pest and diseases, while abiotic stresses are caused mainly by environment such as drought, high salinity and shading among the most important stresses. In the near future, the impact of global climate change is expected to be more severe, which will cause unpredictable events of dry and wet seasons, and outbreak of pest and diseases. In the mean time, rice growing areas are moving towards the less productive areas due to population increase which results in the conversion of arable land to industrial and housing estates. The newly established farming areas, the vast and under utilized suboptimal land, may prone to both biotic and abiotic stresses, unsuitable for rice growing. These issues need to be addressed as the impact may be devastating for rice production, thus our food security. At the Research Center for Biotechnology LIPI, currently we are focusing to solve several major rice problems caused by biotic and abiotic stresses, but in this occasion we are going to describe our work on some of them including attempts to develop drought, high salinity and shading tolerant (abiotic stresses), and stem borrer resistant (biotic stress) varieties through gene discovery and genetic engineering. Drought, high salinity and shading stresses. Abiotic stresses account for over 50% of global rice production (Boyer, 1982, Bray et al., 2000). Abiotic stresses cause changes in morphology, physiology, biochemistry and molecular, which in turn can affect the growth and productivity of plants (Wanget al., 2001). Among them, drought stress is one of the most important abiotic stresses in rice. Drought stress induces a range of physiological and biochemical responses in plants, which Bioresources for food 47 include stomatal closure, repression of cell growth and photosynthesis, and activation of respiration (Shinozaki and Shinozaki, 2007). Plants also respond and adapt to water deﬁcit at both the cellular and molecular levels, for instance by the accumulation of osmolytes and proteins speciﬁcally involved in stress tolerance. Drought stress may severely effects rice plant during generative stage, where flower development is initiated. Therefore, drought stress during generative stage will significantly reduce rice yield and may be one of the main causes of crop loss due to abiotic stress. In Indonesia, the impact of El Nino-Southern Oscillation (ENSO) was severe. Rice production went down, which forced Indonesia to import approximately 5.8 million tons (around 20% of global rice trade), during the 1997/1988 El Nino (Naylor et al., 2007). Likewise in 2006, drought also caused rice production loss. In addition to sensitivity to drought stress, rice is also a salt-sensitive crop (Grover and Pental, 2003). Excess salts may adversely affect all major metabolic activities in rice, such as cell wall damage, plasmolysis, cytoplasmic lysis and damage to endoplasmic reticulum. Excess salts also reduces photosynthesis, and decreases germination and seedling growth (Khan, et al., 2006; Pareek et al., 1997). These will lead ultimately to reduction in growth and diminish in grain yield, which will significantly contribute to grain yield losses. Rice is considered as more sensitive to salts during early seedling than at reproductive stages (Flowers and Yeo, 1981; Lutts et al., 1995). The increase of sea level due to global climate change causes flooding due to sea water intrusion, increasing salt content of rivers and increasing the ground water table (USDA-ARS, 2008). The FAO predicts that more than 800 million ha lands are affected by salinity. High salinity stress is therefore a threat for Indonesian food security since it consists of islands and is surrounded by seas. With the reduction in area of fertile lands available for farming due to land conversion for industry and urbanization, farming will be forced to move upland where land are less fertile and irrigation is generally not available. Furthermore, much uplands have been utilized for industrial estate such as forestry and palm oil. Maximizing those areas for rice growing to increase rice production is possible using shading tolerant varieties. Industrial agricultural estates in Indonesia covers large areas and could expand in the future. There are roughly 5 million ha coconut plantation in Indonesia, the Phillipines and South Pacific. There are approximately 8 million ha palm oil plantation in Indonesia and could expand in the future (Dirjen Perkebunan, 2010). Those areas are potential for rice production providing the application of shading tolerant rice varieties. In addition, global climate change that increases precipitation will reduce light intensity needed for plant to grow normally resulting in shading stress. 48 Proceedings ASIAHORCS 2013

Shading stress reduces light intensities needed for normal growth of plants. Shading directly influences growth and morphological development of plants, therefore reducing production. Under drought rice tends to have few tillers and underdevelop roots, thus less biomass. Moreove, leaves tend to be thinner and wider with increased water content (Wong et al., 1985). Under such condition, production is reduced. The development of shading tolerant varieties is therefore necessary to incrase rice production in those areas. A strategy to identify and isolate important genes. Attempt to identify and isolate genes important traits have been done, many of them from the model plant Arabidopsis thaliana. The genes isolated from Arabidopsis can be used as models to study genes from different plants (orthologues) with similar sequence in hopes that they have the similar functions (Zhang et al., 2004). For example, the NHX1 gene isolated from Atriplex gmelini, an orthologue of At NHX1 from Arabidopsis which plays roles in salt tolerance, capable of increasing salt tolerance when expressed in rice (Ohta et al., 2002). Using the sequence similarity approach, orthologue of NHX1 has also been isolated from different plants, including from rice (Fukuda et al., 1999) and wheat (Chen et al., 2002). Beside NHX1, another gene that has been isolated from rice by using sequence similarity approach is OsDREB1A, an orthologue of AtDREB1A from Arabidopsis (Dubouzet et al., 2003), which plays roles in drought tolerance. Although it was predicted that many genes involved in crucial cellular processes are conserved in plants, there are genes that are unique (or functionally unique) to certain plants. The uniqueness of some genes can be predicted from the different sizes of genome and the different number of genes predicted in the genome of different plants. TheArabidopsis diploid genome size is about 125 Mb, while rice is 430 Mb. There are 25.000 predicted genes in Arabidopsis, while in rice there are 40.000 to 50.000 genes. It is also predicted, based on the sequence similarity, that more than 80% of Arabidopsis genes can be found in rice, while more than 45% of rice genes cannot be found in Arabidopsis (Bennetzen, 2002). Therefore, if we assume that the 40.000 to 50.000 predicted genes in rice are functional, around 20.000 of them are uniquely found in rice which cannot be found in Arabidopsis. This could also mean that to find, identify or isolate genes responsible for any phenotype (such as drought stress tolerance) in rice by using sequence homology with those of Arabidopsis or other plants, it has to be supported and complemented with the attempt to find the responsible gene directly from rice. There are several approaches that can be done in order to study genes in rice. Among others, the first is knock-out and the second is over-expression of the genes in plants. These two approaches will be described in more detail in this paper. The function of the gene can then be predicted by observing the phenotype of the regenerated transgenic plants. Unfortunately, homologous recombination and site Bioresources for food 49 directed mutagenesis techniques routinely used for gene knock-out in yeast, for example, which can precisely replace one allele for another, although have been reported (Hanin and Paszkowsky, 2003) are not yet available for routine use in plants. Therefore, random knock-out by using T-DNA through Agrobacterium transformation is an alternative. The knock-out strategy with T-DNA as insertion mutagen is a powerful forward genetic tool for gene discovery. The knock-out gene can then be analysed functionally by looking at the phenotypes. However, gene disruption approaches have drawbacks since not all the knocked-out genes confer phenotypes under normal condition although some mutation show phenotypes under certain environmental condition or when analysed at different growth stages (Boyes et al., 2001). An explanation for the inability of knocked-out genes to confer phenotypes is the possible functional redundancy. Many plant genes are highly duplicated during the evolution. Although some of the duplicated genes evolved for different function, this event may explain the lack of phenotype in knock-out mutants. Another reason for lack of phenotypes is unsuitable screening protocols. To improve the system and to overcome the limitations of forward genetics by knock-out, modified insertional mutagenesis tools have been developed. The more sophisticated tools incorporate gene trap system involves the creations of fusions between the tagged genes and a reporter gene such as gusA or gfp (Sundaresan et al., 1995). The insertion of the promoterless reporter gene not only will inactivate the gene function but also activates the reporter gene. This way, even though no obvious phenotype resulting from the knock-out, the expression patterns of the tagged genes will be able to be identified. Thus, allowing functional prediction of the tagged genes. Another approach is by incorporation of activation tagging. Activation tagging that we used as tools in identification and isolation of genes related to drought responses, possesses advantages that can overcome some problems that are faced when using the knock-out mutagenesis. This approach has been applied successfully in isolating genes from Arabidopsis (Kakimoto, 1996; Weigel et al., 2000; Borevits et al., 2000; Ito and Meyerowitz, 2000), petunia (Zubko et al., 2002) and Catharanthes roseus (van der Fits and Memelink, 2000). Instead of knocking-out the tagged gene, activation tagging will over expressed the genes. With the strong tandem repeat of 4 minimal promoter derived from the CaMV 35S promoter, the activation tagging can increase the tagged genes’ expression to above normal or even ectopically. Using this approach, hopefully the highly redundant genes can also be functionally detected. The activation tag located between the Ds junctions enables it to transpose and independently inserts into new positions in the genome, thus capable of creating more independent mutation in the T1 generations and stable insertions at T2 generations. The system 50 Proceedings ASIAHORCS 2013

will allow a genome-wide gene identification and isolation providing enough representative number of lines. The genome-wide identification and isolation by activation tagging genes will be facilitated by the availability of rice genome sequence information in databases (Barry, 2001; Goffet al., 2002; Yu et al., 2002). To isolate important genes from rice, we have developed a population of rice insertional mutant lines carrying activation-tag and gene-trap (Figure 1). The population was established using theAgrobacterium transformation method for random insertion of the T-DNA in the rice genome (Nugroho et al., 2007a; Nugroho et al., 2007b; Nugroho et al., 2006) using the plasmids systems obtained from Dr. Narayana Upadhyaya (CSIRO) and Dr. Andy Pereira (WUR). To facilitate the development of population with independent and random insertion the maize Ac/Ds transposon was integrated in the system. The system also facilitate ease in mutant identification using the green fluorescence protein (GFP), bar (basta tolerant) and hpt (hygromycin phospho transferase, tolerant to hygromicin) selection markers.

Figure 1. Development and propagation of insertional mutant population. A-B. Regenerated insertional mutant rice plant, C. Southern hybridization to confirm copy number, D-E. Propaga- tion of insertional mutant population in the glass-house. Bioresources for food 51

The population was developed in the japonica rice cv Nipponbare for the ease of transformation (Hiei et al., 1994) and the availability of genome sequence in the database (Goff et al., 2002; Yu et al 2002; ). To facilitate gene identification obtained from a particular insertion mutant line for future analyses, only singly inserted and viable lines were selected. A scheme of the method for the development of the insertional mutant population is as described in Figure 2. Mutagenic lines were developed by transformation of rice calli using standard protocol (Hiei et al., 1994). The mutagenic lines are those harboring both the active Ac and Ds transposon in their genome. Selection of mutagenic lines can be performed using the selectable marker available (GFP, hpt, bar).

Figure 2. The scheme for gene identification and isolation.

Stable insertional mutant population was screened starting from the T1 generation. Stable lines are those with Ds insertion but lacking the Ac insertion. The screenings were facilitated by using reporter and selectable genes/markers (GFP, basta, hpt). Mutant lines passing the screening process will be propagated to obtain more seeds, while other lines which are still classified as mutagenic lines will be used for future screening. So far, more than 5000 mutant lines have been obtained from the screenings. Screening for drought, salt and shading responsive mutants and gene identification.Drought response screening was performed for the mutant lines using PEG6000. The bioassay was performed at vegetative stage by germinating 52 Proceedings ASIAHORCS 2013

seeds in a jar containing Yoshida solution (Yoshida et al., 1976) with 200 g/L PEG. Scorings were performed 21 days after sowing for root length, leaf length and germination rate. Salt responses screening was performed in Yoshida solution containing 200 g/L NaCl at vegetative stage until 21 days after sowing. Scorings were performed on leaf length, root length and also germination rate (Situmorang et al., 2010). Shading tolerant mutants were screened under 100% darkness after 10 days germinatin under light. Scoring was done on mutant lines that survived 10 days of total darkness. The identification of the insertion sites and genes responsible for the phenotype changes were done using TAIL-PCR (Liu et al., 1995). Following the PCR amplification, the identification of insertion sites was done by using bioinformatics. Four droughts related mutant lines have been identified and the insertion sites have been determined (Nugroho et al., 2009; Nugroho et al., 2011). Currently, several identified genes are being characterized functionally, through over-expression, knock-down and promoter analyses. Meanwhile, salt tolerant and salt sensitive mutants have also been identified. Several candidate genes are being characterized for their roles. Shading tolerant mutant have also been identified and are now waiting for further analyses. Rice yellow stem borer (Scirpophaga incertulas Walker). Yellow stem borer is one of the major rice pests in Indonesia. Every year it impacts 141.000 ha with an average impact of 11% of the total area (BBPadi 2010; 2012). Recent report indicated that in West Java the average impact might be as high as 40%. Yellow stem borer may attack during vegetative or generative stages. Attack during vegetative stage will cause symptoms called dead-heart, while during generative stage it will result in white-head. Dead-heart will still allow rice to recover and develop new tillers post attack, while white-head unable the plant to recover and thus will cause more loss. Rice yellow stem borers are Lepidoptera and are regarded as having the most wide-spread and the most dominant in Java, Bali, Lampung and Kalimantan Selatan. In the rice production central of West Java, the yellow stem borer is considered the major insect pest. It can breed fast enough to be able to have two generations during one planting season whose impact could be devastating. Traditionally, application of pesticide, managing planting seasons and mechanical means are used to combat yellow stem borer (Widagdo, 1994). However, the strategy is not very efficient to reduce the impact of attack. Pesticide is not efficient since the stem borer lives inside the plant. The more pesticides are used, the worse the impact to the environment is. Planting season management is difficult since rice planting seasons are dependent on the availability of water. Mechanical approach is time consuming and needs a lot of manpower and skill, therefore highly inefficient. Therefore, to reduce the impact of stem borer attack Bioresources for food 53 in rice production, the development of resistant rice varieties are needed. Since the availability of resistant gene is not described in rice until now, genetic engineering by inserting the Bacillus thuringiensis Cry genes that are known to be effective for Lepidopteran and are known to be safe for other organisms, including human and animal are preferred. Genetic engineering to improve rice resistant to yellow stem borer. An alternative technology to develop stem borer resistance rice was done by genetically engineering rice using the Cry genes from Bacillus thuringiensis. The approach will solve the problems of unavailability of the traits from rice or its wild relatives. Cry1 gene family members (Cry1Ab, Cry1B, Cry1Aa) are chosen due to its specificity to Lepidoptera. The genes are expressed in different manner in rice as a strategy to reduce the development of resistance in the stem borer. The cry1Ab is expressed using the CaMV35S promoter, the Cry1B is expressed using the wound inducible promoter; maize proteinase inhibitor (mpi), and a fusion of Cry1B::Cry1Aa is expressed using the maize ubiquitin promoter. The constructs were obtained from John Iness Center in the UK. The constructs have been transformed into rice and molecular analyses to determine their insertions and expressions in rice which have been done (Sulistyowati et al., 2011). Currently, environment safety analyses are being performed in 4 locations (Figure 3) as a requirement for possible future release in Indonesia.

Figure 3. Confined Field Trial in Kuningan, West Java as part of a series of 4 trials need to be performed according to the environmental safety regulation. Other trials are being conducted in Muara-Bogor, Sukamandi-Subang and Serang-Banten. 54 Proceedings ASIAHORCS 2013

ConclusionS Rice production is hindered by both biotic and abiotic stresses. In the attempt to solve some of the problems, identification and isolation of genes responsible for drought, high salinity and shading tolerance are being done. The attempts are being facilitated by the development of a population of rice insertional mutants consisting of roughly 5,000 independent lines. The population have been screened for drought, high salinity and shading tolerance, which results in some leads of important tolerant mutants and some candidate genes related to drought and salinity tolerant. Yellow stem borer is one of the major rice insect pests causing serious problems in rice production especially in rice growing centrer in Indonesia. Attempt to improve rice resistance to the yellow stem borer is being done by genetic engineering by expression of the Bacillus thuringiensis Cry gene family in rice. Potential candidate resistant to the yellow stem borer has been obtained and currently being tested for its environmental safety in 4 area in Indonesia.

References Balai Besar Penelitian Tanaman Padi. (2010). Mengendalikan hama penggerek batang kuning dengan perangkap berferomon. Informasi Ringkas. Retrieved from http://pustaka.litbang. deptan.go.id/bppi/lengkap/bpp10050.pdf. Balai Besar Penelitian Tanaman Padi. (2012.) Penggerek batang padi. Retrieved from http://pustaka. litbang.deptan.go.id/index.php/in/hama-padi/207. Barry, G. (2001). The use of the Monsanto draft rice genome sequence in research.Plant Physiology, 125, 1164–1165. Bennetzen, J. (2002). Opening the door to comparative plant biology. Science, 296, 60–63. Borevitz, J. O, Xia, Y., Blount, J., Dixon, R. A, & Lamb, C. (2000). Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell, 12, 2383–2394 Boyer, J. S. (1982). Plant productivity and environment. Science, 218, 443–448. Boyes, D. C., Zayed, A. M., Ascenzi, R., McCaskill, A. J., Hoffman, N. E., Davis, K. R., & Gorlach, J. (2001). Growth stage-based phenotypic analysis of Arabidopsis: a model for high throughput functional genomics in plants. Plant Cell, 13, 1499–510. Bray, E. A., Bailey-Serres, J., & Weretilnyk, E. (2000). Responses to abiotic stresses. In: Gruis- sem W, Buchannan B, Jones R (eds), Biochemistry and molecular biology of plants (pp. 1158–1249). Rockville, MD: American Society of Plant Physiologists. Buell, C. R. (2002). Current status of the sequence of the rice genome and prospects for finishing the first monocot genome. Plant Physiology, 4, 1585–1586. Chen, S., Guo, B., He, S., Tian, A., Wang, Z., & Zhang, J. (2002). Cloning and characterization of the Na+/H+ antiport genes from Triticum aestivum. Acta Botanica Sinica, 44, 1203–1208. Dirjen Perkebunan. (2010). Retrieved from http://ditjenbun.deptan.go.id/cigraph/index.php/ viewstat/ komoditiutama/8-Kelapa%20Sawit. Bioresources for food 55

Dubouzet, J. G., Sakuma, Y., Ito, Y., Kasuga, M., Dubouzet, E. G., Miura, S., . . . Yamaguchi- Shinozaki, K. (2003). OsDREB genes in rice Oryza sativa L., encode transcription activators that function in drought-, high-salt- and cold-responsive gene expression. Plant Journal., 33,751–763. Flowers, T. J., and Yeo, A. R. (1981). Variability in the resistance of sodium chloride salinity with in rice (Oryza sativa L.) varieties. New Phytologist, 81, 363–373. Fukuda, A., Nakamura A., & Tanaka, Y. (1999). Molecular cloning and expression of Na+/H+ exchanger gene in Oryza sativa. Biochimica et Biophysica Acta, 1446,149–155. Greco, R, Ouwerkerk, P. B. F., Taal, A. J. C., Sallaud, C., Guiderdoni, E., Meijer, A.H., . . . Pereira, A. (2004) Transcription and somatic transposition of the maize En/Spm transposon system in rice. Molecular Genenetics and Genomics, 270, 514–523. Goff, S., Ricke, D., Lan,T., Presting, G., Wang, R., et al., (2002). A draft sequence of the rice genome (Oryza sativa L. ssp. Japonica). Science, 296, 92–100. Goff, S. A, Ricke, D., Lan, T. H., Presting, G., Wang, R., Dunn, M., . . . Briggs, S. (2002). A draft sequence of the rice genome (Oryza sativa L. ssp. japonica). Science, 296, 92–100. Grover, A., Pental, D. (2003). Breeding objectives and requirements for producing transgenic for the major field crops of India. Current Science, 84, 310–320. Hanin, M., & Paszkowski, J. (2003). Plant genome modification by homologous recombination. Current Opinion in Plant Biology, 6, 157–62. Hiei, Y., Otha, S., Komari, T., & Kumashiro, T. (1994). Efficient transformation of rice (Oryza sativa L) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Tha Plant Journal, 6(0), 1–11. Ito, T., & Meyerowitz, E. M. (2000). Overexpression of a gene encoding a cytochrome P450, CYP78A9, induces large and seedless fruit in Arabidopsis. Plant Cell, 12, 1541–50. Kakimoto, T. (1996). CKI1, a histidine kinase homolog implicated in cytokinin signal transduction. Science, 274, 982–985. Khan, M.A., Ahmed, M. Z., & Hamee, A. (2006). Effect of sea salt and L-ascorbic acid on the seed germination of halophytes. Journal of Arid Environments, 67, 535–540. Liu, Y. G., Mitsukawa, N., Oosumi, T., Whittier, R. F. (1995). Efficient mapping and isolation of Arabidopsis thaliana T-DNA insert junction by thermal assymetric interlaced PCR. The Plant Journal, 8(3), 457–463. Lutts, S., Kinet, J. M, & Bouharmont, J. (1995). Changes in plant response to NaCl during development of rice (Oryza sativa L.) varieties differing in salinity resistance. Journal of Experimental Botany, 46, 1843–1852. Naylor, R. L., David, S., Battisti, D. S., Vimont , D. J., Falcon, W. P., & Burke, M. B. (2007). Assessing risks of climate variability and climate change for Indonesian rice agriculture. PNAS, 104(19), 7752–7757. Nugroho, S., Trijatmiko, K. R., Rachmawati, S., Zannati, A., & Purwantomo, S. (2006). Upaya pengembangan populasi mutagenic lines padi pembawa activation tag dengan transposon Ac/Ds melalui transformasi dengan Agrobacterium. Proceeding Seminar Nasional Bioteknologi. 15–16 November 2006 pp. 236–242. 56 Proceedings ASIAHORCS 2013

Nugroho, S., Mulyaningsih, E. S., Astuti, D., & Pantouw, C. (2007a). Upaya pengembangan populasi padi mutan dengan mutasi insersi transposon Ac/Ds pembawa gene-trap untuk pencarian gen-gen penting dari padi. Proceeding Seminar pengembangan dan optimalisasi produksi komoditas tanaman pangan, hortikultura perkebunan dan bioenergy, pp. 105–110. Nugroho, S., Trijatmiko, K. R., Zannati, A., & Indrayani, S. (2007b). Analisa aktivitas transposon Ds pembawa activation-tag pada generasi T2 dalam upaya pengembangan populasi padi mutan untuk pencarian gen-gen bermanfaat. Prosiding Seminar pengembangan dan optimalisasi produksi komoditas tanaman pangan, hortikultura perkebunan dan bioenergy, pp. 111–114. Nugroho, S., Windiastri, V. E., Widyajayanti, D., & Pantouw, C. F. (2009). Identification of Drought Tolerant Related Insertional Mutant Rice Lines Using PEG6000. Annales Bogorienses, 13(1), 31–37. Nugroho, S., Zannati, A., Situmorang, A., Windiastri, V. E., Widyajayantie, D., Pantouw C. F., . . . Trijatmiko, K. R. (2011). Phenotypic Screening of Ds transposon and Activation-tag Insertional Mutant Rice Population for Drought and Salinity Tolerant Related Traits. Annales Bogorienses, 15(1). Ohta, M., Hayashi, Y., Nakashima, A., Hamada, A., Tanaka, A., Nakamura, T., & Hayakawa, T. (2002). Introduction of a Na+/H+ antiporter gene from Atriplex gmelini confers salt tolerance to rice. FEBS Letters, 532, 279–282. Pareek, A., Singla, S. L. & Grover, A. (1997) Short term salinity and high temperature stress associated ultra-structural alterations in young leaf cell of Oryza sativa L. Annals of Botany, 80, 629–639. Shinozaki, K., & Yamaguchi-Shinozaki, K. (2007). Gene networks involved in drought stress response and tolerance. Journal of Experimental Botany, 58(2), 221–227. Situmorang, A., Zannati, A., Widyajayanti, D., & Nugroho, S. (2010). Seleksi Genotipe Padi Mutan Insersi Toleran Cekaman Salinitas Berdasarkan Karakter Pertumbuhan dan Biokimia. Journal Agronomi, 38, 8–14. Sulistyowati, Y., Rachmat, A., Zahra, F., Rahmawati, S., & Nugroho, S. (2011). Transformation of rice cv. Ciherang using double T-DNA vector harboring cry1Ab gene. Annales Bogorienses, 15(1) Sundaresan, V., Springer, P., Volpe, T., Haward, S., Jones, J. D., Dean, C., . . . Marttienssen, R. (1995). Patterns of gene action in plant development revealed by enhancer trap and gene trap transposable elements. Genes and Development, 9, 1797–1810. USDA-ARS. 2008. Research Databases. Bibliography on Salt Tolerance. George E.Brown, Jr. Salinity Lab. US Dep. Agric., Agric. Res. Serv. Riverside, CA. Retrieved from http://www. ars.usda.gov/Services/docs.htm.docid=8908. van der Fits, L., & Memelink, J. (2000). ORCA3, a jasmonate-responsive transcriptional regulator of plant primary and secondary metabolism. Science, 289, 295–297. Wang, W.X., Pelah, D., Alergand, T., Shoseyov, O., & Altman, A. (2001). Denaturate stable and/ or protease resistant, chaperone-like oligomeric proteins, polynucleotides encoding same and their uses. Provisional Patent Application No. 60/272,771, USA. Weigel, D., Ahn, J. H., Blazquez, M. A., Borevitz, J.O., Christensen, S. K., Fankhauser, C., . . . Chory, J. (2000). Activation tagging in Arabidopsis. Plant Physiology, 122, 1003–1013. Bioresources for food 57

Widagdo. (1994). Pengendalian hama penggerek batang padi. Yogyakarta: Andi Offset. Yoshida, S., Forno, D. A., Cock, J. H., & Gomez, K. A. (1976). Laboratory manual for physiological studies of rice. Third Edition. Manilla: IRRI. Yu, J., Hu, S., Wang, J., Wong, G. K., Li, S., Liu, B., . . . & Yang, H. (2002). A draft sequence of the rice genome (Oryza sativa L. ssp. indica). Science, 296, 79–92. Zhang, J. Z., Creelman, R. A., Zhum J. K. (2004). From laboratory to field. Using information from Arabidopsis to engineer salt, cold and drought tolerance in crops. Plant Physiology, 135, 615–621. Zubko, E., Adams, C. J., Machaekova, I., Malbeck, J., Scollan, C., & Meyer, P. (2002). Activation tagging identifies a gene from Petunia hybrida responsible for the production of active cytokinins in plants. Plant Journal, 29, 797–808.

Tetraploid Plants from Interspecific Hybrids between Mungbean and Rice Bean

Tanapon Chaisan1*, Prakit Somta2, Peerasak Srinives2*, Sontichai Chanprame2, Rangsarid Kaveeta1, Surapong Dumrongkitikule3 1Department of Agronomy, Faculty of Agriculture, Kasetsart University 2Department of Agronomy, Faculty of Agriculture at Kamphaeng Saen, Kasetsart University 3Department of Horticulture, Faculty of Agriculture at Kamphaeng Saen, Kasetsart University

Abstract Mungbean (Vigna radiata) and rice bean (V. umbellata) (both species 2n = 2x = 22) have desirable traits that complement each other. In this study, we rescued embryos from a cross between mungbean cv. “Kamphaeng Saen 2” and rice bean cv. “Miyazaki” and resolved the hybrid sterility problem by colchicine treatment. The interspecific hybrids were obtained when Kamphaeng Saen 2 was used as the female parent. Four out of 80 immature seeds at 12 days old were able to germinate on an MS medium supplemented with 1 mg.L-1 IAA, 0.2 mg.L-1 kinetin, and 500 mg.L-1 casein hydrolysate. Forty random amplified polymorphic DNA (RAPD) primers were screened for polymorphism among the parents, and two specific primers were finally chosen for testing of hybridity. Using the two primers, all putative F1 hybrids were confirmed as the interspecific hybrids. To observe their fertility, some of the hybrid seedlings were transplanted. The hybrid produced flowers profusely but failed to set pods. To overcome the sterility, plants were induced to become tetraploid by colchicine treatment in vitro. The ploidy level of the regenerated seedlings was confirmed from leaf DNA using a flow cytometer. Three out of 20 hybrid seedlings (15%) were successfully induced from diploid to tetraploid by a colchicine concentration of 2 g.L-1, and the tetraploid plants were able to produce flowers and set pods normally. This man-made tetraploid will be further selected to obtain a new cultivar of mungbean or probably establish a new species for food in Thailand. Keywords: embryo rescue, interspecific hybridization, MS medium, in vitro tetraploid induction, Vigna radiata, Vigna umbellata

*Corresponding Author Chatuchak, Bangkok 10900, Thailand E-mail: [email protected]

Introduction Mungbean (Vigna radiata (L.) Wilczek) (2n = 2x = 22) is the most widely-grown Vigna species in Thailand. The crop has long been domesticated and thus exists in a more desirable phenology such as determinate growth habit, high harvest index, early maturity, and so on. However, mungbean is rather susceptible to pests and diseases. Rice bean [V. umbellata (Thunb.) Ohwi and Ohashi] is a minor legume grown largely in the southern and southeast areas of Asia. It is usually cultivated through intercropping with cereal crops, especially corn. Rice bean is genetically close to mungbean and possesses resistance to insects and diseases such as bruchid

59 60 Proceedings ASIAHORCS 2013

insects, powdery mildew, and cercospora leaf spot diseases (Tomooka et al., 2002). Thus, it has a high potential, together with mungbean, to serve as a gene source in breeding for biotic resistance and high nutrients in related Vigna spp. Interspecific hybridization between mungbean and rice bean was reported by Chen et al., (1983), Chen et al., (1989), and Pandiyan et al., (2010). These authors reported the same findings that the hybrid embryos aborted soon after pollination. Low frequencies of interspecific hybrids were successfully recovered when the embryos were rescued from a synthetic medium, but the plants were completely sterile (Chen et al., 1989). Therefore, transferring of gene (s) from rice bean to mungbean through hybridization seemed to be impossible. Nonetheless, Pandiyan et al., (2010) reported success in obtaining fertile hybrids between specific genotypes of mungbean and rice bean, although no details were described. Colchicine treatment is the most frequently used method for chromosome doubling in plants. It inhibits microtubule polymerization which blocks the formation of spindle fibers and disturbs normal polar segregation of sister chromatids. The ploidy level of colchicine-treated cells is doubled (Hansen and Andersen 1998). Ploidy level induction of plant cells by colchicine treatment is a useful technique in plant breeding aimed to enhance biomass yield and resistance to stresses (Glowacka et al., 2010; Wu et al., 2012), as well as to resolve interspecific hybrid sterility problems (Miyashita et al., 2009; Song et al., 1997). Colchicine treatment has been used to produce tetraploid plants in several species such as bananas, blueberries, grapes, loquat, and gerbera (Hamill et al.,1992; Miyashita et al., 2009; Notsuka et al., 2000; Saikat et al., 2011; Yahata et al., 2004; Yang et al., 2006). Soaking the shoot and the entire plant in colchicine solution, culturing auxiliary shoots in synthetic media supplemented with colchicine, and dropping colchicine solution on axillary buds are standard methods used for chromosome doubling. However, these methods were applied to a large number of target plants. Since only a few interspecific hybrid plants are usually recovered, these methods are not suitable for chromosome doubling. In vitro chromosome doubling by colchicine is an effective method for polyploidy induction (Glowacka et al., 2009, 2010), giving higher efficiency of tetraploid induction than the conventional method. This technique was successfully used to resolve the sterility problem of F1 interspecific hybrids of blueberries and brassica (Miyashita et al., 2009; Nanda-Kumar and Shivanna 1991). In vitro propagation of interspecific hybrids from a cross betweenV. radiata and V. mungo was successful when cotyledonary nodes of the F1 hybrid seedlings were cultured on an MS medium with 1.0 mg.L-1 of 6-benzylaminopurine (6-BAP) (Avenido et al., 1991). Studies on in vitro cultures of mungbean showed that multiple shoots were successfully regenerated from the shoot tip and cotyledonary Bioresources for food 61 node of the seedling (Anju and Jaiwal 1992, 1994). The aim of this study was to recover interspecific hybrids from a cross between mungbean and rice bean by embryo rescue techniques and multiply the hybrids by in vitro propagation. Then, the sterility problem of the hybrid was resolved by in vitro colchicine treatment.

Materials and Methods Interspecific hybridization.Mungbean cv. “Kamphaeng Saen 2” and rice bean cv. “Miyazaki” were used as parents to make direct and reciprocal crosses. Kamphaeng Saen 2 is a Thai recommended variety while Miyazaki is a native variety of Japan. Both varieties were sown in a field at Kasetsart University, Kamphaeng Saen Campus, Thailand. Interspecific hybridization was performed using the method described by Khattak et al., (1998). Embryo rescue by immature seed culture. The experimental design used in this study was a completely randomized design with four replications. Ages of the embryos (days after hybridization, DAH) were used as treatments, having 20 immature seeds per experimental unit. Cross-pollinated pods were harvested at 6, 8, 10, 12, and 14 DAH. The pods were surface-sterilized with 20% (v/v) sodium hypochlorite for 15 min, and rinsed three times with sterile water in a laminar flow hood. Immature seeds were excised from the pods and cultured on an MS medium supplemented with 1 mg.L-1 IAA, 0.2 ml.L-1 kinetin, and 500 mg.L-1 casein hydrolysate. The samples were kept at 25°C under 55μ mol m-2 s-1 of artificial light (daylight fluorescent tube) for 16 h per day. To increase the number of hybrid plants, axillary and apical terminal buds of the recovered hybrids were dissected and cultured on B5 medium, and B5 medium supplemented with 2 mg.L-1 IBA. The samples were kept under the same culture conditions as described above and sub-cultured once a month onto a new medium. Verification of hybrids by RAPD markers. Genomic DNA was extracted from young leaves of mungbean, rice bean, and their rescued hybrids using a modified method of Ida et al., (2004). Forty RAPD primers were screened for polymorphism between the mungbean and the rice bean. PCR reaction in a total volume of 25 μL contained 20 ng genomic DNA, 1× Taq polymerase buffer, 2.5 mM MgCl2, 0.2 mM each dNTPs, 1.25 U of Taq DNA polymerase (Fermentas, USA), and 0.4 μM primer. The PCR was performed in a GeneAmp 2400 PCR System (Perkin-Elmer). The program used was as follows. Incubation at 94°C for 3 min followed by 35 cycles of 94°C for 1 min, 37°C for 1 min, 72°C for 2 min, and a final extension at 72°C for 5 min. The amplified products were separated by electrophoresis at 100 V on 1.5% agarose gel, with 1× TBE buffer for 1 h. The gel was stained with ethidium bromide and visualized using Gel Document (Vilber Lourmat, TCX 20 M). The primers showing polymorphism between the parents were used to prove hybridity of the hybrids. 62 Proceedings ASIAHORCS 2013

In vitro colchicine treatment and flow cytometry analysis. To determine an optimum concentration of colchicines treatment for the in vitro tetraploid induction, 2-week-old plantlets were treated with 0, 1, 2, and 3 g.L-1 of colchicine. The colchicine solution was previously filter-sterilized with a 0.22μ M-pore size filter before treating 20 hybrid plantlets with each concentration. The colchicine was dropped on an apical bud of the plantlets in a laminar flow hood using an aseptic technique before opening and closing the cultured bottle. All colchicine concentrations were dropped every hour from 8:00–12:00 am. This process was repeated once on the following day. Then the plantlets were cultured at 25°C under 16 h fluorescent light (55 μmol m-2 s-1). After shoots were regenerated from the colchicine treated bud, a young leaf was used to determine ploidy level by a flow cytometer following the steps modified from Gu et al., (2005). The regenerated leaves from colchicine-treated shoots and the control group (untreated shoots) were prepared and kept on ice before analysis. The leaves were put in an extraction buffer (solution A of the High Resolution Kit for plant DNA) and chopped into pieces about 0.5 cm2 using a razor blade. The solution was filtered through a Partec 50 mM Cell Trics disposable filter into a test tube and added with 1.6 mL staining buffer. The samples were incubated for 30 to 60 s before analysis. Ploidy analysis was performed with a flow cytometer.

Results and Discussion Interspecific hybridization.Interspecific hybridization was attempted between V. radiata and V. umbellata. Out of 574 crosses, 162 crossed pods (28.2%) were obtained specifically whenV. radiata was used as the female parent. The F1 seeds were small in size and shrivelled (Figure 1) due to the poor development of the embryo and endosperm which is the effect of incompatibility between the two parental genomes (Chen et al., 1983; Gopinathan et al., 1985). After planting, none of the F1 seeds germinated in the field. In contrast to the reciprocal cross using V. umbellata as the female parent, the pollinated pods dropped off a few days after pollination. This phenomenon is caused by pre-fertilization barriers that obstruct the fertilization between pollen grains and eggs. The study on interspecific hybridization between rice bean and wild relative species by Gopinathan et al., (1985) revealed that pollen tube germination of the male parent was delayed in the style when the rice bean was used as a female parent. Then the ovary senesced and the flower abscised before fertilization. Although mungbean and rice bean are both grouped into the subgenus Ceratotropis (Asian Vigna) of the genus Vigna, they belong to different sections. Mungbean is in the section Ceratotropis while the rice bean is in the section Angulares (Tomooka et al., 2002). The two sections are distantly related both morphologically and genetically. On the basis of sexual compatibility, hybrid fertility and chromosome pairing are abnormal because V. Bioresources for food 63 radiata and V. umbellata genomes partially lack in chromosomal homology (Chen et al., 1983). The genome difference contributed mainly to hybrid breakdown. However, Singh et al., (2003) claimed that they successfully transferred yellow mosaic virus resistance from rice bean to mungbean. Pandiyan et al., (2010) reported that they were able to produce hybrids from V. umbellata x V. radiata. Although giving no detail, they noted that the interspecific hybrid can produce viable F2 progenies. Embryo rescue and verification of hybrids. The putative interspecific hybrids between V. radiata and V. umbellata from this study were successfully rescued from the 12-day-old embryos by an immature seed culture, while immature seeds at 6, 8, 10, and 14 days old did not germinate. Out of 80 immature seeds cultured

Figure 1. Seeds of mungbean cv. “Kamphaeng Saen 2” (A), rice bean cv. “Miyazaki” (B), and their F1 hybrid (C). on the synthetic medium, four embryos (5%) germinated and developed into seedlings. All seedlings were pale-green in color and weak. They had a thick stem and developed slowly at the seedling stage (Figure 2), but grew normally at later stages. The success in rescuing 12-day-old embryos was due to the optimum age of the embryos. Sharma et al., (1996) stated that the success in embryo rescue depends on embryo age, culture medium, genotype of embryo, and concentration of the plant growth regulators. Since only four putative hybrid embryos were successfully rescued in this study, it indicated that the synthetic medium and PGR used in this study were not suitable to rescue the hybrid. Yet, the young putative hybrid plants obtained were pale green in color. To verify the putative interspecific hybrids, 40 RAPD primers were screened on the V. radiata and V. umbellata, and five primers (A13, Ax17, A02, A03, and A07) showed polymorphism between the Vigna species. After the hybrids were verified using the five primers, DNA fingerprints of the primers A13 and Ax17 showed distinct female and male parent specific markers (Figure 3). Thus, the 64 Proceedings ASIAHORCS 2013

Figure 2. An interspecific hybrid seedling between mungbean cv. “Kamphaeng Saen 2” and rice bean cv. “Miyazaki” germinated on an MS medium.

Figure 3. DNA fingerprints of male parent (rice bean), female parent (mungbean), and their F1 hybrids (H1, H2, H3, and H4) generated by primer A13 (A) and Ax17 (B). Arrows indicate male and female parent-specific markers.

two RAPD primers confirm that the putative hybrids were true interspecific hybrids from the cross between V. radiata and V. umbellata. RAPD can amplify male and female specific markers and can be utilized as a dependable and less time consuming verification of hybrids (Ali et al., 2008; Ballester and Vicente 1998; Benedetti et al., 2000; Liu et al., 2007). Propagation of the hybrid plantlets by in vitro culture. To multiply the four hybrids obtained, shoot tips of the seedlings were cultured on B5 medium supplemented with 2 mg.L-1 IBA. Shoots and roots were successfully regenerated from the sample a week after culturing. The regenerated shoot was developed from the terminal shoot-bud, one shoot per shoot tip, while regenerated roots emerged from the excised end of the sample. Two weeks after culturing, the regenerated roots and the basal end formed into calluses, thus the plantlets became abnormal Bioresources for food 65 and could not be transplanted (Figure 4A). This implied that the culture medium was supplemented with too high of a concentration of IBA (Walender, 2006). In the following round of subculture, the plantlets were cultured on B5 medium without PGR and B5 medium supplemented with 2 mg L-1 IBA to compare the formation of calluses on regenerated roots. The result revealed that the plantlets grown on the medium supplemented with PGR formed regenerated roots faster than those on non-supplemented medium. However, roots of the hybrids on the medium without PGR were better developed without callus formation (Figure 4B). Subsequently, B5 medium was without PGR was used to multiply plantlets of the hybrid. Upon transplanting to a greenhouse, these hybrid plants developed into mature plants and reached their reproductive stage. They produced flowers profusely but failed to set pods. Their pollen grains were cultured on Brewbaker and Kwak (BK) medium following the modified method of Sato et al., (1998) while none of them germinated. This result indicated that sterility of the hybrid plants was due to the lack of pollen germinability. Some pollen grains of the hybrid developed abnormally during meiotic division and consequently were sterile (Bonato et al., 2004). Colchicine treatment and flow cytometry analysis.Effect of colchicine on the germination of the shoot tip was assessed 2 weeks after treatment. Branches and leaves of the hybrid plants became yellow and fell off due to the stress of colchicine poisoning (Gmitter et al., 1991). The colchicines concentration at 3 g.L-1 had the most pronounced effect. New shoots were generated from the treated bud after 3 weeks but grew rather slowly. The slow development of the shoots may also be a result of the colchicine stress, causing a slow rate of cell division (Roy et al., 2001). However, all colchicine-treated plantlets in cultured bottles in our study survived and showed similar morphology to the untreated explants.

Figure 4. Root regeneration of interspecific hybrid seedlings on B5 medium supplemented with 2 mg L-1 IBA (A) and B5 medium without plant growth regulator (B). 66 Proceedings ASIAHORCS 2013

Flow cytometric analysis (FCM) was applied to detect ploidy level of the colchicine-treated hybrid plantlets, and three types of histograms were observed as shown in Figure 5. The control treatment with 2x (diploid) DNA was used as a standard to determine the ploidy level of the other samples (Figure 5A). The peak of the tetraploid samples was twice as high as the control group (Figure 5B). Moreover, some samples showed a fluorescence peak between 2x and 4x, indicating that they were incomplete tetraploid (Figure 5C). After young leaves of regenerated shoots were analysed by FCM, the result showed that three out of 20 (15%) seedlings treated with colchicine at the concentration level of 2 g.L-1 changed from diploid (2x) to tetraploid (4x) (Table 1). The concentration of 1 g.L-1 showed incomplete tetraploid, while the concentration of 3 g.L-1 did not increase the ploidylevel of the hybrid. Based on the results, the success in increasing the ploidy level by colchicine treatment in this study was due mainly to the concentration of colchicine similar to the early reports of Gmitter et al., (1991) and Gu et al., (2005). A colchicine concentration of 2 g.L-1 is the most suitable to block the formation of spindle fiber and to disturb the normal polar segregation of sister chromatids of the hybrid cells, which finally leads to an increase in ploidy levels (Redha et al., 1998). Colchicine at 1 g.L-1 could double some of the hybrid chromosomes but not the whole genome. The colchicine concentration at 3 g.L-1 failed to increase ploidy level of the hybrid chromosomes due to toxicity in the development of the hybrid cells (Saikat et al., 2011; Xiao and Xiang, 2011). The regenerated shoots from this treatment might also have come from escaped cells. When the tetraploid hybrid plants were transplanted into a greenhouse, they produced flowers and set pods normally. Application of the interspecific hybrids. This man-made tetraploid can be further selected to obtain a new cultivar and probably establish a new species. The new plants can also be used to improve the creole bean (V. glabrescens), the only tetraploid Vigna cultivated by farmers in certain areas in Papua New-Guinea, the Philippines, and Vietnam. There has been no breeding project to improve the creole bean so far, due mainly to limited genetic variability of this crop. The creole bean is a natural allotetraploid Vigna species (2n = 4x), which is resistant to some mungbean pests and diseases. Due to low genetic variability in the creole bean, an interspecific hybridization betweenV. radiata and V. grablescens was performed to create a source of genetic variation for the breeding program of this crop (Chen et al., 1989). However, the interspecific hybridization was not successful due to meiotic irregularities. Tomoka et al., (2002) reviewed a study on interspecific crossing amongV. radiata, V. umbellata, and V. reflexo-pilosa(a wild form of V. glabrescens) and reported that chromosomes of the hybrids between V. Bioresources for food 67

Figure 5. Flow cytometry histrograms of nuclei isolated from young leaves of colchicine treated explants. Diploid (A), tetraploid (B), and incomplete tetraploid plants (C) were identified in this study.

Table 1. Effect of colchicine in induction of ploidy level of F1 hybrids from the cross between the mungbean and rice bean

a Colchicine concentration No. of F1 plants Ploidy level (% w/v) Diploid (%) Incomplete Tetraploid (%) tetraploid (%) 0 20 20 (100) 0 0 0.1 20 17 (85) 3 (15) 0 0.2 20 17 (85) 0 3 (15) 0.3 20 20 (100) 0 0 radiata and V. reflexo-pilosashowed very low bivalent formation during meiosis cell division. Interestingly, hybrids between V. umbellata and V. reflexo-pilosaformed 11 bivalents during meiosis. Thus, V. umbellata is a potential bridge species for an interspecific hybridization betweenV. radiata and V. grablescens for the creole bean breeding program in the future.

Conclusions Although interspecific hybridization among related species is frequently used to create a wide genetic variation for breeding programs, there are many post fertilization barriers interfering with the reproduction of the valuable population, such as seed abortion and sterility problems. In this study, immature seed culture was applied to rescue the interspecific embryos. Even though a few seeds were successfully rescued, the number of hybrid seedlings could be further increased by in vitro culture. Moreover, colchicine treatment was successfully used in increasing ploidy level of the hybrid and overcame the hybrid sterility problem. Some tetraploidlines could be selected and used in a creole bean breeding program. 68 Proceedings ASIAHORCS 2013

Acknowledgement This research was supported by the Center of Excellence on Agricultural Biotechnology, Science and Technology Postgraduate Education and Research Development Office, Office of Higher Education Commission, Ministry of Education (AG-BIO/PERDO-CHE). We also acknowledge the financial supports from the Thailand Research Fund (TRF) and Thailand’s National Science and Technology Development Agency.

References Ali, M. A., Seyal, M. T., Awan, S. I., Niaz, S., Ali, S., & Amjad, A. (2008). Hybrid authentication in upland cotton through RAPD analysis. Aust. J. Crop Sci,. 2, 141–149. Anju, G., Jaiwal, P. K. (1992). In vitro induction of multiple shoots and plant regeneration from shoot tips of mungbean (Vigna radiata (L.) Wilczek). Plant Cell Rep., 29, 199–205. Anju, G., & Jaiwal, P.(1994). Plant regeneration from cotyledonary node explants of mungbean (Vigna radiata (L.) Wilczek). Plant Cell Rep., 3, 523–527. Avenido, R. A., Hautea, D. M., Mendoza, C. J., Carandang, S. L. (1991). Clonal propagation of F1 hybrids of mungbean (Vigna radiata L. Wilczek) x blackgram (V. mungo L. Hepper) by tissue culture. Philipp. J. Crop Sci., 16, 63–67. Ballester, J., Vicente, M. C. (1998). Determination of F1 hybrid seed purity in pepper using PCR-based markers. Euphytica, 103, 223–226. Benedetti, L. D., Burchi, G., Mercuri, A., Pecchioni, N., Facciolo, P., & Schiva, T. (2000). Random amplified polymorphic DNA (RAPD) analysis for the verification of hybridity crosses of Alstroemeria. Plant Breed, 119, 443–445. Bonato, A. B. M., Pagliarini, M. S., Valle, C. B. D., & Jank, L. (2004). Abnormal pollen mitoses (PM I and PM II) in an interspecific hybrid of Brachiaria ruziziensis and Brachiaria decumbens (Gramineae). J. Gen., 83, 279–283. Chen, N. E., Baker, L. R, & Honma, S. (1983). Interspecific crossability among four species of Vigna food legumes. Euphytica, 32, 925–937. Chen, H. K., Mok, M.C., Shanmugasundaram, S., & Mok, D. W. S. (1989). Interspecific hybridization between Vigna radiate (L.) Wilczek and V. glabrescens. Theor. Appl. Genet., 78, 641–647. Glowacka, K., Jezowski, S., & Kaczmarek, Z. (2009). Polyploidization of Miscanthus sinensis and Miscanthus x giganteus by plant colchicine treatment. Ind. Crops Prod., 30, 444–446. Glowacka, K., Jezowski, S., & Kaczmarek, Z. (2010). In vitro induction of polyploidy by colchicine treatment of shoots and preliminary characterisation of induced polyploids in two Miscanthus species. Ind. Crops Prod., 32, 88–96. Gmitter, F. G., Ling, J. R. X., Cai, C., & Grosser, J. W. (1991). Colchicine induce polyploid in citrus embryogenic culture, somatic embryo and regenerate plantlets. Plant Sci., 74, 135–141. Gopinathan, M. C., Babu, C. R., & Shivanna, K. R. (1985). Interspecific hybridization between rice bean (Vigna umbellata) and its wild relative (V. minima): Fertility-sterility relationships. Euphytica, 35, 1017–1022. Bioresources for food 69

Gu, X. F., Yang, A. F., Meng, H., & Zhang, J. R. (2005). In vitro induction of tetraploid plants from diploid Zizyphus jujube Mill. cv. Zhan hua. Plant Cell Rep., 24, 617–676. Hamill, S. D, Smith, M. K, & Dodd, W. A. (1992). In vitro induction of banana autotetraploids by colchicine treatment of micropropagated diploids. Aust. J. Bot., 40, 887–896. Hansen, N. J. P., & Andersen, S. B. (1998). In vitro chromosome doubling with colchicine during microspore culture in wheat (Triticum aestivum L.). Euphytica, 102, 101–108. Ida, A. A., Plummer, J. A., Lancaster, R. A.,& Yan, G. (2004). Fingerprinting of cauliflower cultivars using RAPD markers. Aust. J. Agric. Res., 55, 117–124. Khattak, G. S. S, Haq, M. A, Rana, S. A, Elahi, T., & Srinives, P. (1998). An efficient technique for crossing mungbean (Vigna radiata) (L.) Wilczek). Thai J. Agri. Sci., 31, 577–582. Liu, L., Liu, G., & Gong, Y. (2007). Evaluation of genetic purity of F1hybrid seeds in cabbage with RAPD, ISSR, SRAP, and SSR markers. Hort. Sci., 42, 724–727. Miyashita, C., Ishikawa, S., & Mii, M. (2009). In vitro induction of the amphiploid in interspecific hybrid of blueberry (Vaccinium corymbosum x Vaccinium ashei) with colchicine treatment. Scientia Hort., 122, 375–379. Nanda Kumar P. B. A, & Shivanna, K. R. (1991). In vitro multiplication of a sterile interspecific hybrid, Brassica fruticulosa x B. campestris. Plant Cell Tiss. Org. Cult., 26, 17–22. Notsuka, K., Tsuru, T., & Shiraishi, M. (2000). Induced polyploidy grapes via in vitro chromosome doubling. J. Jpn. Soc. Hort. Sci., 69, 543–551. Pandiyan, M., Senthil, S., Ramamoorthi, N., & Jayaraj, T. (2010). Interspecific hybridization of Vigna radiata x 13 wild Vigna species. Electron. J. Plant Breed., 1, 600–610. Redha, A., Attia, T., Buter, B., Saisingtong, S., Stamp, P., & Schmid, J. E. (1998). Improved production of doubled haploids by colchicine application to wheat (Triticum aestivum L.) anther culture. Plant Cell Rep., 17, 974–979. Roy, A. T., Leggett, G., & Koutoulis, A. (2001). In vitro tetraploid induction of tetraploids from mixoploids in hop (Humulus lupulus L.). Plant Cell Rep., 20, 489–495. Saikat, G., Nirmal, M., Somnath, B., & Prakash, K. D. (2011). Induction and identification of tetraploids using in vitro colchicine treatment of Gerbera jamesonii Bolus cv. Sciella. Plant Cell Tiss. Organ Cult., 106, 485–493. Sato, S., Katoh, N., Iwai, S., & Hagimori, M. (1998). Establishment of reliable methods of in vitro pollen germination and pollen preservation of Brassica rapa (syn. B. campestris). Euphytica, 103, 29–33. Sharma, D. R., Kaur, R., & Kumar, K. (1996). Embryo rescue in plants - a review. Euphytica, 89, 325–337. Singh, K. P, Sareen, M., Ashwini, P. K., & Kumar, A. (2003). Interspecific hybridization studies in V. radiata (L.) Wilczek and Vigna umbellata. Nat. J. Plant Improv., 3, 16–18. Song, P., Kang, W., & Peffley, E. B. (1997). Chromosome doubling ofAllium fistulosumx A. cepa interspecific F1 hybrids through colchicine treatment of regenerating callus. Euphytica, 93, 257–262. Tomooka, N., Vaughan, D. A., Moss, H., & Maxted, N. (2002). The Asian Vigna: Genus Vigna subgenus Ceratotropis genetic resources, pp. 270. Netherlands: Kluwer Academic. 70 Proceedings ASIAHORCS 2013

Walender, M. (2006). In vitro rooting of the apple rootstock M 26 in adult and juvenile growth phases and acclimatization of the plantlets. Physiol. Plantarum., 58, 231–238. Wu, J. H., Ferguson, A. R., Murray, B. G., Jia, Y., Datson, P. M., & Zhang, J. (2012). Induced polyploidy dramatically increases the size and alters the shape of fruit in Actinidia chinensis. Ann. Bot., 109, 169–179. Xiao, C., & Xiang, Y. K. (2011). In vitro tetraploid induction from leaf explants of Populus pseudo-simonii Kitag. Plant Cell Rep., 30, 1771–1778. Yahata, S., Sato, S., Ohara, H., & Matsui, H. (2004). Induction of tetraploid in loquat with amiprofos-methyl and colchicine. Hort. Res. (Japan), 3, 339–344. Yang, X. M, Cao, Z. Y, An, L. Z., Wang, Y. M., & Fang, X. W. (2006). In vitro tetraploid induction via colchicine treatment from diploid somatic embryos in grapevine (Vitis vinifera L.). Euphytica, 152, 217–224. REsistant Starch Formation of Rice from Different Varieties Worawikunya Kiatponglarp1, Sunanta Tongta1,) and Alain Buléon2 1)School of Food Technology, Institute of Agricultural Technology, Suranaree University of Technology, 2)INRA, UR1268, UnitéBiopolymères Interactions et Assemblages, 44300 Nantes, France Abstract Resistant starch (RS) type III, formation from four rice varieties: waxy rice (RD6, 0.0% amylose), low-amylose rice (PS1, 12.6% amylose), intermediate-amylose rice (PS2, 25.6% amylose) and high-amylose rice (CN1, 30% amylose) was studied. Rice starches were debranched with isoamylase at low (10% w/v) and high (21% w/v) solid concentration. The resulting linear glucans were incubated at 25°C for 3 days. The debranched PS2 and CN1 had a higher proportion of long chains than that of PS1 and RD6, resulting in a higher RS content when prepared at low solids concentration. However, the RS contents of debranched PS1 and RD6 were not different when prepared at high solid concentration. The X-ray diffraction pattern of incubated product from debranched CN1 displayed a CB+Vh type, whereas the debranched PS1 and PS2 exhibited a CB-type pattern. All incubated products of debranched PS1, PS2 and CN1 showed a biphasic endotherm at the melting temperature of 84–88°C and 104–112°C, corresponding with chain distribution. The incubated product of CN1 contained a higher RS content (39.2%) that could be a good source of starting material to produce resistant starch with this preparation method. Keywords: resistant starch, debranching, rice starch, rice variety

*Corresponding Author NakhonRatchasima, 30000, Thailand, E-mail: [email protected]

Introduction Starch is digested predominantly in the small intestine by digestive enzymes. A portion of starch, known as resistant starch (RS), resists enzymatic hydrolysis in the small intestine but is fermented by the colonic microflora. Consequently, RS provides many benefits to human health. RS reduces the glycemic and insulin responses and reduces the risk for developing type II diabetes, obesity, and cardiovascular disease. RS also reduces calorie content of foods and enhances lipid oxidation, which reduce body fat and impact body composition. Additionally, fermentation of RS in the colon promotes a healthy colon and reduces the risk of colon cancer (Annison and Topping, 1994). RS is classified into five types. The type I RS is the physically inaccessible starch; type II RS is native granular starch; type III RS is the retrograded amylose; type IV RS is chemically modified starch; type V RS is amylose-lipid complex starch. The type III RS is of particular interest because of its thermal stability and remains after normal cooking (Kim et al., 2010).

71 72 Proceedings ASIAHORCS 2013

The production of type III RS usually involves gelatinization, acid or enzymatic hydrolysis, retrogradation and hydrothermal treatments. Different processing method and conditions can influence the formation and properties of RS. The degree of formation of RS is also influenced by amylose content, chain length, duration and storage conditions (Haralampu, 2000). It has been reported that, after debranching, the linear chain can contribute to a high RS content due to more opportunity of released chains to align and aggregate to form perfectly crystalline structures (Mutungi et al., 2009). Most research on RS has focused on starches from wheat, maize, potatoes, peas, waxy maize and amylomaize. A limited report is available on RS formation of starches derived from crops indigenous to the tropical regions, including rice starch. Therefore, the aim of this study was to investigate the formation and physicochemical properties of RS from different debranched rice starches.

Materials and Methods Materials Rice starch in four rice variety; waxy rice (WxRD6, 0.0% amylose), low-amylose rice (PS1, containing 12.6% amylose intermediate-amylose rice (PS2, 25.6% amylose) and high-amylose rice cultivars (CN1, 30% amylose) was obtained from Bureau of Rice Research and Development (BRRD, Thailand). Isoamylase (EC 3.2.1.68) and resistant starch assay kit (K-RSTAR: lot 111105-1) were purchased from Megazyme International Ireland Limited, Ireland. Preparation of resistant starch by debranching and retrogradation. Starch

slurry (10% or 21% w/v) in 0.05 M acetate buffer, pH 4.5 with 0.1% NaN3) was gelatinized in shaking water bath over multi-step process, including heating at 60°C for 10 min, 85°C for 20 min and finally 99°C for 1 h. The temperature of sample was adjusted to 50°C thereafter, debranched by isoamylase (5 unit/g dry starch) at 50°C for 24 h with glass bead shaking. The solutions were stored at 25°C for 3 days to form retrograded starch. The precipitated starch was air dried at room temperature until weight constant. All samples were ground and screened through 120 mesh sieve. Each experiment was conducted in duplicate.

Structure of debranched starch. Starch was debranched as described above. After 24 hours of debranching, 1 mL were sampled and mixed with 3 mL of 95% DMSO and then heated at 90°C for 15 min in order to inactivated the enzyme and homogenized the sample. The homogenized solutions were determined reducing sugar (Somogyi, 1952) and total carbohydrate (Cuesta et al., 2003) to calculated the degree of hydrolysis (DH). The debranched starches were analyzed ß-amylolysis limit (Mutungi et al., 2009). The residual debranched starches were Bioresources for food 73 rapidly frozen using liquid nitrogen and kept at -40°C before freeze-drying. The molecular size distribution of debranched starches were analyzed using high pressure size exclusion chromatograph with multiple angle laser light scattering detection (HPSEC/MALSS). The freeze-dried debranched starches (50 mg) were solubilized in 1M KOH (500mL) for 2 days at 4°C under gentle magnetic stirring and subsequently diluted with 4.5 mL of DI water. Then, an aliquot was injected into HPSEC/MALLS. The equipment was the same as previously described (Pohu et al., 2004). Resistant starch determination. Resistant starch content was determined by a Megazyme Resistant Starch Assay Kit (AOAC method 2002.02). Wide angle X-ray diffraction.X-ray diffraction was performed on the samples after adjustment of water content to 20% moisture by water phase sorption at 90% of relative humidity. Diffraction diagram were recorded on a BRUKERTM a l (Karlsruhe, Germany) D8 Discover diffractometer with Cu K 1 radiation ( Cu Ka = 1.5405 Å) at 40 kV and 40 mA. The relative crystallinity was determined after normalization of all recorded diagrams at the same integrated scattering between 3 and 35 (2Ø). The degree of crystallinity was estimated by the ratio of crystalline peak area to the total crystalline area (Frost et al., 2009). Differential scanning calorimetry. The sample suspension was prepared in water (25% solid) and sealed in a stainless steel DSC pan 60 mL. The sample was analyzed with a TA Q100 (TA Instruments, New Castles, DE, USA) equipped with intracooler. The Millipore water was used as a reference. Sample was heated from 10°C to 200°C at 3°C/min. Scanning electron microscopy (SEM). A thin layer of sample was placed on aluminum stubs with conductive carbon tape and sputter coated with gold- palladium by using a JEOL JFC-1100 Fine Coater Ion Sputter coater (Tokyo, Japan). The sample was observed using a JEOL JSM-5800LV scanning electron microscope (Tokyo, Japan) operating at an accelerating voltage of 20 kV. Statistical analysis. The data were analyzed using SPSS version 15.0 for windows evaluation version software (SPSS Institute Inc., Cary, NC, USA). The differences between the mean values were analyzed by one-way analysis of variance (ANOVA) at the 5% significant level with Duncan’s multiple range test.

Results and Discussion Structural characteristics of debranched starch. The normalized, molecular-size distributions of debranched starches are displayed in Figure 1. The proportions and correspondings DP are listed in Table 1. Amylose was eluted first before 16.5 ml (Fr. I), followed by amylopectin long unit chain (Fr. II) and amylopectin short 74 Proceedings ASIAHORCS 2013

unit chain (Fr. III). It was found that the amylose content of PS2 was not correlated with the proportion of Fr. I probably due to super-long chain component possessed in amylopectin of PS2 rice that eluted at the same position as amylose (Koroteeva et al., 2007). Although debranched WxRD6 had a higher proportion of low MW (Fr.II and III) than that of PS1, CN1 and PS2, respectively, all debranched starches showed a similar DP of Fr. II and Fr. III. In addition, polydispersity of Fr.II and Fr.III was similar in all debranched starches, indicating a similar structural of low MW fraction in all samples. Debranched PS2 and CN1 had a higher proportion of high MW (Fr. I) than PS1, but the chain lenght (DP) of Fr.I of debranched PS2 was shorter than that of CN1 and PS1.

Figure 1. Molecular weight distribution of debranched rice starches from different varieties of WxRD6, PS1, PS2 and CN1 as determined by HPSEC/MALLS.

Table 1. Chain length distribution of debranched rice starches WxRD6 PS1 PS2 CN1 parameter Fr. II Fr. III Fr. I Fr. II Fr. III Fr. I Fr. II Fr. III Fr. I Fr. II Fr. III AL content (%)a 0 12.6 25.6 30 Area (%) 22 78 15 20 65 28 18 54 27 17 56 b DPmax 54 20 2011 55 20 1422 58 20 1781 56 20 P c 1.2 1.2 2.4 1.2 1.2 2.1 1.2 1.2 2.3 1.2 1.2

a The amylose content was determined by CLI method,b DP = the degree of polymerization at the peak; cP = polydispersity index Bioresources for food 75

The DH of all starch debranched at 10% solid concentration was 4.2–5.0% and b-amylolysis limit was about 98–99%. It was the same value for 21% solid debranched WxRD6, indicating the whole debranched starch molecules were linear. Nevertheless, 3.7% DH and 79.7% b-amylolysis limit values were found in 21% debranched PS1, reflecting the incompletely debranching and amylopectin side branched molecules which were still presented in the sample. Resistant starch content. Table 2 summarizes the content of resistant starch (RS) of debranched starches after each step of production (after debranching, following by retrogradation and further drying). The RS content in all debranched starches increased after retrogradation, as expected, due to the fact that the retrogradation at room temperature would promoted nucleation and enhanced RS formation (Shi and Gao, 2011). The RS content of retrograded-debranched starch was slightly increased after drying process, indicating the air-drying process had a little effect on the RS formation. Among the six dried-incubated products, the product from 10% PS2 had a high RS content (39.2 g/100 g). This result was consistent with higher proportion of high MW in the chain length distribution data, indicating that the formation of long chain double helical crsytallites were more resistant to enzyme digestion. Comparing the RS content of WxRD6 and PS1 prepared at 10% and 21% solid concentration reveals an interesting result. All four samples were not significantly different in the RS content. This result suggested that the solid concentration had no effect on RS formation under this experiment condition. In order to obtain RS product with high yield, high starch concentration is preferred because they facilitate drying and recovery of the product (Shi et al., 2005). However, the starches containing high amylose were not suitable for debranching at a high solid concentration due to the fact that a high strength gel from higher amylose content would limit enzyme diffusion and accessibility to substrate, leading to low level of hydrolysis and RS formation.

Table 2. Resistant starch content (g/100 g) of debranched rice starches as determined after each step of production Sample debranching retrogradation Air drying 10% WxRD6 0.91a 17.36a 27.1a 21% WxRD6 3.23b 25.88b 27.85a 10% PS1 11.83c 28.01c 30.20a 21% PS1 14.30c 24.51b 27.65a 10% PS2 28.01e 36.06c 39.2c 10% CN1 22.22d 36.49c 36.4b

Mean values with different letters within each column are significantly different (P<0.05) 76 Proceedings ASIAHORCS 2013

Crystalline structure. The X-ray diffraction pattern and their corresponding crystalline type and crystallinity of dried-incubated products are presented in Figure 2 and Table 3. All incubated products exhibited a stronger peak at 2q of 5.6° and 17.8° (marked as an arrow), which are a characteristic peak of B-type crystalline structure. Besides the B-type structure, an additional peak at 2q of 19.8° was observed in all incubated sample, which is typical to Vh-type structure. Moreover, the shoulder at 2q of 17.8° is showed in 10% CN1, 21% PSL1, 10% PSL1 and 21% PSL1 indicating that A-type crystals co-existed in these samples. The present of A-type crystalline was attributed to the crystallization of short linear chain at high temperature during debranching (Pohu et al., 2004). This result is in agreement with the general rule in that crystallization at low temperature favors the formation of B-type crystallites, whereas high temperature and high concentration of short chain length induces the A-type crystallization. In this study, it was found that the relative crystallinity was not correlated with the RS content (Table 3). The B-type crystallites of 10% PS2 had higher RS content than A+B type crystallites of 10% CN1, 10% PS1, 21% PS1 and 21% WxRD6, while 10% WxRD6 with B-type structure showed the lowest RS content. These results suggested that the content of RS was not depending on the amount of crystallinity or crystal types. Other factors such as morphology, crystal defects, crystal size, and the orientation of the crystallites should be considered for their ability to resist the enzyme digestibility.

Figure 2. X-ray diffraction patterns of dried-incubated products from different debranched rice starches Bioresources for food 77

Table 3 crystal types, crystallinity and lateral crystal size of RS products sample Crystal types Crystallinity (%) 10%WxRD6 B+Vh 60.3a

21%WxRD6 CB+Vh 73.1c

10%PSL1 CB+Vh 67.5b

21%PSL1 CB+Vh 69.1bc 10%PSL2 B+ Vh 67.0b

10%CN1 CB+Vh 61.2a Mean values with different letters within each column are significantly different (P<0.05)

Thermal properties. The thermal properties of dried-incubated products are shown in Table 4. The 10% WxRD6 showed a single endotherm with a broad endothermic peak at 83.5°C. Compared to 10% WxRD6, the transition temperatures (To and TP) of 21% WxRD6 were decreased. The effects of solid concentration on the transition temperatures (To, TP1 and TP2) were observed in the same trend in the dried-incubated product from PSL1. This result suggested that higher concentration led to lower melting temperature and higher crystallization rate could favor smaller crystals. The dried-incubated products from debranched starches containing long linear chain fraction, which are 10% PSL1, 21% PSL1, 10% PSL2 and 10% CN1, exhibited a very broad biphasic endotherms with main endothermic peaks occurring around 84–88°C and 104–112°C. The biphasic and the broad transition endotherm indicated crystalline inhomogeneity, consistent with crystallites of varying molecular stabilities. This result was consistent with the chain length distribution present in Figure 1. Therefore, the Tp1 could be associated with the melting of short-chains double helical structure. A lack of critical dimension is necessary to form three-dimensional structure resulting in weak crystal. The Tp2 might represent melting of crystallites formed by longer chains, which are heat stable fraction. In this study, the retrogradation of starch containing high amylose is more effective than waxy starch for formation RS in terms of high thermal stability.

Table 4 Thermal properties of dried-incubated products from different debranched rice starches sample D D To (°C) Tp1 (°C) Tp2 (°C) T (°C) H (J/g) 10%WxRD6 58.8 83.5 - 40.6 24.5 21%WxRD6 55.5 77.4 - 37.0 26.4 10%PSL1 51.7 88.1 112.1 71.4 35.5 21%PSL1 47.1 84.1 107.9 79.3 34.9 10%PSL2 33.6 88.8 104.8 84.4 33.5 10%CN1 36.1 87.1 112.1 82.5 29.9

A The ratio of sample (dry basis) and water was 1:4. 78 Proceedings ASIAHORCS 2013

Conclusions The debranched starch with high enzyme resistance and high thermostable can be obtained when crystallisation occur over sufficiently long linear of the polymer chains. Therefore, if conditions are created where crystallisation is favoured, and if the starch contains high concentrations of polymer molecules with sufficiently long chains available for double helix formation, high levels of thermostable resistant starch may be expected. The complete debranching process can be conducted at low solid concentration and it is more effective to produce product with high yield of resistant starch.

Acknowledgement This work was funded by Thailand Research Fund through the Royal Golden Jubilee (RGJ) Ph.D. Program and Suranaree University of Technology. The authors are grateful to B. Pontoire, A. Sabate, S. Guilois and M. de Carvalho for technical assistance.

References Annison, G., & Topping, D. L. (1994). Nutritional role of resistant starch: chemical structure vs physiological function. Annual Review of Nutrition, 14, 297–320. Cuesta, G., Suarez, N., Bessio, M. I., Ferreira, F., & Massaldi, H. (2003). Quantitative determination of pneumococcal capsular polysaccharide serotype 14 using a modification of phenol–sulfuric acid method. Journal of Microbiological Methods, 52, 69–73. Frost, K., Kaminski, D., Kirwan, G., Lascaris, E., & Shanks, R. (2009). Crystallinity and structure of starch using wide angle X-ray scattering. Carbohydrate polymers, 78, 543–548. Haralampu, S.G. (2000). Resistant starch-a review of the physical properties and biological impact of RS3. Carbohydr. Polym., 41: 285–292. Kim, N. H., Kim, J. H., Lee, S., Lee, H., Yoon, J. W., Wang, R., & Yoo, S. H. (2010). Combined effect of autoclaving‐cooling and cross‐linking treatments of normal corn starch on the resistant starch formation and physicochemical properties. Starch‐Stärke, 62, 358–363. Koroteeva, D. A., Kiseleva, V. I., Sriroth, K., Piyachomkwan, K., Bertoft, E., Yuryev, P. V., & Yuryev, V. P. (2007). Structural and thermodynamic properties of rice starches with different genetic background: Part 1. Differentiation of amylopectin and amylose defects. International journal of biological macromolecules, 41, 391–403. McCleary, B. V., & Monaghan, D. A. (2002). Measurement of resistant starch. Journal of AOAC international, 85, 665–675. Mutungi, C., Onyango, C., Jaros, D., Henle, T., & Rohm, H. (2009). Determination of optimum conditions for enzymatic debranching of cassava starch and synthesis of resistant starch type III using central composite rotatable design. Starch‐Stärke, 61, 367–376. Bioresources for food 79

Pohu, A., Planchot, V., Putaux, J., Colonna, P., & Buleon, A. (2004). Split crystallization during debranching of maltodextrins at high concentration by isoamylase. Biomacromolecules, 5, 1792–1798. Shi, M. M., & Gao, Q. Y. (2011). Physicochemical properties, structure and in vitro digestion of resistant starch from waxy rice starch. Carbohydrate Polymers, 84, 1151–1157. Shi, Y. C., Cui, X., Birkett, A. M., & Thatcher, M. G. (2005). Slowly digestible starch product. Google Patents. Somogyi, M. (1952). Notes on sugar determination. Journal of Biological Chemistry, 195, 19–23.

Short Communication of Oral Presentations

The Red Algae Sugar Platform for the Utilization of Marine Bioresources

Kyoung Heon Kim1,2*, Eun Ju Yun1,2 1Department of Food Bioscience & Technology, Korea University 2Department of Biotechnology, Korea University Graduate School Seoul 136-713, Korea

Abstract Algae are considered as the third generation biomass for producing fuels and chemicals due to their advantages compared to lignocellulose as the second generation biomass. Lately, marine macroalgae are receiving much attention since they contain large amounts of carbohydrates that can be used to produce fermentable sugar for producing fuels and chemicals. In particular, ~80% of red macroalage (Rhodophyta) is composed of carbohydrates, and ~60% of their carbohydrate is agarose. Agarose is a linear form of polysaccharide consisting of D-galactose and 3,6-anhydro-L-galactose (L-AHG) in a 1:1 ratio. Although agarose is a valuable source of fermentable sugar for producing fuels and chemicals, enzymes and saccharification processes to depolymerize agarose into monomeric sugars have not been well established yet. In this talk, the recent developments in enzyme-based saccharification of agarose and the necessary novel enzymes are presented in the context of the red algae sugar platform. Also, the novel health-benefiting functions of in-house produced and purified L-AHG are introduced. This study demonstrates that marine algae have high potential to be used as a biomass feedstock for producing not only commodity products, but also high value functional food and cosmetic materials for health.

Keywords: Red algae, Rhodophyta, carbohydrate, Agarose, 6-anhydro-L-galactose

*Corresponding Author Seoul 136–713, Korea

Macroalgae (red, brown and green algae) are primarily composed of polysaccharides. Recently, these are considered as biomass feedstock for the production of fuels (Goh and Lee, 2010; Park et al., 2012). The major cell wall component of red macroalgae (Rhodophyta) is agar; it consists of agarose and agaropectin (Duckwort.M and Yaphe, 1971). The agarose is composed of ß-1,4-linked repeated alternating units of 3,6-anhydro-L-galactose-α-1,3-D-galactose (neoagarobiose) that are composed of D-galactose and 3,6-anhydro-L-galactose (AHG) (Park et al., 2012; Duckwort.M and Yaphe, 1971). To utilize red macroalgae as the biomass for the production of fuels by fermentation, the degradation of agarose into monomeric sugars such as D-galactose and L-AHG is necessary (Park et al., 2012; Kim et al., 2010a). In addition, the further metabolism of galactose and L-AHG by microorganisms is critical for the production of ethanol or other fuels. Saccharophagus degradans 2-40T is one of model marine bacteria that is known to degrade complex polysaccharides in the ocean (Ekborg et al., 2006). To utilize

83 84 Proceedings ASIAHORCS 2013

S. degradans as a genetic source of agarose conversion, it was grown on agarose, agar or red macroalgae biomass. When using enzyme and metabolite profiling, S. degradans was found to have a significantly higher agarase activity and AHG- generating activity than those grown on glucose or galactose (Shin et al., 2010a; Shin et al., 2010b; Yun et al., 2011). We found that neoagarobiose with a degree of polymerization (DP) 2 was be the major product fom agarose when using the crude enzyme from cell-free lysate. DPs 2, 4 and 6 sugars were all predominantly produced by the extracellular crude enzyme. Quantitative analysis of AHG using gas chromatography–mass spectrometry with a derivatization step developed here was highly reproducible and reliable (Yun et al., 2013; Yun et al., 2011). β-Agarases are mostly categorized into three glycoside hydrolase (GH) families 16, 50 and 86 (Ekborg et al., 2006). A recent genomic analysis of S. degradans revealed that five agarase genes belong to these GH families. Among the five agarases, Aga50D (a member of GH50) had neither been functionally characterized not overexpressed (Ekborg et al., 2006). Most GH50 agarases in the literature showed both endo-lytic and exo-lytic activities, which produce neoagarobiose as a final product. In our study using 13C-NMR and mass spectrometry, Aga50D was revealed to have unique exo-lytic activity thus producing neoagarobiose directly from agarose (Kim et al., 2010b). The optimum pH and temperature for the activity were 7.0 and 30°C, respectively. The Km and Vmax for agarose were 41.9 mg/mL (4.2 mM) and 17.9 U/mg, respectively. For the microbial metabolism of agar, α-neoagarobiose hydrolase (NABH) is an essential enzyme. It is because NABH converts neoagarobiose into monosaccharides (D-galactose and 3,6-anhydro-L-galactose) in the agarolytic pathway (Ha et al., 2011; Lee et al., 2009). We newly found the NABH activity of a protein of agaJ in S. degradans and annotated the enzyme as SdNABH. Neoagarobiose was completely hydrolyzed into monosaccharides by SdNABH, and neoagarotetraose (DP4) and neoagarohexaose (DP6 were also hydrolysed by SdNABH, releasing the common product, L-AHG (Ha et al., 2011). SdNABH was found to be a glycosidase assessable to α-1,3-glycosidic linkage from the non-reducing end of neoagarooligosaccharides with (DPs 2, 4 and 6). Further measurement of the kinetic parameters of SdNABH for DP2 showed a Km of 3.50 mM and optimum temperature and pH at 42°C and pH 6.5, respectively. To effectively produce sugar from recalcitrant agarose, a sugar platform equipped with acetic acid, multiple agarases and NABH was developed, and it was evaluated by simultaneous saccharification and fermentation (SSF) (Kim et al., 2010b; Ha et al., 2011; Kim et al., 2012). The sugar platform was composed of to the chemical liquefaction and enzymatic saccharification steps. The chemical liquefaction carried out at mild conditions using a dilute acetic acid at 80°C for 1–6 h resulted in 95% of a liquefaction yield (Kim et al., 2012). We mimicked Bioresources for food 85 the natural agarolytic pathway using several bacterial agarases: Aga16B, Aga50D, DagA and NABH. These enzyme system converted 79.1% of agarose into monosaccharides. From the chemical liquefaction and SSF of 30 g/L agarose, 4.4 g/L ethanol concentration and 49.3% of the theoretical ethanol yield based on galactose were obtained. This is the first report on the enzymatic conversion of agarose into its monosaccharides and the conversion of agarose into ethanol. To improve the chemical liquefaction process of our previous study (Kim et al., 2012), which required long time durations and high acetic acid concentrations, a pretreatment process was developed. The pretreatment of agarose by using acetic acid was conducted for short durations (10–30 min) at low acid concentrations (1–5% (w/v)) and high temperatures (110–130°C) (Kim et al., 2013). When testing the pretreated agarose by using an endo-β-agarase I (DagA), an exo-β-agarase II (Aga50D) and NABH, the addition of the endo-type agarase, DagA, did not increase the saccharification yield. Use of the crude enzyme of Vibrio sp. EJY3 (Roh et al., 2012) in combination with Aga50D and NABH following the acetic acid pretreatment step resulted in a 1.3-fold higher final reducing sugar yield (62.8% of theoretical maximum based on galactose and 3,6-anhydrogalactose in the initial input agarose, than that obtained using Aga50D and NABH only after acetic acid pretreatment. AHG is a rare anhydrosugar whose metabolic fate and fermentability are completely unknown to date (Yun et al., 2013). We isolated a marine agarolytic bacterium, Vibrio sp. EJY3, using AHG as a sole carbon source from a decomposed grapsid crab (Grapsidae) that was collected from the coast of the West Sea (Incheon, Korea) (Roh et al., 2012). The phylogenetic and molecular analyses based on the 16S rRNA sequence revealed that the strain was closely related to Vibrio atypicus HHS02T (98.9%), Vibrio diabolicus HE800T (98.9%) and Vibrio mytili LMG 19157T (98.7%). The genome of EJY3 has two circular chromosomes with 3,478,307 bp and 1,974,339 bp, and their GC contents are 45.0% and 44.6%, respectively. Four β-agarase genes belonging to the GH50 family were found in chromosome I of EJY3. Unlike other agarolytic bacteria, the other typical β-agarases belonging to the GH16 and GH86 families were not identified in the genome of EJY3. Judging from the full genome of EJY3, we anticipate that unveiling the unknown metabolic pathway of AHG is possible by using EJY3. AHG constitute is the main component of red macroalgae. The physiological effects of the rare sugar, AHG, is completely unknown. AHG was produced in the following 3 steps: prehydrolysis of agarose into agarooligosaccharides by using acetic acid, hydrolysis of the agarooligosaccharides into neoagarobiose by an exo-agarase and hydrolysis of neoagarobiose into AHG and galactose by a NABH. After these 3 steps, adsorption and gel-permeation chromatographies were applied to purify AHG. The finally obtained AHG showed 95.6% purity. 86 Proceedings ASIAHORCS 2013

Using the purified AHG, AHG did not exhibit any significant cytotoxicity at a concentration of 100 and 200 g/mL in a cell proliferation assay. In a skin- whitening assay, significantly lower melanin production was exhibited with 100 μg/mL of AHG than with arbutin. Strong anti-inflammatory activity, indicating the significant suppression of nitrite production, was also shown by AHG at 100 and 200 μg/mL. This is the first report on the physiological activities of AHG. Since the enzymatic production of AHG from agar or agarose and the physiological effect of AHG were unveiled, the industrial application of AHG is under active consideration.

References Duckwort. M, & Yaphe, W. (1971). Structure of agar: Part Ι. Fractionation of a complex mixture of polysaccharides. Carbohydrate Research, 16, 189–197. Ekborg, N. A., Taylor, L. E., Longmire, A. G., Henrissat, B., Weiner R. M., & Hutcheson S. W. (2006). Genomic and proteomic analyses of the agarolytic system expressed by Saccharophagus degradans 2-40. Applied and Environmental Microbiology, 72, 3396–3405. Goh, C. S., & Lee, K. T. (2010). A visionary and conceptual macroalgae-based third-generation bioethanol (TGB) biorefinery in Sabah, Malaysia as an underlay for renewable and sustainable development. Renewable & Sustainable Energy Reviews, 14, 842–848. Ha, S. C., Lee, S., Lee, J., Kim, H. T., Ko, H. J., Kim, K. H., Choi, I. G. (2011). Crystal structure of a key enzyme in the agarolytic pathway, α-neoagarobiose hydrolase from Saccharophagus degradans 2-40. Biochemical and Biophysical Research Communications, 412, 238–244. Kim C., Ryu H. J., Kim S. H., Yoon J. J., Kim H. S., & Kim Y. J. (2010a). Acidity tunable ionic liquids as catalysts for conversion of agar into mixed sugars. Bulletin of the Korean Chemical Society, 31, 511–514. Kim, H. T., Lee, S., Lee, D., Kim, H. S., Bang, W. G., Kim, K. H., & Choi I. G. (2010b). Overexpression and molecular characterization of Aga50D from Saccharophagus degradans 2-40: an exo-type β-agarase producing neoagarobiose. Applied Microbiology and Biotechnol- ogy, 86, 227–234. Kim, H. T., Lee, S., Kim, K. H., & Choi, I. G. (2012). The complete enzymatic saccharification of agarose and its application to simultaneous saccharification and fermentation of agarose for ethanol production. Bioresource Technology, 107, 301–306. Kim, H. T., Yun, E. J., Wang, D., Chung, J. H., Choi, I. G., & Kim, K. H. (2013). High temperature and low acid pretreatment and agarase treatment of agarose for the production of sugar and ethanol from red seaweed biomass. Bioresource Technology, 136, 582–587. Lee, S., Lee, J. Y., Ha, S. C., Jung, J., Shin, D. H., Kim, K. H., & Choi I. G. (2009). Crystal- lization and preliminary X-ray analysis of neoagarobiose hydrolase from Saccharophagus degradans 2-40. Acta Crystallographica Section F-Structural Biology and Crystallization Communications, 65, 1299–1301. Bioresources for food 87

Park, J. H., Hong, J. Y., Jang, H. C., Oh, S. G., Kim, S. H., Yoon, J. J., & Kim, Y. J. (2012). Use of Gelidium amansii as a promising resource for bioethanol: A practical approach for continuous dilute-acid hydrolysis and fermentation. Bioresource Technology, 108, 83–88. Roh, H., Yun, E. J., Lee, S., Ko, H. J., Kim, S., Kim, B. Y., . . . Choi, I. G. (2012). Genome sequence of Vibrio sp Strain EJY3, an agarolytic marine bacterium metabolizing 3,6-anhydro-L-galactose as a sole carbon source. Journal of Bacteriology, 194, 2773–2774. Shin, M. H., Lee, D. Y., Liu, K. H., Fiehn, O., & Kim, K. H. (2010a). Evaluation of sampling and extraction methodologies for the global metabolic profiling ofSaccharophagus degradans. Analytical Chemistry, 82, 6660–6666. Shin, M. H., Lee, D. Y., Wohlgemuth, G., Choi, I. G., Fiehn, O., & Kim, K. H. (2010b). Global metabolite profiling of agarose degradation by Saccharophagus degradans 2–40. New Biotechnology, 27, 156–168.b Yun, E. J., Lee, S., Kim, J. H., Kim, B. B., Kim, H. T., Lee, S. H., . . . Kim, K.H. (2013). Enzymatic production of 3,6-anhydro-L-galactose from agarose and its purification andin vitro skin whitening and anti-inflammatory activities. Applied Microbiology and Biotechnology, 97, 2961–2970. Yun, E. J., Shin, M. H., Yoon, J. J., Kim Y. J., Choi, I. G., & Kim, K. H. (2011). Production of 3,6-anhydro-L-galactose from agarose by agarolytic enzymes of Saccharophagus degradans 2-40. Process Biochemistry, 46, 88–93.

POSTERS

SINTang Shrimp as a Protein Source from FreshwaTER “Steps Towards the Development”

Djamhuriyah S. Said, N. Mayasari dan Triyanto Research Center for Limnology, Indonesian Institute of Sciences

Abstract Macrobrachium sintangense or sintang shrimp is one of the native Indonesian shrimps that is commonly discovered in Java, Sumatra and Kalimantan Island. This shrimp is used for protein source and its number still depends on fishing. Recently, population of the sintang shrimp has been decreasing. The eco-biological information of the shrimp was also limited. The research about M. sintangense was conducted in 2012–2013. The research was conducted in several steps, i.e. collecting samples from the original habitat, ecological and biological studies, and adaptation on laboratory condition for domestication of the shrimp. The reseach aims to know the condition of population from several places and to know the proximate content of the shrimp. Shrimp samples were collected from West Java, Central Java, East Java, Lampung and West Kalimantan. The results of the research showed that the M. sintangense natural stock tend to decrease, and the shrimps from some regions had adapted respectively with their level in controlled habitat. Based on the proximate analysis (base on percentage of dry weight) it showed that the protein content of Sintang shrimps was in the range of 57.79–66.51%, and the fat content was in the range of 7.13–12.33%. This research revealed that M. sintangense needs further development to be produced in measurable quantities by aquaculture propagation. Sintang shrimp has been adapted in controlled habitat, therefore they can be a protein source for the people. The dependence of the shrimp fishing can be reduced. Also, the shrimp can be used for conservation purpose, such as for restocking. Keywords: Macrobrachium sintangense, sintang shrimp, nature population condition, protein content

*Corresponding Author Jln. Raya Bogor Km 46, Cibinong, Bogor 16911, Indonesia E-mail: [email protected], [email protected]

Introduction Indonesia is a megabiodiversity country that has many natural resources from the inland water. The natural resources from inland water has potential in various fields, such as food sources, medicine, cosmetic ingredients, and other potentials with an economic value as an export commodity and domestic’s consumption. One of the species that has the potential to be developed is Macrobrachium sintangense. M. sintangense is an Indonesian native shrimp that is widely spread in Java, Sumatra, Kalimantan, and Malay Peninsula (Holthuis, 1950). The shrimp length is relatively small, about 5 cm with a maximum weight about 5 grams (Figure 1). The shrimp has been known as a food for most people, ornamental fish feed, and source of chitin-chitosan. The shrimp has an ecological function

91 92 Proceedings ASIAHORCS 2013

as a natural and ecological control in predator-prey relationships, and as a feed source for higher animal tropic and controling mosquito larvae as well as M. borelli in Argentina (Collins, 1998). According to FAO data, Indonesia has only developed one of Macrobrachium species, M. rosenbergii, while other countries, such as Brazil and Colombia, have already developed 4 types of Macrobrachium, Australia with 3 types, as well as several other countries. According to Sabar (1979), Indonesia probably has 37 species of Macrobrachium.

a b Figure 1. Macrobrachium sintangense (a.male & b. female) from left to right

Recently, M. sintangense population has been declining as well as other Macrobrachium species. Siregar et al., (2001) described that the declining of M. sintangense population is caused by overfishing and habitat degradation. Other possible causes for the decline in many group of Macrobrachium may include habitat loss, overfishing, water pollution, river channelization and competition with invasive species (Bauer and Delahoussaye, 2008). Furthermore, M. sintangense needs to be propagated. The research focused on propagation of the shrimp, so it can be produced as a protein source for the people and reducing the dependency of the shrimp from the uncontrollable fishing. There are several key factors that should be considered for ex-situ shrimp development, such as the environmental information about shrimp habitat, biological information such as growth, reproduction, feeding, breeding season and other conditions. The production of M. sintangense can be successfully achieved by aquaculture activity, which can provide protein source for the people and reduce the dependency from shrimp culture. Furthermore, shrimp population on nature can be sustained. Research on M. sintangense relatively rare compared to M.rosenbergii and M.idae (Sabar, 1979). However, some studies have been conducted, such as feeding behavior (Sabar, 1979), the growth rate with different feed compositions (Wowor, 1983). Also, Wowor (1985) has been able to summarised that the shrimp Bioresources for food 93 has the highest level of spawning in March to June, especially in May. It can be used for the base information to order the implementation of further research. This study is intended to changeM sintangense from fishing commodity into aquaculture commodity. The stages of the research to achieve these objectives include exploration (collection of living shrimps) from nature, adaptation, domestication and propagation in controlled conditions.

Materials and Methods The method used was a survey method or observation of the natural condition of the shrimp and experiment method. Activities of the research included taking shrimps from nature then adapting them to laboratory conditions. The research was conduted in West Java, Central Java, Lampung, and West Kalimantan in 2012 (stage 1). The next research was conducted in East Java and Kalimantan in 2013 (stage 2). Sampling was done by visiting several rivers, lakes, or reservoirs which is Sintang’s habitat. The shrimp was caught by local fishing gear. Data collection for West Java were conducted at 5 locations in Bogor (ponds of Bogor Botanical Garden, Situ Gede, Situ Cikaret, Pondok Rajeg,) and Sukabumi (Situ Cijeruk) by using hand net. In Central Java (Malahayu Reservoir and Panjalin Reservoir) the shrimp was caught by osom (shrimp trap), and seser (hand net). In East Java (Porong River, Mas River in Mojokerto and Lake Ranu in Lumajang District) the shrimp was caught by cast net and hand net. In several rivers and reservoir in Lampung (Way Semaka, Dam Way Semaka, Tebabeng, Way Rarem Reservoir, Way Semah-Goa Maria-la verna, Way Sekampung, Sangharus-Pisangan River), the shrimp caught by waring (small purse seine). In West Kalimantan (Kapuas River in Sintang District) the shrimp was caught by hand net and jermal (shrimp trap) (Figure 2). Together with shrimp collection and observation in sampling areas, water parameters were measured. They were dissolve with oxygen (DO), pH, hardness and some other parameters. The shrimp, which had been collected was delivered to the laboratory to be adapted and was used the laboratory as a controlled habitat.

(a) (b) (c) (d) (e) Figure 2. The types of fishing gear in several locations (a. cast net; b. shrimp trap “osom”; c. Tramel net; d. Shrimp trap “jermal”; e. Hand net “waring”) 94 Proceedings ASIAHORCS 2013

Since the shrimp had undergone adaptation stage, some parameters were observed, such as survival rate, growth rate and reproduction. The observation was done in 3–5 months. Survival data of shrimps that were taken from nature was conducted during the first 3–5 months. At the same time, the life enabling factors were being analyzed in the laboratory which was based on natural ecological conditions. The study was conducted to obtain adapted shrimp. Proximate analysis was done at the Laboratory of Fish Nutrition and Health Sciences, Fac- ulty of Fisheries and Marine Science Bogor Agriculture University. The stages of shrimp development is described in Figure 3.

Collection of live shrimp/ecological analysis

Adaptation in controlled habitat

Biological analysis

Development/propagation

Produce of the adaptive shrimps

Figure 3. The stages of the development of Sintang shrimp

Results and Discussion Population Condition. M. sintangense is a freshwater shrimp inhabitants both flowing waters (rivers) and stagnant water such as a lake, reservoir, pond, dam, and the others (Mohamad, 1979; Sabar, 1979; Kesuma, 1981; Said et al., 2012). The shrimp is not found in brackish waters (Sabar, 1979). Sintang shrimp is found in the shallow part of the waters with a sand, mud and aquatic vegetation on the bottom. The condition of sintang habitat is usually shady. The yield of shrimp observations at several location shows that the shrimp is not always found at the visited freshwater locations (Table 1). Bioresources for food 95

Table 1. Location of the research and population condition ∑ location which No Research Location ∑ location % M.sintangense found 1. West Java (Bogor & Sukabumi) 5 2 40 2. Central Java (Brebes) 2 2 100 3. East Java 4 2 50 4. Lampung 7 2 28,6 5. West Kalimantan 6 5 83,3

Conditions of the Sintang population in the area of Bogor, West Java and Central Java have been reported by Said et al., (2012). For the West Java area, M. sintangense can only be found in Bogor Botanical Gardens pond with relatively high abundance. While in other locations, the shrimps are only found in a very few number or nothing at all, such as in Situ Cikaret and Situ Gede (name of the small lake in Bogor). Both of the small lake condition is contaminated by garbage and waste, especially in litoral zone. The temperature is relatively high and not shady. Sintang shrimp is found plentiful in Malahayu reservoirs Central Java. The reservoir is known as a habitat of Sintang shrimp. In this area, we can only found M. sintangense. While in Panjalin Reservoir, which is located near Malahayu reservoir, another Macrobracium shrimp is found, namely Macrobrachium lanchesteri in a small populations (Said et al., 2012). From the next research, sintang shrimp is not found in West Java (Situ Cijeruk, Sukabumi). In this locations M. lanchesteri can be easily found. This species is an invasive species as well as M. sintangense competitors in terms of habitat and food. M. lanchesteri is a shrimp that can survive in the extreme conditions, such as area with direct expose to sunlight, waters contaminated with plastic waste, relatively high temperatures waters up to 32.22°C, and waters with high ammonium concentration—more than 1 mg/L. In East Java, M. sintangense can be found in Porong River and Mas River. The location of research in Porong river is 500–1000 m towards upstream. The water temperature is about 28.6°C. The average of pH is 6.8. The Mas River which acts as Sintang habitat is located on Wonorejo Village, Jetis Village in Mojokerto district. The water has a temperature of around 26oC and pH averaging in 6.79. Those condition are suitable forM. sintangense habitat. Both locations have a range of dissolved oxygen (DO) about 4.47 mg/L. According to Said et al., (2012) M. sintangense is able to live in the DO range 4–9 mg/L, and is still able to tolerate temperature between 26.9 oC to 32oC, and value of pH in range of 6.16 to 8.73. This result is not much of a different from research of Dwiono (1981) who found Sintang shrimp in the water with pH range of 6.9 to 8.4. 96 Proceedings ASIAHORCS 2013

The recent populations ofM. sintangense population in both locations are still relatively good, probably because it is not a major fishing commodity. Sintang shrimp is a side product for local fishermen that go fishing at night. Nevertheless, these shrimps are sold separately with their own price. M. sintangense is not found at lake in Lumajang (Ranu Klakah and Ranu Pakis). Both of the lakes consist of M. lanchesteri with abundantly. The water quality of both have a temperature of around 26–29 oC. pH is at around 7.47 to 7.86 and DO is in the range of 7.46 to 7.7 mg/L. Based from the result, this water condition is still suitable for Sintang shrimp to live. M. sintangense is not found in these location, allegedly due to competition with M. lanchesteri. In Lampung (southearn part of Sumatra), Sintang shrimp is relatively difficult to find. From a total of 7 places that have been visited, only 2 places have sintang shrimp. Way Sekampung (name of a river) is a location that contains a lot of shrimps. Sintang shrimp ratio is about 36%, and another 64% was M. pilimanus. Otherwise, in Way Rarem, M. sintangense is found in a very few number and this location is dominated by M. lanchesteri. As many as 5 other locations have been dominated by either M. lanchesteri or M. pilimanus. This condition indicates that M. sintangense population has already declined. In West Kalimantan, the study was conducted in two periods. First period was on September 2012 (low water level) and second period was on May 2013 (high water level). At the first period, the observation locations were in Tayan River, Bukit Kelam waters, and Durian River. While in 2013, observations were in River Sibau-Putussibau, River Kapuas and River Malawi in the Sintang District. All of the river locations are parts of main river namely Kapuas River. The population conditions of M. sintangense in Tayan river and Sibau river, are only 2–6 individuals. At Durian river, Kapuas river and Malawi river (Sintang District), it is still easy to get M. sintangense using fishing gearjermal or tonggok. While in Bukit Kelam, as part of water fall area, the Macrobrachium found is dominated by M. lanchesteri and M. pilimanus. M. pilimanus is a freshwater shrimp living in stream. According to the information from local fishermen, Malahayu Reservoir, Central Java is originally fishing ground of sintang shrimp. Production of shrimp fishing can reach 100 kg/day. Recently, the shrimp production has decreased. One of the reasons is allegedly caused by catfish (Pangasius) that stocks in the reservoir (Said et al., 2012). It is a carnivorous fish that preys on Sintang shrimp. So far, the introduction of this fish greatly affects the Sintang shrimp population . Recently in West Kalimantan, trade of M. sintangense is only done in areas near of shrimp fishing locations. It happens because the number of sintang shrimp catches is declining. The observations in 1996–1998 (April) showed that M. Bioresources for food 97 sintangense was very abundant and traded in the traditional markets of Pontianak City (Wowor, Research Center for Biology LIPI, personal communication). Based on these data, the declining of M. sintangense population is caused by competition with invasive species, predators, habitat degradation and overfishing. Adaptation in controlled habitat. The second step in this research is to adapt the shrimp in the laboratory. The main parameters that showed the adaptability are survival rate, growth rate, and reproduction capacity. The survival rate of sintang shrimp is monitored during 3 months since arrival (Table 2). The aim of monitoring is to know the adaptability of the shrimp in controlled conditions (laboratory).

Table 2. Adaptability of sintang shrimp in 3 months at controlled condition (%) Origin of the Survival Rate/SR M.sintangense (%) for 3 months shrimp From nature 1 day since ar- 1 month 2 month 3 month rival West Java*) 100 100 100 95 93 Central Java*) 100 100 95 89 88 East Java 100 90,7 48,5 n.a 17 Lampung 100 100 95 90 85 Kalimantan 100 98 n.a 67 65

*) (Said et al., 2012) ; n.a: no available data

Survival rate of sintang shrimp from Bogor (West Java) and Central Java is relatively high, compared to those from other locations (Said et al., 2012). In Table 2, the data shows that the SR of sintang shrimp from Lampung was also high (85%). It was alleged that shrimps from the site do not experience excessive stress. The relatively low stress level is contributed by the fact that Bogor and Lampung are not too far from the location of laboratory in Cibinong. Also, the time spent for trasnportating the samples does not take too much. Meanwhile, the SR of shrimp from East Java is noticeably decreasing fast. Some external factors have caused the SR of Sintang from East Java getting low. Several external factors also affecting the shrimp was the condition of laboratory. This is likely to be affected by technical handling problems in adaptation period because in that period, laboratory in which the shrimps were maintained was in renovation. The SR of sintang shrimp from West Kalimantan is still relatively good. On the other hand, decreasing of SR that is shown here is also not solely caused by the deaths due to stress, but can also caused by the high cannibalism among the shrimp. That condition occurs presumably because of maintenance with a certain density in aquariums or tanks that are very different from the original habitat of the shrimp. 98 Proceedings ASIAHORCS 2013

Overall, M. sintangense has high adaptability although on arrival at the laboratory it experiences high stress conditions due to far travel from West Kalimantan, Lampung, and East Java. For comparison, survival rate of endemic fish (Marosatherina ladigesi) from Makassar to the Laboratory (Research Center for Limnology at Cibinong) at the initial stage can only reach 30% and by 3 times repetition sampling can reach 60% (Said et al., 2006).

Table 3. Proximate analysis of M. sintangense. Parameter (% in Origin of M. sintangense dry weight) Central Java West Java West East Java Adapted (Brebes) (Bogor Botanical Kalimantan prawn Garden) (West Java) Protein 57.79 62.23 63.77 66.51 60.22 Fat 12.33 11.37 10.55 8.18 7.13 Ash 18.28 16.92 12.77 14.59 18.15 Crude fiber 7.82 7.44 9.18 10.07 8.15 Carbohydrate 3.78 2.04 3.74 0.65 6.36 Mineral (% in wet weight) Kalsium (Ca) 0.23 0.54 0.127 0.70 1.28 Fosfor (P) 0.23 0.34 0.210 0.18 0.18 Besi (Fe) 0.01 0.01 18.71 14.52 14.79

Table 3 shows that protein owned by sintang shrimp is high, the value ranged between 57.79%–66.51%. While its fat ranged from 7.13%–12.33%. The results obtained in this study is higher than that obtained by Mohamad (1979) where the levels of protein and fat are counted respectively at 53.7% and 6.51%. Said (2012) mentions that M. pilimanus from Lampung has a protein content of 50.31% and a fat content of 10.73%, and from Kalimantan respectively by 53% and 6.35%. While M. lanchesteri from Cibinong (West Java) has higher levels of protein and fat respectively by 58.68% and 10.7%. The approximate analysis results indicate that M. sintangense has high enough levels of the protein, so it can be used as a source of protein for the people.

Conclusions Overall, the M. sintangense natural stocks tend to decrease. Shrimps from some region, such as from West Java, Central Java, Lampung and West Kalimantan have been adapted respectively with their level in controlled habitat. Approximate analysis (% of dry weight) shows that the protein content of Sintang is in the range of 57.79%–66.51%, while the fat content is in the range 7.13%–12.33%. Bioresources for food 99

Therefore, these shrimps can be used as an alternative source of high protein for the people. It indicates that M. sintangense needs further development.

Acknowledgement We woukd like to thank LIPI Competitive Program 2012–2013, Subprogram of Exploration and Measured Utilization of the Indonesia Biological Resources which has funded the project research. In addition, we wish to provide our gratitude to Dr. Daisy Wowor, Mir. atul Maghfiroh, S.P.t, and Sahroni who have helped and supported us during the research.

References Bauer, R. T., & Delahoussaye, J. (2008). Life history migrations of the amphidromous river shrimp Macrobrachium ohione from a continental large river system. J. of Crustacean Biol., 28(4), 622–632. Collins, A. P. (1998). Laboratory evaluation of freshwater prawn Macrobrachium borellii, as a predator of mosquito larvae. Aquat. Sci., 60, 22–27. FAO. n.d. Status of macrobrachium fishery and culture in various localities/countries (After Rabanal, 1982). Retrieved from http://www.fao.org/docrep/field/009/ag161e/AG161E02.htm; on August 23, 2011). Holthuis, L. B. (1950). The decapoda of the Siboga expedition part X: The palaemonidae collected by the siboga and snellius expedition with remarks on other species I. subfamily palaemonidae. Leiden: Brill. Kesuma, C. (1981). Suatu Studi tentang Frekuensi Panjang, Nisbah Kelamin, dan Tingkat Kematangan Gonad Udang Regang (Macrobrachiumsintangense (de Man), di Bendung Curug, Kabupaten Karawang. Karya Ilmiah. Institut Pertanian Bogor, Fakultas Perikanan. Mohamad, A. S. A. S. (1979). Some observation on the biology of Macrobrachium sintangense (De Man) In Juanda Reservoir (Jatiluhur) West Java with notes on its fishery and general distribution. Bogor: Biotrop/SEAMEO Regional Center for Tropical Biology. Sabar, F. (1979). Kehidupan udang regang (Macrobrachium sintangense) de man. Berita Biologi, 2(3), 45–52. Said, D.S., Triyanto, S.H. Nasution, H. Fauzi & Supranoto. (2006). Perkembangan Daya Adaptasi dan Uji Reproduksi Ikan Pelangi Sulawesi Telmatherinaladigesi pada Habitat Ex-situ. Ikan Hias Nusantara. Pusat Riset Perikanan Budidaya, Badan Riset Kelautan dan Perikanan, Departemen Kelautan dan Perikanan. Hlm: 59–67. Said, D. S., & Maghfiroh, M. (2012). Kemampuan adaptasi udang air tawar asli indonesia Macrobrachium sintangense (de Man, 1982) pada habitat terkontrol. Limnotek, 19(2), 176–184. Said, D. S., Maghfiroh, M., Wowor, D., & Triyanto. (2012). Kondisi populasi, kondisi ekologis, dan potensi udang Macrobrachium sintangense studi kasus wilayah bogor-jawa barat dan brebes-jawa tengah. Proceeding of National Seminar on Limnology VI. in press. 100 Proceedings ASIAHORCS 2013

Said, D. S., Wowor, D., Ali, F., Lukman, Triyanto, & Maghfiroh, M. (2012). Hibridisasi Macrobrachium sintangense untuk mendapatkan kombinasi tetua terbaik. Yearly Final Report Kegiatan Kompetitif LIPI 2012. Bogor. Siregar, A. S., Sinaga, T. P., & Setijanto. (2001). Studi ekologi fauna benthik (Macrobrachium spp) pada sungai banjaran, pelus & logawa, banyumas. Biosfera, 19. Wowor, D. (1983). Pengaruh pemberian tiga macam makanan buatan terhadap laju pertumbuhan udang regang Macrobrachium sintangense. Berita Biologi, 2(1), 127–131. Wowor, D. 1985. Struktur populasi dan masa reproduksi udang regang. Berita Biologi, 3(3), 116–120. Potency of Yam for Food Diversification and Other Uses in Indonesia

Nurhayati1* and Supli Effendi Rahim2 1Lecturer at Study Program Agrotechnology, 2Lecturer at Study Program Agrotechnology, Agriculture Faculty, University of Palembang, Palembang, South Sumatra, Indonesia

Abstract Increase in the population of Indonesia accompanied by the increase of extreme climate changes results in decreased availability of staple food source. To meet the needs for foods, Indonesia has been importing a number of food commodities for many years. All parties, including government, business, academics and the general public should be more serious in attempting to seek other food sources besides rice through diversification of food sources. Although the goal is to decrease the demand for major food sources of carbohydrates, namely rice, food diversity is also intended to increase the consumption of food beyond rice as a carbohydrate. Diverse source of food is very good for health, growth and intelligence. One source of local food and a potential source of carbohydrates for many Indonesian people are yam tubers (Dioscorea hispida Dennst). Yam is grown wilderly in all dryland areas of Indonesia. The use of yam as staple food should be promoted integratedly, contiously and seriously. Promotion of yam as staple food should be carried out with well understood and adopted processing of yam tuber and flour as nice meals and other useful uses. Yam is found to have great potential as staple food for it can be found and cultivated in all areas of dry land through out the country. Yam is already used as a base product for making pesticides and liquid fertilizers. Yam development opportunities as a supplement replacement for the basic ingredients of food products is very open and promising. Keywords: yam, staple food, diversification, production, processing, and potential uses.

*Corresponding Author Agriculture Faculty, University of Sriwijaya, Indralaya, Ogan Ilir, South Sumatra, Indonesia E-mail: [email protected]

Introduction Diversity of food consumption, in the Indonesian context, is often interpreted as a reduction in rice consumption that is compensated by the addition of non-rice consumption. One reason for the importance of diversification is that a reduction in the scope of national rice consumption will have a positive impact on food dependency of other countries. Food is a commodity of strategic importance for a country. Food is a basic need of human rights fulfillment to every people of the country, which, in Indonesian context, is mandated by the laws of the Republic of Indonesia No. 7 of 1996 concerning Food. Adequacy of food determines the quality of human resources and the resilience of a nation. Therefore, efforts to create quality human resources should be done with the food supply at all times, in adequate amounts, equitable,

101 102 Proceedings ASIAHORCS 2013

safe, having high quality, nutritious, diverse, and at an affordable price. Food crisis experienced by many countries in the world, including Indonesia and other ASEAN countries, gave lessons that food security should be pursued as much as possible based on national resources. Therefore, relying on imported resources will lead to vulnerabilities in the form of economic turmoil, social unrest and political turmoil (Juarini, 2006). Increasing in the population of Indonesia accompanied by the increase of extreme climate changes result in decreased availability of staple food source. All parties, including government, business, academics and the general public should be more serious in attempting to seek other food sources beside rice through diversification of food sources. The goal is to decrease the demand for major food sources of carbohydrates, namely rice. Food diversity is also intended to increase the consumption of food beyond rice as a carbohydrate. Diverse source of food is very good for health, physical growth and intelligence. In order to realize an increase in food security, there are at least five main activities, namely food security escort through domestic production through optimization of paddy fields (especially in irrigated areas), agricultural expansion, intensification quality improvement, improved post-harvest, and acceleration of diversification in food consumption. Indonesia has several food commodities, which can be developed as a national food commodities one of those is yam (in Indonesian it is called gadung). Yam is one source of local food and a potential source of carbohydrates for many Indonesian people. This plant which is from family Dioscorea contains bioactive compound dioscorin that is a protein which functions as an antioxidant (Shewry, 2003) and antihypertension (Myoda et al., 2006). A part from the fact that yam contains bioactive compounds, in Indonesia the usage of yam is already wide, such as for food, liquid fertilizer and bio-pesticides. However, promoting the potency of yam for various uses is very important. Promoting how to cultivate yam, how to get rid of poisons in the tubes, what are the characteristics of its tubers and flour, and what forms of products can be obtained require special discussions and descriptions. This paper is intended to describe the potency of yam as food diversification and its other potential uses in Indonesia. Yam Production in Indonesia. Yam is widely found in most dry land areas in Indonesia. Distribution of wild yam covers Islands of Sumatra, Kalimantan (Borneo), Sulawesi, Java, Bali, Nusa Tenggara, Maluku and Papua. That is why in every parts of the country yam has its local names, namely bitule in Gorontalo, gadu in Bima, gadung in Bali, Java, Madura and sunda, iwi in Sumba, ax in Sasak, salapa in Bugis, and sikapa in Makasar. There exist a number of yam varieties Bioresources for food 103 namely punel yam, glutinous yam, yellow yam and saffron rice yam. About ten millions of hectares of dry land in Indonesia are places for yam plant to grow, both wild and cultivated. It is likely that yam is potential to become staple food for people in all parts of Indonesia in the future (Anonymous, 2001). Yam can be cultivated like other food tuber crops. It is usually propagated by tubers. Yam should be planted at the beginning of the rainy season. In areas where the rainy season is less than 8 months, yam planted early up to 3 months before the arrival of the rainy season, which in turns could increase yields by 30%. Yam plants require soil with good drainage, fertile, high organic matter content, and loam textured soils. Before planting, the field is fertilized with NPK fertilizer a few days before planting. Bulbs are planted 3 or 4 pieces per hole on the mound. Distance between plants was 37.5 to 50 cm, depending on size of tubers. Then the young plants are covered with dry grass when planting takes place. Young plants are tied to bamboo sticks when planting (Anonymous, 2013a). Maintenance of the yam crop is not complicated. To meet the needs of water, these plants simply take advantage of the rain. In addition, planting yam does not produce weeds which can interfere with this plant. Still, there is one dangerous pest to yam, which is Heteroligus claudius. This beetle pests in the larval stage consume bulbs. Schoot yam beetles (Criocerts livida) on stage larvae eat the young leaves and canopies. The first pests are usually addressed with crop rotation and late planting. The second pest is controlled by spraying pyrethrum (Anonymous, 2013a). Yam tubers can be harvested after the plant age is 12 months. Yam can be harvested once and twice. Harvesting is done after most of the leaves turn yellow- ish, and the it is performed 1 month before aging up to 1–2 months thereafter. The first harvest is done in approximately 4–5 months after planting. Dig the soil around the plants and bulbs are removed, and then do the same at the bottom of the tuber crops canopy connection. The next crop is planted again so that the plant will form more roots around the wound after the first harvest. When the plants aged at the end of the season, the second harvest is done. Currently, there is no special treatment to keep the root system. Yam is usually harvested in a way that the first or single harvest is done (Anonymous, 2013a).Y am production could reach 19.7 tonnes/ha (Tropical Product Institute, 1973). In Indonesia, with more intensive farming systems, the possibility of production that could be achieved will be greater because these plants grow well in tropical climates. According to Flach and Rumawas (1996), yam production can reach 20 tons/ha. Yam Processing and Products that Could be Obtained. It is widely known that yam contains a toxic alkaloid and dioskorina (dioscorine) which cause dizziness (Soeseno, 1985). Because they contain toxic compounds, then the removal of 104 Proceedings ASIAHORCS 2013

toxins in the yam tuber is absolutely a must to be done before it is processed into food. A number of well tested traditional ways to eliminate toxins in the yam is as follows. First method. Take the yam tubers carefully, cut the tubers into pieces using a sharp knife. Marinate the pieces wound with ash kitchen, and let it or save it for 24 hours. Then peel the yam tuber pieces to clean. Wash the yam pieces that have been removed in a water flow. Enter the yam tuber pieces into the basket and immediately soak in salt water for 2–4 days. Lift and drain the pieces of the yam tubers from salt water, then wash with sugar water. Furthermore, drying the pieces of yam tubers in the sun. Repeat immersion in salt water, sugar water washing and drying up 2–3 times in order to poison dioscorin completely gone. Second method. Peel the yam tuber skin, which is still fresh using a special knife, making it clean. Cut into thin yam tuber, then coat with wood ash (ash kitchen). Drying yam tubers that have been covered with wood ashes until completely dry. Furthermore, yam tubers are soaked with clean running water for 3–4 days. Drain the yam tuber, then wash again with salt water. Lift the tubers

Table 1. Meals that are widely produced from yam (Anonymous, 2009 and Koswara, 2012) Name of Performace How to make product Pounded Boil tubers, then put into a mortar or pestle, then grind yam until form aviscous material or paste. This paste is then formed into balls or spheres is. Sphere then neaten by dipping it in the sauce and swallowed without chewing first. Fried-yam Materials required are a fresh tuber and spices. Fresh balls tuber is peeled, then grated. Subsequently mixed with spices and fried balls while establishing spheres.

Yam por- Fresh tuber is peeled, then cut into small sizes, dried nat- ridge urally in the sun for a few days. The poison is removed as described earlier. Pieces are then crushed using a mortar or a large milling machine, filtered and sundried. Flour is then mixed with hot water and stirred, resulting in aviscous fluid and served directly as a thick porridge plus other menu. Yam flake Detoxinated boiled tuberis are cut into small pieces or flake form, then they are dried in the roller-drying apparatus. To serve it, just pour hot water into the flake and stir it. This stirring will cause the flakes to turn into a thick porridge like paste and it can be eaten as a sauce. Bioresources for food 105

Name of Performace How to make product In a plastic container, mix flour, water, salt and cmc. Add coloring water, stir well and allow to clot. Roll with rolling noodles at grinder no.2, 2–3 times until it becomes Yam noodle smooth. Cut into pieces using a rolling noodles. Sprinkle tapioca flour to prevent sticking. Coat with cooking oil and stir; noodles are ready to served with another menu. of yam and dry it until completely dry. In Table 1 there are meals that could be widely produced from yam. Characteristics of Yam Flour and Nutrient Contens. The most dominant component in yam flour is a starch or carbohydrate. The starch in the form of granules are dirty white. Fresh yam tubers usually contain cyanide with levels of 50 to 400 ppm. If treated with acidification and warming on the yam tuber, flour that is produced will have cyanide content around 19.95 ppm (Table 2). According to FAO in Winarno (1992), cyanide levels which are up to 50 ppm are safe to eat. According to Damardjati et al., (1993), cyanide levels of <50 ppm are non-toxic category, 50–80 ppm slightly toxic, 80–100 ppm poisonous and >100ppm very toxic. The processing of yam which is like strip, cut, cook can reduce or even eliminate the cyanide before consumption (Janagam et al., (2008).

Table 2. Characteristics chemical composition of yam tubers and yam flour Parameter Yam tubers Yam flour Water content 64.8% 10.89% Starch 32% 51.88% Protein 5.83% Lipid 0.98% 0.35% Fibre 1.11% 5.66% Ash 1.2% 3.66% Cyanide 469.5 ppm 19.95 ppm

Source: Budiono (1998) 106 Proceedings ASIAHORCS 2013

Table 3. Nutritious contents of several selected staple food in Indonesia (per 100 gram material) Name of Cal Prot Lpd Wtr Fibr Ash Vit A Bit Vit Vit Ca Fe material B1 B2 C (g) (%) (mg) Rice 248 8 1.2 40 - - - 0.02 0 5 0.5 Wheat flour 356 10.5 1.68 13.9 1.91 1.41 - - 3.1 - 2.3 0.9 Cassava 342 1.5 0.3 63 1.9 - 0 0.6 - 30 33 0.7 Corn 362 10 4 13.5 - 1.5 - - 0.12 - 12 0.8 Potato 83 2 0.1 78 - 150 0 0.11 - 17 11 0.7 Sago 353 0.7 0.2 14 1.9 157 11 1.35 2 - 47 66 Yam 88 0.6 0.3 77 0.9 26 - 0.03 - - - - Breatfruit 108 1.3 0.3 69 - 0.9 - 0.12 0.06 17 21 0.4 Taro 98 1.9 0,2 73 - - 20 0.13 - 4 28 1.0 Sweet potato 136 1.1 0.40 - 1.0 0.5 900 0.10 0.04 35 57 0.7

Source: modified from http://azaima.tripod.com.

Complete descriptions of nutritious contents of yam flour as compared to other selected food sources are as in the following Table 3. Utilizations of Yam for Other Uses. Yam is a tuber that can be eaten, but the yam tubers contain toxins that can cause dizziness, vomiting and seizures if not processed properly. Harmful toxins in the yam tuber are an alkaloid substance

called dioskorin (C13H19O2N). If treated properly, the yam actually possesses a lot of usefulness. In addition to medicine, yam can be used as materials for pesticides and liquid fertilizers. Use for Medicines. Yam tubers are known to be very toxic. Bulbs are used as fish poison or arrowheads. Tuber piece of yam is enough to kill a man within 6 hours. The first effect of a discomfort in the throat gradually became a burning sensation, followed by dizziness, vomiting of blood, a sense of suffocation, drowsiness and fatigue (Chung, 2001). However in Indonesia and China, grated yam tuber is used to treat early stages of leprosy, warts, calluses and eyelets. Together with chinese yam (Smilax china L.), yam tuber is used to treat wounds caused by syphilis. In Thailand, slices of yam tuber is applied to reduce stomach cramps and colic, and to remove pus from the wounds. In the Philippines and China, this tuber is used to relieve arthritis and rheumatism (Anonymous, 2001) and to clean the maggot-infested animal wounds (Chung, 2001). Dioscorea tubers contain thick mucus glycoproteins and polysaccharides consisting of soluble in water. Glycoproteins and polysaccharides are bioactive materials that serve as a water-soluble dietary fiber and hydrocolloids which are Bioresources for food 107 useful for lowering blood glucose and total cholesterol levels, especially low density lipoprotein (LDL) cholesterol (Anonymous, 2013b). Uses for Pesticides and Fertilizers. The rest of the processing of yam can be used as a pesticide (Ahmad et al., 2012; Hudzari et al., 2011). Pesticides from yam tubers are environmentally friendly because it contains alkaloids dioscorine which is an alkaline substance, containing one or more nitrogen atoms which are toxic to the nerves (Fajar et al., 2006; Rahayu, 2010). Hasanah et al., (2012) reported that application of yam tuber extract can kill walang sangit pest (Leptocorisa or Aorius fabricius) on rice cultivation, up to 75 percent. They also reported that the extract of yam tubers can also kill rodents and insect pests on vegetables. Yam, apart from being used as food and medicine, can be processed as pesticides and organic fertilizers. Pesticides from yam can be used as pest control agents (such as winchesrods, leafhoppers, walangrice pest, thrips and other small insects that harm plants). Nurhayati (2007) made experiments on the use of a number of plant extracts including yam tubes as an effort to controlColletrichum capsici, the cause of Antracnose on Chilli fruit. She reported that yam extract had the prospect to control the growth of the pathogen by reducing the number of conidia; improving soil fertility; increase beneficial microorganisms to plans; suppliers nutrients micro/macro for plants (Anonymous, 2013c). Rhizome of yam has been used as a traditional pest control against larvae of Plutella xylostella, the pest of many horticultural plants. One of the alkaloid derived from the root yam extraction significantly underdevelopes the larval moulting and reduce larva weight and high mortality in the larval stages (Banaag et al., 1997). Bulbs yam can also be made to eradicate the rat poison. Rat poison made from yam tubers are easily broken down, so it is not harmful to the environment. Yam in fact can be utilized as liquid organic fertilizers. To make it,just mix thoroughly the following ingredients, namely 4 kg blended yam tuber with 200 g red sugar, 2 litters rice water, 1 kg bran, 5 litters of water. Store the mixture up to 15 days in a confined container, then collect the liquid with filtration. This liquid fertilizer is ready to be applied at the rate of 18 ml/litters of water into a plantation. This fertilizer is proved to increase the fertility of the land if applied on regular basis (Anonymous, 2013c).

ConcluSIONS In general, cultivation and utilization of yam provide many benefits to a country like Indonesia, both in the preparation of food commodities, to the provision of employment and business. For food, yam as a food commodity utilization of carbohydrates also helps to reduce dependency on rice in which in currently 108 Proceedings ASIAHORCS 2013

80 percent is absorbed by the people of Indonesia, so the food diversification program can be implemented by utilizing local resources. In addition to nature and its nutritional content, yam is considered reliable as commodity for food diversification for the availability is abundant and has higher yield potency. There is no single food that contains all the necessary nutrients for human body in sufficient amounts. To meet all the nutrients needed, it is required to increase the diversity of food eaten daily. With the combination of diverse consumption, nutritional elements of food will complement each other. Having yam in the daily diet will make our body healthier, grow well and smarter. Yam flour has starch which lasts longer in the intestines making it beneficial for microbes in the gut. The use of yam is also potential for liquid fertilizer ingredients, and bio-pesticide. The use of yam as staple food should be promoted integratedly, continuously and seriously. Promotion of yam as staple food should be carried out with well understood and adopted processing of yam tuber and flour as nice meals and other useful uses. Yam is found to have great potential as staple food for it can be found and cultivated in all areas of dry land throughout the country. Yam is already used as a base product for making pesticides and liquid fertilizers. Yam development opportunities as a supplement replacement for the basic ingredients of food products are very open and promising. Efforts to promote diversification of food commodities other than rice in our daily diet such as yam, provide meaningful legacy for the young generation of Indonesia and ASEAN countries in creating food security and food sovereignty in this region.

References Ahmad, L. A. W., Arista, & Murwoono. (2012). Removal of toxic hydrogen cyanide (HCN) in yam tubers using absorptive materials ash. Journal of Chemical Technology and Industry, 1(1), 14–20. Anonymous. (2001). Dioscorea hispida Dennst. Department of Health. 14 November 2001. Retrieved 20 September 2013. Anonymous. (2009). Processing for non-conventional Tubers. Retrieved from E-book Pangan.Com. Anonymous. (2013a). Cultivation of yam ((Dioscore hispida Dennst). Retrieved from http:// cybex.deptan.go.id. Anonymous. (2013b). Dioscorea: Many unanswered alternative food exploited. Crops Research Institute for Legumes and Tuber Crops. Department of Agriculture. February 21, 2013. Retrieved October 5, 2013. Anonymous. (2013c). Yam tuber, as food alternative, pesticides, and liquid fertilizer. Retrieved from http://cybex.deptan.go.id. Banaag, A., Honda, H., & Shono, T. ((1997). Effect of alkaloids from yam, Discorea hispida Schlussel on feeding and development of larvae of the diamondback moth, Plutella xylostella (Lepidopteraponomeutidae). Bioresources for food 109

Budiono, S. (1998). Effect of combination of ash and salt and length of submerge on the quality of yam chips. Thesis. Post Harvest Technology Department, Faculty of Agriculture, University of Brawijaya, Malang. Chung, R. C. K. (2001). Dioscorea L. In van Valkenburg, J. L. C. H., & Bunyapraphatsara, N. (Eds.) Proseabase., plant resources of south east asia no. 12(2): medicinal and poisonous plant. Bogor: PROSEA (Plant Resources of South-East Asia) Foundation. Accessed`on: 16 April 2010. Damardjati, D., Widowati, & Suismono. (1993). Developing a cassava industry system. Research Institute for paddy rice, Sukamandi, Subang, West Java, Indonesia. Fajar, Y.S., Olivia, S., Rostamah, R., Susani, H. S. Z., & Retnowati, I. (2006). Yam as pesticide in paddy rice field. Bogor: Bogor Agriculture University. Flach, M., & Rumawas, F. (1996). Plant resources of south east asia no. 9. plants yielding non-seed carbohydrates. Leiden: Backhuys. Hasanah, M., Tangkas, I. M., & Sakung, J. (2012). Power of natural insecticides from combining the juice of yam tubers (Dioscorea hispida Dennst) with extracts of tobacco (Nicotiana tabacum L.). Journal of Chemical Akad, 1(4), 166–173. Hudzari, R. M., Samad, M. A. H. A., Rizwan, Y. M., Abdullah, A. B. C., & Fauzan, M. Z. M. (2011). Modification of automatic alkaloid removal system for dioscorine. International Journal of Agronomy and Plant Production, 2 (4), 155–161. Janagam, R., Siddeswaran, D., & Kumar, R. (2008). The biochemical effects on occupational of workers to HCN on cassava processing industry. Indian Journal of Science and Technology, 1(7), 1–4. Juarini. (2006). Condition sand food policy in Indonesia. Journal of Economic Dynamics Social, 7(2). Yogyakarta: UPN Veteran. Koswara, S. (2012). Technology of tuber plants processing. Southeast Asian Food and Agricultural Science and Technology (SEAFAST) Center Research, an Community Service Institution. Myoda, T., Matsuda, Y., Suzuki, T., Nakagawa, T., Nagai, T., & Nagashima, T. (2006). Identifica- tion of soluble proteins and interaction with mannan in mucilage of Dioscorea opposita Thunb (Chinese yam tuber). Food Sci. Technol. Res. 12(12), 299–302. Nurhayati. (2007). Effects of a number of plant extracts on the growth ofColletotrichum capsici, the cause of Antraknosa of Chilli fruit. Research Journal Rafflesia,(1), 9 32–35. Bengkulu: Agriculture Faculty, University of Muhammadiyah Bengkulu. Rahayu, S. (2010). Active compound of antiate yam tuber (Dioscorea hispida dennts). Journal of Chemistry, 4(1), 71–78. Shewry, P. R. (2003). Tuber storage protein. Annals of Botany, 91 (7), 755–769. Soeseno, S. (1985). Vegetables for less nutrition, p.101–103. Jakarta: Penebar Swadaya. Tropical Products Institute. (1973). Root crops. Tropical Products Institute. London. RI State Law No.7 of 1996 on food security. Winarno, F. G. (1992). Food chemistry and nutrition. Jakarta: Gramedia.

EGG Production Trait of Indonesian Domestic Ducks Inferred from Analysis of an SNP Genotypes in The 5th Exon of Prolactin Gene

Dwi Astuti* and Siti N. Prijono Research Centre for Biology, Indonesian Institute of Sciences

Abstract Various approaches to increase eggs production of Indonesian domestic ducks are very essential things. Superior ducks that have high eggs productivity are needed in supporting food security in Indonesia. Thus, this study genetically informs the presence of single nucleotype polymorphism (SNP) in the th5 exon of prolactin (PRL exon5) gene to determine egg production trait of 4 Indonesian domestic ducks. This study applied the SNP(C5961) that was found by literature searches. Total DNA was extracted from blood taken from each individual of 93 ducks consisted of 24 Tegal ducks, 25 Magelang ducks, and 22 Mojosari ducks, and 22 Boyolali ducks. A single DNA fragment PRLexon5 was amplified by PCR, and sequenced. DNA sequences aligment showed that SNP (C5961T) was equal with SNP (C97T) of our sequenece data. Therefore, this genotypes study analysis was focused on the SNP(C97T). Sequence genotypes informed that majority of the examined ducks had TT genotype that exhibited low egg weight and production traits. Only three ducks have the CC genotype and 25 ducks have CT genotype. The CC and CT genotypes were exhibited high egg production and big egg. This study might be used for further breeding strategy program to improve the quality of Indonesian domestic ducks. Keywords: SNP, prolactin gene exon 5, egg production trait, genotype, Indonesian domestic ducks

*Corresponding Author Jln. Raya Bogor Km 46, Cibinong, Bogor 16911, Indonesia E-mail: [email protected]

Introduction Indonesia has several domestic duck strains, including tegal duck, magelang duck, and and so on. Duck egg has become an important source for animal protein in human diet. Recently, consumption of eggs have been increasing. Therefore, the duck eggs productions have improved and several approaches have been done. Selecting for superior character is one of many efforts to improve the genetic quality, to maintain genetic purity and to increase productivities of livestock (Philipson and Rehe, 2002). Some selection programmes through morphological characters and molecular analyses have been done, particularly for detecting the presences and linkages between gene markers with egg productivity of poultry. Several DNA markers associated with various reproductive traits have been found, such as single nucleotide polymorphism (SNPs) in Prolactin (PRL) gene for eggs production trait. Prolactin (PRL) is one of the polypeptide hormones

111 112 Proceedings ASIAHORCS 2013

which are synthesized and secreted by anterior gland pituary animal (Sharp et al., 1988), and consists of five exons and four introns (Jiang et al., 2005). In recent years, the polymorphism of the cPRL gene was reported (Cui et al., 2005; Cui et al., 2006) and the correlation between the gene polymorphism and egg performance had also been analyzed (Cui et al., 2006). The presence of SNPs in the chicken’s PRL significantly associated with incubation behavior and egg production. They are very useful as molecular markers for egg production (Liang et al., 2006). Three of SNPs in the 5’-proximal region of the PRL shows a genetically positive effect on eggs production (Jiang et al., 2009). For ducks, prolactin gene associated with eggs performances (Fang et al., 2009) and an SNP (C5961T) in the 5th exon of prolactin gene was significantly assocciated with egg production and egg weight of China ducks (Wang et al., 2011). How egg production traits of Indonesian domestic ducks are genetically expressed is still not well known. The present study applied the SNP (C5961T) of the 5th exon of prolactin gene to detect the genotype sequence of individual duck and to assume the egg production trait of Indonesia domestic ducks. The knowledge of eggs production traits, and the techniques of molecular approaches from this study may provide some prospects in duck’s breeding selection program and breeding management strategy in Indonesia. Hopefully, it has implication at increasing eggs production and supplying protein of animal to humans.

Materials and Methods Blood sampling. Ducks blood were sampled from each individual living duck in the original location/city, including Tegal, Magelang, and Boyolali (Central Java), and Mojokerto (East Java). Totally, 93 blood samples comprised of 24 tegal ducks, 25 magelang ducks, 22 mojosari ducks, and 22 pengging (Boyolali) ducks. Each blood sample was preserved in 2 ml tube containing ethanol absolute (96%), and then kept in the refrigerator (4°C) before use. Extraction, amplification, and sequencing of DNA. Total DNA was extracted from 5–20 mg of each blood sample using standard methods of cell lysis, Proteinase K digestion, extraction with phenol-chloroform, and ethanol precipitation (Arctander, 1988). DNA solutions were checked by 1% agarose gel electrophoresis and staining by Ethidium Bromide. Then DNA was used as a template in the PCR proccess. The PCR reactions were performed in a 20 uL final volume, containing 1 uL DNA, 1×PCR buffer, 0.5 µM of each primer, 25 mM of dNTPs, 2.0 mM MgCl2 and 0.2 units Taq DNA Polymerase. A single fragment of PRL exon 5 gene was amplified using a primer pair (Wang et al., 2011) in PCR conditions; 5 minutes at 94°C followed by 35 cycles of 30 seconds at 94°C, 30 seconds at Bioresources for food 113 annealing temperature, 30 seconds at 72°C, and a common final extension at 72°C until removal from the machine. Samples were purified with polyethilyne glicol (PEG), and then it was used for DNA sequencing. DNA was sequenced in the ABI 3100 DNA sequencing machine. DNA sequence alignment and sequence genotypes analyses. DNA sequences were aligned manually using ProSeq software without difficulties because of their similarity and no gaps were required to maintain the reading frame. No double band pattern was found in the analysed samples. Our sequence data were aligned together with sequence data of Anas from gene bank. From this aligment, we considered the posistion of SNP (5961) in our sequence data. Then the sequence genotypes of CC, CT, and TT were indentified.

Results and Discussion A single DNA fragment, approximately 460-bp (base pairs) of PRL exon 5, gene was amplified from each sample. The DNA sequence data of PRL exon 5 of 93 Indonesian domestic ducks (24 tegal ducks, 25 magelang ducks, 22 mojosari ducks, and 22 boyolali ducks) have been obtained. Based on the present data, the alignment analyses of DNA sequence show that the sites of SNP (C5961T) in the PRL exon 5 gene was equal with SNP (C97T) in the sequence data of examined ducks. Therefore, this study focused on the site of SNP (C97T). There were three genotypes (CC, CT and CT). The CC and CT genotypes indicated superior egg weight and production traits in which CC is higher than CT. While TT genotype indicated low egg weight and production traits (Wang et al., 2011). A profile of sequence genotypes CC, TT, and CT, and fragment genotypes of the PRL gene exon-5 is shown in Figure 1. In detail, genotype frequencies in 5 duck strains in the present study are presented in Table 1 .

97C 97T 97C/T

Figure 1. Profile of sequence genotypes: CC, TT and CT of SNP C97T in the DNA sequences of PRL exon 5 of Indonesian domestic ducks. 114 Proceedings ASIAHORCS 2013

Analysis of PCR-RFLP at restriction Enzyme Pst1 resulted that Pst1 site in the PRLexon5 is being digested into three genotypes CC (400 bp), TT (254 bp and 146 bp), and TC (400 bp, 254 bp, and 116 bp). Pst1 site in the PRL exon 5 detected two (CC and CT) genotypes, and CC genotype could be advantageous genotype on egg production and egg weight (Wang et al., 2011) (Figure 2).

Figure 2: PCR-Pst1-RFLP of duck PRL gene (Wang et al., 2011)

Table 1. Genotype frequencies at PRL exon5 of 5 Indonesian domestic duck strains. PRL exon 5 (egg production and egg weight) duck strain Number Genotype frequencies CC TC TT

Tegal 24 0.000 (0) 0.125 (3) 0.875 (21) Magelang 25 0.040 (1) 0.160 (4) 0.800 (20) Mojosari 22 0.045 (1) 0.227 (5) 0.628 (16) Boyolali 22 0.045 (1) 0.590 (13) 0. 365 (8)

Note: CC and CT = superior trait of egg weight and production (CC was higher and bigger than CT), TT = low trait of egg weight and production.

Tabel 1 informed that the majority of 65 examined ducks ( 70.00%) had homozygote TT genotype. Only three ducks had the homozygot CC genotype ( 3.15%) consisted of 1 of magelang duck, 1 of mojosari duck, and 1 of boyolali duck. The remaining 25 ducks had CT genotype ( 26.85%). The results assumed that the majority of the examined ducks in this study had a genetic trait that reflects to the low egg weight and production. Among the four examined duck strains, boyolali ducks had the highest heterozygote CT genotype (43.33%), following by mojosari, magelang, and tegal ducks, respectively. The differences of genotypes in different duck population may be ascribed to the different genetic background Bioresources for food 115 of these population (Wang et al., 2011) or different genetic background of the domestic duck strains. The practice of genetic improvement aims to improve the average performance of group animals. This is possible if we can change the gene frequencies, seeking an increase in favourable alleles. Considering the parents transmit alleles (not genotypes to the progeny), it is necessary to know the value associated with allele instead of genotype, that is, the average effect of base substitution. In addition, in population with the presence of a heterozygote, it is important to estimate the interaction value of the allele (dominance effect) (Changet al., 2012). Based on this SNP marker, genetically, to increase the superior ducks that have high eggs production trait it is neeeded needed ducks with homozygote CC and heterozygote CT genotypes. In the next breeding program, the ducks with CC and CT genotypes should be selected and used as parents, and ducks with TT genotype should be calling. But, of course, despite genetic character the others factors (food, healthy and so on) also should be improved to get the optimal eggs production.

Conclusions The conclusions of this study are 1) The majority (70.00%) of examined Indonesian domestic ducks, genetically have low egg weight and production traits, 2) the pengging (boyolali) ducks have the best egg productivity trait (43.33%) than other four examined duck strains. Therefore, in obtaining some better egg weight and production traits, we need to develop mating strategy for ducks, in which each parent has to have the superior traits of CC or CT genotype that can be expected to produce breeds which have a superior CC genotype. Hopefully, the strategy can increase duck eggs production and can support food security in Indonesia.

Acknowledgement Thanks to the farmers, staffs and Head of Department of Animal Husbandry in the Government District of Magelang, Tegal, Mojokerto, and Boyolali cities. Thanks to Asc. Prof. Dr. Hitoshi Suzuki, Graduate School of Environmental Earth Science-Hokkaido University Japan and to Non-Degree Scholarship Program of Indonesia Ministry of Research and Technology for their supports. 116 Proceedings ASIAHORCS 2013

References Arctander, P. (1988). Comparative studies of DNA by restriction fragment length polymorphism analysis: convenient procedures based on blood samples from live birds. J. Ornith., 129, 205–216. Cui, J. X., Du, H. L., & Zhang, X. Q. (2005). Polymorphisms and bioinformatics analysis of chicken prolactin gene. Hereditas (Beijing) 27, 208–214. (article in Chinese with an abstract in English). Cui, J. X., Du, H. L., Liang, Y., Deng, X. M., Li, N., & Zhang, X. Q. (2006). Association of polymorphisms in the promoter region of chicken prolactin with egg production. Poult. Sci., 85, 26–31. Chang , M. T., Cheng, Y. S., & Huang, M. C. (2012). Novel genetic marker of the Carbonic Anhydrase II gene associated with egg production and reproduction traits in Tsaiya ducks. Reprod. Dom. Anim., 10. 111/j: 1439–0531. Fang, H. L, Zhu, W. Q., Chen, K. W., Zhang, T. J., & Song, W. T. (2009). Association of polymorphisms in the intron 1 of duck prolactin with egg performance Turk. J. Vet. Anim. Sci., 33(3), 193–197. Jiang, R. S., Xu, G. Y., Zhang, X. Q., & Yang, N. (2005). Association of polymorphisms for prolactin and prolactin receptor genes with broody traits in chickens. Poult. Sci., 84, 839–845. Jiang, R.S., Zhang, L. L., Geng, Z. Y., Yang, T., & Zhang, S. S. (2009). Single nucleotide polymorphisms in the 5’-flanking region of the prolactin gene and the association with reproduction traits in geese. South African Journal of Animal Science, 39(1). Liang, Y., Cui, J., Yang, G., Leung, F.C., & Zhang, X. (2006). Polymorphisms of 5’-flanking region of chicken prolactin gene. Domest. Anim. Endocrinol., 30, 1–16. Philison, J., & Rege, J E. O. (2002). Sustainable breeding programes for tropical farming systems. Module 3. Animal genetics training resources (CD-ROM) Version I.ILRI-SLU. Sharp, P. J., Macnamee, M.C., Sterling, R.J., Lea, R.W., & Pedersen, H.C. (1988). Relationship between prolactin, LH and broody behavior in bantam hens. J. Endocrinol., 118, 279–286. Wang, C., Liang, Z., Yu, W., Feng, Y., Peng, X., Gong, Y., & Li, S. (2011). Polymorphism of the prolactin gene and its association with egg production traits in native Chinese ducks. South African Journal of Animal Science, 41(1), 63–69. Production and Quality Improvement of Mud Crab (Scylla serrata) using Silvofishery to Increase Food Security and to Conserve the Mangrove Resource in Berau East Kalimantan

Triyanto1*, Nirmalasari Idha Wijaya2*, Sutrisno1*, Ivana Yuniarti1*, Fajar Setiawan1*, Fajar Sumi Lestari1*, and Tri Widiyanto1* 1)Research Center for Limnology, Indonesian Institute of Sciences 2)University of Agricultural Sciences STIPER East Kutai

Abstract Mud crab (Scylla serrata) is one of the main bioresources which has important economic value in mangrove ecosystem. As a source of food, the crab is very popular and becomes one of favorite food for most Indonesians. Currently its production mostly depends on capture activities. The declining of mud crab population has been reported in several places in the country. Some of the main problems causing the declining of mud crab production is degradation of its environment, uncontrolled mangrove area conversion into shrimp pond culture, and over fishing conditions. This research was conducted to develop the best silvofishery technique to boost mud crab production. The study site was Bingkar, Teluk Semanting Village in Berau District. It was conducted within two periods (May-June and September-October 2013). Mud crabs were cultured using silvofishery pond combined with the cell system technique. There were 120 individuals categorized in two groups of mud crab size (e.g. group A. 137 ± 29 g and group B 365 ± 98 g) stocked in 25 x 30 x 25 cm cell system. The crabs were fed with small fish (3–5% total body weight every day) for 15 days.The results showed that mud crab in group B (34 ± 24 g) had higer increment body weight than other group. The better quality of mud crab determined by harder carapace was also shown by group B (86.67%). Based on profit and cost ratio (P/C Ratio), group B (P/C=1.19) was more provitable than Group A (0.43). The significance of this research is provision of an alternative livelihood for the people living in coastal area. More important aspect is it can enhance a better mangrove forest mangement. Keywords: Mud crab, bioresources, mangrove, silvofishery, Berau, and East Kalimantan

*Corresponding Author Jln. Raya Bogor Km 46, Cibinong, Bogor 16911, Indonesia E-mail: [email protected]

Introduction Mud crab (Scylla serrata) is an economically important fisheries commodity in Indonesia and Indo-Pacific area. This biota has a qualified and delicious taste, especially the one who carries eggs in their belly. More important, crab meat contains 65.72% of protein and 8.16% of fat. The protein content is even higher in their ovaries (8.16%) and the fat content is lower (0.88%) (Kasry, 1996; Susanto, 2008; Maryanto, et al., (ed), 2013). Even though it has been revealed

117 118 Proceedings ASIAHORCS 2013

that it contains low saturated fat, it is also proven that good nutrition such as vitamin B12, phosphorous, zinc, copper, and selenium are also contained in their bodies. In addition, Australian Fisheries Research and Development Corporation has also signified that the crab contains 22 mg Omega-3 (EPA), 58 mg Omega-3 (DHA), and 15 mg Omega-6 (AA) (Kasry, 1996; Susanto, 2008). Based on Indonesian Fisheries Statistic issued by Indonesian Ministry of Marine and Fisheries, mud crab production in the country reached 34.270 tonnes or 60% from the total fishery production in 2011. Furthermore, Indonesia employed 60% of United States’s crab market in the same year. Combining the production and the extent of mangrove area approaching 4.25 million ha, the country aims to be the greatest crab exporter in the world. Even though its significance has been recognized, there is a very small amount of crab productions generated from aquaculture and most of them use capturing method. Berau District, East Kalimantan Province is a potential mud crab producer. It covers 47,349 ha mangrove area (Setiawan and Triyanto, 2012). This district produced 335.2 tonnes mud crab in 2011 or for about 1% of Indonesian crab production (Berau District Agency of Indonesian Ministry of Marine and Fisher- ies, 2011). As well as the national crab production, this amount was obtained from capture fisheries. Although the district has enormous resources to support crab production, the crab declining capture has been experienced by the fishers. The data provided by Anonymous (2009) showed that East Kalimantan crab trade volume declined for about 50% from 2006 to 2008. Mangrove degradation over the district is appointed to be the main cause of this matter. Moreover, uncontrolled mangrove conversion and overfishing also share the same responsibility to this matter. Kompas (2003) reported that mangrove conversion was at the extent of 450 ha in 1997 and 4,000 ha in 2003. Further, the degradation of habitat area and the two other factors are not only contributing to the declining quantity of crab production, but also affecting the crab quality. Triyanto et al., (2012) found that 22–23% of captured crabs in Berau District are in low quality. It is implicated from empty crabs and crabs with incomplete organs. To improve the yield and quality of crab production, aquaculture is an imperative technology that should be considered seriuosly. Crab culture is already well known in several South Asian Countries which use pond and a pen culture system integrated with mangrove area (Mwaluma, 2002; Shelley and Lovatelli, 2011). In Indonesia, an extensive crab culture mixed with shrimps, milk fish, and sea bass is also widespread. In addition, raising activities are also popular in Bone and Maros (South Sulawesi) and Tarakan (East Kalimantan). Bioresources for food 119

Silvofishery is a growing sustainable aquaculture method which can be utilized as a crab production booster. The system was introduced in 1976 by Perum Perhutani as a sustainable alternative aquaculture method. According to Primavera (2000), this system integrates fish culture with mangrove management. Meanwhile, Quarto (2005) cited in Gunawan et al., (2007) stated that this system is a sustainable integration of mangrove culture with pond system with low input. The system is considered to provide economic benefit for local people as well as to conserve mangrove area. Regarding the needs of crab production increment in Berau District and the significant importance of silvofichery, this research was conducted on the district area. It is objected that the applied silvofishery system can increase the yield of crab production and to improve the quality of it. Furthermore, the provision of crab culture can provide an alternatif livelihood for the locals and also supply sufficient protein source for them.

Methodology Place and Time of TheR esearch. Two periods of research were choosen, May– June and September–October 2013 in Bingkar, Teluk Semanting Village, Berau District, East Kalimanatan. The coordinate of the research site is E:02o07’928”; N:117o53’384”. Research Activities. There were 3 activities group done in this research. They are as follows. Culture site preparation. The culture site was abandoned shrimp ponds which had been grown by mangrove trees. The prepared size was 20 x 70 m2 and within this pond cell cages were built to rear the crabs. The size of each wooden cage was 1 x 2 cm and the length was 2 m (Figure 1). Then, the cages were systematically arranged with ±1 cm distance between each of them. It should be noted that 10 room separators (25 x 30 x 25 cm) were placed within each cage (Figure 1). Stocked crab preparation. There were two sized groups prepared for the initial stocking. The first group (reffered as Group A) contained 60 individuals with size 137 ± 29 g. The crabs were then reared from May to June 2013. The same number of crabs were stocked in September to October 2013 as the second group (Group B). The crab size categorized in this group was 365 ± 98g. The crabs were obtained from local capture using rakang (trap net). The prepared crabs were in the low quality products (empty crab) and they were tied with palstic rope before they were stocked. 120 Proceedings ASIAHORCS 2013

Figure 1. Cell system applied in the silvofishery pond in Bingkar, Teluk Semanting Village-Berau District

Crab rearing. The crabs reared for about two weeks (15 days) were fed with 3–5% of body weight with trash fish. The feeding was done twice a day (morning and afternoon). Observation. During and after crab rearing, some data were collected to obtained the aimed results. The observed parameters were: Total weight. Both initial and 15 day weight were measured with digital weigher with 1 gram accuracy. Water quality. Weekly measured physical water parameters were pH, temperature, dissolved oxygen (DO). Whilst, Chemical parameters (i.e. total organic matters/ TOM, total suspended solid/TSS, total nitrogen/TN, total phosphorous/TP and

ammonium nitrogen/NH4-N) were only measured once in each time period. The analysis of the observed water quality was conducted by referring to Method (APHA, 2000). Quality of crabs (Carapace hardness). Quality of mud crab was determined based on carapace hardness indicating that the content of the mangrove crab meat is very good. Assessment was done by pressing the bottom of the body (Abdomen part) of mud crab. (Figure 4). If the body part feels hard pressed then the crabs were good quality (full crab). If it feels soft when pressed, the crab was low quality (empty crab). Simple financial analysis. Simple analysis was done to determine the level of financial benefits. The analysis based on profit cost ratio (P/C Ratio) calculation. Calculation based on operational costs includes the cost of purchasing seed and feed crabs and benefits based on the sale of crabs. Bioresources for food 121

ResultS and Discussion Weight Increment and Carapace Hardeness. Weight increment of stocked crab is presented in Table 1. While, Table 2 shows the percentage of crabs which had hard carapace and the crabs which did not. It can be presumed from Table 1 that Group B crabs gave more weight increment (34 ± 24 g) than the Group A did (16 ± 10 g). Thereafter, it can be concluded from Table 2 that a better crab quality was also provided by Group B. It can be seen that 86.67% crabs in this group developed hard carapace compared to 83.3% of the crabs in Group A. Figure 2 and 3 specifically illustrate the weight increment of each individual in Group A and B respectively. At the same manner, Figure 4 shows crab quality improvement represented by hard carapace due to applied silvofishery technique.

Table 1. The crabs’ weight increment Weight (g) Number Age (days) Group A Group B 1 Initial (average) 137±29 365±98 2 15-day (average) 153±32 399±101 3 Increment (average) 16±10 34±24 4 Initial (total) 8,228 21,870 5 15-day (total) 9,190 23,524

Table 2. Quality of the crabs determined by the carapace condition Percentage quality of the crabs Number Carapace condition Group A (%) Group B (%) 1 Hard (Full crab) 83.33 86.67 2 Soft (empty) 16.67 11.67

Figure 2. Individual weight increment of the crabs in Group A 122 Proceedings ASIAHORCS 2013

Figure 3. Individual weight increment of the crabs in Group B

The weight increment of crabs in Group A is 6.9% lower than that of Group B. This condition can be resulted by more frequent moulting experienced by the smaller crabs (Group A). Shelley & Lovatelli (2011) stated that S. serrata needs to moult up to 15 times before reaching 150 mm carapace length. As a comparison, an experiment conducted by Duraisamy, et al., (2009) in the Phillipines reported that within 20–30 days a grow out experiment could achieve 40–50 g/individual weight increment. The experiment was done to the crabs with initial size 500–750 g. The feed given to the crabs were 10% of body weight consisting trash fish, small molluscs, shrimps, and small crabs. Another example is presented by an experiment in Bangladesh where a bamboo compartement placed inside a pen culture system gave 10.81–16.24 g weight increment. The experiment was done with the average crab’s initial weight 204.42 ± 2.58 gr fed with 8% of body weight using tilapia (Shah et al., 2009). These comparisons highlight the significant results of this research. It can be seen that silvofishery gives more output with smaller input compared to other culture methods. This benefit can be achieved as silvofishery combined the natural and man made environment. Thus, this method provides the crabs with natural food; hence, the crabs still consumes both natural and given food. Effendie (1997) explained that food availability is one of the most important factors which affects population density, reproduction, condition, and population dynamic in an area. Water Quality Conditions. Besides food, appropriate environmental condition is another circumstance that should be considered to get the optimum growth of the crabs. Hence, water quality condition was measured and the results are summarized in Table 3. The water quality for Group A was measured from May to June, whilst, the Group B’s was measured from September to October 2013. Bioresources for food 123

Overall, the measured water quality conditions were still appropriate for supporting the life of mud crabs. The thing to consider is the discrepancy of salinity level between the water of Group A and Group B. The salinity level of Group A’s water is considerably higher than that of Group B’s since the experiment of Group A was conducted in dry season. More differences were seen from the measurement of pH and Ammonium which was respectively higher and lower than the condition of Group B. These differences may also affect the different results obtained from Group A and B. Although there were some discrepancies, both conditions were still appropriate to support mud crab. ProfitC ost Ratio (P/C Ratio) and Fattening of Mud Crab Prospective Using SilvofisheryS ystem. As an economically valuable resource, mud crab production is potential to be developed in a sustainable aquaculture system. Silvofishery as one of the sustainable aquaculture alternatives is proven by this research to increase the yield and the quality of crab production. Thus, this technique should be developed to provide a sustainable alternative livelihood for coastal people. Moreover, it is to show that it provides financial benefit for local people. A simple financial analysis was done in this research. The results show that silvofishery is a financially profitable system for Group B with P/C ratio 1.19 in contrast to Group A with P/C ratio 0.43 (Table 4).

Figure 4. Hard carapace representing better crab quality due to application of silvofishery technique.

The less profitable result shown by Group A might be caused by its small seed size which still generated more moulting. This moulting factor combined with its very limited rearing period (for about two weeks) created less beneficial results than expected. According to Shelley & Novateli (2011), a mud crab fattening system should be taken place within 20–30 days. Moreover, seed quality and size could give contribution to this concerned matter. 124 Proceedings ASIAHORCS 2013

Table 3. Water quality condition of the silvofishery ponds Group A Group B No Water Quality Parameters (Mey-June 2013) (Sept-Oct 2013) Ambience level

1 Salinity (ppt) 21.2 ± 3,5 15.4 ± 3.5 10-251) 2 Temph (oC) 30.1 ± 2,0 30.7 ± 2.4 25-32 1) 3 pH 7.05 ± 0,04 7.27 ± 0.46 7.5-8.5 1) 4 DO (mg/L) 4.74 ± 0,60 5.87 ± 2.08 >4 2) 5 TOM (mg/L) 20.820 32.10 - 6 TP (mg/L) 0.005 0.03 0.016-0.386 3) 7 TN (mg/L) 2.607 1.43 0.393-6.1 3) 1) 8 N-NH4 (mg/L) 0.360 0.05 <0.25 9 TSS (mg/L) 62.4 77.20 - Notes: Ambience level for mud crab life by Shelley & Lovateli (2011). Ambience level for biota life by Cholik & Hanafi (1992); Susanto & Murwani (2006). Ambience level for biota life by Ryding & Rast (1989)

Regardless, the less profitable result was shown by Group A, while Group B still presents a financially beneficial results and more importantly, the silvofishery system also shows positive impacts to the crab quality improvement. Based on the research conducted Triyanto, et al., (2012) there are 22–33% low quality captured crab in Berau District which can be used as seeds for silvofishery system. Hence, if a silvofishery system can improve the quality, a much higher post harvest value must be obtained as the result. This assumption is supported by Liong (1992) cited in Shah et al., (2009) crab quality improvement system is considered highly beneficial due to its vast period, low operational cost, high survival rate, and high marketable suitability. The short period of the system is siginificantly important to avoid disease break (Duraisamy et al., 2009). After all, silvofishery is still financially considered as a good alternative system to be developed. Furthermore, silvofishery as an integrated aquaculture approach supports both economic activities and mangrove sustainability. The sustainability of mangrove as the natural habitat gives reverse positive impacts to the culture’s water quality since the ecological cycle is still well maintained. Thus, balancing the appropriate stocking size, environmental condition, cell system, and sufficient rearing period will further make silvofishery as an ideal brackish water aquaculture system. Bioresources for food 125

Table 4. P/C ratio of the experiment No. Economy Group A Group B Value Quantity Price (Rp) Total (Rp) Quantity Price (Rp) Total (Rp) 1. Seed of crab (kg) 8,228 12,000 98,736 21,870 12,000 262,440 2. Feed (kg) 10 3,000 30,000 20 3,000 60,000 Total operational - - 128,736 - - 322,440 3. cost(Rp) [(1) + (2)] 705,720

4. Revenue (Rp) 9,190 20,000 183,800 23,524 30,000 5. Profit (Rp) - - 55,064 383,280 [(4) – (3)] 6. P/C Ratio - - 0.43 - - 1.19 [ (5) / (3) ]

ConclusionS Both yield and quality of mud crab production can be improved by using silvofishery combined with cell system. This improvement will further increase the benefit of crab trading. Thus, the system is a financially beneficial to be developed to provide a livelihood alternative for coastal people. The system is also a sustainable way to maintain mangrove sustainibility.

Acknowledgement Our main acknowledgement is submitted to the Competitive Program of Indonesian Institute of Sciences (LIPI) Subprogram Ketahanan Wilayah dan Daya Saing dan Masyarakat Pesisir Tahun 2013 which has funded for the project research. In addition, we wish to provide our gratitude to the Berau District Fisheries Government Office. Mr. Kaharudin and his family and Mr. Ajjerul Mustakim (The headchief of Teluk Semanting Village) who helped and supported us during the research.

References APHA. (2000). Standard methods for the examination of water and wastewater. 19th ed. Washington DC. Anonymous (2003). 4.000 hektar hutan mangrove delta berau habis dibabat. Kompas. Retrieved from http://www.kompas.com/kompas-cetak/0310/21/daerah/636741.htm at August 28, 2011. Anonymous. (2009). Laporan balai karantina ikan kelas I sepinggan balikpapan tahun 2009. Cholik, F., & Hanafi, A. (1992).A Review of the status of mud crab fishery and culture in Indonesia, p. 3–6. Jakarta: Central Research Institute for Fisheries. 126 Proceedings ASIAHORCS 2013

Duraisamy, S., Senthil, K. V., Nagaraja, C., Sanjeeviraj, G., Vijay, R. S., & Sudha, N. (2009). Crab fattening alternative livelihood for fisher women. MS Swaminathan Research Fondation. Retrieved from (www.mssrf.orgdownloaded at August 3,2012) DKP-Kab.Berau. (2011). Statistik perikanan kabupaten berau. Berau: Dinas Perikanan dan Kelautan Kabupaten Berau Effendie, M. I. (1997). Biologi perikanan. Yogyakarta: Yayasan Pustaka Nusatama. Gunawan, H., Chairil, A., Reny, S., & Endang, K. (2007). Peranan silvofishery dalam peningkatan pendapatan masyarakat dan konservasi mangrove di bagian pemangkuan hutan ciasem- pamanukan, kesatuan pemangkuan hutan purwakarta. Info Hutan, IV(2), 153–163. KKP. (2010). Kelautan dan perikanan dalam angka 2009. Jakarta. KKP. (2011). Statistik ekspor perikanan. Berbagai tahun. Jakarta. Kasry, A. (1996). Budidaya kepiting bakau dan biologi ringkas. Jakarta: Bharata. Mwaluma, J. (2002). Pen culture of the mud crab Scylla serrata in mtwapa mangrove system, kenya. Western Indian Ocean J. Mar. Sci. Vol. 1(2), 127–133. Maryanto, I., Joeni, S.R., Sasa, S.M., Wahyu, D., Djauhar, A., Siti, R.A., Yopi, S., & Dwi, S. (eds.). (2013). Bioresources untuk pembangunan ekonomi hijau. Jakarta: LIPI Press. Primavera, J. H. (2000). Integrated Mangrove Aquaculture System in Asia Integrated Coastal Zone Management, pp. 121–130. Autumn ed. Ryding, S. O., & Rast, W. (1989). The control of eutrophication of lake and reservoirs. Paris & U.K: UNESCO and The Parthenon Publishing Group. Shelley, C., & Lovatelli, A. (2011). Mud crab aquaculture: A practical manual. FAO Fisheries And Aquaculture Technical Paper 567. Susanto, G.N., & Murwani. (2006). Analisis secara ekologis tambak alih lahan pada kawasan potensial untuk habitat kepiting bakau (Syclla spp.) Prosiding Seminar Nasional Limnologi 2006, pp. 284–292. Bogor: Puslit Limnologi-LIPI. Susanto, G. N. (2008). Peneluran kepiting bakau (Scylla sp.) dalam kurungan bambu di tambak berdasarkan pengamatan tingkat kematangan gonad. Proceeding Seminar Hasil Penelitian dan Pengabdian Kepada Masyarakat UNILA, pp. 300–309. Shah, M. B. M. M. R., Mamun, A. A., & Alam, M. J. (2009). Comparative study of mud crab (Scylla serrata) fattening practices between two different systems in bangladesh.J. Bangladesh Agril. Univ. 7(1) 151–156. Setiawan, F., & Triyanto. (2012). Studi Kesesuaian Lahan untuk Pengembangan Silvofishery Kepiting Bakau di Kabupaten Berau, Kalimantan Timur. Limnotek, 19(2), 158–165. Triyanto, N. I.W., Tri, W., Ivana, Y., Fajar, S., & Sumi, F. L. (2012). Pengembangan Silvofishery Kepiting Bakau (Scylla serrata) dalam Pemanfaatan Kawasan Mangrove di Kabupaten Berau, Kalimantan Timur. Prosiding Seminar Nasional Limnologi VI 2012, pp. 739–751. Bogor: Puslit Limnologi-LIPI. Low-Fat Duck Meat Production Through Suplementation Seed Papaya (Carica papaya L.) as Feed Additive

Rini Rachmatika1,*, Supadmo2, Zuprizal2, Siti N. Prijono1 1) Research Center of Biology-Indonesian Institute of Sciences (LIPI) 2) Animal Science Faculty, Gadjah Mada University

Abstract Duck meat as a source of animal protein has higher fat and cholesterol content than the other poultries. In this case papaya seeds containing tannins, flavonoids, and saponins can reduce the levels of fat and cholesterol content in meat ducks. This research aims to produce low-fat duck meat through the supplementation of various levels of seed papaya as feed additive. This experiment was designed using Completely Randomized Design (CRD) with four treatments; T0 = 0%; T1 = 0.3%; T2 = 0.6%; T3 = 1.2% of papaya seeds in feed. Each treatment has three replications with six ducks in each replicate. Data were analyzed by analysis of variance (ANOVA) using SPSS 16.0 and a Duncan’s multiple range test was used to determine the significant difference among the means at 5% level of significance.The results showed that crude fat in breast muscle was significantly decreased from 11.76 ± 0.58% (T0) to 6.84 ± 0.22% (T3). Crude fat in legs muscle were significantly decreased from 11.78 ± 0.47% (T0) to 6.73 ± 0.56% (T3). Cholesterol in breasts muscle was significantly decreased from 64.95 ± 23.7 mg/100g (T0) to 34.55 ± 22.94 mg/100g (T3). Cholesterol in leg muscles was significantly decreased from 64.86 ± 13.53 mg/100g (T0) to 47.49 ± 14.17 mg/100g (T3). Keywords: Duck, papaya seed, feed additive, lipid

*Corresponding Author Jln. Raya Bogor Km 46, Cibinong, Bogor 16911, Indonesia E-mail: [email protected]

Introduction Duck meat has good nutritional value and will be one of source animal proteins. Broiler, chicken, turkey, quail, and ducks as a source of protein derived from animal do contain cholesterol. High fat in the duck meat can cause health problems for humans who consume it like atherosclerosis. Lipid is an oily insoluble organic compound water which can be extracted from cells and tissues by nonpolar solvents such as chloroform or ether. Lipid has a single carboxyl group and a long nonpolar hydrocarbon that cause most of lipid components not soluble in water and look oily (Lehninger, 1982). At high concentrations, cholesterol could be a crystalised form, which has a melting point of 150–151 oC (Poedjiadi, 1994). Based on research conducted by Randa (2007), duck meat has fat amount of 10.69 ± 2.18 g/100 g and subcutaneous fat at 22.39 ± 1,97 g/100 g. Effect of papaya seeds to LDL levels on rat has been investigated by Nuraini and Orbayinah (2011), by giving papaya seed juice amounting to 400 mg/kgBB/day

127 128 Proceedings ASIAHORCS 2013 it can decrease plasma LDL effectively. Papaya seed flour can also be used as a feed substitute to corn flour in broilers up to 32% and has an effect on levels of glucose, protein and blood cholesterol, but is not significant (Nwaoguikpe, 2010). Based on phytochemical analysis conducted by Adeneye and Olagunju (2009), papaya seeds contain alkaloids, flavonoids, tannins, saponins, anthraquinones, and anthosianosides, whereas flavonoids, saponins, alkaloids and tannins have a hypolipidemic effect. This study aims to produce low-fat duck meat through the supplementation of fresh papaya seed as feed additive.

Materials and Methods In total, 72 male ducks (Raja) aged 7 days were divided into four groups (18 ducks each) and three replicates (6 ducks each). Four treatment groups with different doses of papaya seeds, T0 = 0%; T1 = 0.3%; T2 = 0.6% and T3 = 1.2%. Papaya seeds (Carica papaya L.) used in the experiments were selected from fresh and ripe fruit, and were separated from the fruit without being washed before. Fresh mashed papaya seeds were mixed into the feed directly. The feed formulation refers to the NRC (1994) for starter and finisher phase (Table 1.). Feeding times at 07.00 am, 12.00 am, and 16 .00 pm. Feed was given controllably while water was given ad libitum. Ducks were farmed after 6 weeks rearing. The variables measured were meat chemical quality (AOAC, 2005) including water, ash, fat and protein and meat cholesterol testing with Liebermann-Burchard method. This was conducted using Completely Randomized Design (CRD). Data were analyzed by analysis of variance (ANOVA) using SPSS 16.0 and a Duncan’s multiple range tests used to determine the significant difference among the means at 5% level of significance (Steel and Torrie, 1993).

Results and Discussion The average chemical content of breast meat and thigh meat ducks can be seen in Table 2 and 3. Water content of the local duck thigh meat aged 10 weeks is 74.98 ± 0.53% (Riskawati, 2006). That is similar with Hustiany (2001) that the water content of local duck thigh meat is 73.31% and 75.82% for breast meat respectively. The highest water content on breast meat in this research is T1 (80.17 ± 1.52%) and the lowest is T2 (78.62 ± 0.63%), whereas for thigh meat, the highest water content is in T3 (79.76 ± 0.23%) and the lowest is in the T0 (76.85 ± 1.31%). Stankov et al., (2002) stated that the decrease in moisture content in meat is resulted from the increasing fat content of meat. Bioresources for food 129

Table 1. Feed Formulation Feed Ingredient Ingredients composition (%) Starter Finisher T0 T1 T2 T3 T0 T1 T2 T3 Yellow corn 42 42 42 42 46 46 46 46 Rice bran 24 24 24 24 32.5 32.5 32.5 32.5 Soybean meal 23 23 23 23 10 10 10 10 Coconut meal 7.5 7.5 7.5 7.5 8 8 8 8 Seed papaya 0 0.3 0.6 1.2 0 0.3 0.6 1.2 Filler 1.2 0.9 0.6 0 1.2 0.9 0.6 0 NaCl 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 L-lysine-HCl 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 DL-methionine 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3 Premix 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25

CaCO3 1.4 1.4 1.4 1.4 1.4 1.4 1.4 1.4 Total 100 100 100 100 100 100 100 100 Nutrient Analysis ME (kcal/kg) 3139 3149 3159 3179 3119 3129 3139 3160 PK(%) 21.88 21.89 21.90 21.91 17.25 17.26 17.27 17.29 LK (%) 6.95 7.04 7.13 7.30 7.23 7.31 7.40 7.57 SK (%) 13.64 13.74 13.83 14.03 14.98 15.08 15.17 15.37 Ca(%) 0.75 0.75 0.75 0.75 0.71 0.71 0.71 0.71 Pav (%) 0.33 0.33 0.33 0.33 0.36 0.36 0.36 0.36 Lisin (%) 1.12 1.12 1.12 1.12 0.79 0.79 0.79 0.79 Metionin (%) 0.60 0.60 0.60 0.60 0.55 0.55 0.55 0.55

Table 2. Breast meat quality Variabel Treatment T0 T1 T2 T3 Water (%)ns 79.41 ± 0.14 80.17 ± 1.52 78.62 ± 0.63 79.73 ± 0.35 Ash (%) 1.09 ± 0.02a 1.11 ± 0.09a 1.16 ± 0.34ab 1.28 ± 0.04b Crude fat (%) 11.76 ± 0.58b 7.95 ± 0.94a 6.79 ± 1.93a 6.84 ± 0.22a Crude protein (%) 20.73 ± 0.24a 21.63 ± 0.23b 21.48 ± 0.39b 21.44 ± 0.22b Cholesterol (mg/100g) 64.95 ± 23.7c 64.38 ± 56.25 ± 25.68b 34.55 ± 22.94a 35.07c

Table 3. Thigh meat quality Variabel Treatment T0 T1 T2 T3 Water (%) 76.85 ± 1.31a 79.19 ± 0.28bc 77.14 ± 0.68ab 79.76 ± 0.23c Ash (%) 1.16 ± 0.05a 1.22 ± 0.01ab 1.26 ± 0.02b 1.35 ± 0.01c Crude fat (%) 11.78 ± 0.47b 11.53 ± 1.49b 10.01 ± 1.29b 6.73 ± 0.56a Crude protein (%) 20.57 ± 0.09ab 19.82 ± 0.68a 21.21 ± 0.15bc 21.40 ± 0.47c Cholesterol (mg/100g) 64.86 ± 13.53b 69.12 ± 9.52b 65.69 ± 28.33b 47.49 ± 14.17a 130 Proceedings ASIAHORCS 2013

Ash content at thigh meat of local duck aged 10 weeks is 0.80 ± 0.20% (Riskawati, 2006). Other studies explain that duck breast meat ash content is 1.22% and 1.14% for thigh meat. Ash content in this researched for breast meat ranged from 1.09–1.28% and for thigh meat is 1.16–1.35%. Highest fat breast meat in this study T0 (11.76 ± 0.58%) and the lowest was T3 (6.84 ± 0.22%). Whereas the highest fat thigh meat was T0 (11.78 ± 0.47%) and the lowest was T3 (6.73 ± 0.56%). Hustiany (2001) described duck breast meat fat content is 6.33% and thigh fat is 15.94%. Statistical analysis showed that supplementation of papaya seeds can have a significant effect in reducing levels of fat in the thigh meat ducks aged 6 weeks. Crude protein levels on breast meat in this study ranged from 20.73–21.63%, and on thigh was between 19.82–21.40%. Protein content of duck breast meat local duck was 18.43% and 16.70% for thigh meat (Hustiany, 2011). Kim et al., (2006) explained that the duck breast meat has 22% protein. In this study breast meat protein content is higher than that of thigh meat. It is related to the muscle fibers that composed breast muscles and thigh muscles. Meat that is largely composed of red fibers has lower protein content and higher fat than that from white meat fibers (Soeparno, 2005). Increasing in the percentage of meat protein in normal range, 16–19%, it can be caused by reducing in the percentage of fat in the meat. Based on the results of the statistical analysis, the supplementation of papaya seeds in feed have significant effect to protein content of breast and thigh. The highest cholesterol content of thigh meat is T1 (69.12 ± 9.52 mg/100g) and the lowest is T3 (47.49 ± 14.17 mg/100g). Cholesterol content for breast meat highest was T0 (64.95 ± 23.7 mg/100g) and the lowest was T3 (34.54 ± 22.94 mg/100g). Depson (2012) explained that duck meat cholesterol levels without treatment was 43.75 mg/dl, whereas cholesterol in mandalung ducks was 35.4 ± 1.7 mg/dl (Joseph et al., 2002). Other studies have suggested that cholesterol meat at the local ducks ranged from 171–197 mg/100g (Ismoyowati and Sumarmono, 2011) and bali male duck meat aged 8 weeks containing cholesterol of 79,03 mg/100g (Sukada et al., 2007). The addition of papaya seeds in feed has significant effect for decreasing cholesterol levels of breast meat and thighs. Decreasing fat and cholesterol of meat is because of tannins, flavonoids, and saponins content in the seeds of papaya. Chukwuka et al., (2013) described that papaya seeds contain flavonoids approximately 0.18–0.36%; 1.17–1.35% saponin, and tannin of 0.18–0.36%, whereas El-Safy et al., (2012) reported that papaya seeds contain tannins 10.6 mg/100g. Saponin can be agent for cholesterol reabsorption and increase excretion by excreta (Aswin, and pudjadi 2008; Malinow et al., 1981; Morehouse et al., 1999). Han et al. (2000) suggested that the mechanism of action of saponins as anti-cholesterol was mediated through delay- ing the intestinal absorption of dietary fat by inhibiting pancreatic lipase activity. Bioresources for food 131

Flavonoids can reducing blood cholesterol levels by increasing the excretion of bile acids and reducing blood viscosity, thereby reducing the deposition of fat in the blood vessels (Carvajall-Zarrabal et al., 2005). Chang et al., (2001) described that tannins can effectively inhibit the enzyme HMG-CoA reductase in cholesterol metabolism. Supplementation of papaya seeds has significant influence on the ash, crude fat, crude protein, and cholesterol, but not for moisture content on duck breast meat. Whereas supplementation of papaya seeds has a significant influence on the water content, ash, crude fat, crude protein, and cholesterol thigh meat.

ConclusionS Fresh papaya seeds that are given to duck as feed additive have a significant influence on breast fat, thigh fat, breast meat cholesterol and thigh meat duck cholesterol.

References Adeneye, A. A., & Olagunju, J. A. (2009). Preliminary hypoglycemic and hypolipidemic activies of the aqueous seed extract of Carica papaya Linn. In Wistar rats. Biology and Medicine, 1(1), 1–10. AOAC (2005). Official Method of Analysis of The Association of Official Analytical Chemist. 18th edition. Washington D. C.: The Association of Official Analytical Chemists, Benjamin Franklin Station. Aswin, N., & Pudjadi. (2008). Pengaruh ekstrak kulit buah rambutan (Nephelium lappaceum L.) terhadap kadar kolesterol total serum pada tikus Wistar. Semarang: Universitas Diponegoro Semarang. Carjavall-zarrabal, O., Waliszewski, S. M., D.M. Barradas-dermitz, D. M., Orta-flores, Z., Hayward-jones, P. M., Nolasco-hipolito, C., . . . Trujillo, P. R. L. (2005). The consumption of Hibiscus sabdariffa dried calyx ethanolic extract reduced lipid profile in rats.Plant Foods for Human Nutrition, 60, 153–159. Chang, J. J., Chen, T. H., Chan, P., Chen, Y. J., Hsu, F. L., . . . Lin, J. Y (2001). The in vitro inhibitory effect of tannin derivatives on 3-hydroxy-3 methylglutaryl-coenzyme a reductase on vero cells. Pharmacology, 62, 224–228. Chukwuka, K. S., Iwuagwu, M., & Uka, U. N. (2013). Evaluation of nutritional components of Carica papaya L. at different stages of ripening.Journal of Pharmacy and Biological Sciences, 6(4), 13–16. Depson, R. (2012). Identifikasi molekuler dan pengaruh pemberian potensial probiotik bakteri asam laktat (BAL) asal dadih terhadap kolesterol daging itik bayang sumber daya genetik Sumatera Barat. (Thesis). Program Pascasarjana Universitas Andalas, Padang. El-Safy, F. S., Salem, R. H., & Abd El-Ghany, M. E. (2012). Chemical and nutritional evaluation of different seed flours as novel sources of protein.World Journal of Dairy & Food Science, 7(1), 59–65. Han, L. K., Xu, B. J., Kimura,Y., Zheng, Y. N., & Okuda, H. (2000). Platycodi radix affects lipid metabolism in mice with high fat dietinduced obesity. Journal of Nutrition, 13, 2760–2764. 132 Proceedings ASIAHORCS 2013

Hutagalung, L. (2012). Pengaruh pemberian tepung biji pepaya (Carica papaya L.) terhadap penurunan kolesterol mencit jantan (Mus musculus L.). (Undergraduate Thesis). FMIPA Universitas Negeri Medan, Medan. Hustiany, R. (2001). Identifikasi dan karakterisasi komponen off-odor pada daging itik. (Thesis). Program Studi Ilmu Pangan. Fakultas Pascasarjana. Institut Pertanian Bogor, Bogor. ( Ismoyowati, & Sumarmono, J. (2011). Fat and cholesterol contents of local ducks (Anas platyrhynchos platyrhyncos) meat fed mash, paste and crumble feeds. Asian Journal of Poultry Science, 5(4) 150–154. Kim, G.D., Jeong, J. Y., Moon, S. H., Hwang, Y. H., Park, G. B., & Joo, S. T. (2006). Effects of muscle fibre type on meat characteristics of chiken and ducks breast muscle. Division of Applied Life Science, pp. 1–3. Graduate School, Gyeongsang National University, Jinju, Gyeongnam 660–701, Korea. Joseph, G., Uhi, H. T., Rukmiasih, I., Wahyuni, S., Randa, Y., Hafid, H., & Parakkasi, A. (2002). Status kolesterol itik mandalung dengan pemberian serat kasar dan vitamin E. Proceeding Seminar Nasional Teknologi Peternakan dan Veteriner 2002, 265–267. Lehninger, A. L. (1982). Dasar-Dasar Biokimia. First Edition. Jakarta: Erlangga. Malinow, M. R., Connor, W. E., McLaughlin, P., Stafford, C., Lin, D. S., Livingston, A. L., . . . McNulty, W. P. (1981). Cholesterol and bile acid balance in Macaca fascicularis. J. Clin. Invest, 67, 156–162. Morehouse, L. A., Bangerter, F. W., DeNinno, M. P., Inskeep, P. B., McCarthy, P. A., Pettini, J. L., . . . Chandler, C. E. (1999). Comparison of synthetic saponin cholesterol absorption inhibitors in rabbits: evidence for a non-stoichiometric, intestinal mechanism of action. Journal of Lipid Research, 40, 464–474. Mustika, R (2010). Khasiat ekstrak kulit kayu mahoni (Swietenia macrophylla King.) sebagai pencegah hiperkolesterolemia pada tikus putih. Undergraduate Thesis. Institut Pertanian Bogor, Bogor. Neuhaus, O. W., & James, M. O. (1982). Human biochemistry. London: Morty Company London. Nijveldt, R.J., Nood, E. V., Hoorn, D. E. C. V., Boelens P. G., Norren, K. V., & Leeuwen, P. A. M. (2001). Flavonoids: a review of probable mechanisms of action and potential applications. American Journals Clinical Nutrition. USA, 74, 418–425. North, M. O (1984). Commercial chicken production manual. Third Edition. Connecticut: The AVI Publishing Company, Inc. NRC. (1994). Nutrient requirement of poultry. Ninth ed. Rev. Washington D. C.: National Academy Press. Nugraha, A. P. D (2008). Respon penggunaan tepung daun katuk (Sauropus androgynus L. Merr) dalam ransum terhadap kolesterol itik lokal. (Undergraduate Thesis). Institut Pertanian Bogor, Bogor. Nuraini, M., & Orbayinah, S. (2011). Pengaruh pemberian jus biji pepaya (Carica papaya Linn) terhadap penurunan kadar low dDensity lipoproteins (LDL) plasma tikus Sprague Dawly. (Undergraduate Thesis). Fakultas Kedokteran dan Ilmu Kesehatan Universitas Muham- madiyah, Yogyakarta. Bioresources for food 133

Nwaoguikpe, R. N. (2010). Plasma glucose, protein and cholesterol levels of chicks or birds maintained on pawpaw (Carica papaya) seed containing diet. Pakistan Journal of Nutrition, 9(7), 654–658. Poedjiadi, A. (1994). Dasar-dasar Biokimia. Yogyakarta: UGM Press. Randa, S. Y. (2007). Bau daging dan performa itik akibat pengaruh perbedaan galur dan jenis lemak serta kombinasi komposisi antioksidan (vitamin A, C dan E) dalam pakan. (Disertasi). Institut Pertanian Bogor, Bogor. (in Indonesian) Riskawati, E (2006). Komposisi kimia daging dan kulit paha itik lokal jantan yang diberi pakan mengandung tepung daun beluntas (Plucea indica L.) pada taraf yang berbeda. (Thesis). Program Studi Teknologi Hasil Ternak. Fakultas Peternakan. Institut Pertanian Bogor, Bogor. Soeparno. (2005). Ilmu dan teknologi daging. Yogyakarta: Gajah Mada University Press. Stankov, L. K., Todorov, N. A., Mitev, J. E., & Miteva (2002). Study on some qualitative features of meat from young goat of bulgarian breeds and crossbreed of goats slaughtered at various ages. Asian-Austr, J. Anim. Sci., 15, 283–289. Steel, R. G. D., & Torrie, J. H. (1993). Prinsip dan prosedur statistik: Suatu prosedur pendekatan biometrik. Second Edition. Jakarta: Gramedia. Sukada, I. K., I.G.N.G. Bidura, dan D. A. Warmadewi. (2007). Pengaruh Penggunaan Pollard, Kulit Kacang Kedelai dan Pod Kakao Terfermentasi dengan Ragi Tape Terhadap Karkas dan Kadar Kolesterol Daging Itik Bali Jantan. Majalah Peternakan Universitas Udayana, Denpasar 10(2): 53–59.

Wild Tuber of Jalawure (Tacca leontopetaloides) is an Alternative to overcome Food Insufficiency of Society in Cikelet Subdistrict, South Garut

Wardah¹* and Dini Ariani² 1.Botany division, Research Center for Biology LIPI Jln. Raya Jakarta-Bogor, Km 46, Cibinong 2. UPT BPPTK-LIPI Ds. Gading Playen Gunung Kidul, Yogyakarta

Abstract Cikelet Subdistrict is one of subdistricts belonging to South Garut region with majority of villages located on seashore. Income of people is obtained from dry farming, fisheries and servant. Cikelet Subdistrict is one of the areas categorized as food insufficiency area. It is due to the mos part of agricultural land depending on the rain with low soil fertility. Level of rainfall is lower than the duration of dry season. Hence, many lands cannot be cultivated to cover daily life need. Therefore, as an alternative way, they should handle food insecurity by utilizing wild tuber of jalawure plant (Tacca leontopatoloides) which grows on seashore as foodstuff. Jalawure is a wild plant which grows on seashore between Pandanus trees as the shade. When the other plants cannot be planted, the jalawure tuber can still be harvested in dry season to be processed as food material. The processing of tuber become starch is done in traditional way. The tuber flour is processed into variety of products and replace the staple foodstuff in overcoming food insecurity. This is because tubers starch of jalawure has adequate deposit until one year. Nutritional analysis of tuber starch showed that it contains of 83.07g carbohydrate, 0.17 g fat, 0.05 g protein, and 334 energy. Keywords: Jalawure, Tacca leontopetaloides, foodstuff, food security, cikelet, South Garut

*Corresponding Author 1Jln. Raya Jakarta-Bogor, Km 46, Cibinong E-mail: [email protected]

Introduction Food is the basic need for people. The Act No. 7 of 1999 on Food states that every community has the right to get food, and the government is obliged to regulate food needed by the community, both in terms of availability, distribution, and consumption. Government Regulation No. 68/2002 on Food Security states that the realization of food security is the responsibility of the Government and the community. For Indonesia, food security is still a concept. In practice, the issue of food security in Indonesia is still happening which includes aspects of production and availability of food. The problem is that the rate of growth in food production is relatively more slowly than demand, and this will have an effect on the availability of food for

135 136 Proceedings ASIAHORCS 2013

the whole population and every household. In every sense of the population and households, they should be able to consume the food in adequate amount of nutrition. Fulfillment of food availability is also associated with each level of household income which, is in some cases, below the average so that they cannot meet their own food needs. Therefore, insufficiency to meet the community needs which is relating to low purchasing power will also affect non-fulfillment of the nutritional status of the community and will have an impact on the level of intelligence of the youth of the nation. In this case, to offset the national food needs, the Government takes a policy of diversification of food consumption and a decrease in rice consumption of 1.5% per year (Presidential Decree No. 22/ 2009). The policy is followed by the Government of Garut Regency by issuing Regent Regulation No. 20/2011 on the Acceleration of Consumption of Local Raw-based Food. Although Garut Regency is a rice surplus region, the effort for diversification of non-rice food consumption continues to be implemented, including the exploration of local food potency in Garut Regency. This study aimed to find out the potency of ‘jalawure’ (Tacca leontopetaloides) as a source of local food substitute for wheat flour in South Garut District of Garut Regency. The data obtained are expected to be used by the local government of Garut Regency to take a policy for the development and preservation of local plants to support the self-reliance and food security of local communities.

Research Methods Field study was conducted to collect local raw food as an alternative source of carbohydrate as solutions of food substitution for rice. The study used purposive random sampling method by visiting some locations, intended to determine the distribution of food plants. Collecting field data on the value of the benefits of plants was done by using the technique of ranking benefit options taken by the elected local resource persons. To minimize the influence of researcher subjectivity, the local resource persons were given the wide opportunity to express their views and ideas on the plant species identified for benefits earlier. Data were analyzed primarily in nutrients (carbohydrates, proteins, fats, vitamins) and minerals (K, Ca, Fe). Analyses were done at Center for Food and Nutrition, Ministry of Health of the Republic of Indonesia. Research sites were at Cikelet Village, Cijambe Village, and Cigadog Village, rural of Cicadas, Giri Mukti, Cikelet Subdistrict, Southern Garut, Garut Regency. Astronomically, Cikelet Subdistrict is located at 107° 37‘–107 ° 46’ East Longitude and 07° 28’–07° 40‘ South Latitude. The population is 40,928 with an area of Bioresources for food 137

Figure 1. Research sites in Cikelet Sub-District, Southern Garut , Garut Regency about 25,484.60 ha. Each hectare is occupied in average of 1.96 people with uneven distribution in each village. Highest density is in Pamalayan Village which reached 2.91 people, while the lowest is in Girimukti Village which was around 0.42 people per hectare. People’s livelihood is farming and fishing. Most of the villages of Cikelet Subdistrict are located in the coastal area with elevation of 0–100 m above sea level, with 18% agricultural area, 13% mixed garden, 5% shrubs, and 26% forest (BPS, 2011). The distance of Cikelet Subdistrict to the city of Garut is 93 km with a travel time of about 4 to 5 hours trip under normal circumstances.

Results and Discussion Research conducted in several villages in the coastal villages i.e., Cigadog Village, Mount Sulah, Mount Geder, Cicadas, Cikelet, Cikelet Subdistrict, Southern Garut has discovered a wild tuber used by people as food. The tuber is known by local people with a local name as jalawure (Tacca leontopetaloides). Jalawure is utilized by local community, especially those living in coastal areas for a long time and even for generations as food to cope with a prolonged dry season. Besides jalawure, other tubers are also used, such as cassava, sweet potato, and canna. Yet other tubers have constraints in the dry season or drought that they cannot save, even the plants cannot grow. This is very different from the jalawure herbs that are in the season where other plants cannot grow in the dry season, yet jalawure on the season is the season in which the tubers can be harvested. 138 Proceedings ASIAHORCS 2013

Jalawure (Tacca leontopetaloides) is originally known by the people from a fisherman (personal interview) who were at sea for fishing because food supplies run out, the fishermen discovered a tuber of “jalawure” or Tacca growing on the beach. Initially, fishermen were afraid of eating it, but they trie to cook these tubers, and it turned out that fishermen were not poisoned. Then, the tubers were named jalawure. Jalawure meaning is likely due to the wide leaves of plants such as nets (jala), so it was interpreted as nets, while ure is the beach or the sea coast. Therefore, the name of jalawure means it is shaped like nets growing in coastal area. In some places, it is known as kecondang or mice taro, in Central Java (Banyumas, Pekalongan, Jepara and Rembang), and East Java (Drenth, 1976). Jalawure or taka (Tacca leontopetaloides) is one species of tuber-producing herbaceous plants that can be found on a few islands in Indonesia, such as the Island of Madura, Java island, Krakatoa, Karimunjawa Islands and some other islands. Jalawure is naturally dispersed from the western part of the continent of Africa, passing through Southeast Asia to the Pacific Islands (Maneket al., 2005). In Cikelet Subdistrict, jalawure or taka is found growing along the coast on clay sand in the shade of the Pandanus tree. According to Fitter & Hay (1981) and Ukpabi et al., (2009), taka is a tropical savannah plant that can live in the dry season because it has roots that can hold water. Jalawure (Tacca leontopetaloides) belongs to the family Taccaceae, an annual herb, can reach 3 m in height, rounded bulbous-shaped rhizomes elliptic up to 20 cm in diameter with a possible weight of more than 1 kg. Tubers are renewable

Figure 2. Jalawure (Tacca leontopetaloides) in South Garut Bioresources for food 139 each year, the old tubers will turn into brown-greyish and the young one is bright colored cream. Above the tubers, the leaves grow vary in number 1–3, and one inflorescence with stalk can reach 2 meters in length, single leaf, long-stemmed hollow middle section. The flowers gather at the terminal is protected by 2 different bractea lancet-shaped green or greenish yellow color, sometimes violet and bractea shaping like sticks is violet-colored. The flowers are yellow, rounded fruit, and the seeds come in highly variable shape. Jalawure is one of the roots of wild plants which produce the starch used by local communities to cope with the famine. This plant generally has a parent tuber and peripheral tuber, but in a fairly humid conditions, it will produce plenty of tubers (Figure 3).

Jalawure (Tacca leontopetaloides ) Jalawure fruits young Jalawure fruits young tubers Jalawure bulbs Figure 3. Jalawure and its parts of plants

Jalawure has very supportive role in food security and food self-sufficiency in the Cikelet community. Food self-sufficiency program is currently being intensively conducted by the government with the aim to explore local resources and reduce dependence on imported products. Communities in South Garut region, especially in the Cikelet subdistrict have long been utilizing jalawure (T. leontopetaloides) as food to cope with frequent famines in the region. Frequent famine struck this region, due to hot air of the western winds that blow from the Indonesian ocean to land causing almost all of the trees dry up and die. In this condition, there is no agricultural crop growing, but jalawure on the season reach its maturity or harvesting date. According to the Head of Cigadog Village, Sukarna, only tuber of jalawure (Tacca leontopetaloides) can be harvested in dry season. Jalawure has a great benefit to people’s lives in the Cikelet coastal area as a source of food substitute to overcome famine. Jalawure is harvested in the dry season, usually in July and August. In the rainy season (November to December) jalawure tubers start to regrow. 140 Proceedings ASIAHORCS 2013

Figure 4. Traditional technology of processing way of tuber starch of Jalawure (Tacca leontopetaloides) 1, Jalawure bulbs washed and cleaned; 2, bulbs are already clean; 3, grated tubers 4, grated tubers; 5, the results of grated tubers; 6, the process to be filtered; 7, filtering process; 8, Disposal of the murky water immersion; 9, the results immersion flour is clean and white; 10, flour is dried and filtered; 11, flour is ready to use.

People usually harvest by simultaneously rollicking towards the shore to dig jalawure because they are afraid of not gaining these tubers. Harvesting jalawure tuber is a very enjoyable time for coastal residents because they can be together and have time to joke around with other community members. Moreover, getting the jalawure tubers is not so easy because when the plant is still visible and it is harvest time, the plant dies and does not appear again, but the community is able to predict its habitat. The tubers ages which are ready for harvesting ranged from 7 to 8 months, characterized by brownish yellow tubers. After being harvested, the tubers are processed by using traditional technology. Tubers are then washed from the dirt attached, shredded, and the results are squeezed until the waste is completely out of water, filtered and the result are added with water, stirred, let it to settle and discard the water, add fresh water, let it precipitate until the filter water becomes clear. Filtering is usually done 4 to 5 times. The starch results are white and clean, bright and quality of flour produced was not different from cassava starch (Figure 4). In the future, hopefully it can use flour processing mechanical power that does not require a long time and can be treated in considerable amounts. Utilization of starch from jalawure tubers can help improve the lives of the people, especially in rural communities of Cigadog because they no longer need to buy flour for making food they need. Bioresources for food 141

Jalawure flour is used by communities instead of wheat flour, especially on the eve of the holy month of Ramadan, the Eid al-Adha, and Eid Fitri holidays. They use jalawure flour for entire processed food that uses wheat flour. They state that the taste of cake made from jalawure flour is more delicious and savoury. To prove to the people in Cikelet subdistrict that the flour they consume are safe (non-toxic), sample jalawure tubers are analyzed to determine the nutritional composition (Tabel 1).

Tabel 1. Nutritional analysis component of jalawure. Sample Fat Protein CH (g) Ca P Fe Vit.C Ash Water Energy (g) (g) mg/100g mg/100g mg/100g mg/100g Cont. Cont. (Kkal) HCN (g) (g) Tuber 0.2 1.09 38.16 - - 11.9 3.28 1.2 59.25 159 0 Flour 0.17 0.05 83.07 - - 2.0 0.31 1.3 15.65 334 0

The nutritional analysis results were informed to the Food Security Agency of Garut Regency, then it were forwarded to the residents of Cikelet Subdistrict, KWT and farmers group associations (Gapoktan) through the existing extension officers. Of this farmers group, they will be passed on to the public. Food Security Agency introduces these plants through a variety of events, such as food exhibition, food competition, both from the subdistrict level, district to provincial level. Cigadog Village, Cikelet Subdistrict has become an area of food security which was awarded by the President of the Republic of Indonesia, as a way to overcome the food poverty and food insecurity. Utilization of jalawure (Tacca leontopetaloides). The results of analysis of jalawure tuber starch revealed that jalawure contains carbohydrate about 83.07 g/100 g, 0.17g/100g fats, 0.05 g/100 g protein, whereas in the form of tuber, carbohydrate is 38.16 gram/100g. The community around the coast of South Garut has long consumed jalawure starch and easily make them feel full. This is because of high carbohydrate content which equal to wheat flour or rice. Jalawure flour can be processed into variety of traditional food or breads, biscuits, and other food. The utilization of jalawure as food is still on a local scoop, and has not yet been socialized to the surrounding community. Therefore, the socialization of jalawure starch processed into food products which can be marketed has been performed to KWT chairman and farmer group associsations. In line with the increasing need for alternative carbohydrates sources, the local community and surrounding areas are encouraged to cultivate jalawure plant on the land around the coast. The process of domestication of jalawure plants being developed by the local community, so it is expected that coastal communities along the South Garut can cultivate crops jalawure properly and productively. 142 Proceedings ASIAHORCS 2013

For that reason, Research Center for Biology LIPI (2012, 2013), through Food Program funded by DIPA, together with Food Security Agency of Garut and the extension officers encourage local communities to conduct the cultivation of jalawure plants because the demand of jalawure starch is increasing, while the processing of jalawure starch has not yet been appropriately handled.

Figure 5. Various processed products of tuber starch of jalawure (Tacca leontopetaloides): 1, kue lobak jalawure; 2, lapis jalawure; 3, kue cipa; 4, bolu jalawure; 5, karamel jalawure; 6, es cendol jalawure; 7, Roti jalawure; 8, mie jalawure; 9, bangkit jahe jalawure; 10, cheestick jalawure; seroja jalawure; 12, nastar jalawure; 13, kue nastar ceria

Jalawure tuber starch can be quite a wise choice to meet the needs of local food-based raw materials with consideration of jalawure as main raw material. According to the agro-climate in most of coastal areas, cultivation cost is low, productivity is high, producing large enough tubers, making it possible to cultivate. Its utilization has high potential, especially in the coastal areas that have a prolonged dry season and suitable for the Food Diversification and Food Resilience program. It is also supported by the relatively high carbohydrate content (83.07) which is equivalent to the content of wheat flour (77.3 g) and the amount of energy contained in wheat flour (365 kkal) which does not differ much with jalawure starch (334 kkal) (Table 1). Bioresources for food 143

In Table 1, it can be seen that jalawure beside a source of carbohydrates, also contains vitamin C, fats, and low protein in the flour and can be included in the classification of Low Glycemix index, so jalawure is suitable for diabetics. By contrast with the nature of the carbohydrates with a high Glycemic Index, such as rice and maize (Budijanto, 2009), this flour can be used as a replacement or substitution of wheat flour in making bread and wheat substitutes in the manufacture of dry noodles, mix food ingredients, and so on. (Figure 5.). Development of jalawure. Jalawure plant growth cycle takes about 7–12 months, with 3–4 months of dormancy in tubers. Plant growth starts from the root and leaf, followed by the flower. The possibility of a second leaf and root growth takes about 7–8 months. Young tuber enlargement needs 4 months.

Figure 5. 1) land after corn planting; 2) land cleared and cultivated; 3) lands that are already in process; 4) jalawure seedlings ready to be planted; 5) farmers are planting jalawure; 6) tuber crops jalawure; 7) large sized jalawure tubers; 8) jalawure gatherers; 9) yields were weighed.

Today, the people in Southern Garut had already cultivated jalawure plant. The starch of jalawure tuber can substitute flour usually needed by community, so it can also improve the living standards by saving. This plant has been started in production, because it was planted in farmers’ fields and the results are quite satisfactory (Figure 6.). Local government should give attention to the development of jalawure in order to reach society welfare as well as to make food security in the community of Southern Garut. 144 Proceedings ASIAHORCS 2013

ConclusionS Cikelet Subdistrict is one of subdistricts belonging to South Garut region with majority villages located on seashore. Cikelet subdistrict is one of the areas categorized as food insufficiency area. This category is supported due to the mostly part of agricultural land depending on the rain with low soil fertility. Level of rainfall is lower than duration of dry season, so many lands cannot be cultivated to meet daily life need. Therefore, as alternative way, the community utilize wild tuber of jalawure plant (Tacca leontopatoloides) which grows on seashore as foodstuff to overcome food insecurity. When the other plants cannot be planted, the jalawure tuber still can be harvested in dry season to be processed as food material. The processing of tuber into starch is done in traditional way. The tuber flour is processed to become variety of products and replace the staple foodstuffs in overcoming food insecurity. This is due to the reason that tubers starch of this plant has enough deposit for one year. Nutritional components of jalawure tuber starch are 83.07 g carbohydrate, 0.17 g fat, 0.05 g protein, and 334 energy. Jalawure tuber starch is the right solution as the source of carbohydrate (83.07%) substitute for wheat flour to address food insecurity because frequent famines hit in Cikelet Subdistrict, Garut District.

References BPS. (2011). Kecamatan cikelet dalam angka 2011. Garut: Badan Pusat Statistik Kabupaten Garut. Budijanto, S. (2009). Dukungan iptek bahan pangan pada pengembangan tepung lokal. Majalah Pangan, 18(54) 55–67. Drenth, E. (1976). Taccaceae. Flora Malesiana Serie I, 7(4). Leiden: Noordhoff International. Fitter, A. H., & Hay, R. K. M. (1981). Fisiologi lingkungan tanaman (S. Andani & Purbayanti, trans.). Yogyakarta: Gadjah Mada University Press. Manek, R. V., Olobango, O., Kunle, M., & Emeje, O. (2005). Physical, thermal, and sorption profile of starch obtained from Tacca leontopetaloides. Starch. 55–61. Media Komunikasi dan Informasi, Edisi No. 54/XVIII. hlm. 55–66. Nikijuluw, V. P. H. (2012). Kedaulatan pangan. Retrieved from http://gagasanhukum.wordpress. com/2012/03/29/ kedaulatan pangan/. at March 4, 2012. Rofig, A. (2009). Pengembangan potensi lokal untuk bahan baku pangan dan industri sebagai usaha meningkatkan ketahanan pangan Nasional. Majalah Pangan, 54(13), pp. 36–42. Ukpabi, U.J., E. Ukenye and A.O. Olojede. 2009. Raw-material potentials of Nigerian wild Poynesian arrowroot (Taccaleontopetaloides) tubers and starch. J. Food Tech., 7, 135–138. Functional Food

Full Paper of Oral Presentations

Mannanase from Isolated Marine Bacteria of Pari Island for Manno-oligosaccharides production

Yopi1* Apridah Cameliawati Djohan1, Laksmi Ambarsari2 1Research Centre for Biotechnology, Indonesian Institute of Sciences (LIPI) 2Department of Biochemistry, Faculty of Mathematic and Natural science, Bogor Agricultural University (IPB)

Abstract Indonesia’s tropical marine biodiversity of microorganisms has high potential and commercial value. This study focused on the isolation and identification of potential microbes which produce mannanase enzyme to hydrolyze mannan and eventually pro duce manno-oligosaccharides. Sampling was conducted in Pari Island at Jakarta Bay area, the screning and observation of mannanase enzyme activity from those marine biodiversity have been conducted. The research succeed to collect 20 bacteria that could produce mannanase enzyme, three of them have the most high activity from qualitative analysis based on mannolytic index using congo red method for Pari 3, 4 dan 5 such as 4.33; 2.40; dan 2.60. Further quantitative analysis for these bacteria was conducted such as activity of mannanase using dinitrosalicylic acid method and showed that the highest activity is Pari 3 with 2.474 U/mL and Pari 4 with 1.193 U/mL both in the second day of fermentation, whereas Pari 5 with 1.087 U/mL is in the third day of fermentation. Analysis 16S rRNA gene showed that Pari 3, 4, and 5 are domain Bacteria, phylum Firmicutes, class Bacilli, ordo Bacillaceae and genus Bacillus. The spesific identification are using phylogenetic tree and concluded that Pari 3 has similar sequence 91.1% with Bacillus safensis and 92% of Bacillus pumilus. Whereas the results of Pari 4 identification has similar sequence of 94.1% with Bacillus anthracis and 92.2% with the Bacillus cereus in the genetic relationship. The result of Pari 5 identification has similar sequence of 97.1% with Bacillus anthracis and 95.2% with the Bacillus cereus in the genetic relationship. Keywords: Pari Island, biodiversity microorganism, mannanase, marine bacteria, 16S rRNA

*Corresponding Author Jln. Raya Bogor Km 46, Cibinong, Bogor 16911, Indonesia E-mail: [email protected]

Introduction Indonesia is a country that has a wealth of marine microorganism biodiversity with potential value for the development of science and commercial value in improving the domestic industry. The advances in biotechnology research stimulate the development of marine microorganism exploration of Indonesian native biodiversity to complete the database of potential microorganisms that has not been done much. Utilization of marine microbial biodiversity is increasingly expected to produce maximum new breakthrough for metabolism products, as well as its ability to produce the kind specific enzymes from bioprocess. The high market demand for new products that has a high efficiency in the production

149 150 Proceedings ASIAHORCS 2013 process is needed especially in functional food industry, pharmaceutical, veterinary, bio-energy, environment and health. Recently, the enzymatic technology utilized in an industry is being rapidly established, one of the enzymes that plays a crucial role is mannanase enzyme. Mannanase enzyme is an enzyme that can catalyse the hydrolysis reaction of the β-1,4-manosidik bond from mannan chain, glucomannan, and galactomanan. Mannanase enzyme can be used in an enzymatic technology application for diverse industries as food, feed, pharmaceutical, paper and gas industry as well as the stimulation pretreatment on lignocellulosic biomasses as material for second generation biofuels (Songsiriritthigul et al., 2010). The microorganisms producing enzymes mannanase from soil research, such as actinomycetes, fungi, aspergillus, and bacteria have been done. The information about the soil microbe genes that encode mannanase enzymes that have been cloned and sequenced from soil microbes can be obtained, these enzymes have the ability to bind β-mannan and have high catalytic activities in depolymerization of polysaccharide substrate (Tanaka et al., 2009). Hence, due to the low interest for these research, exploration and isolation of Indonesian indigenous marine microorganisms producing enzymes mannanase are still rare. Mannolytic microbes are microbes that can produce mannanase enzymes which have ability to hydrolyze complex polysaccharides into simple molecules such as manno-oligosaccharides and mannose. In generally, mannanase enzyme is produced from microorganisms, such as bacteria. However, it could also be produced from plants and animals. Mannanase enzymes produced by microorganism have its own advantages; they are more economical, convenient, and efficient in producing process. The characterization and fermentation process of mananase enzyme from microbial is faster compared with enzymes from plants and animals. Polysaccharide compounds which are contained in marine waters have many variants due to the type of monomer that constructs the agar, chitin, mannan, xylan and cellulose. The utilization of polysaccharide products in domestic area is very limited despite it has abundant source because Indonesia is a tropical country that is plentiful in biodiversity of tropical plants. The high cost of polysaccharides product development and traditional processing system caused Indonesia often selling raw materials and importing consumable product with a more expensive import price than the exporting raw materials price. The expectation of this research is to develop the potential local microbes from marine which can produce enzyme for industry, and begin to utilize the genetic engineering and enzymatic technologies that can produce a maximum product from polysaccharides biomasses due to renewable and more environmentally friendly of enzyme technology. Enzymes from local marine microbes have not been studied and developed in the laboratory and in commercial. Enzymes from marine microbe have a different character with enzymes from soil microbe, according functional food 151 to that reason the research related to marine microbe biodiversity which has ability to hydrolyze the polysaccharide biomasses become more interesting to be studied. Biomass also has an important role as a carbon source in production of an enzyme, whereas the specific biomass can specifically determine the ability of microbes to produce specific enzymes too. The previous research of thermophilic mannanase from marine microbe Rhodothermus marinus has been conducted. This microbe was isolated from high temperature marine area due to its ability to produce a thermophilic mannanase enzyme that can degrade mannan substrate such as galactomannan from locust bean gum. This microbe has been known for its ability to produce thermophilic glycoside mannanase that can resist high temperature, averaging at 85°C after going through the process of characterization enzymes and DNA sequence analysis (Politz et al., 2000). Mannanase producing microbe from soil can be included in Actinobacteria such as Cellulomonas fimi and Actinomicetes groups from Streptomyces such as Streptomicetes galbus and Streptomyces lividans, which have unique characteristics of enzymes that can degrade various types of manan substrates (Stoll et al., 1999).

Materials and Methods Culture Colection. Marine Bacteria from Pari Island used in these experiments were identified using direct sampling method. Bacteria sample had been collected from sea water. The medium for screening and purification bacteria was composed with several Mannan substrates (0.5% LBG), 0.075% peptone, 0.05% yeast extract and some minerals compound. PH was adjusted to 6.0 (Mandels & Sternberg, 1976). Identification Potential Microbes. Pure isolates were inoculated onto agar medium surface then incubated for 24 hours, medium was rich by carbon source from Mannan substrates (0.5% LBG), 0.075% peptone, 0.05% yeast extract and some minerals compound (Mandels & Sternberg, 1976). Identification mannanase by bacteria activity uses congo red dye for LBG medium. Crude Enzymes Production. The most potential microbes were selected to produce specific crude enzyme such as mananase. They were inoculated into medium with spesific carbon sources (0.5%), extract and some minerals compound (Mandels & Sternberg, 1976). Incubation process had been running for 24–48 hours. Crude enzyme is resulted after centrifuge in the medium after harvest time. Enzyme Assays. Enzyme activities were assayed as follows; a reaction mixture containing 0.5 ml of 0.3% mannan in 20 mM acetate buffer as well as 0.5 ml of enzyme solution in the same buffer was incubated at 40°C for 30 min. The resulting reducing power was determined by dinitrosalicylic acid (DNS) method (miller), using D-mannose as a standard. One unit of the mannanase 152 Proceedings ASIAHORCS 2013

activity was defined as the amount of enzyme liberating 1 µmol of reducing sugar per minute under the above condition.

Identification Microbial based on 16S-rRNA analysis Isolation of Total Genome. Manolitik bacterial identification was begun by isolating total genomic DNA using BioRad kit InstaGene Matrix TM. Colony isolate was collected by a loop with 250 mL of sterile milli-Q and centrifuged for 1 minute at 10.000 rpm. Supernatant was discarded, while the pellet was added by 50 mL InstaGene TM Matrix BioRad kit and incubated at 56 ºC for 15–30 mins. The solution was vortexed at 100 rpm for 10 seconds and then heated at 100 ºC for 8 minutes. The final stage of DNA extraction process was to separate DNA (supernatant) from pellet and centrifuged at 10.000 rpm for 2 minutes. The DNA template was amplified by PCR if the template was not directly used, it must be stored at a temperature of 20°C. PCR. Template DNA was amplified by taking 2 mL (60 ng/1 μL), then templates were mixed with 25 mL “Gotaq”. Gotaq is a mixture of dNTPs, primers and PCR buffer. Further added was 1 μL forward primer 9F 50 μLM (5’-GGCTACCTTGTTACGACTT-) and 1 mL 50 μLM 1510R reverse primer (5’-GAGTTTGATCCTGGCTCAG-) and added sterile milli-Q until 50 mL. The 30 cycles of amplification was performed in a thermocycler using pre-denaturation process for 2 minutes at 95 ºC, denaturation for 30 minutes at 95 ºC, annealing for 1 minute at 55 ºC and extension for 2 minutes at 72°C. Electrophoresis. The electrophoresis analysis using 3 μL of PCR product was added into agarose gel wells, for marker 0.5 mL dye Loading Fermentas and 2 mL milli-Q and mixed then put into different well. Electrophoresis process performed for 60 minutes with a 50 Volt in TAE buffer solution. Amplification DNA was identified by using Ethidium bromide solution incubated for 15 minutes, rinsed by distilled water for 10 minutes. Observe the result by using UV transluminator, DNA bands would be visible and known in size by molecular size markers, which are expressed in base pairs (bp). Phylogenetic Tree. Sequences performed at the Laboratory 1st BASE Singapore, editing process of partial sequences data was done by using Bioedit program. Program results for the nucleotide sequence contiq was based on amplification with universal primers, then the homology would be compared with other prokaryotes that exist in Gene Bank database. Cluster analysis is performed using the data base from Ribosomal Database Project (RDP) website (http://www.rdp. com). While the construction of phylogenetic tree was performed using MEGA 5 program. functional food 153

Results and Discussion Isolation and Purification Mannolytic Marine Bacteria.Pari Island is located in Kepulauan seribu Indonesia with geographical location in 05° 51' 22"south latitude and 106° 36' 02" east longitude. Pari Island is also a tourism object, seaweed cultivation and oceanography research which are facilitated by the Indonesian Institute of Sciences (LIPI). Sampling conducted in 4 different locations, namely the coastal areas surrounded by palm trees which are a source of comfort; shallow sea areas suspected surface having various types of potential bacteria; beach area that has plenty types of tropical plants that are expected to have microbes that can produce mananase enzyme; and the last area is seaweed cultivation area that one of mannan sources. The research succeed to collect 20 bacteria that could produce mannanase enzyme, three of them have the highest activity from quantitative analysis based on mannolytic index using congo red method for Pari 3, Pari 4 dan Pari 5 such as 4.33, 2.40, dan 2.60. The clear zone result colonies showed at Figure 1.

Figure 1. Analysis quantitative manolytic bacteria by using congo red staining method Pari 3 (a), Pari 4 (b), and Pari 5 (c).

Analysis of Mannanase Activity. Further quantitative analysis for these bacteria were conducted, such as activity of mannanase by using dinitrosalicylic acid method and it showed that the highest activity is Pari 3 with 2.474 U/mL and Pari 4 with 1.193 U/mL both in the second day of fermentation, whereas Pari 5 with 1.087 U/mL in the third day of fermentation.

Figure 2. Pari 3 mannanase enzyme activity and cell growth (A 660 nm). 154 Proceedings ASIAHORCS 2013

The mananase enzymes degradation produced by Pari 3 isolate is the type of exoenzyme degradation because utilized substrate are degraded directly in proportional to the growth cell activity, so it can be assumed that the enzyme formed by cutting off the end of outer mannose groups bond to produce monosaccharide mannose from polysaccharide. This case may be due to the substrate that has been perfectly hydrolyzed (Aryanthi 2008).

Figure 3. Pari 4 mannanase enzyme activity and cell growth (A 660 nm).

Curve above showed the mannanase activity on day 2 and 3 having values of 1.193 U/mL and 1.174 U/mL. Enzyme activity of the growth curve Pari 4 concluded that bacteria have optimum phase cell number, which is quite stable, and the sugar reduction formed is not constant, it can be suspected the enzyme which is an endoenzyme type that degrade the linear polysaccharide chains at random from the middle of chain, whereas the analysis of reducing sugar mannose formed is not influenced by the number of cells formed, but rather by enzymes activity that produce monosaccharide.

Figure 4. Pari 5 mannanase enzyme activity and cell growth (A 660 nm). functional food 155

The enzyme activity from mannolytic bacteri Pari 5 increases on the third day reaching a maximum of 1.087 U/mL but the growth cell has decreased. It can be concluded that the available substrate hydrolyzed by the enzyme reached maximum point at random on the first day and resulted in mannobiose or mannotriose, then it will be completely degraded into monosaccharides on the third day while the enzyme activity decreased until day four continuously.

Analysis of DNA Genome and Amplicon 16S rRNA Gene

Figure 5. (a) Electrophoregram DNA genome (b) Amplicon 16S rRNA Gene

The electrophoregram at Figure 5 indicated the presence of genomic DNA. It can be implicated that the three potential bacteria isolates have DNA bands visible on agarose according to the marker used as a reference, i.e. above 6,000 bp. Phylogenetic Tree. Analysis 16S rRNA gene showed that Pari 3, 4, and 5 are domain Bacteria, filum Firmicutes, class Bacilli, ordo Bacillaceae and genus Bacillus. For the specific identification, phylogenetic tree is used, and then it can be concluded that Pari 3 is 91.1%, similar in sequence with Bacillus safensis and 92% with Bacillus pumilus. From both result, it can be implicated that the genetic relationship is less than 97% in similarity. Therefore, it was suggested that the bacteria Pari 3 is a new strain and can be further investigated. The result of Pari 4 identification has a similar sequence of 94.1% withBacillus anthacis and 92.2% with the Bacillus cereus in the genetic relationship. The result of Pari 5 identification has a similar sequence of 97.1% with Bacillus anthracis and 95.2% with the Bacillus cereus in the genetic relationship. 156 Proceedings ASIAHORCS 2013

Figure 6. Phylogenetic tree Pari 3 Figure 7. Phylogenetic tree Pari 4 and Pari 5

Conclusions This research has been able to isolate 20 mannolytic bacteria from local sea of Pari Island in Kepulauan Seribu Jakarta Indonesia that potentially degrading mannan source. Mananase enzyme qualitatively characterization using congo red staining method resulted three potential mannolytic bacteria, such as Pari 3, Pari 4, and Pari 5. The result of quantitative analysis of mananase enzyme activity from Pari 3 isolate is having the highest activity level of 2.474 U/mL on the second day with the exo-enzyme type in mannan degradation because the enzyme that are cut from the outside bond is linear chain of polymer mannan. Pari 4 and Pari 5 indicate the highest mannanase enzyme activity consecutive 1.193 U/mL and 1.087 U/mL with the endoenzyme type of degrading mannan substrate or the enzymes hydrolyze linear polymer chains in randomly to produce reducing sugar monosaccharide, galactose and mannose and also disaccharide such mannobiose. The results showed that the bacteria Pari 3 has similarity withBacillus safensis with percentage of 91.1% and 92% with Bacillus pumillus because both showed the percentage of similarity less than 97%. It can be presumed that the Pari 3 isolate is a new strain and can be investigated further. The result of identification 16S rRNA for Pari 4 has similarity with Bacillus anthracis for 94.1% and 92.2% with Bacillus cereus. While the identification of bacteria Pari 5 has 97.1% yield similarity with Bacillus anthracis and Bacillus cereus with 95.2%. According to Hagstrom & Wipat (2002), if the similarity is ≥ 93%, then it is considered as the same species. Therefore, it can be presumed that Pari 4 and Pari 5 isolates were Bacillus anthracis. functional food 157

Acknowledgement The author would like to thank Department of Biochemistry, Faculty of Math- ematic and Natural science, Bogor Agricultural University (IPB) and Research Centre for Biotechnology, Indonesian Institute of Sciences (LIPI).

References Aryanthi, D. (2008). Uji kualitatif dan kuantitatif enzim mananase isolat bakteri laut dari perairan laut cilacap dan pantai marina. Field Report. Program Keahlian Analisis Kimia Direktorat Program Diploma, Institut Pertanian Bogor, Bogor. Campbell, N. A., Reece, J. B., & Mitchell, L. (2002). Biologi. Edisi kelima jilid I. Jakarta: Erlangga. Clarridge III, J. E. (2004). Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clinical Microb. Rev., 17(4), 840–862. Cole, J. R., & Wang, Q. (2009). The ribosomal database project: improved alignments and new tools for rRNA analysis. Nucleic Acids Res., D141–D145. Dhawan, S., & Kaur, J. (2007). Microbial mananases: an overview of production and applications. Critical Reviews in Biotechnology, 27, 197–216. Downie, B., Hilhorst H. W. M., & Bewley, J. D. (1994). A New assay for quantifying endo-β-D- Mannanase Activying Using Congo Red Dye. Pyhtochemistry, 36, 829–835. Duffaud, G. D. et al. (1997). Purification and characterication of extremely thermostable mananase. mannosidase. and a-galactosidase from the hyperthermophilic eubacterium Thermotoga neapolitana5068. Applied and Environ. Microbiol., 63, 169–177. Hagstrom, C. R., & Wipat, A. (2002). Genome management and analysis: Prokaryotes. In Ratledge, C., & Kristiansen, B. (eds.). Basic Biotechnology, pp. 17–44. Second edition. Cambridge: Cambridge University Press. Henrissat et al. (1993). New families in the classification of glycosyl hydrolases based on amino acid sequence similarities. Biochem. J., 293, 781–788. Hilge, M. et al. (1998). High-resolution native and complex structures of thermostable mananase from Thermomonaspora fuscasubstrate specificity in glycosyl hydrolase family .5 J. Structure, 6, 1433–1444. Israhmadini, U. (2008). Identifikasi dan karakterisasi bakteri laut penghasil selulose dengan metode 16S rRNA. Undergraduate Thesis. Jurusan Biologi FMIPA, Universitas Negeri Jakarta, Jakarta. Kagawa, et al. (2003). Crystal structure of bacillus substilis α-amylase in complex with acarbose. J. Bacteriology, 185(23), 6981–6984. Kensch, O. (2008). Mananase engineering for fibre degradation. Speciality Chemicals Magazine, 18–19. Kuchel, P. W., & Ralston, G. B. (1998). Biochemistry. Second edition. New York: The McGraw- Hill Companies. Kurakake, M., & Komaki, T. (2001). Production of β-mananase and β-mannosidase from aspergillus awamori K4 and their properties. J. Microbiology, 42, 377–380. 158 Proceedings ASIAHORCS 2013

Lauroa, F. M., et al., (2009). The genomic basis of trophic strategy in marine bacteria. PNAS,106(37), 15527–15533. Leblond, B. N., Philipe, H. I., & Decaris, B. (1996). 16S rRNA and 16S to 23S Internal transcribed spacer sequence analysis reveal inter and intra spesificBifidobacterium phylogeni. Int. J. Syst Bacteriol., 46, 102–111. Lehninger, A. L. (2004). Principles of biochemistry. New York: The John Hopkins University, School of Medicine. Malik, A. (2006). Identifikasi bakteri asam laktat (BAL) penghasil eksopolisakarida (EPS) meng- gunakan gen penyandi 16S rRNA. Depok: Departemen Farmasi, Universitas Indonesia. Mandels, M., & Sternberg, D. (1976). Recent advances in cellulase technology. Ferment. Technol., 54, 267–286. Moreira, L. R. S., & Filho, E. X. F. (2008). An overview of manan structure and manan-degrading enzyme systems. Appl. Microbiol. Biotechnol., 70, 165–178. Pangastuti, A. (2006). Definisi spesies prokaryota berdasarkan urutan basa gen penyandi 16S rRNA dan gen penyandi protein. Biodiversitas, 7(3), 292–296. Politz, O. M., et al., (2000). A highly thermostable endo-(1.4)-b-mannanase from the marine bacterium Rhodothermus marinus. Appl. Microbiol. Biotechnol., 53: 715–721. Purawadaria, T., Haryati, T., & Darma, J.(1994). Isolasi dan seleksi kapang mesofilik penghasil mananase. Majalah Jurnal Peternakan, 26–29. Ruyitno. (2004). Bakteri laut dan peranannya dalam mendukung aktivitas manusia. Jakarta: Pusat Penelitian Oseanografi, Lembaga Ilmu Pengetahuan Indonesia. Sachslehner, A., Gabriele, F., Nikolaus, F., George, G., & Dietmar, H. (2000). Hydrolysis of isolated coffee mannan and coffee extract by mannanase of Sclerotium roflsii. J. Biotechnol- ogy, 80, 127–134. Songsiriritthigul, C., et al., (2010). Efficient recombinant expression and secretion of a thermostable GH26 mannan endo-1.4-β-mannosidase from Bacilluslicheniformis in Escherichia coli. Microbial Cell Factories, 9, 20. Stoll, D., & Stalbrand, W. A. (1999). Manna degrading enzyme from Cellulomonas fimi. Retrieved from http://www.aem,asm.org, on September 1, 2012, 08.30 GMT +7. Sumardi. (2004). Isolasi karakterisasi dan produksi mananase ekstraseluler dari Geobacillus strearothermophilus l-07. Disertasi. Program Pascasarjana Institut Pertanian Bogor, Bogor. Suryadi. (2004). Isolasi karakterisasi dan produksi β-Mananase ekstraseluler dari Geobacillus strearothermaphilus 1-7. Disertasi. Program Pascasarjana Institut Pertanian Bogor, Bogor. Tamaru et al. (1995). Purification an characterization of an extracellular β-1.4-mananase from a marine bacterium. vibro sp. Strain MA-138. J. Microbiology, 4454–4458. Tanaka, M. et al. (2009). Cloning and characterization of a β-1.4 mannanase 5C possessing family 27 carbohydrate-binding module from marine bacterium. Vibrio Sp. Strain MA-138. Biosci. Biotech. Biochem., 7(1), 109–116. Weisburg, W. G., Barns, S. M., Pelletier, & D. A., Lane, D. J. (1991). 16S ribosomal DNA amplification for phylogenetic study. J. Bact. 173(2), 697–703. functional food 159

Yopi et al. (2007). Study on hemicellulytic bacteria: production of oligosaccharides from palm kernel cake using fermentation. Proceedings Advances in biological science: Contribution towards a better human prosperity, 111–113. Zahura, U. A. et al. (2011). cDNA cloning and bacterial expression of an endo-β-1.4-mannanase AkMan from Aplysia kurodai. Comparative Biochemistry and Physiology Part B, 159, 227–235. Zhang et al. (2000). Purification and characterization of mananase from Bacillus licheniformis from industrial use. J Biotechnology, 22, 1375–1378.

Enzymatic Production of Xylo-oligosaccharide from Agricultural Wastes

Zhengqiang Jiang1,*, Qiaojuan Yan2, Shaoqing Yang1 1) College of Food Science and Nutritional Engineering, Beijing Key Laboratory of Functional Food from Plant Resources, China Agricultural University, 2) Bioresource Utilization Laboratory, College of Engineering, China Agricultural University, Beijing 100083, China.

Abstract The enzymatic production of xylooligosaccharide (XOs) from agricultural wastes of corncob and rice straw was investigated. For corncob, XOs production was performed by the hydrolysis of corncob which was pretreated by a steam explosion at 196°C for 5 min. A maximum XOs yield of 28.6 g XOs/100 g xylan in corncob was achieved after the steam explosion liquor of corncob (SELC) was hydrolyzed by a thermostable xylanase Paecilomyces themophila J18 under the optimized conditions; pH 7.0, 70°C, -1 7.5 U ml and 2.5 h, and the XOs syrup containing more than 90% of xylobiose (X2) and xylotriose

(X3). In addition, a thermostable recombinant xylanase (XynB) from Thermotoga maritima MSB8 was used for the production of X2 from SELC. The yielded hydrolysis products containing 49.8% of

X2 and 22.6% of xylose were further purified by an activated charcoal column, and a maximum 2X recovery yield of 84.7% was obtained. The purity of the obtained X2 was reached high up to 97.2%. Furthermore, rice straw was also used for the production of XOs. XOs was produced by hydrolyzing the steam explosion liquor of rice straw (SELS) at 215°C for 45 min using a xylanase from Malbranchea cinnamomea S168. After SELS was hydrolyzed under the optimized conditions; pH 6.5, 60°C, 5 U -1 ml and 2 h, the highest XOs yield of 7.69 g XOs/100 g rice straw, containing more than 80% of X2 and X3 was achieved. These results suggest that the process of enzymatic hydrolysis coupled with steam explosion might be effective for XOs production from agricultural wastes in industrial applications. Keywords: Xylooligosaccharide; agricultural waste; xylanase; hydrolysis; steam explosion

*Corresponding Author Beijing 100083, China E-mail: [email protected]

Introduction Lignocelluloses as abundant and renewable raw materials are potential feedstock’s for industrial utilization. Xylooligosaccharides (XOs) have been produced for use as a valuable food sweetener or as an additive with much functionality. The production of XOs from xylan rich lignocelluloses has been investigated by several ways, such as direct enzymatic treatments, enzymatic hydrolysis of the isolated xylans and hydrolytic degradation of xylans to XOs by dilute solutions of mineral acids, steam or water (Yang et al., 2007; Tan et al., 2008). Autohydrolytic hydrothermal reaction is an effective method to degrade the hemicelluloses in

161 162 Proceedings ASIAHORCS 2013

lignocelluloses to XOs. However, this process usually takes 0.5–3.0 h and produces XOs which have wide range of Degree of Polymerization (DP) 2–20 (Parajó et al., 2004; Makishima et al., 2009). Generally, the commercial XOs contain mainly xylobiose (DP 2) to xylotetraose (DP 4). Corncobs show great potential for producing XOs. There are some reports on the production of XOs from corncobs using different methods (Parajóet al., 2004; Tan et al., 2008). However, no previous reports could be found that describe the production of XOs from corncobs using the steam explosion pre-treatment followed by enzymatic hydrolysis using thermostable xylanases (Makishima et al., 2009). The production of xylobiose with high purity is a time consuming and expensive process. For this purpose, a biologically safe and cost-effective method of xylobiose production is necessary, but there are yet any attempts to utilize immobilized xylanases in xylobiose production. Generally, the hydrolytic properties of xylanases are very crucial for xylobiose production. It has been shown in a previous paper that the recombinant xylanase B (XynB) of Thermotoga maritima could effectively produce xylobiose from xylan (Jiang et al., 2004). In addition, rice straw is produced in large quantities as an agricultural by-product in Asia. It is a fibrous lignocellulosesic material that contains about 25% hemicelluloses, which can also be further utilized through bioconversions to produce XOs. The main objective of this study was to develop new and efficient processes for the production of XOs and xylobiose from corncobs and rice straws. We have investigated a new type of steam explosion method for pre-treatment of corncobs and rice straw, and optimized enzymatic hydrolysis conditions using the thermostable xylanases from Paecilomyces themophila, Thermotoga maritima and Malbranchea cinnamomea, respectively. The processes were proved to be effective in producing XOs from corncobs and rice straw and xylobiose from corncobs.

Materials And Methods Materials. Corncobs and rice straws were obtained locally. Birchwood xylan was from Sigma Chemical Company (St. Louis, MO). All other chemicals used were of reagent grade unless otherwise stated. The thermostable xylanases fromP. themophila, T. maritima MSB8 and M. cinnamomea S168 were prepared by the Food Enzyme and Fermentation Engineering Lab in the College of Food Science & Nutritional Engineering, China Agricultural University, Beijing, China. Steam explosion and preparation of steam explosion liquor of corncob (SELC) and rice straw (SELR). Corncobs with 35.7% xylan, 5.5% moisture and 3.1% ash were provided by Henan Taixing Co. Ltd. (Henan Province, China). Corncobs were soaked in water overnight and then the excess liquid was removed by centrifugation. Steam explosion was performed in a pilot-scale equipment functional food 163 with 30-L reaction vessel designed by the company according to the patent of Li (2007). The reactor was filled with 20 kg by dry weight of feedstock per batch, and was then heated to the desired temperatures, directly with saturated steam. The experimental conditions used in the present study for corncobs were 2.5–7.5 min and 188–204°C according to the method of Teng et al. (2010). After steam-explosion, all the exploded samples were recovered and extracted with 200 l of tap water for 1 h at 60°C, and then filtered to remove the water-insoluble fraction to obtain the steam explosion liquor of corncob (SELC). The content of xylose, XOs, total sugars and reducing sugars in SELC was analysed. Rice straw with 17% xylan and 5.3% moisture obtained from Hubei Fengchi Industrial Limited Company were chopped and milled to particles smaller than 0.9 mm, homogenized in a defined lot, and stored in plastic containers at room temperature. One hundred grams of rice straw and 1200 ml of water were loaded in the reactor. The reactor was controlled at 215°C, for 45 min. After steam-explosion, the solid fraction and the liquid fraction were separated by filtration with the solid residue washed by deionized water several times. The solid fraction was then lyophilized, and the liquid fraction (SELR) including washing water was stored at -20°C. Enzymatic hydrolysis of SELC and SELR by the thermostable xylanases. SELC and SELR were hydrolysed by the thermostable xylanases from P. themophila and M. cinnamomea, respectively. For SELC, after adjusting to pH 7.0, the xylanase from P. themophila (7.5 U ml-1) was added to SELC. The influence of hydrolysis period (0–4 h) on the enzymatic hydrolysis yield was studied at 70°C. A 10 ml sample was taken at regular intervals and heated to 100°C for 5 min to inactivate enzyme. For SELR, the pH was adjusted to 6.5, then 5 U ml-1 of xylanase from M. cinnamomea was added into mixture, and the reaction mixture was incubated at 60°C for 3 d on a rotary shaker with rotation speed of 150 rpm. Samples were taken at regular intervals and heated at 100°C for 5 min to stop the enzymatic reaction. The formation of XOs was monitored using high-performance liquid chromatography (HPLC). Continuous production of xylobiose by the immobilized XynB from T. Maritime. The xylanase from T. maritima MSB8 (XynB) was immobilized according to the method of Tian et al., (2008). The column reactor was prepared by packing the immobilized XynB (35 g, wet) in a stainless steel jacket column (Φ = 12 mm, H = 30 cm) and kept in a thermostatic water bath at 90 ± 0.2°C. AELC was passed through the reactor at a flow rate of 50 ml h-1 for 168 h for 7 days. At 4 h interval, 5 ml aliquot was withdrawn from the reactor outlet for sugar analysis. The results presented are the average of two trials. The xylobiose produced in the hydrolysis mixture was purified by activated charcoal column chromatography according to the method of Tian et al., (2008). Crystallization 164 Proceedings ASIAHORCS 2013

of xylobiose was performed at room temperature after adding some crystalline seed in the supersaturated xylobiose solution. Analytical methods. Total sugars (TS) were determined according to the Orcinol–HCl method with xylose as the standard. Reducing sugars (RS) were determined by dinitrosalicylic acid method with xylose as the standard. The content of xylose and XOs was analysed using LC-10AD HPLC (Shimadzu, Japan), equipped with an InterWAX (KS-802) column (DM) and a RID-10A refractive index detector. The column was maintained at 80°C and eluted with deionized water at a flow rate of 0.6 ml min-1. The XOs yield (w/w) was calculated calculated using the equation: Yield (w/w) = XOs (g l-1) × Volume (l)/xylan in raw corncobs (g), where XOs = X2 + X3 + X4 + X5, where X2 is xylobiose, X3 is xylotriose, X4 is xylotetraose, X5 is xylopentaose. The content of X2 and X3 in XOs syrup was (X2 + X3)/XOs. The percent yield of TS was calculated using the following equation: Hemicellulose recovery (%) = TS yield (%) = TS in SELC (g l-1) × Volume (L) × 100/raw corncobs (g).

Figure. 1. Time course for production of XOs from hydrolysis of SELC by the thermostable xylanase from P. thermophila (a) and TLC analysis of hydrolysis products (b). Symbols: XOs (▲), xylobiose (●) and xylotriose (■). Data represents the mean ± S.D. of three replicates. The hydrolysis conditions were as follows: xylanase, 7.5 U ml-1 (pH 7.0) at 70°C for 4.0 h. Lanes Xn, authentic xylose to xylopentose from top to bottom. Xylooligosaccharides are indicated. functional food 165

Results and Discussion Production of xylooligosaccharide by the xylanases from P. themophila and M. Cinnamomea. Since previous study shows that the thermostable xylanase from P. thermophila hydrolysed xylans to produce mainly xylobiose and xylotriose (Li et al., 2006), the enzyme was used for production of XOs. Figure. 1 illustrates the time course for production of XOs from hydrolysis of SELC by the thermostable xylanase from P. thermophila. The accumulation of xylobiose and xylotriose increased rapidly during the initial 0.5 h. After 0.5 h of incubation, xylobiose increased slowly while xylotriose decreased. XOs concentration reached 8.5 g l-1 by hydrolysing SELC with 7.5 U ml-1 xylanase for 2.5 h, resulting in a yield of 28.6% XOs from xylan in corncobs. The main hydrolysis products of SELC were xylobiose and xylotriose, which contain 2.3 g l-1 xylose, 1.45 g l-1 arabinose, 0.3 g l-1 acetic acid, 0.26 g l-1 formic acid and 0.22 g l-1 furfural. The concentration of xylobiose and xylotriose was 3.1 g l-1 which increased to 8.2 g l-1 after 2.5 h. Furthermore, XOs were mostly composed of xylobiose and xylotriose. More than 90% in XOs are xylobiose and xylotriose. The time course for the production of XOs from hydrolysis of SELF by the xylanase from M. cinnamomea was shown in Figure. 2. The accumulation of xylobiose and xylotriose increased rapidly during the initial 2 h. Then it increased slowly after 2 h incubation. The yield of XOs reached 7.69% by hydrolysis of SELF with 5.0 U ml-1 of xylanase for 2 h. The main hydrolysis products were xylobiose and xylotriose, and the content of xylobiose and xylotriose was increased from 15% to more than 80% after 2 h of hydrolysis. The conventional enzymatic hydrolysis in the production of XOs is a time consuming process possibly due to use of mesophilic xylanases having temperature optimal around 40–60°C (Yuan et al., 2004; Akpinar et al., 2007; Yang et al., 2007). The hydrolysis period in this study was short due to the use of thermostable xylanase from P. thermophila and M. cinnamomea. These results suggest that the thermostable xylanases are effective in hydrolyzing SELC and SELR, and exhibit a great potential in production of XOs. Production of xylobiose by the hydrolysis of SELC using XynB. The content of xylopentaose, xylotetraose, xylotriose, xylobiose, xylose, and arabinose by HPLC of the products derived from continuous hydrolysis within 76 h were analyzed (data is not shown). The ratio of xylopentaose/xylotetraose/xylotriose/xylobiose/xylose/ arabinose of the final hydrolysate was 1.9/5.1/9.7/49.8/22.6/10.9. The xylobiose produced in this hydrolysis was further separated on an activated charcoal column. In this study, xylobiose may be easily separated from reaction mixture by the activated charcoal column chromatography since xylobiose is the main product occupying 49.8%. The proportion of xylooligosaccharides separated from the 166 Proceedings ASIAHORCS 2013

hydrolyzed SELC is shown in Table 1. Xylobiose and other monosaccharides accounted for 46.7% and 19.1% of the saccharides eluted, respectively, and there were about 19.5% of mixed fractions. It was noteworthy that the purity of the separated xylobiose was 97.2% as examined by HPLC. Crystallization of the eluate further allowed purification of xylobiose up to 99.1%, and its yield was 34.4%. This purity of xylobiose in this study is higher than 95% purity for commercial xylobiose from Megzame (Lot XBI40301, Megazyme International Ireland Ltd., Ireland).

Figure. 2 Time course for production of xylooligosaccharides (®), xylotriose (¡) and xylobiose (▲) from rice straw by the thermostable xylanase from M. cinnamomea. The hydrolysis conditions were as follows: xylanase, 5.0 U ml-1 (pH 6.5) at 60°C for 2 h.

Table 1. Composition of separated sugars from the hydrolysatea Composition of Amount of sepa Sugars the hydrolysate Elution ratio (%) rated sugar (g) (%) Xylose + arabinose 33.5 2.77 ± 0.12 19.1 Xylobiose 49.8 6.76 ± 0.28 46.7 Xylotriose 9.7 0.97 ± 0.04 6.7 Xylopentaose + xylotetraose 7.0 1.16 ± 0.04b 8.0 Otherc – 2.83 ± 0.12 19.5 a Total sugar, 14.49 g, recovery 90.5%. The results presented are expressed as mean ± standard deviation, n = 3. b This fraction still contaminated some xylotriose. c The other fractions were combined during a chromatogram of the hydrolyzed AELC functional food 167

Conclusions The processes consisting of steam explosion pre-treatment and hydrolysis of SELC and SELF by the thermostable xylanases for the production of XOs and xylobiose have been developed. The exploded corncobs and rice straw were confirmed to be suitable for hydrolysis by the thermostable xylanases to produce XOs mainly with the preferred DP. Finally, the total yield of XOs based on xylan in corncobs was 28.6% and the syrup contained more than 90% of xylobiose and xylotriose, while the XOs yield based on the rice straw xylan was 7.69%, with the content of xylobiose and xylotriose high up to more than 80%. In addition, xylobiose was prepared at more than 97.2% in the purity, by the hydrolysis of immobiolized XynB coupled with active-charco purification. The processes appear to be promising techniques for practical production of XOs and xylobiose.

Acknowledgement This work was financially supported by the National Science Fund for Distin- guished Young Scholars (No. 31325021).

References Akpinar, O., Ak, O., Kavas, A., Bakir, U., & Yilmaz, L. (2007). Enzymatic production of xylooligosaccharides from cotton stalks. Journal of Agriculture and Food Chemistry, 55, 5544–5551. Jiang, Z. Q., Deng, W., Zhu, Y. P., Li, L. T., Sheng, Y. J., & Hayashi, K. (2004). The recombinant xylanase B of Thermotoga maritimais highly xylan specific and produces exclusively xylobiose from xylans, a unique character for industrial applications. Journal of Molecular Catalyze B: Enzymatic, 27, 207–213. Li, L.T., Tian, H. M., Cheng, Y. Q., Jiang, Z. Q., & Yang, S. Q. (2006). Purification and characterization of a thermostable cellulase-free xylanase from the newly isolated Paecilomyces thermophila J18. Enzyme and Microbial Technology, 38, 780–787. Li, L.S. (2007). Steam explosion equipment for breaking down biomass. China Pat. ZL200720089880.X. Makishima, S., Mizuno, M., Sato, N., Shinji, K., Suzuki, M., Nozaki, K., . . . Amano, Y. (2009). Development of continuous flow type hydrothermal reactor for hemicellulose fraction recovery from corncob. Bioresource Technology, 11, 2842–2848. Parajó, J.C., Garrote, G., Cruz, J. M., Dominguez, H. (2004). Production of xylooligosaccharides by autohydrolysis of lignocellulosic materials. Trends in Food Science and Technology, 15, 115–120. Tian S.S., Li, D.Y., Jiang, Z. Q., Zhu, Y. P., Shi, B., & Li, L.T. (2008). Production of xylobiose from the autohydrolysis explosion liquor of corncob using Thermotoga maritimaxylanase B (XynB) immobilized on nickel-chelated Eupergit C. Bioresource Technology, 99, 200–204. 168 Proceedings ASIAHORCS 2013

Teng, C., Yan, Q. J., Jiang, Z. Q., Fan, G. S., & Shi, B. (2010). Production of xylooligosaccharides from the steam explosion liquor of corncobs coupled with enzymatic hydrolysis using a thermostable xylanase. Bioresource Technology, 101, 7679–7682. Yang, C. H., Yang, S. F., & Liu, W.H. (2007). Production of xylooligosaccharides from xylans by extracellular xylanases from Thermobifida fusca.Journal of Agriculture and Food Chemistry, 55, 3955–3959. Yuan, Q. P., Zhang, H., Qian, Z. M., & Yang, X. J. (2004). Pilot-plant production of xylooligosaccharides from corncob by steaming, enzymatic hydrolysis and nonofiltration. Journal of Chemical Technology and Biotechnology, 79, 1073–1079. Immunomodulating Effects of Polysaccharides from Edible Mushrooms in Japan

Ken-ichiro Minato*, and Akihiro Ohara Department of Applied Biological Chemistry, Meijo University

short Abstract A lot of studies have revealed immune functions of edible mushrooms. We had already shown that some edible mushrooms possessed immunomodulating polysaccharides. In this study, we examined immunomodulating effects polysaccharide from Pleurotus citrinopileatus on a macrophage differentiation and activation. Amacrophage is a dynamic and heterogeneous immunocompetent cell. Polarized macrophagesare is broadly classified into two types. There are M1 type (classical activated macrophage) and M2 type (alternatively activated macrophages). The previous study showed that polysaccharides can influence macrophage differentiation and macropahge activities. The differentiation of macrophage in treatment with a polysaccharide from P. citrinopileatus showed an increasing value significantly IL-12 inside of differentiated monocyte. Moreover, it was shown that the polysaccharide preferentially induced to express type 1 cytokines, which were pro-inflammatory effectors such as IL (interleukin)-1b, TNF (tumor necrosis factor)-a, IL-6 andIL-12 from activated macrophages. These data showed the functional polysaccharide from this edible mushroom P. citrinopileatus could act as an inflammatory immunomodulator. Moreover, the polysaccharide was associated with a differentiation of monocytes toward M1 macrophage, and the mushrooms could make an effective materials of a type 1 immunomodulator. Keywords: polysaccharide, immunomodulating action, M1/M2 macrophage, mushroom, cytokine

*Corresponding Author 468-0073 Aichi, Nagoya, Tenpaku Ward, Shiogamaguchi, 501, Japan E-mail: [email protected]

Introduction Several studies have suggested the immunomodulating effects of edible and medicinal mushroom. They suggested that polysaccharides and its related compounds demonstrated several potentials and unique properties as biological response modifiers (BRM). It is implicated that these polysaccharides from edible and medicinal mushrooms could augment or complement a desired immune system to maintain a health condition in a host, called as immunomodulating effect. We had assessed a relationship between polysaccharide contents and immunomodulating action. It was suggested that different mushrooms showed different contents of polysaccharide and immunomodulating activity. Several immunological reports considered that a macrophage can play a key role in our immunomodulating action. Therefore, we examined a macrophage

169 170 Proceedings ASIAHORCS 2013

action stimulated with immunomodulating polysaccharides. Macrophages are dynamic and heterogeneous cells. Polarized macrophages are broadly classified into two types, M1 type and M2 type (Takeuchi and Akira, 2011, Benoit et al., 2008). The M1 type is called classical activated macrophage, and as a response to type 1 inflammatory cytokine. The M2 type is called alternatively as activated macrophages, and has anti-inflammatory and immunosuppressive properties. Similar with Th1 and Th2 lymphocytes, M1 is proinflammatory effectors and express mediators of inflammation, such as IL-12, TNF-a, CC chemokines and nitric oxide. Otherwise, the M2 macrophage plays an important role in immunoregulation system, and it is differentiated by Th2 cytokines, such as IL-4 or IL-13. To understand whether a functional polysaccharide influence on their differentiation and polarization, we have studied the type of cytokine which is produced from monocyte and activated macrophage by polysaccharide treatment. It was suggested that the activated macrophages made contact with lymphocyte in acquired immune system, then the Th response was induced. It is generally considered that maintaining a balance of M1 and M2 macrophages could prevent a development of animmunodificient disease, such as inflammatory, allergy and cancer. According to the result of the research, it suggested that the immunomodulating polysaccharide could regulate this macrophage balance. In this study, we examined an immunomodulating action of a polysaccharide from P. citrinopileatusin innate immune system especially, and their tumorcidal effects. It was assessed the potential of this mushroom as a powerful material of functional food.

Materials and Methods Preparation of immunomodulating polysaccharide fraction, HWE-P-IV, from P. citrinopileatus. The immunomodulating polysaccharide fraction was prepared from a hot water extract of P. citrinopileatus chromatographically as described previously (Minato, 2008). Hot water extracteded from the mushroom fruiting body was separated into six fractions by using DEAE-Sepharose CL-6B column (2.6 × 30 cm). The active fraction among them (P-IV) was purified by using Sephacryl S-400 column. The amount of total sugar in each fraction was measured by anthrone-sulfuric acid method using glucose as a standard. Preparation of macrophage cell lines. THP-1 cell (Riken Cell Bank, Tsukuba, Japan) was differentiated to macrophages as follows. Their macrophage-like states were obtained by treated each monocyte with 160 ng×mL-1phorbol 12-myristate 13-acetate (PMA; Sigma) in 24-well cell culture plates (Nunc) with cell suspension (1 × 106 cells). The differentiated and adherent cells were washed twice with RPMI 1640 medium containing 10% FBS and 1% glutamate/penicillin/streptomycin functional food 171

(Chanput et al.,2013), the resting state of macrophage, they were furthermore rested in the culture medium. After the incubation, the cultures were washed to remove the non-adherent cells. Each sample in fresh medium was added to the % plates and cultured at 37ºC and 5 CO2. After incubation, the accumulation of cytokine in the cell was examined by using fluorescence-conjugated anti-IL-12, and IL-10 antibodies. Furthermore, the cell was incubated for 6 hours. The supernatant of cultures was collected and used for nitrite assay, and cell lysate was obtained to quantify mRNA expression of cytokine. CBA assay. Supernatant was collected, and cytokine content was measured using the cytometric bead array Human inflammation Kit (BD Biosciences) according to the manufacturer’s instruction. Data collection and analysis were performed using a FACS Calibur flow cytometer and FCAP array software (BD Biosciences).

Nitrite assay. NO2 measured by the accumulation of nitrite as a stable end product was determined by a microplate assay. The samples (100 mL) were incubated with an equal volume of Griess reagent (1% sulfanilamide/0.1% N-1- naphthylethylenediamine dihydrochloride/2.5% H3PO4) at room temperature for 10 minutes. The absorbance at 570 nm was determined with a microplate reader. Nitrite concentration was calculated by using a sodium nitrite as a standard. qRT-PCR analysis. The total RNA was extracted by the single step guanidinium thiocyanate-phenol-chloroform method. The cDNA was synthesized by using a SuperScript III First-Strand Synthesis system (Invitrogen). Real-time PCR was performed using a Thermal Cycler Dice TP850 (TaKaRa Bio, Japan) to quantify cytokines mRNAs. Thermal cycling conditions for real-time PCR with SYBR Green quantification were 95°C for 30 second following by 40 cycles at 95°C for 5 second and 60°C for 30 second. The mRNA expressions of respective genes were normalized to the level of GAPDH mRNA. Statistical analysis. All data were presented as mean ± SD. Differences were analysed by Student unpaired t- test. Between-group comparison of means was carried out by ANOVA, followed by Tukey’s test. A level of p< 0.05 was accepted as statistically significant.

Results and Discussion Separation of an immunomodulating polysaccharide from Pleurotus citrinopileatus. The extract was eluted by using a DEAE-Sepharose CL-6B column with 1/15M phosephate buffer (pH 7.2) and the same buffer containing 0.2 or 0.6M NaCl in a stepwise elution. The sugar content of each fraction was measured at

620 nm using the Anthrone- H2SO4 method. This crude polysaccharide fraction was separated into six fractions which were P-I, II, III, IV, V, and VI.P-IV, and the most active fraction was furthermore purified by size-exclusion chromatography 172 Proceedings ASIAHORCS 2013

using a Sephacryl S-400 column. We found that a molecular mass of this fraction was determined to be 448 kDa. It was exhibited that P-IV possesses a potent immunomodulating activity (Minato, 2008). An immunomodulating effect of the polysaccharide on a differentiation of monocyte. To assess a macrophage differentiation, a monocyte THP-1 was stimulated with the immunomodulating polysaccharide fraction P-IV.A monocyte was differentiated toward macrophage by stimulating with PMA for 48 hours. Then, it was kept for 24 hours without FCS for differentiation to M0 stage of a macrophage. After the cell was incubated for 24 hours with the polysaccharide, an accumulation of cytokine in differentiated cell was examined. Figure 1 showed that P-IV treatment showed to preferentially increase in IL-12 accumulation inside of the cell. It was suggested that P-IV predominantly regulated a differentiation of monocyte toward classical activated macrophage (M1).

Figure 1. The polysaccharide fraction (P-IV) from P. citrinopileatus could induce M1 macrophage differentiation with dose dependence. Nuclei were stained by DAPI (Red), IL-12 was stained fluorescently (Blue), and IL-10 was stained by FITC (Green).

An immunomodulating effect of P-IV fraction from P. citrinopileatus on Th1-cytokinesproduction from activated macrophages. Table 1 shows that high productions of Th1 cytokines, TNF-a, IP-10, were determined. The polysaccharide fraction (P-IV) showed a strong immunomodulating effect on expressions of some inflammatory cytokines mRNAs. Figure 2 shows IL-1b and TNF-a mRNA expression in activated macrophage stimulated with the immunomodulating polysaccharide, P-IV. As positive control, The LPS was used. Although their expressions were weak, the polysaccharide fraction also possessed immunomodulating effect on expressions of other inflammatory cytokines, IL-12 and IL-6 (Figure 3). These results suggest that P-IV polysaccharide fraction showed an immunomodulating effect on an inflammatory cytokine expression. On the other side, it was not shown that this polysaccharide had an anti-inflammatory effect. Moreover, P. citrinopileatus was an innate immune activator toward inflammatory response. functional food 173

Table 1. Immunomodulating effects of P-IV fraction from P. citrinopileatus on Th1-cytokines production from active macrophages.

Comparison of means between different groups was performed using the Student’s t-test. *p < 0.001, **p < 0.001 vs control.

Figure 2. P-IV showed an immunomodulating effect on inflammatory cytokines, IL-1b as well as TNF-a, expressions in an activated macrophage.

An anti-tumorcidal effect of an activated macrophage by an immunomodulating polysaccharide. It was examined whether macrophage activation by polysaccharide could induce tumoricidal action. The monocyte cell-line, THP-1 (Riken Cell Bank, Japan) was induced differentiation to a macrophage by PMA for 48 hours, and then stimulated with crude polysaccharide fraction from P. citrinopileatus. After cancer cells were indirectly co-cultivated for 48 hours with the stimulated cells, a tumoricidal effect was examined by using MTT assay. It was confirmed that only this fraction did not show tumoricidal action. Figure 4 shows that a growth of tumor cell HeLa could be inhibited by indirect co-cultivation with the stimulated macrophage. It was suggested that P. 174 Proceedings ASIAHORCS 2013

citrinopileatus activated a macrophage and it could contribute to inhibition of HeLa. These results suggest that an immunomodulating polysaccharide from P. citrinopileatus stimulated monocyte and induced to differentiate it toward M1 type macrophage (Figure 5). Moreover, the polysaccharide in the mushroom stimulated activated macrophage, and then the macrophage could secrete inflammatory cytokines. These cytokine might attack tumor cells.

Figure 3. P-IV showed immunomodulating effects on IL-6 and IL-12 expression in an activated macrophage.

Figure 4. A polysaccharide fraction of P. citrinopileatus induced to activate a macrophage. And, it was shown that a growth of HeLa was inhibited by co-cultivation with the macrophage stimulated with the fraction. functional food 175

Figure 5. An immunomodulating polysaccharide fraction of an edible/medicinal mushroom could be expected to use as effective materials of a type 1 immunomodulator in macrophage differentiation and activation.

Conclusion The treatment with immunomodulating polysaccharide in P. Citrinopileatus showed a significantly increasing data more IL-12 than IL-10 inside of differentiated macrophages. The immunomodulating polysaccharide induced to produce Th1 cytokines, TNF-a, IL-1b from the macrophages, and then, the type 1 macrophage could kill HeLa tumor cell by non-contacting co-cultivation by stimulating with the polysaccharide. These results suggest that the immunomodulating polysaccharide in P. citrinopileatus could be expected to use as effective materials of a type 1 immunomodulator and it was suggested that this mushroom will make a powerful functional food.

Acknowledgement We thank The Indonesian Institute of Sciences and Japan Society for the Promotion of Science. This work was supported in part by Institution of “Yaku- Syoku-Dogen” at Meijo University. We also thank Kinokkusu Co., Sendai for supplying some mushrooms, and RIKEN BioResource Center, Tsukuba for supplying cell line, THP-1. This work was partially supported by Grant-in-Aid for Exploratory Research23650465 from The Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan. 176 Proceedings ASIAHORCS 2013

References Benoit, M., Desnues, B., & Mege, J.L. (2008). Macrophage polarization in bacterial infections. J. Immunol., 181, 3733–3739. Chanput, W., Mes, J.J., Savelkoul, H.F.J., & Wichers, H.J. (2013). Characterization of polarized THP-1 macrophages and polarizing ability of LPS and food compounds. Food Funct., 4, 266–276. Takeuchi, O., & Akira, S. (2011). Epigenetic control of macrophage polarization. Eur. J. Immunol., 41, 2470–2525. Minato K. (2008). Immunomodulatin activity of a polysaccharide fraction of a culinary-medicinal mushroom, Pleurotuscitrinopileatus Singer (Agaricomycetideae), in vitro. Int. J. Med. Mushr., 10 (3), 235–244. Effects of Consumption Timing on Gastric Emptying Rate and Bioavailability of Bilberry Anthocyanins

Sakakibara H1,2,*, Aoshima Y3, Yamazaki S3, and Shimoi K4 1) Faculty of Agriculture, University of Miyazaki 2) Graduate School of Agriculture, University of Miyazaki 3) Graduate School of Nutritional and Environmental Sciences, University of Shizuoka 4) Graduate School of Integrated Pharmaceutical and Nutritional Sciences, University of Shizuoka

Abstract Anthocyanins, one of the most important flavonoid groups, are widely distributed in the berry fruits, and have beneficial effects including antioxidant activity. We previously examined bioavailability of anthocyanins using mice model, and concluded that bilberry anthocyanins are absorbed into the body and distributed as intact forms in specific organs, particularly in the liver, kidney, and testis. Additionally, we also reported that many of the biological processes involving absorption and metabolism of dietary ingredients follow diurnal rhythms recurring every 24 hours. In this study, we evaluated the effects of consumption timing on gastric emptying rate (GER) and bioavailability of bilberry anthocyanins. After fasting for 12 hours, bilberry extracts were orally administrated in amounts of 100 mg/kg body weight at ZT0 (beginning of the inactive phase) or ZT12 (beginning of the active phase) to male C57BL/6 mice. Animals were anesthetized with ether at 0 (just before the administration), 15, 30, 60, and 120 minutes after the administration, and the gastrointestinal tract (stomach and ileum) and plasma were collected. GER of anthocyanins was significantly faster upon administration at the active phase than that of the inactive phase. Their amounts appeared in the plasma suggested different time-dependent property according to the consumption timing. In conclusion, GER and bioavailability of bilberry anthocyanins may vary with timing of consumption. Keywords: Anthocyanins, bioavailability, consumption timing, gastric emptying rate, rodents

*Corresponding Author 1-1 Gakuen Kibana-dai Nishi, Miyazaki 889-2192, Japan E-mail: [email protected]

Introduction Many kinds of functional candidates have been identified in dietary foods using in vivo studies (Sakakibara et al., 2002, Shibamoto et al., 2008). Basically, most of the factors are recognized to be difficult to be absorbed in the native forms existed in foods. For example, most of flavonoids, which are one of the major functional groups widely distributed in the plant kingdom (Sakakibara et al., 2003) are absorbed after some modifications (Terao, 2010), and also their absorption ratio is quite low; around 1% for flavonoid glycosides (Anandet al., 2007, Sakakibara et al., 2009). Hence, it is mandatory to know whether bioactive food factors are absorbed in sufficient quantity, and if these components reach target organs while

177 178 Proceedings ASIAHORCS 2013

maintaining beneficial effects. For such reasons, many researchers, including our group, have investigated the bioavailability of functional food factors using animal models to obtain the evidence of their accurate physiological benefits (Boughattas et al., 1989, Hashimoto et al., 2006, Sakakibara et al., 2006, Yokoyama et al., 2009). Interestingly, most of the physiological and biological processes in living things show diurnal rhythms (Tsurusaki et al., 2013). These include some parameters such as absorption and metabolism. Because of such diurnal rhythms, biological effects of several compounds, especially nutrients such as hexose and peptide, have been suggested to be fairly different according to consumption timing (Houghton et al., 2008, Pan et al., 2003). However, information about the effects of consumption timing of functional food factors on their bioavailability is quite limited. In this study, we therefore focused on anthocyanins, which are a major group of flavonoids and reported to be absorbed mainly as intact forms existed in the berry fruits (Sakakibara et al., 2009), and evaluated the effects of their consuming timing on gastric emptying rate (GER) and plasma levels after oral administration using mice model.

Materials and Methods Materials. Bilberry extracts (BBEx) were obtained from Wakasa Seikatsu Co. Ltd., (Kyoto, Japan). Standards of the following anthocyanidins and anthocyanins were obtained from Extrasynthèse (Genay, France): delphinidin, delphinidin-3-glucoside, cyanidin, cyanidin-3-galactoside, cyanidin-3-glucoside, cyanidin-3-rutinoside, petunidin, peonidin, peonidin-3-glucoside, pelargonidin, pelargonidin-3-glucoside, malvidin, malvidin-3-galactoside, and malvidin-3- glucoside. Trifluoroacetic acid (TFA) and ascorbic acid were obtained from Wako Pure Chemical Industries, Ltd. (Osaka, Japan). All other reagents were of the highest grade available. Animal experiments. Male C57BL/6 mice (6 weeks old, Japan SLC, Shizuoka, Japan) were housed in the air-conditioned room (23±1°C) under 12-h dark/12-h light cycle (light on 8:00–20:00) with free access to tap water and purified control diet (3.8 kcal of energy per gram; D12450B, Research Diets, Inc., New Brunswick, NJ, USA). As additional light environment, a 1 lux dim red lamp without a spectral radiance less than 650 nm was turned on the entire day including the light period to allow the researchers to work efficiently during the dark period without affecting the mice (Conway, 2007, Jacobset al., 2007). After 2 weeks of acclimatization, a group of 50 mice was divided at random into 2 groups, and treated as follow: Group A was orally administrated BBEx dissolved in 10% citric acid (100 mg/kg body weight) at ZT0. “ZT” is an abbreviation of Zeitgeber Time, functional food 179 and “ZT0” indicated the period when the light went on. Hence, the light period was from ZT0 to ZT12, and the dark period was from ZT12 to ZT24 (0). The other group B was orally administrated same amounts of BBEx at ZT12. The both groups of mice were anesthetized with ether at individual time points after the administrations (0, 15, 30, 60, 120 minutes). After decapitation, trunk blood was collected into heparinized tubes (Capiject, Terumo, Medical Corporation, Somerset, NJ). The plasma was separated by centrifugation at 800 g for 10 min, and acidified by addition of 15 μL formic acid to 1 mL plasma. After addition of 5 μL of 100 mM ascorbic acid, the plasma was stored at -80°C for analysis. Then, the gastrointestinal tracts were dissected into stomach and ileum (5 cm length from the blind gut). Tissue specimens were immersed immediately into 5 mL of 10% ice-cold citric acid, and then thoroughly dissected. After mixing at 2,500 rpm for 5 minutes, the sample solution was centrifuged at 3,000 rpm for 10 minutes, and 1.5 mL of the supernatant was evaporated to dryness using a centrifugal concentrator (VC-96N, Taitec Co., Saitama, Japan). The residue was dissolved in 300 μL of methanol containing 0.5% TFA and was subjected to high performance liquid chromatography (HPLC) analysis as described below. This study was conducted according to the guidelines for the care and use of laboratory animals of the University of Shizuoka, Japan. Extraction of anthocyanins from plasma. The extraction procedure was as previously described (Sakakibara et al., 2009). Briefly, the frozen plasma was thawed, and aliquots (400 µL) were loaded onto OASIS HLB (30 mg) extraction cartridges (Waters Co., Milford, MA), which was equilibrated with 0.01 M oxalic acid. After washing the cartridge with 2 mL of 0.01 mM oxalic acid, anthocyanins were eluted with 1 mL of methanol containing 0.5% TFA. The eluate was evaporated to dryness using a centrifugal concentrator. The residue was then dissolved in 150 μL of methanol containing 0.5% TFA, filtered with a 0.2 µm membrane filter (Millex-LG, Millipore Co., Bedford, MA), and submitted to HPLC analysis. HPLC-DAD system. Anthocyanins in gastrointestinal tracts and plasma were analysed by HPLC in combination with a diode array detector (DAD) system according to our previous study (Sakakibara et al., 2009). Briefly, the HPLC system employed was a JASCO system control program HSS-1500 (Tokyo, Japan) equipped with JASCO-BORWIN chromatography data station, pump PU-1580, autosampler AS-1559, column oven CO-1565, and DAD system MD-1510 for monitoring at all wavelengths from 200–600 nm. The column, a Capcell Pak ACR (4.6 mm i.d. × 250 mm, S-5, 5 µm, Shiseido Co. Ltd., Tokyo, Japan) was used at 40°C. Linear gradient elution was performed with solution A (0.5% TFA aqueous) and solution B (acetonitrile containing 0.1% TFA) delivered at a flow rate of 1.0 mL/minute as follows; initially 92% of solution A; for the next 50 180 Proceedings ASIAHORCS 2013

minutes, 85% A; for another 10 minutes, 70% A; for another 5 minutes, 40% A; and finally, 40% A for 10 minutes. The injected volume of the extract was 20 µL. Statistical analysis. Data are indicated as mean ± standard deviation (SD). Statistical analysis were performed using the software program Stat View for Windows (Version 5.0, SAS Institute, Cary, NC). Time-dependent data analysis was performed using repeated measure ANOVA and following Fisher-PLSD analysis on between subject factors. The results were considered to be significant if the possibility of error was less than 5%.

Results and Discussion Anthocyanins in bilberry extracts (BBEx). BBEx used in this study contained 15 kinds of anthocyanins as shown in Figure 1, and their retention times and spectra were compared with our previous results (Ogawa et al., 2008, Sakakibara et al., 2009). These peaks were calculated using calibration curves obtained from commercially available anthocyanins with the same aglycone structures. For example, delphinidin-3-glucoside was used for calculation of delphinidin-3-arabinoside content. Peak 11 (malvidin-3-galactoside) and 12 (peonidin-3-glucoside) in Figure 1 had almost same retention times and spectra under our HPLC conditions. These peaks indicating typical anthocyanin spectra were determined to be either peonidin-3-glucoside or malvidin-3-galactoside, and calculated using the calibration curve of malvidin-3-galactoside. Peaks 13 and 14 also gave almost identical retention times. The total concentration was 67.3μ mol/100 mg BBEx. Effects of consumption timing on gastric emptying rate (GER) of bilberry anthocyanins. The concentration profiles of total anthocyanins in mouse plasma and gastrointestinal contents after consumption of 100 mg BBEx per kg body weight (67.3 μmol anthocyanins/kg body weight) were investigated by HPLC- DAD system. When BBEx were orally administered at ZT0 (beginning of the inactive phase) or ZT12 (beginning of the active phase) in the same amounts, anthocyanins were more rapidly decreased from stomach, and significantly lower at 30 min and 60 minutes after the administration in the treatment group at ZT12 than that at ZT0 (Table 1). Additionally, anthocyanins indicated the tendency to be appeared faster in the ileum, when administrated at ZT12. These results indicate that the GER of anthocyanins was remarkably faster upon administration during the active phase than that of the inactive phase. Effects of consumption timing on plasma levels of bilberry anthocyanins. The total concentration of anthocyanins in the plasma after administration at ZT0 and ZT12 reached maximum at 15 minutes after administration, and their mean values were 1.54 μM and 1.39 μM, respectively (Table 1). The plasma anthocyanins in mice treated at ZT0 were then slightly decrease at 30 min after functional food 181 administration (1.38 μM), and following sharply decreased almost to basal levels after 60 minutes. On the other hand, in the group treated at ZT12, the plasma anthocyanins were more sharply decreased, and reached almost to basal levels after 30 minutes (0.27 μM), indicating that the clearance of anthocyanins might be faster upon administration during the active phase than that of the inactive phase although there is no difference on the maximum levels in the plasma.

Conclusions In this study, we evaluated the effects of consumption timing on GER and plasma levels of bilberry anthocyanins. The GER of anthocyanins was significantly faster upon administration at the active phase than that at the inactive phase. Our results also suggested that the clearance of anthocyanins absorbed into the body might be faster upon administration during the active phase although there is no difference on the maximum levels appeared in the plasma.

Acknowledgement The present study was supported in part by a Grant-in-Aid forY oung Scientists (A) from the Japan Society for the Promotion of Science (No. 23310011, to H.S.), and Hokuto Foundation of Science and Technology (to H.S.).

References Anand, P., Kunnumakkara, A. B., Newman, R. A., & Aggarwal, B. B. (2007). Bioavailability of curcumin: problems and promises. Molecular Pharmacology, 4, 807–818. Boughattas, N. A., Levi, F., Fournier, C., Lemaigre, G., Roulon, A., Hecquet, B., . . . Reinberg, A. (1989). Circadian rhythm in toxicities and tissue uptake of 1,2-diamminocyclohexane(trans-1) oxalatoplatinum(II) in mice. Cancer Research, 49, 3362–3368. Conway, B. R. (2007). Color vision: mice see hue too. Current Biology, 17, R457-R460. Hashimoto, T., Ueda, Y., Oi, N., Sakakibara, H., Piao, C., Ashida, H., . . . Kanazawa, K. (2006). Effects of combined administration of quercetin, rutin, and extract of white radish sprout rich in kaempferol glycosides on the metabolism in rats. Bioscience, Biotechnology, and Biochemistry, 70, 279–281. Houghton, S. G., Iqbal, C. W., Duenes, J. A., Fatima, J., Kasparek, M. S., & Sarr, M. G. (2008). Coordinated, diurnal hexose transporter expression in rat small bowel: implications for small bowel resection. Surgery, 143, 79–93. Jacobs, G. H., Williams, G. A., Cahill, H., Nathans, J. (2007). Emergence of novel color vision in mice engineered to express a human cone photopigment. Science, 315, 1723–1725. Ogawa, K., Sakakibara, H., Iwata R., Ishii, T., Sato, T., Goda, T., . . . Kumazawa, S. (2008). Anthocyanin composition and antioxidant activity of the Crowberry (Empetrum nigrum) and other berries. Journal of Agricultural and Food Chemistry, 56, 4457–4462. 182 Proceedings ASIAHORCS 2013

Pan, X., Terada, T., Okuda, M., & Inui, K. (2003). Altered diurnal rhythm of intestinal peptide transporter by fasting and its effects on the pharmacokinetics of ceftibuten. Journal of Pharmacology and Experimental Therapeutics, 307, 626–632. Sakakibara, H., Ashida, H., & Kanazawa, K. (2002). A novel method using 8-hydroperoxy-2’- deoxyguanosine formation for evaluating antioxidative potency. Free Radical Reserch, 36, 307–316. Sakakibara, H., Honda, Y., Nakagawa, S., Ashida, H., & Kanazawa, K. (2003). Simultaneous determination of all polyphenols in vegetables, fruits, and teas. Journal of Agricultural and Food Chemistry, 51, 571–581. Sakakibara, H., Ashida, H., Fukuda, I., Furuyashiki T., Sano, T., Nonaka, Y., . . . Kanazawa, K. (2006). A frequent drinking of green tea lowers the levels of endogenous oxidative stress in small intestines, erythrocytes and kidneys in rats. Journal of Clinical Biochemistry and Nutrition, 39, 32–39. Sakakibara, H., Ogawa, T., Koyanagi, A., Kobayashi, S., Goda, T., Kumazawa, S., . . . Shimoi, K. (2009). Distribution and excretion of bilberry anthocyanins in mice. Journal of Agricultural and Food Chemistry, 57, 7681–7686. Shibamoto, T., Kanazawa, K., Shahidi, F., & Ho, C. T. (2008). Functional Food and Health. Washington D. C: ACS Publications. Terao, J. (2010). Flavonols: Metaboism, bioavailability, and health impact. In Fraga, C. (Eds) Plant Polyphenolic and Human Health, pp. 185–196. Hoboken: John Wiley & Sons, Inc. Tsurusaki, T., Sakakibara, H., Aoshima, Y., Yamazaki, S., Sakono, M., & Shimoi, K. (2013). Diurnal rhythmicity in biological processes involved in bioavailability of functional food factors. Journal of Clinical Biochemistry and Nutrition, 52, 208–214. Yokoyama, A., Sakakibara, H., Crozier, A., Kawai, Y., Matsui, A., Terao, J., . . . Shimoi, K. (2009). Quercetin metabolites and protection against peroxynitrite-induced oxidative hepatic injury in rats. Free Radical Reserch, 43, 913–921. functional food 183

Table 1. Effects of administration timing on GER and plasma levels of anthocyanins after oral administration of BBEx in mice. Time after administration Administration timing (min) ZT0 ZT12 Gastric contents (nmol/stomach) B u.d. u.d. 15 417.8 ± 35.2 326.8 ± 22.7 30 375.7 ± 25.5 221.8 ± 62.7* 60 292.8 ± 47.5 184.6 ± 29.6* 120 206.9 ± 20.4 154.5 ± 16.2

Ileum contents (nmol/ileum) B u.d. u.d. 15 5.5 ± 1.1 9.0 ± 1.8 30 14.8 ± 2.2 8.2 ± 2.4 60 12.5 ± 2.9 8.5 ± 1.5 120 8.8 ± 1.9 14.1 ± 4.6

Plasma (μM) B u.d. u.d. 15 1.54 ± 0.42 1.39 ± 0.58 30 1.38 ± 0.65 0.27 ± 0.04* 60 0.15 ± 0.02 0.45 ± 0.19 120 0.10 ± 0.06 0.49 ± 0.18

Bilberry extracts (BBEx) was orally administrated in amounts of 100 mg/kg B.W. (67.3 μmol anthocyanins/kg B.W.) of male C57BL/6 mice at ZT0 or ZT12. Gastrointestinal tracts (stomach and ileum) and plasma were colleceted at individual time points. The amounts of anthocyanins in gastrointestinal contents and plasma were analyzed by HPLC-PDA system described in the Material and Methods. Data indicate mean ± SD (n = 5). *Significantly differences vs same time point after the treatment at ZT0 (P<0.05, Fisher-PLSD analysis). B, just before the treatment at ZT0 or ZT12; GER, gastric emptying rate; u.d., under the detection limits. 184 Proceedings ASIAHORCS 2013

V) 2

μ 60000 5 3

4 7 40000 11 13 8 12 14

6 20000 10 9 15 Intensity nm ( Intensity 520at

0 0 10 20 30 40 50 60 Retention time (min)

Figure 1. Typical HPLC profiles of bilberry extracts (BBEx) as amounts of 1 mg/mL at 520 nm.

Peak numbers refer (μmol/100 mg BBEx): 1, Delphinidin-3-galactoside (10.2); 2, Delphinidin-3-glucoside (8.9); 3, Cyanidin-3-galactoside (8.3); 4, Delphinidin-3-arabinoside (7.8); 5, Cyanidin-3-glucoside (6.8); 6, Petunidin- 3-galactoside (2.4); 7, Cyanidin-3-arabinoside (5.7); 8, Petunidin-3-glucoside (4.6); 9, Peonidin-3-galactoside (0.8); 10, Petunidin-3-arabinoside (1.7); 11/12, Malvidin-3-galactoside/Peonidin-3-glucoside (4.3); 13/14, Malvidin- 3-glucoside/Peonidin-3-arabinoside (4.7); 15, Malvidin-3-arabinoside (1.1). Short Communication of Oral Presentations

Functional Foods: Recent Research and Future Prospects

Prasanna Vasu, Food Safety & Analytical Quality Control Laboratory (FS & AQCL), CSIR-Central Food Technological Research Institute, Mysore-570020, Karnataka, India

Food is the basic necessity for the sustenance of human life. Hippocrates espoused “Let food be thy medicine and medicine be thy food” about 2,400 years ago, which stressed upon the importance of well-balanced diet for human health. Conventional foods satisfy hunger and provide varying amounts of nutrients and energy to sustain the growth and support vital metabolic processes. A functional food is similar to the conventional food, and is demonstrated to have physiological, and potential positive health benefits beyond basic nutrition. They may be envisioned as the luxurious next-generation food with intended efficacy superseding basic nutrition, as exemplified by fortified foods, enriched foods, enhanced foods and dietary supplements. These functional foods provide essential nutrients often beyond quantities necessary for normal growth and development, and/or other biologically active components that impart or promote health benefits or desired physiological effects. Additional benefits include reducing risk of chronic and life-st=yle diseases or enhancing physical and mental well-being. Functional foods have no therapeutic effects, and hence regular consumption as diet will significantly reduce the risk of getting a particular disease rather than preventing it. Functional foods are known to reduce the risk of life-style related diseases such as intestinal infection, constipation, non-insulin dependent diabetes, obesity, osteoporosis, or colon cancer. The potential of functional food is to mitigate disease, promote health and wellness, and reduce healthcare costs. Scientists and regulators have recently begun to agree that main attributes of functional foods should be found in whole foods rather than in their individual components. Functional foods are introduced in Japan in the mid 1980s. Epidemiological and clinical data indicate that plant-based diet reduced the risk of chronic disease (for example cancer). Numerous epidemiological studies have shown that cancer risk was only 50% in people consuming diets rich in fruits and vegetables than those who consume few of these foods. Evidences also suggest that biologically active phytochemicals in plant-based diet can reduce cancer risk. These bioactive phytochemicals are known as “Nutraceuticals.” A nutraceutical is a product isolated or purified from foods that is generally sold inmedicinal forms not usually

187 188 Proceedings ASIAHORCS 2013

associated with foods, demonstrated to have a physiological benefit or provide protection against chronic disease. Many foods are considered functional foods as they contain certain nutraceuticals to help in neutralizing free radicals (b-carotene, catechins, flavonones), reducing the risk of cancer (lycopene, anthocyanins, catechins, flavonones, flavones, conjugated linoleic acid), reducing the risk of cardiovascular disease (insoluble and soluble fibre,b -glucan, omega-3 fatty acids, tannins), protecting against coronary heart disease (b-glucan, iso-flavones), lowering LDL and total cholesterol (soluble fibre,b -glucan, stanol ester, iso-flavones), improving visual function and mental health (omega-3 fatty acids), reducing the risk of macular degeneration (lutein), preventing cancer (lignin), and improving quality of gut microflora (fructo-oligosaccharides). Functional foods are defined as food and food components that provide a health benefit beyond basic nutrition (i.e., traditional nutrients it contains). A food can be regarded as functional if it is satisfactorily demonstrated to affect beneficially one or more target functions in the body, beyond adequate nutritional effects, in a way which is relevant to either the state of well-being and health or the reduction of the risk of a disease. Nutrition Business Journal defines functional food as food fortified with added or concentrated ingredients to a functional level, which improves health and/or performance of products marketed for their inherent functional qualities. Some examples are catechins in black and green tea reducing risk of cancer, sulforaphane in broccoli reducings cancer risk, omega-3 fatty acids in fish reducing risk of heart disease, garlic has sulfur compounds reducing risk for cancer and heart disease, oats with soluble fibreb-glucan reducing cholesterol level, purple grape juice contains resveratrol supporting normal and healthy cardiovascular function, soy protein reducings cholesterol levels, lycopene in tomatoes reducing risk for cancer, yogurt containing probiotics improving gastrointestinal health, fruits and vegetables contain phytochemicals reducing risk for cancer and cardiovascular diseases. Functional foods are broadly classified into three main groups, probiotics (live microorganisms), conventional (whole foods), and designer (enriched foods). Further based on nutraceutical components, there are different types of functional foods like a food containing high levels of a nutraceutical, a food fortified with a nutraceutical, a food from which a component has been removed, a food in which the nature of one or more components have been modified to improve health, and a food in which the absorption of one or more components have been increased to provea beneficial effect. Furthermore, based on the mechanism of action, functional foods are classified into lipid lowering (apple, barley, blackberry, blueberry, carrot, eggplant, oats, garlic, ginger, ginseng, mushroom, onion, soybean, tea), enhanced drug detoxifying (lemon, apple, cranberry, garlic, beet, cucumber, squash, soybean, cabbage, brussels sprouts, cauliflower, kale, functional food 189 broccoli, spinach), anti-inflammatory (ginseng, licorice, oats, parsley, papaya), anti-microbial (cranberry, garlic, onion, green tea), anti-estrogenic (anise, fennel, soybean, cabbage), and anti-proliferative (orange, green tea, garlic, lemon). Today’s consumer expects food to be convenient, safe, healthy and above all tasty. The focus of food science and technology has transformed over centuries, from food security through improved agricultural practices, to food safety through improved manufacturing and preservation practices, to now toward healthy and functional foods, from technology-oriented to consumer oriented practices. In Asia, functional foods have been regarded as an integral part of the culture. However, the concept is new in the European countries. India, the second largest producer of food, had a rich potential for functional foods as they are increasingly becoming an integral part of an overall healthy lifestyle. In fact, India occupies a premier position in the use of herbal drugs, where Ayurveda has been systematically documented. India pioneered in the development and practice of well-documented indigenous systems of medicines, the Ayurveda and the Unani. New scientific evidences concerning the potential benefits and challenges of functional foods are constantly emerging. Regular consumption of whole grain foods has been associated with a reduction in incidence of cardiovascular disease, diabetes, and cancer mortality. Oat and oat products are widely studied dietary source of the cholesterol-lowering soluble fibre b-glucans. Flaxseeds are rich source ofa-linoleic acid and lignans, which are known to reduce the risk of cancer. Pearl millet (Pennisetum glaucum) is a repository of dietary antioxidants, such as tricin, acacetin, luteolin, and 4-OMe tricin, and are implicated in the chemo preventive efficacy of Pearl Millet. Clinical studies have suggested that bean saponins help protect the human body against cancers, lower cholesterol and lower blood glucose responses. The cholesterol-lowering effect of soy saponins, and cancer risk reduction of soy proteins are well-documented physiological effect. The antioxidants found in cocoa enhance vascular function and decrease platelet stickiness and thus influence the cardiovascular system. Consumption of flavanol-rich foods, such as cocoa powders and dark chocolates, may be associated with a reduced risk for cardiovascular and chronic diseases. Dietary antioxidants; vitamin C, phenolic compounds, and lipid-soluble vitamin E andcarotenoids present in cabbage, broccoli and brussels protect cells against oxidative damage, and may therefore prevent chronic diseases. Health benefits like anti-carcinogenic properties are attributed to their high concentration of glucosinolates. Extensive studies have explored the antioxidant properties of peptides hydrolyzed from food proteins. As an excellent plant source for essential amino acids, and wealth of disease-preventing nutrients like beta-carotene, vitamin C, folic acid and minerals, moringa leaves are considered to be one of the best 190 Proceedings ASIAHORCS 2013

functional foods. Nutritional analyses indicate that Moringa leaves contain a wealth of essential, disease preventing nutrients such as natural antioxidant (ascorbic acid, phenolics and carotenoids). Spinach (Spinaciaoleracea) leaves contains a powerful, water-soluble, non-toxic, natural antioxidant mixture (NAO), which play significant role in chemoprevention and dietary intervention in humans. Pumpkins are enriched with omega-3 fatty acid, dietary lignans, phenolic antioxidants, b-carotene (Vitamin A), vitamin E, and minerals (zinc, magnesium), and thus diet rich in seeds lowers gastric, breast, lung and colorectal cancers. Consumption of strawberries is shown to lower the risk of heart disease, owing to their antioxidant power. Antioxidant compounds in strawberries (ellagic acid and quercetin) are demonstrated to have anticancer activity by blocking the initiation of carcinogenesis, and suppressing the progression and proliferation of tumors. Research has shown that orange and citrus flavonoids and their metabolites suppress many of the events of cancer and inflammation which involve reactive oxygen species. Hesperidin blocks an enzyme involved in an inflammatory reaction such as the release of histamine, and is thus considered an anti-inflammatory agent. Numerous in vitro studies have shown that blueberry anthocyanins, proan- thocyanidins, resveratrol, flavonols, and tannins inhibit mechanisms of cancer cell development and inflammation. Several recent studies showed that consumption of tomatoes containing lycopene is associated with decreased risk of chronic diseases (cancer and cardiovascular diseases), owing to the anti-proliferative properties of lycopene. Gingerol, the active ingredient in ginger, is thought to relax blood vessels, stimulate blood flow and relieve pain. Garlic has purported health benefits in chemo preventive, anti-hypertensive, and cholesterol-lowering effects. Cinnamon has anti-clotting and anti-inflammatory properties, which help prevent unwanted clumping of blood platelets. Catechins found in tea have been shown to be beneficial in the prevention and treatment of cancer. Green tea is believed to exhibit beneficial effects on arthritis, bone density and stress. FAO/WHO stated that a probiotic is ‘a live microorganism which when administered in adequate amounts confer a health benefit to the host’. In some studies using yogurt, promising health benefits were found, like lactose intolerance, constipation, diarrheal diseases, colon cancer, Helicobacter pylori infection, and allergies. Danish researchers found that the lower rates of heart disease in Greenland Eskimos were associated with their higher intake of seafood (cold water fish). Fish oil is the most significant source of omega-3 fatty acid; eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). Omega-3 fatty acids are associated with decreased incidence of coronary artery disease (CAD) and cardiovascular mortality. functional food 191

Central Food Technological Research Institute (CFTRI), Mysore, is a constituent laboratory of Council of Scientific and Industrial Research (CSIR), New Delhi. CFTRI came into existence during 1950, with the great vision of its founders. The focus of the institute has been towards low-cost effective technologies, utilisation of indigenous raw materials, bio-friendly processes with emphasis on integrated technology and high level pursuit for total technology with underpinning of food safety, health and nutrition to all sections of the population.The institute has geared up its research and development due to large number of externally funded projects from national and international funding agencies.The present scenario in the country is very vibrant with rising capital investment in food industry, which is expanding at a rapid pace in urban markets focusing on processed foods, especially for the traditional foods through eco-friendly technologies. CFTRI is an ISO 9001:2008 and ISO 14001:2004 organisation and NABL accredited for chemical and biological testing of samples. My lab focuses on several aspects of food research; preparation and characterization of protein hydrolysates (functional foods), characterization of legume lectins (protein chemistry), development of analytical methods (bioanalytical chemistry), protein designing to enhance protein quality (molecular biology), and purification and characterization of food enzymes (enzymology). Currently I am involved in a project aiming to prepare moringa leaf protein isolate and hydrolysate. Moringa leaves contain all of the essential amino acids, which are unusual for a plant source. Moringa leaf proteins were prepared using different extraction methods, and the protein isolate was treated with alcalase to prepare protein hydrolysate. Isoelectric point (pI) precipitation was found to be problematic, i.e., solubility issues after precipitation is evident. However, ammonium sulfate precipitation recovered 59% of total extracted protein. SDS- PAGE revealed several leaf proteins, and the pattern of Alcalase treatment showed clear sign of protein hydrolysis. Examining the antioxidant properties of peptides hydrolyzed from moringa leaf proteins is of significant interest. This will help to prepare the hydrolysate to incorporate or to use as functional food. Similarly, research on pumpkin seed protein isolate and hydrolysates, as well as their oil and phytochemicals will be performed to explore this rich source of essential amino acids and antioxidant potentials in preparing snack bars (functional foods). Future focus will be on diet–gene interaction of these proteins. The rapid development of the genomics will allow us to understand the effect of nutrients on gene function and health outcome (i.e, nutrigenomics), which is very much essential to predict individual nutritional needs (personalized diet). Furthermore, I am also involved in a project aimed at degreening of moringa leaves. The objective is to test several degreening strategies (ethylene and methyl Jasmonate, with or without sodium hypochlorite or potassium metabisulfite). 192 Proceedings ASIAHORCS 2013

The chlorophyll, carotenoids and total phenolics acid contents were analysed during this treatment. Decrease in chlorophyll contents was observed indicating degreening of leaves, however no yellowing of leaves was evident. Defoliation of leaves was observed which can be an advantage for large-scale processing of leaves. The results also suggest that natural degreening (yellowing) of leaves is due to degradation of chlorophyll, and not due to synthesis of carotenoids. Functional foods are reality today, and are likely to be so in the future. Function al food, nutraceuticals and nutrigenomics are promising and broadening field of food research. The key drivers of the functional food research and development are the food industry, consumers and the governments. Governments have a major role to play in the future of functional food, by creating a favourable environment for basic and applied research programmes, promoting continuous and truthful consumer health education on nutrition science, facilitating integration of public health issues and enforcing regulatory systems for flexible and credible science-based claims on nutrition and health. Consumers are opting for more pharmaceutical approach. Thus there is need for on-going research to pinpoint effective components/foods and their optimum dose levels. Investment in functional food research is essential to bridge the gaps in this research field. Novel Cyclic Depsipeptides Exhibiting Multi-drug Resistance Reverting Activities Produced by Fusarium Strain Isolated from Potato in Korea

Chan Lee* Review Board, National Research Foundation of Korea School of Food Science & Technology, Chung-Ang University, Anseoung, Korea

Abstract New functional cyclic pentadepsipeptides, neo-N-methylsansalvamide and neosansalvamide were produced by Fusarium solani KCCM90040, which were isolated from potato in Korea. Structural analysis of neo-N-methylsansalvamide using liquid chromatography mass/mass spectrometry showed the cyclic structure sequence–phenylalanine–leucine–valine–N-methylleucine–leucic acid–and neosansalvamide exhibited demethylated structure having a different peptide sequence. The intrinsic cytotoxic and multidrug resistance reversal effects of neoN-methylsansalvamide were evaluated on the human cancer cell lines MES-SA and HCT15 as well as on their multidrug resistance sublines using the sulforhodamine B assay. The EC50 values of paclitaxel for MES-SA, HCT15, and for the multidrug resistance sublines MES-SA/DX5 and HCT15/CL05 were 1.00±0.20, 0.85±0.63, 10.00±0.53, and >1000 nmol/l, respectively. However, the EC50 values of paclitaxel including 3 μmol/l neoN-methylsansalvamide for MES-SA/DX5, HCT15, and HCT15/CL02 were 1.58±0.12, 0.10±0.02, and 288.40±21.02 nmol/l, respectively. The in-vitro multidrug resistance reversal activity of neo-N-methylsansalvamide was similar to that of the control verapamil. This finding suggests that a novel cyclic pentadepsipeptide, neo-N-methylsansalvamide, is effective in reversing multidrug resistance in vitro.

*Corresponding Author 84 Heukseok-ro, Dongjak-gu, Seoul, 156–756, South Korea E-mail: [email protected]

Introduction Fusarium strains produce cyclic depsipeptide, such as beauvericin (BEA) and enniatins (ENNs). These are N-methylated cyclic hexadepsipeptides which consist of alternating residues of D-2- hydroxyisovaleric acid and a branched-chain N-methyl-L-amino acid linked by peptide and ester bonds. The ionophoric properties are main reason for their biological activities such as their cytotoxic, antifungal, and antibiotic properties. Cyclic depsipeptide can be produced from various species including insects and plants and they are synthesized chemically. The genusFusarium is capable of growing on higher marine plants, and some Fusarium species isolated from green algae produces the novel cytotoxic cyclic depsipeptides, N-methylsansalvamide which is composed of four amino acids [Phe, Leu, N-methylleucine (N-MeLeu), and Val] and one hydroxy acid (O-Leu)

193 194 Proceedings ASIAHORCS 2013

(Cueto et al., 2000). It exhibits in vitro cytotoxicity in the National Cancer Institute (NCI) human tumour cell line. Sansalvamide A was first reported to be produced by marine microorganisms such as Halodule wrightii.(Belofsky et al., 1999) It shows same structure back bone in cyclic depsipeptide structure, with five stereogenic centres all with S-stereochemistry except lecucine instead of N-methylleucine (N-MeLeu). Sansalvamide A exhibited antiproliferative effects on the NCI’s 60 cell line and it is an inhibitor of topoisomerase I. The anticancer effects of sansalvamide analogue can be partially mediated by similar mechanism. Additionaly sansalvamide analogues are proved as successful inhibitor of human pancreatic cancer cells growth. We recently isolated several Fusarium strains from potato in Korea producing cytotoxic cyclicdepsipeptides, (Song et al., 2008) Some Fusarium isolates have been shown to produce recently defined cyclic peptides, ENs H, I, and MK1688, together with BEA (Song et al., 2006). Interestingly, one of the Fusarium isolates produced a new kind of cyclic depsipeptide (analogues of N-methylsansalvamide) exhibiting in vitro cytotoxic effects on various human cancer cell lines. In our research, the chemical structure of this new cyclic pentadepsipeptide was elucidated by several analytical methods, and its in vitro cytotoxic activity was investigated on various human cancer cell lines.

Figure 1. Chemical structures of neosansalvamide and other cyclic pentadepsipeptides: (A) neosansalvamide, (B) N-methylsansalvamide, (C) sansalvamide, (D) neo-N-methylsansalvamide, and (E) zygosporamide. (Lee et al., 2013) functional food 195

Neo-N-Methylsansalvamide. Neo-N-methylsansalvamide was produced by Fusarium solani KCCM90040, which was isolated from potato in Korea. The producer was identified as F. solani by examining its morphological characteristics and by ITS-5.8rDNA sequence analysis. Neo-N-methylsansalvamide was analysed for C33H52N4O6 by electrospray ionization mass spectrometry and combined structural analysis. The one and two-dimensional NMR and the

Figure 2. HMBC and NOESY correlations of neo-N-methylsansalvamide (Song et al. 2011) and neosansalvamide (Lee and Lee, 2012) absolute configurations of amino acids spectral data allowed the resolution of five subunits linked in the following order: (S)-2-hydroxy-4-methylpentanoic acid, N-methyl-L-leucine, L-valine, L-leucine, and L-phenylalanine. The in vitro cytotoxic effect of the purified neo-N-methylsansalvamide was evaluated to establish the possibility that it would be an anti-cancer agent. The concentrations of purified cyclic pentadepsipeptide required to inhibit cell growth in vitro by 50% for A549 (lung cancer), SK-OV-3 (ovarian cancer), SK-MEL-2 (skin melanoma), and MES-SA (uterine sarcoma) cell lines were 10.7 ± 0.15, 11.2 ± 1.23, 10.0 ± 0.53, and 14.0 ± 0.74 M, respectively (mean ± SE). Furthermore, the intrinsic cytotoxic and multidrug resistance reversal effects of neoN-methylsansalvamide were evaluated on the human cancer cell lines MES-SA and HCT15 as well as on their multidrug resistance sublines (MES-SA/DX5 andHCT15/CL05, respectively) using the sulforhodamine Bassay. The EC50 values of paclitaxel for MES-SA, HCT15, and for the multidrug resistance sublines MES-SA/DX5and HCT15/CL05 were 1.00±0.20, 0.85±0.63, 10.00±0.53, and >1000 nmol/l, respectively. However, the EC50 values of paclitaxel including 3 μmol/l neoN-methylsansalvamide for MES-SA/DX5, HCT15, and HCT15/ CL02 were 1.58±0.12, 0.10±0.02, and 288.40±21.02 nmol/l, respectively.The 196 Proceedings ASIAHORCS 2013

in-vitro multidrug resistance reversal activity of neo-N-methylsansalvamide was similar to that of the control verapamil. These finding suggest that a novel cyclic pentadepsipeptide, neo-N-methylsansalvamide, is effective in reversing multidrug resistance in vitro, and this activity may be a major applicable biological function of this compound. Neosansalvamide. Another novel cytotoxic cyclic pentadepsipeptide, neosansalvamide, was produced by same strain, Fusarium solani KCCM90040. The structure of neosansalvamide was analyzed as cyclic five subunits linked in the following order: (S)-leucic acid, two L-leucine, L-valine, and L-phenylalanine, and this sequence shows a molecular structure as a new demethylated analogue of neo-N-methylsansalvamide but having a different peptide sequence. The cytotoxic effects of neosansalvamide were investigated by sulforhodamine B bioassay on four human cancer cell lines. The IC50 value of neosansalvamide required to inhibit cell growth in vitro by 50% for A549 (lung cancer), SK-OV-3 (ovarian cancer), SK-MEL-2 (skin melanoma), and MES-SA (uterine sarcoma) cell lines were 11.70 ± 0.55, 10.38 ± 0.64, 13.99 ± 1.32, and 11.75 ± 0.13 μM, respectively (mean ± standard error).

References Belofsky, G. N., Jensen, P. R., & Fenical, W. (1999). Sansalvamide: A new cytotoxic cyclic depsipeptide produced by a marine fungus of the genus Fusarium. Tetrahedron Letter, 40, 2913–2916. Cueto, M., Jensen, P. R., & Fenical, W. (2000). N-methylsansalvamide, a cytotoxic cyclic depsipeptide from a marine fungus of the genus Fusarium. Phytochemistry, 55, 223–226. Lee, H. S., & Lee, C. (2012). Journal of Agricultural and Food Chemistry, 60, 4342–4347. Song, H. H., Ahn, J. H., Lim, Y. H., & Lee, C. (2006). Analysis of beauvericin and unusual enniatins co-produced by Fusarium oxysporum FB1501 (KFCC 11363P). Journal of Microbiology and Biotechnology, 16, 1111–1119. Song, H. H., Lee, H. S., Jeong, J. H., Park, H. S., & Lee, C. (2008). International Journal of Food Microbiology, 122, 296–301. Song, H. H., Lee, H. S., & Lee, C. (2011). Food Chemistry, 126, 472−478. Lee, H. S., Phat, C., Choi, S. U., & Lee, C., (2013). Anti-Cancer Drugs, 24, 455–460. Posters

Effects of Luteolin on Vascular Endothelium Exposed to Inflammatory Stimuli

Michiko Yasuda1,2, Kayoko Shimoi1,2* 1Graduate School of Nutritional and Environmental Sciences, University of Shizuoka 2Graduate School of Integrated Pharmaceutical and Nutritional Sciences, University of Shizuoka

Abstract The adhesion of leukocyte to endothelium under inflammatory situation plays an important role in the development of various disease; arteriosclerosis, cancer. Previously, our group showed the suppressive effect of several flavonoids including luteolin on the cell surface expression of adhesion molecule induced by tumor necrosis factor (TNF)-α in human umbilical vein endothelial cells (HUVECs). This study aims to clarify the effects of luteolin on vascular endothelium exposed to inflammatory stimuli in more detail. Using ELISA system, we investigated the effects of luteolin on cell surface adhesion molecule-1 (ICAM-1) in HUVECs. Luteolin (2-40 μM) significantly suppressed the cell surface expression of ICAM-1 induced by oxidized low-density lipoprotein (ox-LDL) (200 μg/ml) and TNF-α (0.1 ng/ ml). HUVECs exposed to TNF-α (0.1 ng/ml) adhered to THP-1 monocytes. Luteolin inhibited the adhesion of human THP-1 monocyte to HUVECs induced by TNF-α. These results suggest the possibility that intake of natural products including luteolin suppressed inflammatory responses in vascular endothelium via adhesion of leukocyte to endothelium. Keywords: Luteolin, inflammation, ICAM-1, endothelium

*Corresponding Author 52-1 Yada, Suruga-ku, Shizuoka, 422-8526, Japan E-mail: [email protected]

Introduction Luteolin is a flavone contained in many herbs including parsley, celery, perilla, chamomile tea, rosemary, oregano as well as olive oil, carrots and peppermint, and possesses various pharmacological activities (Figure. 1). Our group and other groups reported that luteolin had anti-oxidant (Shimoi et al., 1994; Van Hoyweghen et al., 2012), anti-cancer (Chen et al., 2013; Pandurangan et al., 2014), anti-diabetic (Deqiu et al., 2011; Liu et al., 2013) and anti-inflammatory (Wölfle et al., 2011; Park et al., 2013) activities. By using HPLC and liquid chromatography/mass spectrometry analyses, we showed that the main metabolite after oral administration of luteolin was luteolin monoglucuronide and that free luteolin, the aglycone of luteolin, was also presented in rat plasma. Free luteolin were also detected in human serum after ingestion of luteolin (Shimoi et al., 1998). An important factor regulating leukocyte traffic into and within inflammatory tissues is the expression of various adhesion molecules on the cell surface, and this facilitates the appropriate cell-cell interactions (Springer, 1990). For example,

199 200 Proceedings ASIAHORCS 2013

intercellular adhesion molecule-1 (ICAM-1), one of cell surface molecules, expressed in not only leukocyte but also endothelial cells and extra vascular resident cells. This molecule plays important roles in leukocyte adhesion during inflammatory responses, resulting in deterioration of atherosclerosis and cancer (Galkina et al., 2007 and Kobayashi et al., 2007). Thus, the inhibition of expression of adhesion molecules induced by inflammatory stimuli is valid for amelioration of inflammation and inflammatory diseases. Previously, our group investigated the suppressive effect of several flavonoids on the cell surface expression of adhesion molecule induced by tumor necrosis factor (TNF)-α in human umbilical vein endothelial cells (HUVECs), and among nine flavonoids (40μ M) examined, chrysin, apigenine, quercetin, galangin and luteolin demonstrated significant suppressive effects on it (Shimoi et al., 2000). However, the detail function of them remains unclear. Therefore, we focused this inhibitory effect of luteolin. This study aims to clarify the effects of luteolin on vascular endothelium exposed to inflammatory stimuli in more detail.

Figure 1. Chemical structure of Luteolin

Materials and Methods Chemicals. Luteolin was isolated from perilla seed, purified by HPLC, and confirmed by mass spectrometry and NMR spectral data at the Oryza Oil and Fat Chemical Co., Ltd. (Ichinomiya, Japan) as reported previously (Shimoi et al., 2000). All other chemicals were of reagent grade, and purchased from Wako Pure Chemicals (Osaka, Japan) unless specified otherwise. Cells. HUVECs were cultured on 0.1% gelatin (Sigma, St. Louis, MO) coated dishes in MCDB-104 (Nihon Pharmaceutical Co., Ltd.) supplemented with 10% FBS (Moregate, Australia and New Zealand), 100 ng/ml endothelial cell growth factor (ECGF), 10 ng/ml epidermal growth factor (EGF, Collaborative Research Inc., Bedford, MA) and 100 μg/ml heparin (Sigma) at 37°C in an incubator with 5% CO2 and 95% air. THP-1 cells were grown in Roswell Park Memorial Institute medium (RPMI-1640, Sigma) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS, Sekisui Medical Co., Ltd., Tokyo, Japan), penicillin (100 U/ml), and streptomycin (100 μg/ml) at 37°C under a humidified atmosphere of 95% air and 5% CO2. functional food 201

Cell ELISA of ICAM-1 on HUVECs. After HUVECs reached confluence in 96-well microplates, the cells were treated with TNF-α (0.1 ng/ml) or Cu2+- Oxidized low-density lipoprotein (Cu2+-ox-LDL) (200 μg/ml) for 6 hours in the presence and absence of luteolin (2-40 μM), and then fixed with 1% (w/v) paraformaldehyde. The cells were incubated with mouse anti-human ICAM-1 monoclonal antibody (Wako Pure Chemicals) and then treated with peroxidase- conjugated goat anti-mouse IgG (Seikagaku kogyo, Tokyo, Japan). The absorbance of the reaction mixture was determined at 492 nm using a microplate reader. Adhesion assay of THP-1 monocyte to HUVECs. After HUVECs reached confluence in 96-well microplates, the cells were incubated with TNF-α (0.1 ng/ ml) and luteolin (2-40 μM). After 6 hours, THP-1 cells (2 x 105 cells/well) were added and incubated for 10 minutes. These cells were washed with PBS and treated with 0.25% Rose Bengal in PBS for 5 minutes at room temperature, and fixed with 50% ethanol in PBS for 30 minutes. Absorbance was measured at 550 nm. Statistical Analysis. Statistical analysis was performed using Student’s t-test. Any difference between the two groups with a value of P < 0.05 was considered significant.

Results and Discussion As shown in Figure. 2A, treatment with TNF-α (0.1 ng/ml) and Cu2+-ox-LDL for 4 hours enhanced the expression of ICAM-1 in the surface of HUVECs. When the cells were treated with TNF-α and luteolin (2-40 μM) simultaneously, luteolin significantly inhibited TNF-α-induced ICAM-1 at the concentration of 20 and 40 μM by 83% and 93% (P < 0.01), respectively. Luteolin also suppressed Cu2+- ox-LDL-induced ICAM-1 expression by 71% (P < 0.05). Our group previously reported that TNF-α (0.5 ng/ml)-induced ICAM-1 expression was inhibited by luteolin at the concentration of 40 μM by 48% (Shimoi et al., 2000). It showed nearly the same results in this study. To assess the effects of luteolin on the adhesion of leukocyte to endothelium exposed to inflammatory stimuli, we investigated the effects of luteolin on the adhesion of THP-1 monocytes treated with TNF-α (Figure. 2B). Incubation of THP-1 monocytes for 10 minutes with HUVECs exposed to TNF-α (0.1 ng/ml) and luteolin (2-40 μM), the adhesion of THP-1 to HUVECs was significantly suppressed by 82% and 100% (P < 0.01), respectively. To our knowledge, there is no report that demonstrated the inhibitory effects of luteolin on the adhesion of leukocytes to endothelium. Luteolin suppressed ICAM-1 expression in HUVECs and adhesion of THP-1 monocytes to HUVECs. In addition, the production of ICAM-1 in the plasma was enhanced in the mice after injection of LPS, and administration of 202 Proceedings ASIAHORCS 2013

luteolin significantly decreased this production (Yasuda et al., unpublished data). Collectively, these results indicate that luteolin may be a food phytochemical capable of anti-inflammatory activities by its ability to modulate the adhesion of leukocyte to endothelium. As one of natural products including luteolin, we focus on the Rooibos tea, produced from the endemic South African shrub Aspalathus linearis, and to clarify the effects of Rooibos tea in mice, the investigation is now in progress.

Figure 2. The effects of luteolin on ICAM-1 expression (A) and adhesion of leukocyte (B)

Conclusions Luteolin significantly inhibited TNF-α-induced ICAM-1 at the concentration of 20 and 40 μM by 83% and 93%, respectively. Luteolin also suppressed Cu2+-ox-LDL-induced ICAM-1 expression by 71%. In conclusion, the present study results led to the hypothesis that intake of natural products including luteolin suppressed inflammatory responses in vascular endothelium via adhesion of leukocyte to endothelium. Further investigation to identify this underlying molecular mechanism may lead to development of this flavonoid with pronounced anti-inflammatory activities.

Acknowledgement We express deep appreciation to Prof. Naohide Kinae and Ms. Noriko Saka (Graduate School of Nutritional and Environmental Sciences, University of Shizuoka, Shizuoka, Japan) for their helpful support. functional food 203

References Chen D., Zhang Y.J., Zhu K.W., Wang W.C. (2013). A systematic review of vascular endothelial growth factor expression as a biomarker of prognosis in patients with osteosarcoma. Tumour Biol, 34, 1895–1899. Deqiu, Z., Kang, L., Jiali, Y., Baolin, L., & , Gaolin, L. (2011). Luteolin inhibits inflammatory response and improves insulin sensitivity in the endothelium. Biochimie, 93 (3), 506–512. Galkina, E., & , Ley, K. (2007). Vascular adhesion molecules in atherosclerosis. Arteriosclerosis, Thrombosis, and Vascular Biology, 27, 2292–2301. Kobayashi, H., Boelte, K. C., & , Lin, P. C. (2007). Endothelial cell adhesion molecules and cancer progression. Current Medicinal Chemistry, 14, 377–386. Liu, Y., Tian, X., Gou, L., Sun, L., Ling, X., & , Yin, X. (2013). Luteolin attenuates diabetes- associated cognitive decline in rats. Brain Research Bulletin, 94, 23–29. Pandurangan, A. K., Ananda Sadagopan, S. K., Dharmalingam, P., & , Ganapasam, S. (2014). Luteolin, a bioflavonoid inhibits Azoxymethane-induced colorectal cancer through activation of Nrf2 signaling. Toxicology Mechanisms and Methods, 24 (1), 13–20. Park, C. M., & , Song, Y. S. (2013). Luteolin and luteolin-7-O-glucoside inhibit lipopolysaccharide-induced inflammatory responses through modulation of NF-κB/AP-1/PI3K-Akt signaling cascades in RAW 264.7 cells. Nutrition Research and Practice, 6, 423–429. Shimoi, K., Masuda, S., Furugori, M., Esaki, S., & , Kinae, N. (1994). Radioprotective effect of antioxidative flavonoids in γ-ray irradiated mice. Carcinogenesis, 15, 2669–2672. Shimoi, K., Okada, H., Furugori, M., Goda, T., Takase, S., Suzuki, M., Hara, Y., Yamamoto, H., & ., Kinae N. (1998). Intestinal absorption of luteolin and luteolin 7-O-β-glucoside in rats and humans. FEBS Letters, 438, 220–224. Shimoi, K., Saka, N., Kaji, K., Nozawa, R., & , Kinae, N. (2000). Metabolic fate of luteolin and its functional activity at focal site. BioFactors, 12, 181–186. Springer, T. A. (1990). Adhesion receptors of the immune system. Nature, 346, 427-451. Van Hoyweghen, L., De Beer, T., Deforce, D., & , Heyerick A. (2012). Phytochemical Analysis, 23 (5), 433–443. Wölfle, U., Esser, P. R., Simon-Haarhaus, B., Martin, S. F., Lademann, J., & , Schempp, C. M.. (2011). UVB-induced DNA damage, generation of reactive oxygen species, and inflammation are effectively attenuated by the flavonoid luteolin in vitro and in vivo.Free Radical Biology & Medicine, 50 (9), 1081–1093.

The Study of Expression of Seed-Spesific Transcription Factors Regulating Anthocyanin Biosynthesis in Indonesian Local Black Rice for Developing Black Rice as Functional Food

Yekti Asih Purwestri1*, Lisa Novita Anggraeni1, Rarastoeti Pratiwi1, Rumiyati2, Woro Anindito Sri Tunjung1 1Faculty of Biology, Gadjah Mada University 2Faculty of Pharmacy, Gadjah Mada University

Abstract Black rice is considered as functional food which contains bioactive compounds such as anthocyanin. Our previous results indicated the beneficial effects of black rice including increasing LDL cholesterol and decreasing HDL cholesterol in mice. The other reports showed suppression of tumor progression or carcinogenesis in mice and several human cancer cell lines and reduction of oxidative stress both in vitro and in animal models. It is in our interest to determine genes responsible for anthocyanin biosynthesis. In this research, we obtained cDNA library from different developmental stages of black rice seeds and white rice seeds as control. Seeds were harvested at different developmental stages (at pollination time, 2, 7, 14 and 21 days after pollination) for RNA isolation. One g of RNA were subjected for obtaining cDNA library. Semi-quantitative RT-PCR showed that several seed-specifics transcription factors regulating anthocyanin biosynthesis were expressed in Indonesian local black rice. Further study in these genes will be important for developing black rice or other crops as functional food. Keywords: Anthocyanin biosynthesis genes, Indonesian black rice, functional food

*Corresponding Author Jln. Teknika Selatan, Sekip Utara Yogyakarta 55281 Indonesia E-mail: :[email protected]/[email protected]

Introduction Most population in Indonesia use rice as staple food. Therefore, it is essential to develop rice production either quantitatively or qualitatively. Black rice and red rice are pigmented rice cultivars which are considered as functional food due to the high anthocyanin content compare to white rice. Black rice cv. cempo ireng is Indonesian local rice cultivated mainly in Yogyakarta and Central Java Province. Previous studies indicated that black rice cv. cempo ireng contain high anthocyanin, vitamin E and phenolic compound contributed to its antioxidant activity (Anggraeni, 2010). Antioxidants are compounds that can neutralize free radicals, thereby reducing the risk of cells or tissue damage (cancer and degenerative disease), or metabolic disorders particularly hyperlipidemia and diabetes. Anthocyanin content of black rice is located in the pericarp layers of black rice grains, which gives it a dark purple color (Ryu et al., 2000; Takashi et

205 206 Proceedings ASIAHORCS 2013

al., 2001). Anthocyanins, a group of reddish-purple water-soluble flavonoids, are the primary pigments in the red and black grains, and are responsible for the attractive red, purple, and blue colors of many flowers, fruits, and vegetables. The main pigments comprising anthocyanin of dark purple rice are cyanidin (cyanidin-3-O-β-glucoside) and peonicin (peonidin-3-O-β-glucoside) (Ryu et al., 1998, Abdel-Aal et al., 2006, Lee et al., 2010). Another important nutrient of black rice are carbohydrate, protein, flavonoids, water and other components amounted 21.6%, 4.9%, 16.6%, 5.5% and 8.2% respectively (Xia et al., 2006). Our previous results indicating the beneficial effects of black rice included decreasing LDL cholesterol and increasing HDL cholesterol in mice that consumed black rice in their diet (Pratiwi et al., 2011). The other reports showed suppression of tumor progression or carcinogenesis in mice and several human cancer cell lines and reduction of oxidative stress both in vitro and in animal models (Hyun and Chung 2004; Weisel et al., 2006; Spormann et al., 2008; Schantz et al., 2010). It is in our interest to determine genes responsible for anthocyanin biosynthesis.

Materials and Methods Rice seed materials. The black rice used was cv. cempo ireng. White rice was a ciherang cultivar. Two rice cultivars were cultivated under controlled conditions in greenhouse of the Faculty of Agriculture, Gadjah Mada University. Cempo ireng represents local black rice cultivated in the Yogyakarta Province. RNA extraction. Rice seeds were harvested at the fourth developmental stages, at pollination, pollination +7 days, +14 days and +21 days in triplicate. The samples were collected from research plot in the greenhouse in 2012. They were grounded under liquid nitrogen to obtain a fine powder using a mortar and pestle. The milled rice powders were kept at–80°C before RNA extraction. Total RNA was extracted from seeds of cempo ireng black rice cultivar and the wild type ciherang cultivar. We performed at least three replicates for each treatment. Frozen samples were homogenized with a mortar and pestle in liquid

N2. The ground powder was transferred to empty micro tubes on liquid N2 until the homogenization procedure was ready to be performed, and 0.5 mL of RLC buffer (Qiagen, Hilden, Germany) was added. Because of the high starch content of rice seed, the homogenates were shaken with a vortex for only 10 s, and then plant debris was pelleted by centrifugation. Supernatants were extracted using an RNeasy Kit (Qiagen, Valencia, CA, USA) according to manufacturer’s instructions. The RNA samples were applied for DNase treatment to eliminate DNA contamination (invitogen) and further purified using phenol extraction followed by ethanol precipitation. RT-PCR analysis. Reverse transcription-polymerase chain reaction (RT-PCR) functional food 207 analysis was carried out to determine the expression of seed specific transcription factors previously published (Kim et al., 2011). After treatment with RNase-free DNase followed by phenol extraction and ethanol precipitation, 5 μg of total RNA from each sample was used to synthesize cDNA using the SuperScript II First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA). For PCR amplification, 1μ l of the resulting cDNA reaction was used as a template. The PCR reactions were carried out in 20-μl volumes with 1.25 unit of Taq DNA polymerase and 20 pmol of each primer pair. The primers used in this research were listed on Table 1. The amplification condition were as follows: pre-denaturation 95°C (5 min), 30 cycles of denaturation 95°C (30 s), annealing 55°C (30 s), elongation 72°C (1 min); followed by 5 min at 72°C. To validate our RT-PCR results, we performed each experiment three times. The PCR reaction amplification was analysed by gel electrophoresis. Ubiquitin mRNA was used as a loading control.

Results and Discussion RT-PCR analysis was performed on the 4 hypothetical genes responsible for anthocyanin biosynthesis as previously reported (Kim et al., 2011). Two of down regulating genes showed small differences with control rice (white rice cv. Ciherang). Interestingly, one of up regulating (Os11g059600) demonstrated the high expression level at all four seed developing stages, however only expressed at the day of pollination in white rice control (Figure. 1). This result indicated that this gene may play a role in the anthocyanin production during seed development. This gene was reported as conserved hypothetical protein located at chromosome 11 (RAP-DB). The down regulating genes were assumed inhibit anthocyanin metabolism or had a negative effect on the anthocyanin biosynthesis pathway. Several transcription factors were reported involved in anthocyanin biosynthesis (Ramazzotti et al., 2008; Stommel et al., 2009; Kim et al., 2012). Further characterization to get insight the function of this gene in the biosynthesis of anthocyanin in black rice cv cempo ireng was important to develop black rice or other crops as functional food. 208 Proceedings ASIAHORCS 2013

Table 1. Primers and PCR condition used in this experiment Genes Primers Annealing Temperature Os06g0170500 (D1) Forward : CATAGAAGGGTAATCATGTGACGGTACTC 55°C Reverse : TCAGTTCTGGGTCGTCTGCTGCGGAGGAG Os07g0184633 (U1) Forward:GGGTGTTGCCTGCTTGATGTCCAGCACAAG 55°C Reverse : CTACGCAGTTGTGCTGTCAACAGCTTC Os07g0429700 (D2) Forward : TTCCCATGTATTCTGGCCGATTCTGTTG 55°C Reverse : TTCCCATGTATTCTGGCCGATTCTGTTG Os11g0539600 (U2) Forward : ATGTCTGGAAGAGCTGGAACTCAATATG 55°C Reverse : CATAGAAGGGTAATCATGTGACGGTACTC Ubiquitin Forward : CACAAGAAGGTGAAGCTCGC 55°C Reverse : GCCTTCTGGTTGTAGACGTAGG

Figure 1. RT-PCR analysis result of 3 candidate genes, representing one up-regulated (U2) and two down-regulated genes (D1 and D2) responsible for biosynthesis anthocyanin during seed development. Ubiquitin was used as a control. M: Marker 100 bp, 1. black rice at pollination; 2. 2 days after pollination (DAP); 3. 7 DAP; 4. 14 DAP; 5. 21 DAP; 6. white rice at pollination; 7. 2 DAP; 8. 7 DAP; 9. 14 DAP; 10. 21 DAP

Acknowledgement This work was supported by The Ministry of Education and Culture Republic of Indonesia through Strategis Nasional (Stranas) Project 2013 to YAP.

References Abdel-Aal, E. -S. M., Young, J. C., & Rabalski, I. (2006). Anthocyanin composition in black, blue, pink, purple, and red cereal grains. Journal of Agricultural and Food Chemistry, 54, 4696–4704. Anggraeni, L. N. (2010). Aktivitas antioksidan tiga varietas padi (Oryza sativa L. var. Cempo reng, var. Cempo Abang, dan var IR-64. Laporan Seminar. Program Sarjana, Fakultas Biologi Universitas Gadjah Mada, Yogyakarta. functional food 209

Hyun, J. W., & Chung H.S. (2004). Cyanidin and malvidin from Oryza sativa cv. Heugjinjubyeo mediate cytotoxicity against human monocytic leukemia cells by arrest of G2/M phase and induction of apoptosis. Journal of Agricultural and Food Chemistry, 52, 2213–2217. Kim, C. K., Cho, M. A., Choi, Y. H., Kim, J. A., Kim, Y. H., Kim, Y. K., & Park, S.H. (2011). Identification and characterization of seed-specific transcription factors regulating anthocyanin biosynthesis in black rice. Journal of Applied Genetics, 52, 161–169. Lee, J. H. (2010). Identification and quantification of anthocyanins from the grains of black rice (Oryza sativa L.) Varieties. Food Science and Biotechnology, 19 (2), 391–397. Pratiwi, R., Purwestri, Y. A., & Tunjung, W.A. (2011). Efek Diet Nasi dari Padi (Oryza sativa L.) kultivar Cempo Ireng, Cempo Abang, dan IR-64 terhadap Profil Lipid Serum Darah Tikus Putih (Rattus norvegicus Berkenhout, 1769) Hiperlipidemia. Research Report TP3F Fakultas Biologi UGM. Ramazzotti, S., Filippetti, I., & Intrieri, C. (2008). Expression of genes associated with anthocyanin synthesis in red-purplish, pink, pinkish-green and green grape berries from mutated ‘Sangiovese’ biotypes: A case study. Vitis, 47 (3), 147–151. Ryu, S. N., Han, S. J., Park, S. Z., & Kim, H. Y. (2000). Antioxidative activity and varietal difference of cyanidin 3-glucoside and peonidin 3-glucoside contents in pigmented rice. Korean Journal of Crop Science, 45 (4), 257–260. Schantz, M., Christiane, M., Baum, M., & Richling, E. (2010). Antioxidative efficiency of an anthocyanin rich bilberry extract in the human colon tumor cell lines Caco-2 and HT-29. Journal of Berry Research, 1, 25–33. Spormann, T. M., Albert, F. W., Rath, T., Dietrich, H., Will, F., Stockis, J. P., Eisenbrand, G., & Janzowski, C. (2008). Anthocyanin/polyphenolic-rich fruit juice reduces oxidative cell damage in an intervention study with patients on hemodialysis. Cancer Epidemiology, Biomarkers & Prevention, 17, 3372–3380. Stommel, J. R., Lightbourn, G. J., Winkel, B. S., & Griesbach, R.J. (2009). Transcription Factor Families Regulate the Anthocyanin Biosynthetic Pathway in Capsicum annuum. Journal of the American Society for Horticultural Science, 134 (2), 244–251. Takashi, I., Bing, X., Yoichi, Y., Masaharu, N., & , Tetsuya K (2001). Antioxidant Activity of Anthocyanin Extract from Purple Black Rice. Journal of Medicinal Food, 4, 211–218. Weisel, T., Baum, M., Eisenbrand, G., Dietrich, H., Will, F., Stockis, J. P., Kulling, S., Rufer, C., Johannes, C., & Janzowski, C. (2006). An anthocyanin/polyphenolic-rich fruit juice reduces oxidative DNA damage and increases glutathione level in healthy probands. Biotechnology Journal, 1, 388–397. Xia, X., Ma, W. L. J., Xia, M., Hou, M., Wang, Q., & Zhu, H. (2006). An anthocyanin-rich extract from black rice enhance atheroscleorotic plaque stabilization in apolipoprotein E-deficient mice. Journal of Nutrition, 136, 2220–2226.

Protective Effect of Epigallocatechin-3-gallate (EGCG) in Yeast Candida albicans and Candida tropicalis Treated with Antifungal Nystatin or (+)-2,2’-Epicytoskyrin A

Heddy Julistiono*, Ruby Artanti, Arif Nurkanto, and Andria Agusta Research Center for Biology, The Indonesian Institute of Sciences

Abstract (+)-2,2’-Epicytoskyrin A is a secondary metabolite produced by the endophytic fungi Diaporthe sp. GNBP-10. This study is to investigate possibility of its antifungal activity via oxidative stress induction. For comparison, the same study of a well known antifungal nystatin was also performed. Protective effect of an antioxidant EGCG in yeast treated with the two above compounds was evaluated as indicator of oxidative stress induction. By using MTT assay, we observed viability of Candida albicans or C. tropicalis yeast cells was significantly decreased by the two compounds at concentration of 32 µg/ml. In C. albicans, EGCG of 100 µg/ml increased cell viability in cell treated with 32 to 128 µg/ml of epicytoskirin, whereas EGCG only protected cell toxicity induced by nystatin at concentration of 32 µg/ml. In C. tropicalis, EGCG protected cell toxicity caused by epicytoskirin or nystatin with the concentration of 32 to 256 µg/ml. By using spread plate method, colony of the two yeast cell treated with epicytoskirin or nystatin and EGCG was also more dense compared to that of treated with the compounds only. The data strongly indicated that one mechanism of fungal toxicity of (+)-epicytoskirin A or nystatin could be caused by oxidative stress. Keywords: (+)-Epicytoskyrin A, nystatin, C. albicans, C. tropicalis, antifungi

*Corresponding Author Jln. Raya Bogor Km 46, Cibinong, Bogor 16911, E-mail: [email protected]

Introduction Some species of genus Candida are considered to be opportunistic human pathogen (Richardson, 1991). In Indonesia, development of Candida infection by animmunosupres-Intense states that is caused by HIV infection had been shown by Wahyuningsih et al., (2008). The clinical significance and the severity of drug resistance in candidiasis motivate researchers to search urgently for antifungal agents with novel mechanisms of action (Cernicka and Subik, 2006). In addition, the compelling evidence accumulated showed that yeasts, including Candida spp., are valuable for Programmed Cell Death (PCD) research due to their ability to undergo PCD responses which display a certain degree of conservation with apoptotic mechanisms of metazoan cells (Almedia et al., 2008). Nystatin is a polyene antifungal that is toxic to many yeasts including Candida. Nystatin binds to ergosterol, a major component of the fungal cell membrane

211 212 Proceedings ASIAHORCS 2013

causing pores in the membrane that lead to death of the fungus (Gahnnoum and Rice, 1999). In fact, mode of action of polyene antifungal is complex by which Reactive Oxygen Species (ROS) is implicated that causes cell death (Sokol-Anderson et al., 1988; An et al., 2009).

Epicytoskyrin showed cytotoxic activity against KB cell with an IC50 of 0.5 µg/ml (Agusta et al., 2006). Some anticancer drugs have also similar activity against yeasts by inducing PCD that is associated with ROS formation (Almeida et al., 2008). Epigallocatechingallate (EGCG) is polyphenolic flavonoid in green tea that has activity as antioxidants in yeast Saccharomyces cerevisiae (Mitrica et al., 2012) and also prooxidant (Maeta et al., 2007). By using antioxidant property of EGCG we evaluated the role of oxidative stress in yeast cells toxicity caused by antifungal (+)-2,2’-epicytoskyrin A or nystatin. If EGCG protects cell from antifugal whereas EGCG is antioxidant, we may conclud that toxicity of the antifungal is partially via oxidation.

Methods Microorganisms Candida albicans NBRC 1594 and Candida tropicalis LIPIMC were used in this study. Yeast growth conditions. Yeasts were grown in Yeast Malt Broth media (3 g of yeast extract, 3 g of malt extract, 5 g of pepton, 10 g of glucose, in 1 l of distilled water). Sterile media of 100 ml was contained in 300-ml Erlenmeyer flasks on rotary shaker at 100 rpm. Yeast cells suspension of 1 ml was inoculated into the media and incubated for 48–64 hours at room temperature for further bioassay. Yeast Malt Agar (YM Agar) is used for observation of yeast colony growth. YMA contained 20 g of agar in 1 l of distilled water. Antifungals and EGCG. Nystatine was obtained from Applichem. Stock solutions were prepared in DMSO and stored at–20ºC. (+)-Epicytoskyrin A was obtained by extraction and purification from endophytic fungi Diaporthe sp. EGCG which was obtained from Sigma Chemical. Stock dilutions were prepared in 0.15 mM H3PO4 to avoid oxidation (Navarro-Martı´nez et al., 2006). Bioassay. YMB media containing EGCG and antifungals of 300 µl contained in reaction tube (hight 10 cm,ø 1.5 cm). The media was inoculated with approximately 0.3 x 106 CFU/ml of yeast. Cell suspensions then treated with EGCG, or antifungals, or EGCG and antifungals. The concentration of EGCG was 100 μg/ml since it does not provoke oxidation in yeast cells (Julistiono et al., 2012). Concentrations of antifungals were 32, 64, 128 and 256 μg/ml respectively. The functional food 213 cultures were incubated at room temperature with rotation of 100 rpm for 24 hours. The experiments run in triplicate. Yeats cells viability. The MTT assay was used for measuring yeast cell viability, according to El-Baz and Shetaia (2005) with small modification. It functions by measuring intracellular reduction of yellow, water soluble MTT reagent to a purple formazan salt which is water insoluble and can be colorimetrically detected at 595 nm. Cells suspension of 300 µl was added with 50 μl MTT (5 mg/ml), incubated at 30ºC for 2h, then added with 500 μl propna-2-ol containing 0,04 M HCl. The mixture was vigorously vortexed to remove MTT-formazon from the cells, then centrifuged at 11600 x g for 2 min. The absorbance of the supernatants was measured at 595 nm. Colony growth of suspension cells was also observed. We presented data colony growth of treatment with 8 µg/ ml of nystatin and 32 µg/ ml of epicytoskyrin. Suspension of 100 μl was inculated onto YMA media, then incubated at room temperature for 48 h to observe colony growth indicating viability of yeast cells.

Results Effects of EGCG on viability of yeasts treated with various concentrations of antifungals. Effects of EGCG on viability ofC. albicans treated with various concentrations of nystatin or epicytoskyrin are presented in Figure 1 and 2 respectively. At concentration of 32 µg/ml, C. albicans cells started to decrease. At low concentration (32 µg/ml), toxicity of antifungal was rescued by EGCG significantly whereas at higher concentration it was not. Similar pattern wa also observed in C. albicans treated with epicytoskyrin. At low concentration (32 µg/ ml), the antifungal also decreased cells viability significantly; presence of 100 µg/ ml attenuated cell toxicity. Effects of EGCG on viability ofC. tropicalis treated with various concentrations of nystatin or epicytoskyrin are presented in Figure 3 and 4 respectively. The toxicity of nystatin in C. tropicalis could be attenuated by EGCG at any concentration (32 to 256 µg/ml). Similar pattern of effect of epicytoskyrin onC. tropicalis cell was also obtained, however EGCG tend to protect yeast cell from antifungal toxicity at lower concentration (32 µg/ml) (Figure 4). Effects of EGCG on growth of colony of yeasts treated with antifungals. Presence of EGCG (100 µg/ml) did not alter growth of C. albicans colony on YMA media (Figure 5). Growth of C. albicans colony treated with epicytiskyrin (32µg/ml) and EGCG was also slightly better than epicytoskyrin only (Figure 6). Growth of C. albicans colony treated with nystatin (32µg/ml) and EGCG was slightly better than nysatin only (Figure 7). 214 Proceedings ASIAHORCS 2013

Figure 1. Effects of EGCG on viability of C. albicans cells treated with nystatin

Figure 2. Effects of EGCG on viability of C. albicans cells treated with epicytoskyrin functional food 215

Figure 3. Effects of EGCG on viability ofC. tropicalis cells treated with nystatin

Figure 4. Effects of EGCG on viability of C. tropicalis cells treated with epicytoskyrin 216 Proceedings ASIAHORCS 2013

EGCG (100 µg/ml) did not alter growth of C. tropicalis colony on YMA media (Figure 8 and 9). Both of antifungals nystatin (8 µg/ml) and epicytoskyrin (8 µg/ ml) decreased clearly growth of C. tropicalis colony on YMA media. The presence of EGCG rescued colony growth of the yeast treated with the antifungals.

Discussion Based on the ability of yeasts cells to reduce MTT and grow on YMA media, nystatin or epicytoskyrin is toxic to the yeasts. Protective effect of an antioxidant EGCG against toxicity of lower concentration of nystatin and epicytoskyrin in yeasts cells indicates that the antifungals provoke oxidative stress. It is well

KE N N + E

K: control N: + Nystatin (32µg/ml) E: + EGCG (100 µg/ml) N+E: Nystatin + EGCG (100 µg/ml) Figure 5. Effect of EGCG on colony Figure 6. Effect of EGCG on growth growth of C. albicans of C. albicans treated with nystatin functional food 217

Es: + epicytoskyrin (32µg/ml) Es+E: epicytoskyrin + EGCG (100 µg/ml)

Figure 7. Effect of EGCG on colony growth ofC. albi- Es Es + E cans treated with epicytoskyrin

K: control E: + EGCG (100µg/ml) N: + Nystatin (8 µg/ml) N+E: Nystatin + EGCG

Figure 8. Effects of EGCG on growth of C. tropicalis treated with nystatin K E N N+E

K :control E: + EGCG(100 µg/ml) Es: + epicytoskyrin (8 µg/ml) Es+E : + epicytoskyrin+ EGCG Figure 9. Effects of EGCG on growth of C. tropicalis treated with epicytoskyrin K E Es Es+E 218 Proceedings ASIAHORCS 2013

known that nystatin binds to membrane ergosterol of yeast causing cells leakages (Gahnnoum and Rice, 1999) whereas specific mode of action of epicytoskyrin toxicity is not identified. Hwanget al., (2012) demonstrated that a phytochemical (+)-Medioresinol causes intracellular ROS accumulation and mitochondria- mediated apoptotic cell death in Candida albicans. This mode of action is not specific since there is no specific cellular target of the compounds. Several authors supported a mechanism by which compounds disturb electron transfer in respiratory system in mitochondrion leading to ROS formation (Zhang et al., 2002; Collier and Chris, 2003; Moraitis and Curran, 2004; Morales et al., 2010; Peng et al., 2012; Sangalli-Leite et al., 2011). In general, the generation of ROS is an early event in apoptotic cell death (Madeo et al., 1999). Similar to

mammalian apoptosis, ROS or low concentrations of H2O2 are key regulators of apoptotic process in yeast. Mitochondria, that have a central role in apoptosis, are the richest source of ROS in the cell and the inhibition of the mitochondria electron transport chain, which results in the subsequent release of ROS. Many important aspects of the apoptotic process converge in mitochondria (Wang and Youle, 2009; Ludovico et al., 2002). Inhibition of MTT reduction in yeast, which is catalysed by mitochondrial enzymes, indicates that mitochondrion is an important target of redox disturbance by xenobiotic compounds (Julistiono et al., 2012). Antibiotic resistance in bacteria caused by DNA mutation related with oxidative stress induction by such xenobiotic compound had been also revealed by Wang et al., (2013). These findings and our data therefore support the possibility of nystatin and epicytoskyrin in generating ROS in yeast mitochondrion. The mechanism of how epicytoskyrin kills yeast cell has not been known yet. Our study strongly indicates oxidative stress in yeast cell induced by epicytoskyrin. However, other specific mechanism of epicytoskyrin in killing yeast cells should be considered. Further study focusing on ROS detection and effect of epicytoskyrin on respiratory system in mitochondrion is needed to elucidate oxidative stress induced by epicytoskyrin. Impact of ROS on physiology of cell is relevant to explore in yeast cell (Perrone et al., 2008).

Conclusions Our study strongly indicates that partial mechanism of fungal toxicity of (+)-2,2’-epicytoskirin A or nystatin could be through induction of oxidative stress in yeast cells. functional food 219

References Agusta, A., K. Ohashi and H. Shibuya. (2006). Bisanthraquinone metabolites produced by the endophytic fungus Diaporthe sp., Chem. Pharm. Bull., 54, 579–582. Almeida, B., Silva, A., Mesquita, A., Sampaio-Marques, B., Rodrigues, F., & Ludovico, P. (2008). Drug-induced apoptosis in yeast. Biochimica et Biophysica Acta, 1783, 1436–1448. An, M., Shen, H., Cao, Y., Zhang, J., Cai, Y., Wang, R., & Jiang, Y. (2009). Allicin enhances the oxidative damage effect of amphotericin B against Candida albicans.International Journal of Antimicrobial Agents, 33, 258–263. Cernicka, J., & Subik, J. (2006). Resistance mechanisms in fluconazole-resistant Candida albicans isolates from vaginal candidiasis. International Journal of Antimicrobial Agents, 27 (5), 403–408. Collier, A. C., & Chris, A. (2003). The mitochondrial uncoupler dicumarol disrupts the MTT assay Pritsos. Biochemical Pharmacology, 66, 281–287. El-Baz, A. F., & Shetaia, Y. M. (2005). Evaluation of different assays for the activity of yeast killer toxin. International Journal of Agriculture & Biology, 7, 1003–1006. Ghannoum, M. A., & Rice, L B. (1999). Antifungal agents: Mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clinical Microbiol- ogy Reviews, 12, 501–517. Hwang, J. H., Hwang, I. S., Liu, Q. H., Woo, E. R., & Lee, D. G. (2012). (+)-Medioresinol leads to intracellular ROS accumulation and mitochondria-mediated apoptotic cell death in Candida albicans. Biochimie, 94,1784–1793. Julistiono, H., Muthmainah, R. S., & Adam. (2012). Efek ferri sitrat terhadap kemampuan Khamir Candida Tropicalis dalam mereduksi 3-(4,5-Dimethylthiazol-2-yi)-2,5-Diphenyltetrazolium Bromide (MTT). Berita Biologi, 11, 187-193. Ludovico, P., Rodrigus, F., Almeida, A., Silva, M. T., Barrientos, A., & M. Corte-Real, M. (2002). Cytochrome c release and mitochondria involvement in programmed cell death induced by acetic acid and in saccharomyces cerevisiae. Molecular Biology of the Cell, 13, 2598–2606. Madeo, F., Frölich, E., Ligr, M., Grey, M., Sigrist, S. J., Wolf, D. H., & K. U. Frölich. (1999). Oxygen stress: a regulator of apoptosis in yeast. Journal of Cell Biology, 145, 757–767. Maeta, K., Nomura, W., Takatsume, Y., Izawa, S., & Inoue, Y. (2007). Green tea polyphenols function as prooxidants to activate oxidative-stress-responsive transcription factors in yeasts. Applied and Environmental Microbiology, 73, 572–580. Mitrica, R., Dumitru, I., Ruta, L. L., Ofiteru, A. M., & , Farcasanu, I. C. (2012). The dual action of epigallocatechingallate (EGCG), the main constituent of green tea, against the deleterious effects of visible light and singlet oxygen-generating conditions as seen in yeast cells. Molecules, 17, 10355–10369. Moraitis, C., & , Curran, B. P. (2004). Reactive oxygen species may influence the heat shock response and stress tolerance in the yeast Saccharomyces cerevisiae. Yeast, 21, 313–323. Morales, D. K., Jacobs, N. J., Rajamani, S., Krishnamurthy, M., Cubillos-Ruiz, J. R., & , Hogan, D. A. (2010). Antifungal mechanisms by which a novel Pseudomonas aeruginosaphenazine toxin kills Candida albicans in biofilms. Molecular Microbiology, 78, 1379–1392. 220 Proceedings ASIAHORCS 2013

Navarro-Martıńez, M. D., Garcıá-Cańovas, F., & Jose´ Rodrı´guez-Lo´pez, N. (2006). Tea polyphenol epigallocatechin-3-gallate inhibits ergosterol synthesis by disturbing folic acid metabolism in Candida albicans. Journal of Antimicrobial Chemotherapy, 57, 1083–1092. Peng, Y., Dong, D., Jiang, C., Yu, B., Wang, X., & Ji, Y. (2012). Relationship between respiration deficiency and azole resistance in clinical Candida glabrata. FEMS Yeast Research, 12, 719–727. Perrone, G. G., Tan, S. X. & Dawes, I. W. (2008). Reactive oxygen species and yeast apoptosis. Biochimica et Biophysica Acta, 1783, 1354–1368. Richardson, M. D. (1991). Opportunistic and pathogenic fungi. Journal of Antimicrobial Chemotherapy, 28 (suppl A), 1–11. Sangalli-Leite, F., Scorzoni, L., Mesa-Arango, A. C., Casas, C., Herrero, E., Gianinni, M. J. S. M., Rodríguez-Tudela, J. L., Cuenca-Estrella, M., & Zaragoza, O. (2011). Amphotericin B mediates killing in Cryptococcus neoformans through the induction of a strong oxidative burst. Microbes and Infection, 13, 457–467. Sokol-Anderson, M., Sligh, Jr, J. E., Elberg, S., Brajtburg, J., Kobayashi, G. S., & Medoff, G. (1988). Role of cell defense against oxidative damage in the resistance of Candida albicans to the killing effect of amphotericin B.Antimicrobial Agents and Chemotherapy, 32, 702–705. Wahyuningsih, R., SahBandar, I. N., Theelen, B., Hagen, F., Poot, G., Meis, J. F., Rozalyani, A., Sjam, R., Widodo, D., Djauzi, S., & Boekhout, T. (2008). Candida nivariensis Isolated from an Indonesian Human Immunodeficiency Virus-Infected Patient Suffering from Oropharyngeal Candidiasis. Journal of Clinical Microbiology, 46, 388–391. Wang, Z. Y., Xiong, M., Fu, L.Y. & Zhang HY. (2013). Oxidative DNA damage is important to the evolution of antibiotic resistance: evidence of mutation bias and its medicinal implications. Journal of Biomolecular Structure and Dynamics, 31, 729–733. Wang, C., & Youle, R. J. (2009). The role of mitochondria in apoptosis. Annual Review of Genetics, 43, 95–118. Wang Z.Y., Xiong M., Fu L.Y., and Zhang H.Y. (2013). Oxidative DNA damage is important to the evolution of antibiotic resistance: evidence of mutation bias and its medicinal implications. J. Biomol. Struct. Dyn., 31, 279–733. Zhang, L., Zhang, Y., Zhou, Y., An, S., Zhou, Y. & Cheng, J. (2002). Response of gene expression in Saccharomyces cerevisiae to amphotericin B and nystatin measured by microarrays. Journal of Antimicrobial Chemotherapy, 49, 905–915. Production of Lipase from Aspergillus oryzae var. viridis, Aspergillus awamori and Aspergillus niger

Apridah Cameliawati Djohan1*, Yopi1and Heri Hermansyah2 1Research Centre for Biotechnology, Indonesian Institute of Sciences (LIPI) 2Departement of Chemical Engineering, University of Indonesia, Depok 16424, Indonesia

Abstract Lipases (Triacylglicerolacylhydrolase, EC 3.1.1.3) are natural catalysts of the hydrolysis of fats to produce monoglycerides, diglycerides, free fatty acids and glycerol. The catalytic potential lipase is enormous; thus, lipases are ideal biocatalyst for production of fine chemicals, pharmaceutical preparation, flavour compounds and food additives. It is widely used in the processing of fats and oils, detergents, food processing, chemical synthesis, pharmaceutical, synthesis paper, cosmetics and industrial production of biodiesel. This research aims to study the characteristics of potential microbial isolate producing lipase from Aspergillus oryzae var. viridis (JCM 2232), Aspergillus awamori (JCM 2262) and Aspergillus niger (JCM 22344). Media production of lipase using carbon source such as olive oil and nitrogen source such as peptone, yeast extract and urea are also being optimized. The production of lipase, powdering and analysis was done for knowing the activity enzyme and enzyme characteristic such as intracellular or extracellular enzyme types. Keywords: Lipase, Aspergillus oryzae var. viridis, Aspegillus niger, Aspergillus awamori, spray drier, nitrogen sources

*Corresponding Author Jln. Raya Bogor Km 46, Cibinong, Bogor 16911, E-mail: [email protected]; [email protected]

Introduction The biological function of lipase is to catalyse the hydrolysis of triacylglycerols to give free fatty acids, diacylglycerols, monoacylglycerols and glycerol. Lipases occur widely in nature, but microbial lipases are commercially significant because of low production cost, greater stability and wider availability than plant and animal lipases. Lipase is produced by several microorganisms, namely bacteria, fungi, archea, eucarya, as well as by animals and plants. Commercially useful lipases are usually obtained from microorganisms that produce a wide variety of extracellular lipases. They may originate from fungi, and bacteria lipases are indispensable for the bioconversion of lipids (triacylgylcerols) from one organism to another and within the organism. Furthermore, they process the unique feature of acting at an interface between the aqueous and non-aqueous (i.e. organic) phase; this feature distinguishes them from esterases (Aravindan et al., 2007). The Aspergilli are a ubiquitous group of filamentous fungi spanning over 200 million years of evolution. They have an impact on human health and society and there are more

221 222 Proceedings ASIAHORCS 2013

than 180 officially recognized species, including 20 human pathogens as well as beneficial species used to produce foodstuff and industrial enzymes (Manali et al., 2012). This genus emphasized that among the different species, Aspergillus oryzae and Aspergillus niger are on the Generally Recognized As Safe (GRAS) list of the Food and Drug Administration (FDA) in the United States. There are several species with great potential as sources of lipase (Buisman et al., 1998) with important properties for industrial application. Many studies have been undertaken to define the optimal culture and nutritional requirements for lipase production. These requirements are influenced by the type and concentration of carbon and nitrogen sources, culture pH and growth temperature (Sanchez et al., 2002). Lipidic carbon sources generally seem to be essential to obtain a high lipase yield although a few author observed that the presence of fats and oil was not statistically significant for enzyme production (Buisman et al., 1998). The use of Aspergillus lipases of agro-industry is very important enzyme that are widely studied for food industrial application such as aroma compound. They can be obtained by traditional methods such as chemical synthesis or extraction from natural sources, but the use of biocatalyst provide some advantages. Esters from short-chain fatty acids and alcohols are important aroma compound and can be synthesized by lipase catalysed esterification. Ester of short and medium chain carboxylic acids and alcohol moieties synthesized by lipase play a relevant role in the food industry as flavour and aroma constituents. The majority of enzymes used in industry are for food processing, mainly for the modification and breakdown of biomaterials. Most of commercial lipases produced are utilized for flavour development in dairy products and processing of other foods, such as meat, vegetables, fruit, baked foods, milk product and beer. Lipases are extensively used in the dairy industry for hydrolysis of milk fat. The dairy industry uses lipases to modify the fatty acid chain length, to enhance the flavour of various cheeses and ripening cheese and lipolysis of butter, fat and cream. Enzyme modified cheese (EMC) is produced when cheese is incubated in the presence of enzymes at elevated temperature in order to produce a concentrated flavour by lipase catalysis for use as an ingredient in other product, such as dips, sauces, soups and snacks. In the bakery industry, lipase as a hydrolysis enzyme is effective in reducing the initial firmness and increasing the specific volume of the breads, and could also form texture and softness to the bread product by enzymatic interesterification lipase (Fabiano et al., 2010). Other than the food industry, lipases have been applied in the synthesis of fine chemical, biodiesel production, biopolymer, detergent, paper and pulp industries, the synthesis of surfactant and oleochemical industry, agrochemical industry, pesticides industry and in environmental management. This research aims to set up the optimum condition of nitrogen source for functional food 223 fermentation medium, and knowing the characteristic of each Aspergillus types for lipase production; whether it was intracellular or extracellular. For the final purpose, we would like to establish the most effective and efficient treatment for lipase fermentation product in food industrial application in accordance to enzyme activity after various treatments such as sonification cell and spray drier powdering technology were done.

Materials and Methods Strain. Most of the industrial microbial lipase were derived from fungi and bacteria. Fungi were preferable because fungal enzymes were usually extracellular, facilitating extraction from fermentation media. This study used four isolates lipolytic fungi which are a standard collection of JMC isolates such as Aspergillus oryzae var. viridis (JCM 2232), Aspergillus awamori (JCM 2262) and Aspergillus niger (JCM 22344). Potential isolates lipase-producing were grown on media lipase potato dextrose agar (PDA) and rejuvenated once every two weeks. Chemicals and Substrates. Medium potato dextrose agar (PDA) (BactoDifco, USA), potato dextrose broth (PDB) (BactoDifco, USA), peptone, yeast extract, Co(NH2)2, agar powder, 2-propanol, 4-Nitrophenyl palmitate (4-NPP), triton X-100, olive oil, Na2HPO4, aquades, KH2PO4. Pre-culture and Culture Medium. Preliminary maintained stock with PDA contained 39 g/L. Pre-culture and culture medium were contained 39g/L PDB in aquades, olive oil as a carbon source, several nitrogen sources such as 0.1% yeast extract; 0.1% peptone and 0.1% urea. Pre-culture medium was incubated at 30°C, 200 rpm in agitation for 24 h after inoculated to grow a strain for initiation fermentation progress. Culture medium was incubated at 30°C, 200 rpm in agitation for final sampling for 72 h (modification Krieger et al., 1997). Determination of Lipolytic Activity. Lipolytic activity was determined according to the modified method of Kriegeretet al. (1992). The enzyme assay was performed by using 4-nitrophenyl palmitate (4-NPP) as substrate. The substrate solution was prepared by adding solution A (3 mM 4-NPP in 2-Propanol) and solution B (0.4% triton X-100, 0.1% gum Arabic, 20 ml phosphate buffer 0.02 m pH 7.00 with comparison A:B = 1:9) drop wise with intense stirring. The solution obtained remained stable for at least 2 h. The assay mixture 950μ L substrate and 50 μL sample was incubated for 20 min at 37°C and the enzymatic process was de-activated at 95–100°C for 10 min, centrifuge the mixture at 4°C, 12.000 rpm for 3 min. Supernatant is p-nitrophenol released from reaction and measured at 410 nm. The reagent blank was used and it contained distilled water instead of enzyme. Standard curve using 4-NPP in 2-propanol with concentration 2, 4, 6, 8, 10, 12 mM) was incubated at 37°C for 20 min then measured at 410 nm. 224 Proceedings ASIAHORCS 2013

One unit of activity is expressed as μmol of ρ-nitriphenol released per minute under the standard assay conditions.

ResultS and Discussion Lipases Activity in Various Nitrogen Sources. This research aims to study the characteristics of potential isolate producing lipase from Aspergillus oryzae var. viridis (JCM 2232), Aspergillus awamori (JCM 2262) and Aspergillus niger (JCM 22344). Lipase is used to hydrolyse the fats into fatty acid component, which is needed by microorganism for metabolism process. This enzyme is constitutive, which means that it is constantly expressed without any inducer. Lipase expression increases when microorganisms enter the death phase because of the amount of fat from the dead cells increased (Madigan, 1994).

Figure 1. Potential isolates for lipase production Aspergillus oryzae var. viridis (a), Aspergillus awamori (b), Aspergillus niger (c).

This study showed that each isolate has characteristics that vary in producing lipase as the nitrogen source or a tendency on the type of lipase-producing isolates in intracellular or extracellular after various experiments were done. In the experiment of nitrogen sources optimization in Table 1, it can be concluded that the use of urea in culture media over stimulate selected bacteria to produce lipase activity is better than the use of yeast extract in the production of lipase enzyme in the same production conditions and carbon source. The effect of nitrogen sources Co(NH2)2 supported maximum lipase production than peptone and yeast extract. Therefore, to study the intracellular and extracellular lipase activity in further research, we subsequently used 0.5% amount of Co(NH2)2 as a nitrogen source. Lipase Activity from Various Treatments of Fermentation Product. Following the nitrogen sources optimation experiments, we studied the lipase fermentation product with several treatments to know the effectiveness of preservation and application in the laboratory scale. Lipase product from Aspergillus niger, Aspergil- lus oryzae and Aspergillus awamori have been through several treatments before analyzing the enzyme activity of each product such as original crude enzyme supernatant, sonication of the cell in supernatant mixture, sonication of the cell functional food 225

Table 1. Lipase Activity in Various Nitrogen Sources No Nitrogen Source Isolate Lipase Activity (U/mL) 1 PEPTONE A. niger 4.955 A. oryzae 4.545 A. awamori 4.545 2 YEAST EXTRACT A. niger 4.545 A. oryzae 4.955 A. awamori 5.364 3 Co(NH2)2 A. niger 28.501 A. oryzae 27.068 A. awamori 14.169 in 0.02 mM phosphate buffer, cell and supernatant spray drier treatment, and supernatant spray drier with 10% maltodextrin additional. The characteristics ofAspergillus niger to produce lipases are extracellular and intracellular because the lipase activity from supernatant analysis showed the value of 19.287 U/mL and after sonication process of cell and supernatant, it resulted an increase of enzyme activity as much as ± 5 U/mL, reaching the value of 25.02 U/mL; whereas for treatment sonication of cells in the buffer, it showed a decreasing result due to dilution. For spray drier treatment including cells and supernatant mixture, it has nearly the same result such as 21.744 U/mL and 20.516 U/mL. Figure 2 showed that there is no significant influence for enzyme activity when the liquid form of Aspergillus niger crude enzyme was transformed into powder form by spray-drier treatment. Aspergillus oryzae has a tendency to be extracellular and intracellular because the result of measurements on the supernatants and cell with supernatant mixture with sonication method showed enzyme activity of 12.735 U/mL and 17.240 U/mL, while the results of the spray drier enzyme activity value is smaller in the range of 2–4 U/mL. Based on data in Figure 2, Aspergillus awamori has intracellular type because of the high lipase activity contained in the cells than in the supernatant after sonication process that is equal to 20.106 U/mL, and the supernatant did not reveal any lipase activity. The results spray drier of Aspergillus awamori cells showed a high enough value of 15.602 U/mL compared to spray drier treatment when it was mixtured with supernatant and it resulted in smaller value of 8.640 U/mL. An interesting finding is the difference of lipase production from several Aspergillus types which could result various kind of extracellular and intracellular and the specific characteristic can be a new focus of advance experiment in the future conduct to the application in food industry for fermentation technology. Aspergillus niger and Aspergillus oryzae have amazing capability because it can be extracellular and also intracellular. It become more interesting because most of fungi are preferable extracellular facilitating extraction from fermentation media. Aspergillus awamori which has intracellular and lipase in cells, could be more 226 Proceedings ASIAHORCS 2013

stable for application in reservation for continuous fermentation process, and is very interesting to be made as an immobilized enzyme for future food industry technology.

Figure 2. Lipase activity for Aspergillus niger (a), Aspergillus oryzae (b), Aspergillus awamori (c). Analysis of lipase activity after various treatments such as crude enzyme supernatant (A), sonication cell and supernatant mixture (B), sonication of the cell in 0.02 mM phosphate buffer (C), cell and supernatant spray drier treatment (D), supernatant spray drier with 10% maltodextrin (E).

Conclusions The characteristics and application of lipases to catalyse reactions with commercial potential will significantly broaden the advance of industrial biotechnology. The tremendous potential of lipase in food and allied technology applications shows the need to develop novel cost-effective technologies for increased production, scaling up and purification of this versatile enzyme. There are several points that must be improved such as fermentation technology, allowing for feasible production process of the enzyme on a large scale, and immobilization methods, which are important to enhance lipase stability, activity and selectivity and enzymatic technology to reach possibility of the continuous use or reuse the biocatalyst in production process.

References Buisman, G. J. H., Van-Heltersen, C. T. W., Kramer, G. F. H., Veldsnik, J. W., Derksen, J. T. P., & Cuperus, F.P. (1998). Enzymatic esterification of functionalized phenol for the synthesis of lipophilic antioxidants. Biotechnology Letters, 20, 131–136. Contesini, F. J., Lopes, D. B., Macedo, G. A., Nascimento, M. G. and P. O. Carvalho. (2010). Aspergillus sp. Lipase: Potential biocatalyst for industrial use. Journal of Molecular Catalysis B: Enzymatic, 67, 163–171. Fabiano J. C., Danielle B. Lopesa, Gabriela A. Macedoa, Maria da Graça Nascimentob, Patrícia de Oliveira Carvalhoc. (2010). Aspergillus sp. lipase: Potential biocatalyst for industrial use. Journal of Molecular Catalysis B: Enzymatic. Vol 67, Issues 3–4, Pages 163–171. Krieger, N., Taipa, M.A., Aires-Barros, M.R., Melo, E.H.M., Lima-Filho, J.L., Cabral, J.M.S. (1997). Purification of Penicillium citrinum lipase using AOT reversed micelles. J. ChemTechnol. Biotechnol. 69: 77–85. functional food 227

Krieger, N., Taipa, A., Aires-Barros, R., Melo, R. H. M., Lima-Filho, J. L., & , Cabral, J.,. (1999). Purification of the Penicillium citrinum Lipase using AOT reversed micelles. Journal of Chemical Technology and Biotechnology, 69, 77–85. Madigan, M. T., Brock, T. D., Martinko, J. M., & Parker, J. (1994). Biology of microorganisms, 7th ed. Upper Saddle River, NJ: Prentice Hall. Manali, K. & Munishwar, N G. (2012). Lipase promiscuity and its biochemical applications. Process Biochemistry, 47, 555–560. Aravindan, R., Anbumathi, P. & Viruthagiri, T. (2007). Lipase application in food industry. Indian Journal of Biotechnology, 6, 141–158. Sanchez, M., Prim, N., Rendez-Gil, F., Pastor, F. I. J., & Diaz, P. (2002). Engineering of baker’s yeasts, Escherichia coli and Bacillus host for the production of Bacillus substilis lipase A. Biotechnology and Bioengineering, 78, 339–345. Sumanthi, R., & Meerabai, R. S. (2012). Lipase production by Aspergillus terreus using cotton seed oil as carbon source. Plant archives, 12, 765–768. Vonderwulbeche, T., Kieslich, K. & Erdmann, H. (1992). Comparison of lipases by different assays. Enzyme and Microbial Technology, 14, 631–639. Zhou, J., Chen, W. W., Jia, Z. B., Huang, G. R., Hong, Y., Tao, J. J., & X. B. Luo, X. B. (2012). Purification and characterization of lipase produced by Aspergillus oryzae CJLU-31 isolatd from waste cooking oily soil. American Journal of Food Technology, 7, 596-608.

Bioprocessing for Food and Food Technology

Full Paper of Oral Presentations

Development of Flour Preparation Method Derived from Local Arrowroot (Maranta arundinacea) of Yogyakarta

Miftakhussolikhah1*, Dini Ariani1, Cici Darsih1, Mukhamad Angwar1, Haryadi2 1Technical Implementation Unit for Development of Chemical Engineering Process, Indonesian Institute of Sciences (LIPI) 2Faculty of Agricultural Technology, Gadjah Mada University, Jln. Flora 1, Bulaksumur, Yogyakarta, Indonesia

Abstract Arrowroot (Maranta arundinacea) tuber has traditionally been used by local people in Gunungkidul Regency, Yogyakarta Province, Indonesia as a source of carbohydrate in their food diet. It will be likely more preservable and flexible when the tuber is processed into flour as an alternative raw food material. This paper aimed to present two methods to prepare the arrowroot flour with desirable characteristics. The methods were 1) pressing the grated, cleaned tuber followed by drying, grinding and screening; 2) chipping the cleaned tuber followed by drying, grinding and screening. The resulted flours were characterized for the proximate composition, amylose content, solubility, swelling power, gelatinization properties and degree of whiteness. The results show that arrowroot flours prepared by pressing and chipping contained 1.42% and 5.13% protein, 0.11% and 0.58% fat, 1.65% and 3.55% ash, 63.60% and 63.81% carbohydrate, respectively. Amylose content of arrowroot flour resulted from the pressing method was 27.40% and that from the chipping method was 23.26%. The solubility and the gelatinization temperature of the flour derived from the chipping method were higher than those from the pressing method, but the swelling power was on the contrary. The pressing method gave higher whiteness flour compared to that resulted from the chipping method. In summary, the pressing method gave more desirable physical and chemical properties for use as a raw material for food such as noodle. Keywords: Arrowroot, pressing, chipping, flour, bioprocessing

*Corresponding Author Jln. Jogja-Wonosari Km 31.5, Gading, Playen, Gunungkidul, Yogyakarta, Indonesia E-mail: [email protected]

Introduction Tuber is one of the alternative carbohydrate food sources. Tubers are usually consumed in fried, boiled, steamed or baked. There are many varieties of tubers in Gunungkidul, Yogyakarta, Indonesia such as cocoyam, arrowroot, canna, long yam, and black potato. Processing tuber into flour could increase tuber shelf life and economic value (Richana and Sunarti, 2004). Arrowroot (Maranta arundinacea) as a food carbohydrate source is potential to substitute wheat and rice, to diversify staple food, and to be utilized as raw material for industrial purposes. Arrowroot is an herbaceous, tropical perennial plant, with a creeping rhizome, indigenous from tropical America. It has fleshy

233 234 Proceedings ASIAHORCS 2013

cylindrical tuber with rings of scars; these are leftovers of large thin scales. The stem reaches a height of 6 feet and has creamy white flowers. It has numerous, ovate leaves, 2 to 10 inches, with long sheaths that often envelope the stem. Arrowroot needs approximately 6–12 months from grow to harvest. The plant bears fruits; little berries or capsules. Starch is usually extracted from the rhizomes not older than a year old. Arrowroot starch is a high quality starch, and can be used as a thickener for sauces and gravies. It thickens at a lower temperature than corn flour or cornstarch does and is also used to make clear glazes for fruit pies (Anonymous, 2013). Arrowroot can be found in almost all islands in Indonesia, scattered from the coast to the mountains. Based on arrowroot potential as carbohydrate source, physical and chemical properties of arrowroot flour need to be determined, so it can be developed as functional food. The aim of this paper is to present two methods to prepare arrowroot flour with desirable characteristics such as pressing and chipping method.

Materials and Methods Materials. Arrowroot was obtained from Katongan Village, Nglipar, Gunung- kidul, Yogyakarta, Indonesia. Sodium meta-bisulfite was bought from a local agent in the same area. Arrowroot flour producing process.The arrowroot flours were produced using two different methods: 1) pressing the grated, cleaned tuber wrapped in a cloth to dewater followed by drying, grinding and screening (Figure 1); 2) chipping the cleaned tuber followed by drying, grinding and screening (Figure 2).

Figure 1. Flow diagram of pressing method to produce arrowroot flour bioprocessing for food 235

Figure 2. Flow diagram of chipping method to produce arrowroot flour Flour Characterisation. The flours were characterized for proximate composition (AOAC, 1995), and carbohydrate content was determined by difference. Amylose content was determined by spectrophotometry. Solubility and swelling power of the flour were measured based on Adebowaleet al., (2002) at temperature 60, 70, 80 and 900°C. Gelatinization properties were determined using a Rapid Visco analyser and colour characteristics used a Minolta Chromameter.

Results and Discussion Chemical Properties of Arrowroot Flour. Water content of arrowroot flour under pressed and chipped methods were 8.39% and 5.44% respectively (Table 1). The water content influences flour shelf life during storage and flour quality. Flour which has high water content was more easily damaged because fungi will be easier to grow. According to Indonesian National Standard on quality requirement of cassava flour (<12%), sago flour (<13%) and wheat flour (14.5%), water content of arrowroot flour made by two methods met the requirement.

Table 1. Chemical composition of arrowroot flour Component Pressed arrowroot flour (%) Chipped arrowroot flour (%) Ash 1.65 3.55 Fat 0.11 0.58 Protein 1.42 5.13 Carbohydrate 88.70 85.81 Amylose 27.40 23.26 Starch 76.38 66.75 236 Proceedings ASIAHORCS 2013

Ash content in chipped arrowroot flour was 3.55%, higher than pressed arrowroot flour (1.65%). This was due to the minerals that dissolved in water partially pressed out during pressing process. Meanwhile, fat content in pressed and chipped arrowroot flour were 0.11% and 0.58% respectively. High level of fat content will cause more easily rancid. Protein content of the chipped arrowroot flour (5.13%) was higher than that of the pressed arrowroot flour (1.42%). It could happen due to tissue destruction during grating and pressure could partially express water containing protein. The protein content in arrowroot flour was quite higher compared to the ISO for cassava flour (1.25%) and nearly close to the wheat flour SNI protein value (7%). Amylose content of arrowroot flour made by pressing method (27.40%) was higher than by chipping method (23.26%). Amylose content in flour plays a role during gelatinization process. Carbohydrate content in arrowroot flour pressing method (88.70%) was higher than chipping method (85.81%).

Solubility and Swelling Power

Figure 3. Solubility of chipped and pressed arrowroot flours at different temperature levels.

Figure 3 shows that solubility of the arrowroot flour was different at various temperatures. The highest solubility was achieved at 70°C and 80°C for chipped and pressed arrowroot flour respectively. Application of high temperature could produce short chain amylose fractions that were released from the swelling of the starch granules. Swelling of the starch granules lead to the suppression of granules toward one another and to form a paste which causes the flour difficult to dissolve. Solubility of the chipped arrowroot flour was higher than that of the pressed arrowroot flour because the amylose content in pressed arrowroot flour was higher than that bioprocessing for food 237

Figure 4. Swelling power of chipped and pressed arrowroot flours at different temperature levels. in chipped arrowroot flour. Chang et al., (2010) mentioned that low solubility of rice starch can be caused by the presence of amylose starch which can limit swelling and resulted in the maintenance of starch granules structure during heating with water. Meanwhile, swelling power increased as the temperature increase (Figure 4). The highest swelling power for the chipped and pressed arrowroot flours were achieved when heated at 80°C and 90°C, respectively. Based on the results of this study, swelling power for pressed arrowroot flour was higher than the flour made by chipping method. Swelling properties were affected by amylose and amylopectin ratio of the starch (Blazek and Copeland, 2008). This was consistent with the starch swelling power and amylose content of Triticale and Triticum timopheevii germplasm which indicates that the swelling power increased with increasing amylose content (Dennett et al., 2009).

Gelatinization properties Different gelatinization patterns between each sample can occur due to differences in amylose content. Starches having different amylose content will have different functional properties, such as gelatinization temperature, and viscosity (Charles, et al., 2005). Simple structure of amylose can form a strong molecular interaction with water, resulting in formation of hydrogen bonds to be easier to occur in amylose (Taggart, 2004). As a result, the pressed arrowroot flour that contained higher amylose ratio might have a lower gelatinization temperature than the chipped arrowroot flour because it was easier to gelatinize. 238 Proceedings ASIAHORCS 2013

Table 2. Pasting characteristics of arrowroot flour Gel. Gel. Peak Peak Peak 930C 930C/20’ 500C Set Time Temp time temp viscos- viscos- viscosity viscos- Back (min) (°C) (min) (°C) ity (BU) ity (BU) (BU) ity (BU) Visc. (BU) Chipped 32 78 39 88,5 250 250 200 250 (+) 50 arrowroot flour Pressed 31 76.5 36 84 320 310 280 410 (+) 130 arrowroot flour

Color characteristics Based on luminosity value, the colour of pressed arrowroot flour was brighter than the chipped arrowroot flour. This was because the flour preparation process used sodium meta-bisulphite, and the pressing process involving grating of the peeled arrowroot caused higher surface area of contact between the reactants so that browning reaction was minimized. Table 3. Pressed and chipped arrowroot flour color-characteristics Luminosity (L) Hue a* (a) Hue b* (b) Pressed arrowroot flour 94.41 0.74 4.33 Chipped arrowroot flour 83.93 3.52 11.44

Conclusions Arrowroot flour made by two different processes, i.e. pressing method involving grating the peeled arrowroot tuber, addition of sodium metabisulfite, by pressing to dewatering, drying followed by grinding, and chipping method involving chipping of the peeled tuber, drying and grinding. Amylose content of arrowroot flour resulted from the pressing method was higher than that of the flour from the chipping method. The solubility and the gelatinization temperature of the flour derived from the chipping method were higher than those from the pressing method, but the swelling power was on the contrary. The pressing method gave higher whiteness flour compared to the result of chipping method. The pressing method gave more desirable characteristics as a raw material for food like noodle. It needs further research to utilize arrowroot flour for food products.

Acknowledgement The authors thank the Indonesian Institute of Sciences for the financial support to conduct the research through the Competitive Program 2013. bioprocessing for food 239

References Adebowale, K. O., Afolabi, A. T., & Lawal, S. O. (2002). Isolation, chemical modification and physicochemical characterisation of Bambarra groundnut (Vondzeiasubterrenea) starch and flour. Food Chemistry, 78, 305–311. Anonymous. (2013). “Maranta arundinacea L.-Arrowroot.” http://www.tropilab.com/arrowroot. html. Accessed on November 4, 2013. AOAC. (1995). Official Methods of Analysis of AOAC International. Arlington, Virginia, USA. Blazek, J., & Copeland, L. (2008). Pasting and swelling properties of wheat ﬂour and starch in relation to amylose content. Carbohydrate Polymers, 71, 380–387. Chang, Y. H., Lin, J. H., & Pan, C.L. (2010). Type and concentration of acid on solubility and molecular size of acid–methanol-treated rice starches differing in amylose content. Carbohydrate Polymers, 79, 762–768. Charles, A. L., Chang, Y. H., Ko, W. C., Sriroth, K., & Huang, T.C. (2005). Influence amylopectin structure and amylose content on gelling properties of five cultivars of cassava starches. Journal of Agricultural and Food Chemistry, 53, 2717–2725. Dennett, A. L., Schoﬁeld, P. R., Roake, J. E., Howes, N. K., & Chin, J. (2009). Starch swelling power and amylose content of triticale and Triticumtimopheevii germplasm. Journal of Cereal Science, 49, 393–397. DSN. (1992). Tepung Singkong (SNI 01-2997-1992). Dewan Standardisasi Nasional, Jakarta. DSN. (2009). Tepung terigu sebagai bahan makanan (SNI 3751:2009). Dewan Standardisasi Nasional, Jakarta. Richana, N. & Sunarti, T.C. (2004). Karakaterisasi Sifat Fisikokimia Tepung Umbi dan Tepung Pati dari Umbi Ganyong, Suweg, Ubikelapa, dan Gembili. Jurnal Pascapanen, 1, 29–37. Taggart, P. (2004). Starch as an ingredient: manufacture and application. In Elliason A.C. (ed). Starch in food. England CRC Press, 363–392.

Rice Analog from Broken Rice (Oryza Sativa L.) and Adlay (Coix lacryma-jobi L.)

Lerjun M. Peñaflor1* and Arnold R. Elepaño2 1Food Engineering Division, Food Science Cluster, College of Agriculture 2Agricultural and Bio-Processing Division, Institute of Agricultural Engineering, College of Engineering and Agro-industrial Technology, University of the Philippines Los Baños, College, Laguna, 4031 Philippines

Abstract An optimization process for making rice analog is done by reconstituting broken rice mixed with adlay and water through cooking, to produce a partially gelatinized mixture then extruded to form a rice kernel shaped and finally dried, cooled and packed. The research specifically determines the operating parameters that can be controlled and modeled, addressing the concepts of control stability for reconstituting broken rice mixed with adlay. Three rice varieties with high, intermediate and low amylose content; rice-adlay mixture (1:0, 1:1, 1:2); mixture moisture content (25%, 30%, 35%); and gelatinization temperature (80, 90, 100) were set and controlled for this study. The optimum combination established were intermediate amylose content for rice variety, 1: 0.9 rice-adlay mixture, 30% moisture content of the mixture and 91°C gelatinization temperature. Verification test showed that predicted, experimental and actual values were reasonably close. Thus, the percentage difference for all the responses for compression test could be attributed for extrusion test such as 8% processing time, 20% compression force, 0.6% moisture content ,4% physicochemical properties and 2% cooking quality. Physicochemical and cooking characteristics of these rice analog can be modified by alteration of the different reconstitution parameters for specific application requirement. Keywords: Rice analog, broken rice, adlay, extrusion, reconstitution, optimization

*Corresponding Author University of the Philippines Los Baños , College, Laguna, 4031 Philippines E-mail: [email protected]

Introduction Rice is the staple foods in the large part of the world including the Philippines. Palay production in the Philippines is about 17.1 million metric tons, most of which is grown domestically and produces only about 10.8 million metric tons of milled rice (GAIN Report, 2012). Philippines consume about 12.8 million metric tons of rice annually. Frequent deficit emerged due to declining domestic production caused by unpredictable calamities, increasing population and corruption in the rice supply chain. It makes Philippines one of the largest world rice importers. Perhaps, corn can be adapted, but most of it is being process into other things like animal feed and now, bio-ethanol for fuel. Therefore, an alternative for rice and corn crops was needed also find ways to meet the national cereal requirement. Adlay comes from the family Poaceae or the grasses, the same

241 242 Proceedings ASIAHORCS 2013

family where rice, corn, and wheat belong. Adlay is not new and may be familiar to people but barely recognized. Some local tribes and farmers from various part of the country have been planted and consumed adlay in the same manner as rice; however, it has not yet been well documented and given priority. Another concern is the breakage of rice kernels during milling processes; 67% milled rice was obtained after milling rough rice. It contained 52% head rice and 15% broken rice. These broken kernels are not generally accepted by consumers and sold at low price. In the past few decades, several studies had been conducted and revealed that broken milled rice could be mixed with some desired additives to improve their quality and extruded to form rice analogues. These are the main reasons why this study intends to develop a technology to reconstitute the broken milled rice and mixed with adlay, to promote the utilization of broken rice and explore the potential of adlay as an alternative source of food to at least alleviate the deficit in rice production. Most importantly, the process intends to upgrade the value and quality of the rice to be produced leading to innovation of the technology. At the same time provide basic information for determining the operating parameters that can be controlled and modelled, addressing the concepts of control stability for reconstituting the broken rice and adlay, also establishing the optimum combination of the different reconstitution parameters for rice analogue from broken rice and adlay.

Materials and Methods Materials. Samples prepared for this study were adlay and three rice varieties with high (RC-10), intermediate (RC-18) and low (RC-160) amylose content. Methods of Reconstituting Rice and Adlay. Compression Test (Laboratory Process). The grind adlay and broken milled rice together with water were put inside the tube then cooked in an oven for a certain period of time to gelatinize the mixture. The processing time was measured as the time from the start of the sample was put inside the oven at a certain temperature and switched off when the sample was partially gelatinized. Then, use the round bars to compress the gelatinized samples inside the tube to form new shape rice analog. These improvised pelletizing instrument which was attached to universal testing machine was utilized to reconstitute the broken rice and adlay and also to determine the applied compression force. Products obtained from the experiment were dried and allowed to cool at room temperature and immediately packed airtight in plastic bags. Later, samples were subjected for analysis of their physicochemical and cooking properties and quality of the cooked rice analog. Extrusion Process (Machine). Samples were sorted to remove the impurities and mixed at the corresponding ratio of the rice and adlay. Next, sample was bioprocessing for food 243 grinded into flour then rewetted to allow exposure to moisture, and afterwards, the mixture was gelatinized. Lastly, extrusion process covered the entire processing operation. The gelatinized mixture of raw materials was fed into the extruder screw feeder which has maintained the rate of feeding. It was extruded at different extrusion variables, through a rice-grain–shaped die then cut with a rotary knife to form the rice analog. Extruded products were further dried until the moisture content was safe for storage and allowed to cool then immediately packed in airtight plastic bags. Samples were subjected for analysis and evaluated to select the best combination for making rice analog from broken rice mixed with adlay. Optimum value obtained from compression test was utilizes as experimental design for extrusion test to validate the acceptability of the result gathered from the laboratory analysis. Optimization of the Extrusion Process. Reconstituting of broken rice and adlay was optimized using Response Surface Methodology. The analysis of the study, a three-level-four-parameters incomplete factorial experiment was utilized to establish the optimum operating condition. Independent variables include amylose content (X1); rice-adlay mixture (X2); moisture content (X3) and gelatinization temperature (X4). While the dependent variables were gelatinization time, compression force, extrudates moisture content, physicochemical and cooking properties of the uncooked rice analog and quality of the cooked rice analog. Through response surface regression procedure, parameters of complete quadratic response surface were fitted and critical values were determined, such that response optimization with respect to the factors was effective. Data analysis were done using Statistical Analysis System for Windows and Design Expert software for establishing the optimum points. Then, verification of the response models was made by making several separate experimental test runs using optimum conditions.

Results and Discussion Reconstitution of Broken Rice and Adlay. Reconstitution of broken rice and adlay starts from mixing the grind rice and adlay at a desired ratio and by adding appropriate amount of water to the mixture. Then, the mixture was heated and the granules melt and become soft or gelatinized. The structure of the rice analog is created by forming through compression of the gelatinized mixture of rice and adlay. During gelatinization process, the layer of gelatinized mixture flows easily in the bubble walls that allows the bubbles to expand as the superheated water is released very quickly at atmospheric pressure. Melted fluids of the gelatinized mixture hold and expand due to bubbling of water vapor during extrudates expansion until it reached the rupture point. After expansion, rapid fall in the temperature caused by evaporation and the rise in viscosity, accompanied is the 244 Proceedings ASIAHORCS 2013

formation of glassy state due to moisture loss, the cellular structure shrink back and solidify as they cool to stabilize the structure of the rice analog to form a hard brittle texture. Thus, the essential features of the process are the melting of the crystalline regions of granules and degradation of starch polymers (Guy, 2001). Forming the structure of gelatinized mixture must have minimum molecular weight adequate to give enough fluid viscosity to prevent the shrinkage of reconstituted rice kernel or extrudates. Once an extrudates was too viscous, there will also rapid shrinkage or collapse after expansion due to low internal pressure in the unbroken bubbles or low viscosity that gives little apparent expansion on cooling. “Globular proteins even if smaller than starch polymers in a melted fluid they linked together to form larger structures as they flow through a die channel. They aggregate and form higher viscosity complexes, which served to form crude films and retain some of the expanding water vapor. Their viscosity on cooling is sufficient to prevent shrinkage” (Guy, 2001).

Effect of Independent Variables on Reconstituting Rice and Adlay Gelatinization Time. Amylose content, rice-adlay mixture, moisture content and gelatinization temperature mainly affects the gelatinization time. Gelatinizing the mixture of rice and adlay granules, particularly when the mixture is 1: 2 takes more time for the reason that adlay contains enough proteins, and protein plays a role in gelatinization of a starch granule, which the main component are amylose and amylopectin, it must be heated to a desire temperature to absorb water in order to gelatinized. Water absorption causes the proteins to make new bonds and this will affect the gelatinization time. Thus, the gelatinization temperature and moisture content are liable for starch granule to starts swell in hot water, accompanied by the loss of crystalline structure which affects the time. Response surface regression yielded the following equation for gelatinization time: Gelatinization Time = 9.145 X2 + 3.347 X3 + 0.861 X2 2 + 0.0179 X4 X1 – 0.025 X4 X3 The model indicates that the gelatinization time increases as the rice-adlay mixture and mixture moisture content increases also by decreasing the gelatinization temperature as shown in Figure 1. The combination of rice variety with intermediate amylose content, without mixture of adlay, 25% mixture moisture content and gelatinization temperature of 90°C has the lowest value of 33 minutes. While the combination of rice variety with intermediate amylose content, 1: 2 rice-adlay mixture, mixture moisture content of 30% and 80°C gelatinization temperature give the highest value of 44 minutes gelatinization time. bioprocessing for food 245

Figure 1. The interaction effect of gelatinization temperature and mixture moisture content on gelatinization time.

Compression Force. The amylose content, rice-adlay mixture and moisture content entails to the increase in viscosity which increase the compression force since these variables were directly related to gelatinize mixtures and these mixtures have no internal friction and they are able to withstand pressure. Thus, when external forces are applied, they will easily flow. However, this gelatinized mixture tends to develop internal pressure that resists flow. Viscosity is the property of fluid which contributes more to affect of this force. Therefore, it is because of the viscosity of the gelatinize mixture of rice and adlay, that is characterized by the starch composition, which influences the compression force. Response surface regression yielded the following equation for compression force: Compression Force = 1.1356 - 0.0336X1 + 0.0002X12 + 0.0002X3X1 + 0.0001X4X1 The model indicates that decreasing amylose content and rice-adlay mixture but increasing the mixture moisture content will increase the compression force. The interaction effect among the independent variables on compression force is shown in Figure 2, in which the combination of rice variety with low amylose 246 Proceedings ASIAHORCS 2013

content, 1: 2 rice-adlay mixture, moisture content of 30% and gelatinization temperature of 90°C give the highest value of 345 Newton. While the combination of rice variety with high amylose content, without mixture of adlay, moisture content of 30% and gelatinization temperature of 90°C give the lowest compression force of 226 Newton.

Figure 2. The interaction effect of mixture moisture content and rice- adlay mixture on compression force.

Physicochemical Properties of the Rice Analog Moisture Content of the Extruded Rice Analog. Moisture content has direct implication for microbiological safety of food. Some deteriorative processes in foods are triggered by water activity in which influences the storage stability of foods. The moisture content of the extruded rice analog was mainly affected by the mixture moisture content and gelatinization temperature. Analysis revealed that high moisture content of the mixture during processing will give a higher moisture content of the rice analog. The gelatinization temperature changes moisture content during processing due to changes in water binding, dissociation of water and solubility of solutes in water. Though, solubility of solutes was a controlling factor, usually from the conditions where glassy or rubbery state. Whiteness Index. Whiteness is a concern for the appearance of the reconstituted bioprocessing for food 247 rice kernel, and also a basic indicator for rice quality. Rice that is not attractive to the consumer will have a lower value in the market place. Thus, rice grains value increases by improving their whiteness index. The combination of low amylose content, without mixture of adlay, 30% mixture moisture content and gelatinization temperature of 90°C gives the highest value of 31 for whiteness index of the rice analog. Increasing the processing temperature causes overheating in material which induce changes on the color development due to the effects of the non-enzymatic browning by maillard reactions. Sugar released during the boiling process that reacts with the amino acids of the grain, causing discoloration of rice analog. The adlay bran and husk pigments which are mixed during milling of adlay might also contribute to discoloration of rice analog, thus increasing the mixture of rice and adlay increases the discoloration of the rice analog. Also moisture may have a direct influence on the change of color during cooking but the most likely explanation is that the moisture content affects the dissipation of heat. The water acts as a plasticizer on the starch-based material and reduces the viscosity of the melted fluid so that less heat is dissipated in the material. It influences the temperature profile of the material in the cooking zone, and thus some degree of change in the color. Bulk Density. It provides gross measure of particle size and dispersion which can affect material flow consistency and reflect packaging quantity. The bulk density of the rice analog from different combination studied ranging from 0.57–0.61 g- ml-1. It was primarily influenced by rice variety in terms of amylose content, and moisture content possibly due to the intrinsic characteristics of every variety. Depending on the moisture content, the amount of impurities, and the degree of filling, the bulk density can be changed. The higher the sphericity of the reconstituted kernels, the better the arrangement was. Consequently, large space between the reconstituted rice analog, resulted in a higher bulk density. Densities are also dependent on the amount of moisture they contain since rice analog contains rigid cell wall that allows a certain degree of porosity that the moisture is confine. It was attributed to an increase in mass due to moisture gain in the material which was lower than the associated volumetric expansion of bulk. Crude Protein. The crude protein was affected mainly by amylose content of rice variety and gelatinization temperature. This is because of the differences in amino acid composition, particularly lysine, between proteins from various tissues of the different rice grain and adlay variety. The outer tissues of the rice grain are rich in albumin. In view of the fact that it is a water soluble protein, at high temperature it will coagulate and then broken down into a small fraction after processing. Therefore, protein content of the rice analog was affected. Also, since adlay was known with higher percentage of proteins fraction, as a result, the protein content in the rice analog will also increase. 248 Proceedings ASIAHORCS 2013

Gel Consistency. Gel consistency measures the tendency of cooked rice. When gel consistency is hard, the cooked rice tends to be less sticky and hard texture. Amylose content and rice-adlay mixture had larger influence on gel consistency of the rice analog, mainly because of starch composition of rice and adlay, particularly the amylose-amylopectin fraction that they contains, thus when the rice analog was cooked and after it gets cool, the cooked rice analog becomes hardened. It could relates to the fact that the higher value of amylose content improves the capacity of the starch granules to absorb water and expand in volume without collapsing because of greater capacity of amylose to hydrogen-bond or to produce retrogradation. Granule with limited swelling would increase the rigidity of the amylose gel drastically since the swollen granule was confined in the gel medium of the amylose and strengthened the gel structure. Gel Viscosity. The viscosity measurements of gels made from milled rice starch have long been in use for evaluating cooked rice texture (Jualino and Perez, 1983). Rice-adlay mixture and amylose content are mainly affecting the gel viscosity of the rice analog, particularly because of amylose-amylopectin fraction of the mixture. Structure of amylose and amylopectin has been reported to play an important role in the pasting properties of starches (Juliano and Perez, 1983). An increase in molecular weight of amylose and amylopectin has been reported to decrease the amount of long-branch chain length as well as branching degree of amylopectin, which resulted into an increase in viscosity. Cooking Characteristics of the Rice Analog. Cooking time for rice analog varied from 17.3 to 23.9 min. Amylose content and rice-adlay mixture have greatly influence the time of cooking of the rice analog. Hence, amylose content determines the rice water ratio for cooking milled rice (Juliano and Perez, 1983), in which amount of water determines the cooking time. The dissimilarity in the texture and area of rice analog caused by drying, in which rate of water diffusion through the cooked layer toward the boundary of the uncooked interior become limited, thus, affecting the cooking time. Also, because of protein hydrophobic nature, it directly affects by acting as a barrier to inward movement of water diffusion into the rice analog. Thus, the addition of adlay contributes to the increase of protein content on the rice analog and increase the cooking time. Since amylose content determines the rice-water ratio for cooking milled rice (Juliano and Perez, 1983), water absorption and volume expansion of the rice analog obviously will be affected by amylose content, rice-adlay mixture, and mixture moisture content. The difference in water absorption and volume expansion was attributed to the differences in viscosity pattern and weak internal organization within the starch granules. bioprocessing for food 249

Quality of the Cooked Rice Analog. The aroma and taste of the cooked rice analog increases as the rice-adlay mixture increases. Mainly because of the concentration at which larger ratio of adlay than rice, the aroma and taste of the cooked rice analog is dominated by adlay. This is due to the large amount of protein molecules in adlay. Thus, when distorted during processing they were more susceptible to oxidation breakdown and therefore, cause the changes in aroma and taste of the cooked rice analog. The cohesiveness of the cooked rice analog decreases as the amylose content and rice-adlay mixture decrease. Addition of adlay contributes to the decrease in amylose content and increase in amylopectin. The tenderness of the cooked rice analog increased as the moisture content increased, and decreased as amylose content and rice-adlay mixture decreased. Since cohesiveness and tenderness are determined by the rice-water ratio evidently, it will be directly affected by moisture content. It was also determined largely by its starch composition, which contains amylose and amylopectin as the main component (Juliano and Perez, 1983). Thus, cohesiveness and tenderness of cooked rice analog have been attributed primarily to the presence of abundant long chains in the amylopectin leads to strong and resilient starch granules that resisted swelling and breakdown, whereas their absence lead to weak and fragile granules that broke down easily during cooking. Optimization. The results derived from canonical analysis, the stationary point were not all located inside the experimental value and some were saddle point. This indicates that it could not be applicable to determine the optimum combination for analytical technique. Therefore, available literatures, preliminary results, observations and engineering judgment served as the basis for setting of acceptable boundaries or target point for each response in the absence of standards for the selection of the acceptable optimum combination for reconstituting the rice and adlay. As a result, 49 solutions of optimum points were found and established, but only several points were chosen as optimum points on condition that it satisfied the criteria mentioned. The optimum values obtained specifically for the rice variety with low, intermediate, and high amylose content were rice-adlay mixture of 1: 0.9, moisture content of 30% and processing temperature of 91°C. In addition, it would be more efficient to operate at this point considering that all these combination have almost the same mixture of rice and adlay. Then, the moisture content and gelatinization temperature were much reasonable and acceptable at tolerable level wherein nutritious component of the mixture will not much degraded during processing at this phase. Verification test showed that rice variety with intermediate amylose content, rice-adlay mixture of 1: 0.9, moisture content of 30% and processing temperature of 91°C is the best optimum combination compare to other, whereas about 7% difference of gelatinization time for compression test could be minimized for extrusion process. Meanwhile, the 250 Proceedings ASIAHORCS 2013

compression force of 19.6% difference at compression test could be attributed for extrusion process. However, the verification test showed that predicted, experimental and actual values were reasonably close for moisture content, cooking quality and physicochemical properties except for whiteness index that has 16% difference.

Conclusions The research conducted develops a technology for reconstituting broken rice and adlay. Specifically, it determined the optimum operating parameter that was controlled and modelled addressing the concepts of control stability for reconstituting broken rice and adlay. The research also established the optimum combination of the different reconstitution parameters. Physicochemical properties and cooking characteristics of these rice analog can be modified for specific applications by alteration of the different reconstitution parameters. Optimum values obtained for rice variety with low, intermediate, and high amylose content were rice-adlay mixture of 1: 0.9, mixture moisture content of 30% and 91°C gelatinization temperature. Verification test showed that predicted, experimental and actual values were reasonably close. Thus, the percentage difference on the responses for compression test could be attributed for extrusion test such as 8% processing time, 20% compression force, and 0.6% moisture content. Physicochemical and cooking properties of these rice analog can also be modified by alteration of the different reconstitution parameters.

Acknowledgement This work was supported by a grant from DOST-SEI through PCAARRD. It was reviewed and monitored by Dr. Ernesto P. Lozada, Dr. Engelbert K. Peralta, Dr. Arsenio N. Resurreccion, and Dr. Lencio C. Raymundo. Their support is gratefully acknowledged.

References Dechkunchon, M., & Thongngam, M. (2007). Chemical and physicochemical properties of adlay flours and starches.Proceedings of the 45th Kasetsart University Annual Conference, Kasetsart, 30 January-2 February, 2007. Subject: Agricultural Extension and Home Economics. 618–624. GAIN Report. (2012). Phillippines, Grain and feed annual, Grain and feed situation and outlook. Retrieved from http://gain.fas.usda.gov/Recent%20GAIN%20Publications/Grain%20 and%20Feed%20Annual_Manila_Philippines_2-13-2012.pdf. Guha, M., & Zakiuddin, A.S. (2006). Extrusion cooking of rice: Effect of amylose content and barrel temperature on product profile. Journal of Food Processing & Preservation, 30, 706–716. bioprocessing for food 251

Guy, R. (2001). Extrusion Cooking: Technologies and Applications. North and South America: Woodhead Publishing Limited. P. 206. Juliano, B. O. (1982). An international survey of methods used for evaluation of the cooking and eating qualities of milled rice. IRRI Research Paper No. 77. Juliano, B. O., & Perez, C. M. (1983). Research note: Major factors affecting cooked milled rice hardness and cooking time. Journal of Texture Studies, 14, 235–243. Juliano, B. O. (1985). Rice Chemistry and Technology. 2nd Edition. St. Paul, Minnesota, USA: American Association of Cereal Chemists. Mishra, A., Mishra, H. N., & Rao, P.S. (2012). Preparation of rice analogues using extrusion. International Journal of Food Science and Technology, 47 (9), 1789–1797. Sadeghi, M., Araghi, H. A. & Hemmat A. (2010). Physico-mechanical properties of rough rice (Oryza Sativa L.) grain as affected by variety and moisture content.Agricultural Engineering International: CIGR Journal, 12 (3), 129–136. Tseng, Y. H., Yang, J. H., Chang, H. L., & Mau, J. L. (2004). Taste quality of monascal adlay. Journal of Agricultural and Food Chemistry, 52 (8), 2297–300.

Optimization of Dextrinization Process of Corn Starch by Means of Twin Screw Extruder Using Response Surface Method

Achmat Sarifudin1* and Alhussein M. Assiry2 1* Center for Appropriate Technology Development, Indonesian Institute of Sciences (BBPTTG-LIPI) 2Department of Agricultural Engineering, College of Food and Agricultural Sciences, King Saud University, P O Box, 2460, Riyadh 11451, Saudi Arabia

Abstract Dextrin was produced by dry acid hydrolysis (dextrinization) of corn starch at low moisture content process using twin screw extruder. Response surface method was utilized to determine the optimum operating condition for the process. Result showed that the extrusion process at low moisture content was a high energy consumption process, where the range of SME (specific mechanical energy) was 0.15 - 3.32 kW.h/kg. The optimum extrusion operating condition to produce dextrin with the highest level of DE (7.71) and lowest SME requirement (0.33 kW.h/kg) was at temperature 135°C where the screw speed was 35 rpm. Keywords: Dextrin, dextrinization, dextrose equivalent, dry acid hydrolysis, extrusion, response surface method

*Corresponding Author 1Jln. K.S. Tubun No. 5, Subang, West Java, Indonesia, Postal Code :41213. Fax: 0062-260-411239 E-mail address: [email protected]

Introduction Dextrin is widely known as a derived product of starch and is extensively used in the textile, food, brewing and pharmaceutical industries (Griffin and Brooke, 1989). Hydrolysis of starch by hydrolytic enzymes, acids or their combination produces dextrin (Fullbrook, 1984). Each procedure has its advantages and disadvantages. The use of starch hydrolytic enzyme such as amylase involves the frequent handling of starch slurries, relatively long reaction times and drying of the product output which must be employed (Linko, 1992). On the other hand, using acid hydrolysis method requires less time but an excessive amount of by-products is formed. In an industrial scale, most of the dextrin is produced using dry acid hydrolysis method in which starch is hydrolysed under low moisture conditions and high temperatures. This method is mainly chosen rather than the wet hydrolysis method because of its higher yield and it does not require drying process. The most common acid used for the dry hydrolysis reaction is the hydrochloric acid

253 254 Proceedings ASIAHORCS 2013

because of its high hydrolytic capability, low price, readily available and easiness to be removed by an evaporation process. Also, it has been reported that during a dry hydrolysis process, some amount of the hydrochloric acid is evaporated; therefore, it is not necessary to neutralize the final product (Kennedy and Fischer, 1984). Dextrinator is the general name of the equipment used to carry out the hydrolysis process either using enzymes or acids. Two models are commonly available; the first is a steam or oil jacketed kettle which uses a rotating arm to agitate the starch. This dextrinator type is known as the “Hagen” cooker. The second dextrinator model is a rotary heated drum. Continuous dextrinator model is also available, where a thin layer of acidified starch is transported using a moving belt through heated ovens at a uniform speed (Evans and Wurzburg, 1967). By using conventional dextrinization process, white dextrin can be produced in the presence of acid at low temperature range (79–120°C) in a short time (3–8 hours) and yellow dextrin can be produced at higher temperature range (150–220°C) in a longer time (8–18 hours) (Greenwood, 1967). The use of an extruder as a continuous reactor having been suggested as a novel approach to overcome many drawbacks of the conventional hydrolysis method (Govindasamy et al., 1997). The extrusion technology uses a combination of high-temperature, compression and shear stress in order to produce a product in a short-time with the advantage of high flexibility and the absence of effluents (Harper, 1992). A number of researchers (Likimani et al., 1991; Roussel et al., 1991; Grafelman and Meagher, 1995; Govindasamy et al., 1997; Baks et al., 2008) have investigated several extrusion methods in pre-gelatinization, liquefaction and hydrolysis of starches using enzymes as hydrolytic catalysing agents. In our previous researches, we studied the effect of extrusion on the dextrinization of acidified corn starch process. It has been reported that the extrusion process can be used to produce dextrin (Sarifudin, 2012). In this present study, we specifically study the use of response surface method to find the optimum condition of the dextrinization process.

Materials and Methods Materials. Corn starch with grade for food was purchased from ARASCO Ltd-Saudi Arabia, and used in this study. The hydrolysis process was catalysed by hydrochloric acid (HCl) (Panreac Quimica, Spain). All reagents used in the determination of dextrose equivalent (DE) were analytical grade. The standard for the reducing sugar (dextrose) was D (+) glucose anhydrous (Avonchem Inc. Cheshire-UK). Feed preparation. Corn starch powder was mixed thoroughly with HCl (0.2 M) in ratio of 2 starch : 1 acid using dough mixer (Tian Shuai–Taiwan, model bioprocessing for food 255

TS-201) for 20 min at 110 rpm. The mixture was equilibrated at room temperature for 48 hours as thin layers of 1 cm thickness on trays. The moisture content of the feed material was 11.26 ± 0.19%. After the equilibration process, the size of feed material was uniformed by grinding (Lab Size Disc Mill, Type DFH-48, Glen Creston, Stanmore-England) and sieved by a 200 μm pore mesh. Prior to extrusion process, the feed was stored at 4°C in sealed plastic bags. Extrusion process. A co-rotating twin screw extruder (Model ZPT-32HT Zenix Industrial Co., Ltd.,Taiwan) was used to dextrinize the acidified corn starch. The extruder screw was 32 mm in diameter and the die plate was not mounted since the extruder was used as a continuous reactor to accomplish the roasting process. Each screw shaft was configured by the two right hand screw type elements where each screw type has a different pitch and length. The screw elements arrangement can be illustrated by Figure 1. The barrel length was 110 cm and consisted of ten sections where each section was 11 cm long. The temperature of each section was controlled using a heating and cooling system. Heating was provided by electrical induction heater elements and steady state temperature was maintained by circulating cooling water which passes through the barrel. The temperature of each section was controlled and monitored using a digital control panel. The extruder was driven by a direct current motor (model LSK 114 VL21-Leroy Somer-French) coupled with a speed reducer (Model Zambello2-Lendinara-Italy) with a ratio of 3:1. The screw speed was controlled and the loading ampere was monitored.

Figure 1. (i) Photo of the twin screws used in this study, (ii) illustration of the arrangement of the screw elements, not to scale, *screw element pitch (mm)/length (mm). 256 Proceedings ASIAHORCS 2013

Preliminary experiments were conducted to identify the suitable range of the operating condition of the extruder. Based on that, three extrusion temperatures (125, 130, and 135°C) and five different screw speeds (35, 45, 55, 65 and 70 rpm) were selected as operating condition in the dextrinization process. A steady state of extrusion temperature was achieved when the difference between the set temperature value and the real temperature of the material before the exit from the extruder was ± 1°C over 10 minutes of operation. A constant feeding rate was attained and maintained at 32.56 ± 0.53 gm/min using a twin screw feeder. Dextrose equivalent (DE). Three samples were collected in plastic containers for DE analysis from the extruder. The samples were milled by an electrical grinder (Moulinex-France) and sieved using a 200 μm powder siever. Prior to the DE analysis, the samples were kept in a tightly sealed container and stored at 4°C. DE was assessed by a spectrophotometric method (modification of Nelson-Somogyi method) (Apriyantono et al., 1989) using a spectrophotometer (UV/Vis spectrophotometer UNICO SQ-2800, Dayton, USA) at λ 529 nm. The moisture levels were confirmed for the determination of dry substance of samples by oven drying method (AOAC International, 2011). The DE was calculated by the following equation:

The DE analysis was performed in triplicate and the average and standard deviation was reported. Specific mechanical energy S( ME). SME is defined as the total input of mechanical energy per unit mass of the outcome product (Guan and Hanna, 2006). The extruder was calibrated under unloading condition to obtain the calibration factor (α). Under steady state conditions, the SME was calculated using the following equation (Su and Kong, 2007):

Where SME = specific mechanical energy [kW.h/kg] α = calibration constant [0.0049 rpm-1] I = extruder loading at a certain operating condition [ampere] V= voltage input of extruder motor [380 Volt] n = screw speed [rpm] m& out = mean of mass flow rate [kg/h]. bioprocessing for food 257

Experimental design and statistical analysis. Preliminary experiments were conducted to identify the suitable range of roasting temperatures and screw speeds. It was noticed by DE analysis that the starch hydrolysis was not detected at any temperatures less than 120°C and screw speed less than 25 rpm. On the other hand, at roasting temperatures beyond 140°C and screw speed of 50 rpm, melting occurred and some glossy brown agglomerates were formed during the extrusion process. Investigation on the DE value of the melted material from the extrusion at a temperature of 140°C showed that the DE value was 2.91±0.38 which was lower than the DE at 135°C. These preliminary results suggested that starch hydrolysis using acid as a hydrolytic agent and roasted by extrusion only occurred in a narrow temperature range. Thus, the primary experiment treatments included three levels of roasting temperatures (125, 130, and 135°C) and five different screw speeds (35, 45, 55, 65 and 70 rpm). A full factorial experimental design was performed to evaluate the effect of different treatments on DE, tm, and SME. Analysis of variance (ANOVAs) was carried out to analyse the obtained data using SAS 9.1.3 Service Pack 4 (SAS Institute Inc., Cary, USA), in order to determine the variance differences between the parameters. Tukey multiple range tests were performed for further statistical analysis to determine the significance level between the different treatments. The response surface plots were generated from nonlinear regression equations by Matlab version 7.9.0.529-R2009b (The MathworksTM). The regression equations derived from general regression model from SPSS 11.0 (SPSS. 2001. SPSS Statistical Package for Windows Ver.11.0. Chicago: SPSS, Inc.) was employed to find the optimum extrusion operating condition (screw speed and roasting temperature) using parameter of dependent variables (DE and SME). The general regression model used was:

where Y is the response, n is the screw speed and T is the extrusion temperature.

Results and Discussion Dextrinization of corn starch. As a product of hydrolysed starch, the amount of dextrin is quantified by its dextrose equivalent (DE) value, which can be used as an indicator of the degree of hydrolysis. During starch hydrolysis several degraded starch products are formed such as dextrin, olygomer and glucose (Garard, 1976). 258 Proceedings ASIAHORCS 2013

The DE value of pure glucose is 100 which represent a complete transformation of raw starch to dextrose (i.e. D-glucose), while the DE value of pure maltose is about 50. As emphasized by Zapsalis and Beck (1986), DE can be used to quantify the amount of degraded starch which represents the amount of starch that has been cleaved by mechanical action and heat treatment. The DE values listed in Table 1 indicate that the extrusion process was effective to hydrolyse starch. It can be observed that the DE of the feed was 0.25; meanwhile the DE range of the treated samples was 0.21–8.48. It should be noticed that the DE of the feed was not significantly different from that of the extrudates at the lowest screw speed (35 rpm) and temperature (125°C). This was probably due to the mechanical and thermal energies (attributed to the shear forces and temperature effects) at this operating condition which were not enough to break the starch granules. It was reported by Lai and Kokini (1990) that during an extrusion process, gelatinization, melting and fragmentation occurred when starches were subjected to high temperatures and shear forces; thereby forming smaller starch components. Results showed that the extrusion process can be applied to accomplish hydrolysis reaction and can be an alternative method to produce dextrin in a continuous process. Conventionally, dextrin is produced in a batch reactor where acidified starch is roasted in a heated stainless steel vessel. The vessel is equipped with an agitator and the setting temperature is in the range of 110–120°C for 2 to 4 hours. Handoko (2004) reported that dextrin with DE value of 4.44 was obtained from conventional dry hydrolysis method using feed which was made from a mix of hydrochloric acid (0.04 M) with starch at a ratio of 2:3 respectively, where the roasting temperature was 110°C and the heating time was 50 min.

Table 1. The average and standard deviation of DE as affected by screw speed (n) and roasting temperature (T). Parameter T n [rpm] [˚C] Feed 35.2 ± 0.3 44.9 ± 0.2 55.1 ± 0.2 64.8 ± 0.5 70.3 ± 0.3 DE - 0.25 ± - - - - - 0.00a 125.5 ± 0.21 ± 2.75 ± 3.75 ± 3.88 ± 5.40 ± - 0.8 0.18a 0.26bc 0.58def 0.44dgh 1.33i 130.3 ± 2.78 ± 3.54 ± 5.41 ± - 1.50 ± 0.91j 4.30 ± 1.07fl 0.6 0.66bk 0.60ceghkl 0.98i 134.7 ± 7.71 ± 7.00 ± 8.48 ± 8.29 ± - 6.76 ± 0.71p 0.6 1.29mno 0.93mp 1.04nq 1.27oq

*values followed by same letter are not statistically different (p > 0.05) in both direction either rows or columns for each parameter. bioprocessing for food 259

Based on the DE values, the dextrin obtained in this study was comparable to that reported by other investigators although they used a combination of extrusion and enzymes to hydrolyse starch. For example, it has been reported that the DE range was 3.5–4.5 for barley extrudates (Linko et al., 1983), 2.7–6.4 for corn-soybean extrudates (Likimani et al., 1991) and 0.3–10.4 for sago starch extrudates (Govindasamy et al., 1997). According to Zapsalis and Beck (1986) the hydrolysed starch having DE ≥ 20 is classified as glucose syrups when post hydrolysis starch products are purified and concentrated. Since the DE values of the dextrin obtained in this study were less than 10, it can be classified as low DE dextrin products. It has been reported that low DE dextrins can be used as vehicles for carrying flavors since they have a little taste while offering an increase on the cohesiveness and thickness to several flavors and other foodstuffs (Zapsalis and Beck, 1986). Goldberg and Williams (1991) classified the usage of low DE dextrins as follows: dextrin with DE values ranging from 1 to 5 can be used as fillers in milk or fat based product such as yoghurt, ice cream and margarine, while dextrin with DE values in the range of 9 to 12 can be used in sugar free cheesecake filling products. The DE of the dextrin obtained by the extrusion process was significantly affected by both temperature and screw speed (Table 1). Specifically at temperatures of 125 and 130°C, increasing the screw speed resulted in an increase on the DE values. Increasing the screw speed represents a higher shear rate which causes more shear forces resulting in a higher degradation of the starch. Similar phenomenon was reported by Lai and Kokini (1990) where they observed that increasing the screw speed increased the effect of shear forces between the sample and screw; hence long chain of starch polymer can be fragmented into shorter chains. It was noticed that at high temperature (135°C) increasing the screw speed from 35 to 70 rpm resulted in a little increase in the DE values, however at temperatures of 125 and 130°C, the effect of screw speed was more significant. On other words, the effect of shear forces at the high temperature (135°C) was less than that at low temperatures (125 and 130°C). The statistical analysis also indicated that increasing the temperature from 125 to 130°C at some screw speeds treatments did not significantly affect the DE values. Generally, it can be stated that both temperatures (125 and 130°C) gave almost similar thermal degradation effects on the starch. Increasing the temperature from 125 to 135°C resulted in a significant increase in the DE values. This indicates that temperature of 135°C was effective in the dextrinization of starch using the extrusion process. As previously reported that during preliminary experiments, the feed extrusion at roasting temperature of 140°C and screw speed of 50 rpm resulted in low DE (2.91 ± 0.38) where it was lower than the DE at temperature of 135°C. This could be due to repolymerization process at higher temperatures (above 135°C). It has been reported 260 Proceedings ASIAHORCS 2013

by Tomasik (1989) that during dextrinization process, the amount of reducing sugar increases as the temperature increases to reach a maximum value at a certain temperature then decreases as the temperature increases further. Moreover, Evans and Wurzburg (1967) reported that the reducing sugar content of the dextrin at a higher temperature decreased due to a complex repolymerisation reaction of low molecular weight compounds. The maximum temperature in which the highest DE dextrin can be produceding depend on the method of dextrinization (Evans and Wurzburg, 1967).

Table 2. The regression models for DE, tm and SME based on the independent variables: screw speed (n) and roasting temperature (T). Dependent Coefficient Sig. Independent variables* R2 variable DE Intercept 307.46 0.001 0.82 T3 3.16 x 10-4 0.000 n3 1.46 x 10-4 0.008 T2 -0.59 x 10-1 0.000 T . n3 -1.04 x 10-6 0.013

* units of n and T are rpm and°C, respectively.

The effect of temperature and screw speed on the DE value can be predicted by the empirical relation as shown in Table 2. Figure 2 illustrates the effect of both screw speed and temperature on the DE value where the DE increased as both the screw speed and temperature were increased. During the extrusion process, specifically at low roasting temperature; it can be seen clearly that the increase of DE was more affected by the increase of screw speed. As the temperature increased, the effect of screw speed on the DE value was proportional to the temperature. The figure suggested that higher DE can be obtained by increasing both the screw speed and temperature; however, energy consumption must be taken into consideration when choosing the most suitable operating conditions for dextrin production as discussed in the next section. Specific mechanical energy (SME). The SME is an important factor to evaluate the extrusion process in terms of the operating cost to produce a unit mass of a certain product. Both shear forces and thermal energy may break down the long chain molecules of starch to obtain new shorter chain molecules (Miladinov and Hanna, 1999). The required SME for dextrinization of starch at different operating condition is shown in Table 3. It indicates that the extrusion process was a high energy consumption process. The range of the SME was 0.15–3.32 kWh/kg. The lowest SME occurred at the lowest screw speed and temperature. By increasing the screw bioprocessing for food 261

Figure 2. Effect of screw speed and roasting temperature on the DE value.

Table 3. The average and standard deviation of SME as affected by screw speed (n) and roasting temperature (T). Parameter T n [rpm] [˚C] Feed 35.2±0.3 44.9±0.2 55.1±0.2 64.8±0.5 70.3±0.3 SME 125.5±0.8 - 0.15±0.02ab 0.29±0.02acde 0.76±0.04f 1.19±0.08g 2.13±0.08h [kW.h/kg] 130.3±0.6 - 0.20±0.05bci 0.43±0.07dj 0.95±0.04k 1.73±0.15l 2.30±0.17m 134.7±0.6 - 0.33±0.04eij 0.64±0.02f 1.10±0.08gk 1.85±0.09l 3.32±0.20n

*values followed by same letter are not statistically different (p > 0.05) in both direction either rows or columns for each parameter. speed and temperature, the SME increased drastically and reached the highest level at the highest screw speed and highest roasting temperature. Generally, extruding feed with high moisture content requires lower SME because water acts as a lubricating and plasticizing agent, therefore the viscosity and mechanical energy dissipation during extrusion are reduced (Ilo et al., 1996). For the purpose of comparison, Akdogan (1996) reported that the extrusion of rice starch which had moisture content of 57, 60 and 65% w.b. at screw speed of 275 rpm and temperature of 90°C required 0.07, 0.038, and 0.039 kW.h/kg, respectively. Seker and Hanna (2005) reported an increase of moisture content from 40 to 70% reducing the SME from 0.773 to 0.347 kW.h/kg during the extrusion of blend starch, NaOH, and SMTP at screw speed of 140 rpm and temperature of 95°C. Also, low SME range (0.0879–0.115 kW.h/kg) was reported by Meng et al., (2010) who extruded chickpea flour based snack product which had moisture contents of 16–18%. Akdogan (1996) emphasized that at the same temperature, a decrease on the moisture content could be attributed to a higher SME. In addition to that, higher moisture content corresponds to a lower melt viscosity hence less 262 Proceedings ASIAHORCS 2013

torque is required to work the material in the screw channels. Therefore, it can be stated that dextrinization of acidified corn starch at low moisture content required higher SME if compared with other extrusion processes. Statistical analysis indicated that the SME was significantly affected by the screw speed and temperature during the extrusion process as shown in Table 3 (p ≤ 0.05). The SME was more noticeable at the highest screw speed. Actually increasing the screw speed was attributed to a higher SME as reported by Guan and Hanna (2006), Akdogan (1996) and Seker and Hanna (2005). Also, Table 3 shows that the SME increased as the temperature increased. During the extrusion process, it was observed that at screw speed of 70 rpm and roasting temperature of 135°C, some glossy brown agglomerates were noticed in the extrudates. This can be an indication of a repolymerization process where the long starch polymer chain was fragmented due to high shear forces (high SME) and high temperature and then some of the material that spent more time in the extruder melted and started to re-polymerize again. In general, a similar phenomenon was mentioned by Likimani et al., (1991) where the SME increased with an increase in the barrel temperature when a mix of corn-soybean flour was extruded in the presence of amylase enzyme.

Table 4. The regression models for DE, tm and SME based on the independent variables: screw speed (n) and roasting temperature (T). Dependent variable Independent variables* Coefficient Sig. R2 SME Intercept 0.695 0.000 0.95 [kW.h/kg] T3 . n3 0.90 x 10-11 0.000 T . n2 -0.8 x 10-5 0.000

* units of n and T are rpm and°C, respectively.

A high regression correlation (R2 = 0.95) was obtained for the model of SME as affected by the screw speed and roasting temperature (Table 4). The surface response plot (Figure 3) illustrates the effect of both screw speed and temperature on the SME, where the effect of temperature on the SME was more pronounced at the high screw speed. The effect of SME on the degradation of starch is shown in Figure 4. The mechanical energy applied to the starch during the extrusion process broke down the starch granules. This was indicated by increasing of the DE values as the SME increased. This phenomenon was also reported by Xie et al., (2006) who observed that an exponential decrease in the molecular weight of starch when the specific mechanical energy input was increased. Figure 4 also shows that at a high temperature (135°C), the SME did not significantly affect the DE, but the DE was more affected by increasing the temperature from 130 to 135°C. bioprocessing for food 263

Figure 3. Effect of screw speed and temperature on the SME requirement during extrusion process.

Figure 4. Effect of specific mechanical energy on the dextrose equivalent of dextrin during extrusion process, vertical and horizontal error bars represent 95% confidence interval.

Optimum extrusion operating condition. To summarize the effects of operating conditions on the DE, the extrusion parameters including the screw speed and SME on the dextrinization of acidified corn starch process at the best operating temperature (135°C) are presented in Figure 5. At this temperature, the SME increased significantly; however, the DE was not significantly changed in most cases. Therefore, the lowest screw speed (35 rpm) and highest temperature (135°C) can be considered as the most suitable operating condition to produce a high level DE dextrin (7.71) with low SME requirement (0.33 kW.h/kg). It should be noticed that these experiments were performed at a pilot scale; therefore for 264 Proceedings ASIAHORCS 2013

further study these results could be utilized in techno economic feasibility study for industrial scale up and cost analysis.

Figure 5. Extrusion parameters at the best operating temperature (135°C) as related to the dextrose equivalent of dextrin during extrusion process.

Conclusions The DE increased as the screw speed and temperature were increased. High SME requirement indicated that there were high shear forces contributed to the degradation of starch. The most suitable extrusion operating condition was obtained at a screw speed of 35 rpm and roasting temperature of 135°C, where the SME was 0.33 ± 0.04 kW.h/kg and the DE was 7.71 ± 1.29. The work might be extended to obtain higher DE values using a multistep extrusion method to get a longer roasting time. Further studies are recommended regarding the high requirement of specific mechanical energy using two different approaches. First, extrusion conducted using different screw type and arrangement and second, the extrusion might be performed at higher moisture content of the feed with higher acid concentration.

References Akdogan, H. (1996). Pressure, torque, and energy responses of twin screw extruder at high moisture content. Food Research International, 29 (5–6), 423-429. AOAC International. (2011). Official Methods of Analysis of AOAC (Association of Official Agricultural Chemist) International. 18th edition, 2005, 4th revision 2011. Gaithersburg, MD, USA: Association of Analytical Communities. bioprocessing for food 265

Apriyantono, A., Fardiaz, D., Puspitasari, N. L., Yasni S., & Budiyanto, S. (1989). Practical guidelines for food analysis. Center of Collaboration Research for Food and Nutrients, Bogor Agricultural University, Indonesia. Baks, T., Kappen, F. H. J., Janssen, A. E. M., & Boom, R. M. (2008). Towards an optimal process for gelatinization and hydrolysis of highly concentrated starch-water mixture with alpha-amylase from B. licheniformis. Journal of Cereal Science, 47, 214–255. Evans, R. B., & Wurzburg, O. B. (1967). Production and use of starch dextrin. In Wistler, R. L. & Paschall, E. F. (Eds.), Starch: Chemistry and technology (Chapter 11, pp. 254–276). London: Academic Press. Fullbrook, P. D. (1984). The enzymatic production of glucose syrups. In Dziedzic, S. Z. & Kearsley, M. W. (Eds.), Glucose Syrups: Science and Technology (Chapter 2, pp. 65–115). London: Elsevier Applied Science Publishers. Garard, I. D. (1976). The Introductory of Food Chemistry. Wesport: The AVI Publishing Company Inc. Goldberg, I. & Williams, R. (1991). Biotechnology and Food Ingredients (pp. 336-346). New York, USA: Van Nostrand Reinhold. Govindasamy, S., Campanella, O. H., & Oates, C. G. (1997). The single screw extruder as a bioreactor for sago starch hydrolysis. Journal of Food Chemistry, 60 (1), 1–11. Grafelman, D. D., & Meagher, M. M. (1995). Liquefaction of starch by single-screw extruder and post-extrusion static-mixer reactor. Journal of Food Engineering, 24, 529–542. Greenwood, C. T. (1967). The thermal degradation of starch.Advances in Carbohydrate Chemistry, 22, 483–515. Griffin, V. K. & Brooke, J. R. (1989). Production and size distribution of rice maltodextrins hydrolyzed from mille rice flour using heat-stable alpha-amylase. Journal of Food Science, 54, 19–193. Guan, J., & Hanna, M. A. (2006). Selected morphological and functional properties of extruded acetylated starch-cellulose foams. Bioresource Technology, 97, 1716–1726. Handoko, D. D. (2004). Study of water sorption isothermis of dextrin produced from Maranta arundinaceae at different hydrolysis level. Graduate student thesis (unpublished). Bogor Agricultural University, Bogor, Indonesia. Harper, J. (1992). Extrusion processing of starch. In Alexander, R. J., Zobel, H. F. (Eds.), Develop- ments in Carbohydrate Chemistry. A.A.C.C., USA. Ilo, S., Tomschik, U., Berghofer, E., & Mundigler, N. (1996). The effect of extrusion operating conditions on the apparent viscosity and the properties of extrudates in twin-screw extrusion cooking of maize grits. Lebensmittel-Wissenschaft und-Technologie, 29, 593–598. Kennedy, H. M., & Fischer, A. C. (1984). Starch and dextrin in prepared adhesives. In Whistler, R. L., Bemiller, J. N., & Paschall, E. F (Eds.), Starch: chemistry and technology. Orlando: Academic Press. Lai, L. S., & Kokini, J. L. (1990). The effects of extrusion operating conditions on the online apparent viscosity of 98% amylopectin (Amioca) and 70% amylose (Hylon 7) corn starches during extrusion. Journal of Rheology, 34 (8), 1245–1266. Likimani, T. A., Sofos, J. N., Maga, J. A., & Harper, J. M. (1991). Extrusion cooking of corn/ soybean mix in presence of thermostable α-amylase. Journal of Food Science, 56 (l), 99–108. 266 Proceedings ASIAHORCS 2013

Linko, P., Hakulin, S. & Linko, Y. Y. (1983). Extrusion cooking of barley starch for the production of glucose syrup and ethanol. Journal of Cereal Science, 1, 275–284. Linko, P. (1992). Twin screw extrusion cooker as a bioreactor for starch processing. In Kokini, J. L., Chi-Tang Ho, and Karwe, M. V. (Eds.), Food Extrusion Science and Technology. Meng, X., Threinen, D., Hansen, M., & Driedger, D. (2010). Effects of extrusion conditions on system parameters and physical properties of a chickpea flour-based snack. Food Research International, 43, 650–658. Miladinov, V. D., & Hanna, M. A. (1999). Physical and molecular properties of starch acetates extruded with water and ethanol. Industrial Engineering Chemical Research, 38 (10), 3892–3897. Roussel, L., Vieille, A., Billet, I., & Cheftel, J. C. (1991). Sequential heat gelatinisation and enzymatic hydrolysis of corn starch in an extrusion reactor. Optimisation for a maximum dextrose. Lebensmittel-Wissenschaft und-Technologie, 24, 449-457. Sarifudin, A. (2012). Effect of Reactive Extrusion Process on Starch Hydrolysis for Production of Dextrin Nano Particles. M.Sc. Thesis, King Saud University, Riyadh, Kingdom of Saudi Arabia, Chapter 2, pp. 7–37. Seker, M., & Hanna, M. A. (2005). Cross-linking starch at various moisture contents by phosphate substitution in an extruder. Carbohydrate Polymers, 59, 541–544. Su, C. W., & Kong, M. S. (2007). Effects of soybean oil, cellulose, and SiO2 addition on the lubrication and product properties of rice extrusion. Journal of Food Engineering, 78, 723–729. Tomasik, P. (1989). The thermal decomposition of carbohydrates. Advance of Carbohydrate Chemistry and Biochemistry, 47, 279–343. Xie, F., Yu, L., Liu, H., & Chen, L. (2006). Starch modification using reactive extrusion.Starch/ Stärke, 58 (3-4), 131-139. Zapsalis, C., & Beck, R. A. (1986). Food Chemistry and Nutritional Biochemistry (Chapter 6, pp. 351–355). Canada: John Wiley and Sons. Development of a Dispersive Liquid-liquid Microextraction Method for the Spectrophotometric Determination of Nickel in Food Samples

Shuo Wang*, Jiale Li, Junping Wang Key Laboratory of Food Nutrition and Safety, Ministry of Education of China, Tianjin University of Science & Technology, Tianjin 300457, China

Abstract Dispersive liquid-liquid microextraction (DLLME) technique combined with ultraviolet-visible spectrophotometry for the preconcentration and determination of nickel in food samples was developed. 2-(5-Bromo-2-pyridylazo)-5-(diethylamino) phenol (Br-PADAP), carbon tetrachloride and ethanol were used as chelating agent, extraction solvent and disperser solvent, respectively. Some important DLLME parameters such as the volume of extraction and disperser solvent, pH, concentration of Br-PADAP, and extraction time were investigated in detail. Under the optimized conditions, the calibration graph for nickel was linear from 1 to 30 ng mL−1 with a correlation coefficient of 0.9974. The limit of detection was 0.3 ng mL−1 and the relative standard deviation (n = 7, for 20 ng mL−1 of nickel) was 3.2%. The proposed method was successfully applied to the determination of trace amounts of nickel in food samples. Keywords: Nickel, dispersive liquid-liquid microextraction, Br-PADAP, ultraviolet-visible spectrophotometry, food samples

*Corresponding Author Tianjin 300457, China E-mail: [email protected]

Introduction Due to its unique physical and chemical properties, metallic nickel and its compounds are widely used in many industries and catalytic processes, and it has widespread occurrence in various effluents [1, 2]. Nickel is considered to be essential for plants and some domestic animals, being the component of the enzyme urease and five other important enzymes [3, 4]. Though nickel is a moderately toxic element as compared with other transition metals, it can lead to serious problems, including respiratory system cancer, skin allergies, variable degrees of kidney and cardiovascular system poisoning and stimulation of neoplastic transformation [1, 5]. Foods have been found to be the main source of nickel intake by man [5]. Contamination of crops can occur through deposition of nickel from the atmosphere or through uptake of nickel from soils contaminated by nickel. Some food could be contaminated by nickel during processing, due to the constant contact with stainless steel processing equipment and nickel

267 268 Proceedings ASIAHORCS 2013

based catalysts employed in the hydrogenation of edible fats [6]. Therefore, from public health of view, it is important to develop a simple and sensitive method for monitoring the concentration of nickel in food samples. However, the direct determination of nickel in food samples is usually difficult due to the very low concentration of nickel and the matrix interferences. Therefore, previous preconcentration of the analyte and matrix separation is often necessary. The widely used techniques for the separation and preconcentration of nickel include liquid-liquid extraction (LLE) [7, 8], solid phase extraction (SPE) [9-12] ，cloud point extraction (CPE) [3, 13, 14] and liquid phase microextraction (LPME) [15-17]. Recently, a novel miniaturized sample pre-treatment techniques named dispersive liquid-liquid microextraction (DLLME) was introduced by Assadi and his co-workers in 2006 [18]. In this method, an appropriate mixture of extraction solvent and disperser solvent is injected into an aqueous sample rapidly by syringe, and a cloudy solution is formed, which is consisted of fine droplets of the extraction solvent, dispersed throughout the aqueous solution. The analyte in the sample solution is extracted into the fine droplets of extraction solvent. After extraction, phase separation is performed by centrifugation, and the enriched analyte in the sediment phase is determined by chromatography or spectrometry methods [19]. It exhibits high performance such as simple, rapid, inexpensive as well as high concentrating ability and low consumption of toxic organic reagents [20]. DLLME has been successfully combined with FAAS [21-23], ETAAS [19, 24, 25], ICP-MS [20, 26, 27], ICP-OES [28-30], spectrofluorometry [31] and UV-VIS spectrophotometry [32, 33] for the preconcentration and determination of metal ions. As spectrophotometry has the advantages of using low cost and very common instruments and the simplicity of operation. It is more appropriate for monitoring purposes than AAS and ICP-based techniques [34, 35]. The aim of this work is to combine DLLME with UV-VIS spectrophotometry and develop a new method for the determination of nickel. In the proposed method, 2-(5-Bromo-2-pyridylazo)-5-(diethylamino) phenol (Br-PADAP), which reacts with nickel ions to give in general ML2 complex with high molar absorptivity and relatively large bathochromic shift [2], was selected as chelating reagent. Several factors such as the type and volume of extraction and disperser solvent, pH, the amount of chelating reagent, the extraction time and salt effect were investigated. The established method was successfully applied to the determination of trace amount of nickel in food samples.

Materials and Methods Apparatus. A Cary 50 UV-Visible Spectrophotometer (Varian Australia Pty. Ltd., Australia) with a 500 μL quartz cell was used to record the spectra or measure the absorbance of the complex at 565 nm. A model 5804 R centrifuge (Eppendorf bioprocessing for food 269

AG, Germany) with 15mL calibrated centrifuge tubes was used to accelerate the phase separation process. The pH values were controlled with a model FE20 pH meter (Mettler Toledo Instruments Co., Ltd, China). Reagents and solution. All of the chemicals used in the experiment were of analytical reagent grade. The ultra pure water (18.2 MΩ cm-1) used throughout the experiment was prepared by Milli-Q system (Millipore Corporation, USA). All of the glassware were cleaned by soaking in 10% (v/v) HNO3 at least for 24 h and subsequently rinsed three times with ultra pure water. Stock standard solution of Ni (1000 μg mL−1) and certified reference materials (GBW10052 Tea-leaves and GBW10024 Shellfish) were obtained from the National Institute of Standards (Beijing, China). Working standard solutions were obtained by appropriate dilution of the stock standard solution. The solution of Br-PADAP was prepared by dissolving appropriate amount of Br-PADAP (TCI Shanghai Development Co., Ltd., China) in ethanol, 1.0 mol L-1 acetate buffer solutions and 1.0 mol L-1 phosphate buffer solutions were used in the pH range of 3.0–6.0 and 6.5–8.0, respectively. Dispersive liquid-liquid microextraction procedure. At first, 10 mL of the sample solution containing Ni2+, adjusted to pH 5.5 using acetate/acetic acid buffer was placed in a 15 mL centrifuge tube with a conical bottom. Then 30 μL of Br-PADAP (10−3 mol L−1) solution as chelating agent was added into the sample solution. The contents in the tube were mixed well and left to stand for about 1 min, allowing pink complex of Ni-Br-PADAP to form. 1.2 mL of ethanol (disperser solvent) containing 100 μL of carbon tetrachloride (extraction solvent) was injected rapidly into the sample solution using a 2.0 mL syringe. A cloudy solution was rapidly produced, resulting in fine droplets of carbon tetrachloride, and the coloured Ni-Br-PADAP product was extracted into these fine droplets. The mixture was then centrifuged for 3 min at 3500 rpm and the dispersed fine droplets were deposited at the bottom of the test tube (about 70 μL). After removing the whole aqueous solution, the remained organic phase was diluted to 300 μL with ethanol and transferred to a 500 μL cell. The absorbance was measured at 565 nm against a reagent blank. Sample preparation. As 0.1 to 1.0 gram of real sample or certified reference materials was weighed and transferred into a beaker. Furthermore, 8 mL of concentrated nitric acid and 2 mL of concentrated perchloric acid was added. The mixture was heated on a hot plate at about 180°C until the solution becomes transparent, continuously evaporated near to dryness. After adjusting the pH of the residues to 5.5, the solution was made up to 25 mL with acetate/acetic acid buffer. The same procedure was applied for a blank. 270 Proceedings ASIAHORCS 2013

Results and Discussion Selection of the extraction and disperser solvent. The selection of an appropriate extraction solvent is important for DLLME. It should have higher density than water, high extraction capability of the interested compounds and low solubility in water. According to these considerations, dichloromethane (CH2Cl2), chloroform (CHCl3), carbon tetrachloride (CCl4), and tetrachloroethylene (C2Cl4) were investigated as extraction solvent. For the DLLME method, disperser solvent should be miscible with both water and extraction solvent. Therefore, methanol, ethanol, acetonitrile and acetone were tested as disperser solvent. In this study, all combinations of CH2Cl2, CHCl3, CCl4 and C2Cl4 as extraction solvent and methanol, ethanol, acetonitrile, and acetone as disperser solvent were tested. It was found that the sediment phase could not be observed with dichloromethane as the extraction solvent, while a two-phase system was formed in all other combinations. The results (Figure 1) revealed that higher signal was observed in the case of carbon tetrachloride with ethanol. Therefore, carbon tetrachloride and ethanol were selected as extraction and disperser solvent, respectively.

Figure 1. Selection of the extraction and disperser solvent. DLLME conditions: Ni, 20 ng mL-1; pH, 5.5; extraction solvent volume, 100 μL; disperser solvent volume, 1.2 mL; Br-PADAP concentration, 3.0 μmol L-1.

Effect of volume of the extraction and disperser solvent. In order to evaluate the effect of the extraction solvent volume on the absorbance, solutions containing different volumes of carbon tetrachloride were subjected to the same DLLME procedure. Figure 2 showed that the absorbance increased by increasing the volume of the carbon tetrachloride from 20 to 90 μL and then remained approximately constant by further increasing of its volume between 90 and 150 μL. Therefore, in subsequent experiments, 100 μL carbon tetrachloride was chosen. bioprocessing for food 271

Figure 2. Effect of volume of the extraction and disperser solvent on the absorbance. DLLME conditions: Ni, 20 ng mL-1; pH, 5.5; Br-PADAP concentration, 3.0 μmol L-1.

To examine the effect of the disperser solvent volume, solutions containing different volumes of ethanol were subjected to the same DLLME procedure. As shown in Figure 2, the absorbance increased and then decreased with the increasing of the volume of ethanol, and highest signal was observed when 1.2 mL ethanol was used. It appears that, at low volume, ethanol could not disperse carbon tetrachloride properly and the formation of a cloudy state was not complete. While at higher ethanol volumes than 1.2 mL, the solubility of Ni-Br-PADAP complex seems to increase in water and, consequently, the absorbance decreased due to the extraction efficiency for the complex into the organic phase decreases. Thus, in order to obtain a stable cloudy solution, as well as to achieve higher absorbance, 1.2 mL ethanol was selected as the optimum volume. Effect of pH.The acidity of sample solution influences the formation and stability of Ni-Br-PADAP complex and its subsequent extraction into organic phase. The effect of pH on the DLLME extraction of Ni was studied in the pH range of 3.0 to 8.0. As shown in Figure 3, the absorbance of the extracted complex was higher in the range from pH 4.5 to 6.0. The reduced analytical signal at lower pH values could be due to protonation of the ligand, preventing its reaction with Ni and the pH values higher than 8.0 which were not examined because hydrolysis of Ni may occur, which results in lowering its interaction with the ligand [2, 36]. For further study, a pH of 5.5 was chosen. Interferences. To study the effect of interfering ions, 10.0 mL solution contained 20 ng mL−1 Ni and various amounts of interfering ions were treated according to the DLLME procedure. An ion was considered to interfere when its presence produced a variation in the absorbance higher than 5%. Tolerable ratios of foreign 272 Proceedings ASIAHORCS 2013

ions during the determination of 20 ng mL−1 Ni were showed in Table 1. Fe3+ and Cu2+ interfered during the determination of Ni more than the others. The interfering effects can be eliminated by using 2% (v/v) of acetylacetone for Fe3+ and 1% (w/v) thiourea for Cu2+ ions.

Figure 3. Effect of pH on the absorbance. DLLME conditions: Ni, 20 ng mL-1; extraction solvent (CCl4) volume, 100 μL; disperser solvent (ethanol) volume, 1.2 mL; Br-PADAP concentration, 3.0 μmol L-1.

Table 1. Tolerable ratio of foreign ions in the determination of 20 ng mL−1 Ni Species Interferent-to-Ni ratio Recovery K+ 25000 99.7 Ca2+ 7500 102.4 Al3+ 5000 101.7 Cr3+ 1000 104.1 Mg2+ 1000 100.2 Pb2+ 500 103.7 Ag+ 100 101.7 Mn2+ 100 98.8 Zn2+ 100 102.9 Cd2+ 50 103.3 Hg2+ 50 102.4 Fe3+ 5 147.0 40 a 101.1 Cu2+ 1 136.1 10 b 99.0 a. In the presence of 2% (v/v) acetylacetone. b. In the presence of 1% (w/v) thiourea. bioprocessing for food 273

Analytical figures of merit. Under the optimized conditions, the analytical characteristics of the method were investigated. The calibration graph is linear in the range of 1–30 ng mL−1 of Ni with a correlation coefficient (R2) of 0.9974. The relative standard deviation (R.S.D.) for seven replicate measurements of 20 ng mL−1 Ni was 3.2%. The limit of detection, defined as CL = 3 SB/m (where CL, SB and m are the limit of detection, standard deviation of the blank and slope of the calibration graph, respectively), was 0.3 ng mL−1. Comparison of the published UV-VIS methods for Ni detection with the proposed method in this work was shown in Table 2, which showed that this method was rapid and sensitive.

Table 2. Comparison of the published UV-VIS methods for Ni detection with the method in this work Method Reagent Calibration Range LOD R.S.D. Sample Time Ref (ng mL−1) (%) volume (min) (mL) ATPE DMG 2.5 - 40 μg/25 mL - - 25 >30 [38] CPE ACDA 20 - 500 ng/mL 10 <3.6 10 >30 [39] LLE ECCT 1.2 - 5.6 μg/ml - <0.806 25 - [40] LLE PPT 0.5 - 5.0 μg/ml 69 <2.62 25 - [41] SPS o-CDAA 0.48 - 25 ng/mL 0.14 1.5 100 >20 [42] DLLME Br-PADAP 1 - 30 ng/mL 0.3 3.2 10 <5 This work ATPE, Aqueous two-phase extraction system; SPS, Solid-phase spectrophotometry; DMG: Dimethylglyoxime; ACDA: 2-amino-cyclopentene-1-dithiocarboxylic; PPT: Pyridoxal-4-phenyl-3-thiosemicarbazone; o-CDAA: o-Carboxylphenyldiazoaminoazobenzene

Determination of nickel in food samples. In order to evaluate the capability of the proposed method, the developed procedure was applied to the determination of nickel in fish, instant coffee and certified reference materials (GBW10052 Tea-leaves and GBW10024 Shellfish). Reliability was checked by spiking the sample. The analytical results were shown in Tables 3. The recovery varied within the range of 96.0% to 103.0%, showing the good performance of the method in various food samples. 274 Proceedings ASIAHORCS 2013

Table 3. Determination of nickel in different real samples Food Samples Spiked Ni (ng g-1) Found Ni (ng g-1) Recovery (%) Fish 0 336.57 ± 14.28 300 626.20 ± 28.49 96.5 600 928.48 ± 32.44 98.7 Instant coffee 0 664.02 ± 23.50 300 952.15 ± 39.94 96.0 600 1281.84 ± 47.68 103.0 CRM Certified (μg g-1) Found (μg g-1) Recovery (%)

GBW10052 Tea-leaves 5.40 ± 0.40 5.25 ± 0.23 97.2 GBW10024 Shellfish 0.290 ± 0.080 0.285 ± 0.011 98.3

Conclusions In this work, dispersive liquid-liquid microextraction has been combined with spectrophotometry for the determination of Ni in different food samples. The main advantages of this method are that it is simple, rapid, sensitive and has low consumption of toxic organic solvent. Also, in comparison with AAS and ICP-based techniques, using spectropotometry as a detection system exhibits a low primary and operational cost, which is more suitable for monitoring purposes.

References 1 Denkhaus, E., & Salnikow K. (2002). Nickel essentiality, toxicity, and carcinogenicity. Critical Reviews in Oncology/Hematology, 42 (1), 35–56. 2 Amini, M. K., Momeni-Isfahani, T., Khorasani, J. H., & , Pourhossein, M. (2004). Development of an optical chemical sensor based on 2-(5-bromo-2-pyridylazo)-5-(diethylamino)phenol in Nafion for determination of nickel ion. Talanta, 63 (3), 713&720. 3 Arpa Sahin, Ç., Efeçinar,, M. & Satiroglu N. (2010). Combination of cloud point extraction and flame atomic absorption spectrometry for preconcentration and determination of nickel and manganese ions in water and food samples. Journal of Hazardous Materials, 176 (1-3), 672–677. 4 Abdolmohammad-Zadeh, H., & Ebrahimzadeh, E. (2011). Ligandless cloud point extraction for trace nickel determination in water samples by flame atomic absorption spectrometry. Journal of the Brazilian Chemical Society, 22 (3), 517–524. 5 Yebra, M. C., Cancela, S., & Cespón, R. M. (2008). Automatic determination of nickel in foods by flame atomic absorption spectrometry. Food Chemistry, 108 (2), 774–778. 6 Smart, G. A., & , Sherlock, J. C. (1987). Nickel in foods and the diet. Food Additives and Contaminants, 4 (1), 61–71. 7 Komjarova, I., & Blust, R. (2006). Comparison of liquid-liquid extraction, solid-phase extraction and co-precipitation preconcentration methods for the determination of cadmium, copper, nickel, lead and zinc in seawater. Analytica Chimica Acta, 576 (2), 221–228. bioprocessing for food 275

8 Arain, M. B., Kazi, T. G., Jamali, M. K., Afridi, H. I., Jalbani, N., Sarfraz, R. A., Baig, J. A., Kandhro, G. A., & Memon, M. A. (2008). Time saving modified BCR sequential extraction procedure for the fraction of Cd, Cr, Cu, Ni, Pb and Zn in sediment samples of polluted lake. Journal of Hazardous Materials, 160 (1), 235–239. 9 Sadeghi, O., Tavassoli, N., Amini, M. M., Ebrahimzadeh, H., & Daei, N. (2011). Pyridine- functionalized mesoporous silica as an adsorbent material for the determination of nickel and lead in vegetables grown in close proximity by electrothermal atomic adsorption spectroscopy. Food Chemistry. 127 (1), 364–368. 10 Pourreza, N., Zolgharnein, J., Kiasat, A. R., & Dastyar, T. (2010). Silica gel-polyethylene glycol as a new adsorbent for solid phase extraction of cobalt and nickel and determination by flame atomic absorption spectrometry. Talanta, 81 (3), 773–777. 11 Tuzen M., & Soylak, M (2009) Column solid-phase extraction of nickel and silver in environmental samples prior to their flame atomic absorption spectrometric determinations. Journal of Hazardous Materials 164 (2-3), 1428–1432. 12 Tuzen, M., Soylak, M., Citak, D., Ferreira, H. S., Korn, M. G. A., & , Bezerra, M. A. (2009). A preconcentration system for determination of copper and nickel in water and food samples employing flame atomic absorption spectrometry.Journal of Hazardous Materials, 162 (2-3), 1041–1045. 13 Ghaedi, M., Shokrollahi, A., Ahmadi, F., Rajabi, H. R. & Soylak, M. (2008). Cloud point extraction for the determination of copper, nickel and cobalt ions in environmental samples by flame atomic absorption spectrometry.Journal of Hazardous Materials, 150 (3), 533–540. 14 Lemos, V. A., Santos, M. S., David, G. T., Maciel, M. V., & Bezerra, Md. A. (2008). Development of a cloud-point extraction method for copper and nickel determination in food samples. Journal of Hazardous Materials, 159 (2–3), 245–251. 15 Abulhassani, J., Manzoori, J. L., & , Amjadi, M. (2010). Hollow fiber based-liquid phase microextraction using ionic liquid solvent for preconcentration of lead and nickel from environmental and biological samples prior to determination by electrothermal atomic absorption spectrometry. Journal of Hazardous Materials, 176 (1–3), 481–486. 16 Jiang, H., Qin, Y., & Hu, B. (2008). Dispersive liquid phase microextraction (DLPME) combined with graphite furnace atomic absorption spectrometry (GFAAS) for determination of trace Co and Ni in environmental water and rice samples. Talanta, 74 (5), 1160–1165. 17 Bidabadi, M. S., Dadfarnia, S., & Shabani, A. M.H. (2009). Solidified floating organic drop microextraction (SFODME) for simultaneous separation/preconcentration and determination of cobalt and nickel by graphite furnace atomic absorption spectrometry (GFAAS). Journal of Hazardous Materials, 166 (1), 291–296. 18 Rezaee, M., Assadi, Y., Hosseinia, M. R. M., Aghaee, E., Ahmadi, F., & Berijani, S. (2006). Determination of organic compounds in water using dispersive liquid-liquid microextraction. Journal of Chromatography A, 1116 (1-2), 1–9. 19 Liang, P., & , Peng, L. L. (2010). Determination of silver(I) ion in water samples by graphite furnace atomic absorption spectrometry after preconcentration with dispersive liquid-liquid microextraction. Microchimica Acta, 168 (1–2), 45–50. 276 Proceedings ASIAHORCS 2013

20 Jia, X. Y., Han, Y., Liu, X. L., Duan, T. C., & Chen, H. T. (2010). Dispersive liquid-liquid microextraction combined with flow injection inductively coupled plasma mass spectrometry for simultaneous determination of cadmium, lead and bismuth in water samples. Microchimica Acta, 171 (1–2), 49–56. 21 Yousefi, S. R., & Shemirani, F. (2010). Development of a robust ionic liquid-based dispersive liquid-liquid microextraction against high concentration of salt for preconcentration of trace metals in saline aqueous samples: Application to the determination of Pb and Cd. Analytica Chimica Acta, 669 (1–2), 25–31. 22 Khani, R., Shemirani, F., & , Majidi, B. (2011). Combination of dispersive liquid-liquid microextraction and flame atomic absorption spectrometry for preconcentration and determination of copper in water samples. Desalination, 266 (1–3), 238–243. 23 Mohammadi, S. Z., Afzali, D., Taher, M. A., & Baghelani, Y. M. (2010). Determination of trace amounts of palladium by flame atomic absorption spectrometry after ligandless-dispersive liquid-liquid microextraction. Microchimica Acta, 168 (1–2), 123–128. 24 Kagaya, S., Takata, D., Yoshimori, T., Kanbara, T., & Tohda, K. (2010). A sensitive and selective method for determination of gold(III) based on electrothermal atomic absorption spectrometry in combination with dispersive liquid-liquid microextraction using dicyclohexylamine. Talanta, 80 (3), 1364–1370. 25 Anthemidis, A. N., & , Ioannou, K. I. G. (2010). Development of a sequential injection dispersive liquid-liquid microextraction system for electrothermal atomic absorption spectrometry by using a hydrophobic sorbent material: Determination of lead and cadmium in natural waters. Analytica Chimica Acta, 668 (1), 35–40. 26 Razmisleviciene, I., Padarauskas, A., Pranaityte, B., & Naujalis, E. (2010). Determination of Cr(VI) by Dispersive Liquid-Liquid Microextraction and Dried-Droplet Laser Ablation ICP-MS. Current Analytical Chemistry, 6 (4), 310–315. 27 Jia, X. Y., Han, Y., Liu, X. L., Duan, T. C., & Chen, H. T. (2011). Speciation of mercury in water samples by dispersive liquid-liquid microextraction combined with high performance liquid chromatography-inductively coupled plasma mass spectrometry. Spectrochimica Acta Part B-Atomic Spectroscopy, 66 (1), 88–92. 28 Rezaee, M., Yamini, Y., Khanchi, A., Faraji, M., & Saleh, A. (2010). A simple and rapid new dispersive liquid-liquid microextraction based on solidification of floating organic drop combined with inductively coupled plasma-optical emission spectrometry for preconcentration and determination of aluminium in water samples. Journal of Hazardous Materials, 178 (1–3), 766–770. 29 Yamini, Y., Rezaee, M., Khanchi, A., Faraji, M., & , Saleh, A. (2010). Dispersive liquid-liquid microextraction based on the solidification of floating organic drop followed by inductively coupled plasma-optical emission spectrometry as a fast technique for the simultaneous determination of heavy metals. Journal of Chromatography A, 1217 (16), 2358–2364. 30 Sereshti, H., Khojeh, V., & Samadi, S. (2011). Optimization of dispersive liquid-liquid microextraction coupled with inductively coupled plasma-optical emission spectrometry with the aid of experimental design for simultaneous determination of heavy metals in natural waters. Talanta, 83 (3), 885–890. bioprocessing for food 277

31 Abdolmohammad-Zadeh, H., & Sadeghi, G. H. (2010). Combination of ionic liquid-based dispersive liquid-liquid micro-extraction with stopped-flow spectrofluorometry for the pre-concentration and determination of aluminum in natural waters, fruit juice and food samples. Talanta, 81 (3), 778–785. 32 Wen, X. D., Yang, Q. L., Yan, Z. D., & Deng, Q. W. (2011). Determination of cadmium and copper in water and food samples by dispersive liquid-liquid microextraction combined with UV-vis spectrophotometry. Microchemical Journal, 97 (2), 249–254. 33 Tabrizi, A. B. (2010). Development of a dispersive liquid-liquid microextraction method for iron speciation and determination in different water samples. Journal of Hazardous Materials, 183 (1–3), 688-693. 34 Di Nezio, Ma. S., Palomeque, M. E., & Fernández Band, B. S (2004). A sensitive spectrophotometric method for lead determination by flow injection analysis with on-line preconcentration. Talanta, 63 (2), 405–409. 35 Castillo, E., Cortina, J-L., Beltran, J-L., Prat, M-D., & Granados, M. (2001). Simultaneous determination of Cd(II), Cu(II) and Pb(II) in surface waters by solid phase extraction and flow injection analysis with spectrophotometric detection. Analyst, 126 (7), 1149–1153. 36 Jiang, Z. T., Li, R., Xi, J. B., & , Yi, B. Q. (1999). Determination of trace amounts of manganese by β-cyclodextrin polymer solid phase spectrophotometry using 2-(5-bromo-2-pyridylazo)- 5-diethylaminophenol. Analytica Chimica Acta, 392 (2-3), 247–253. 37 Abdolmohammad-Zadeh, H., & , Ebrahimzadeh, E . (2010). Determination of cobalt in water samples by atomic absorption spectrometry after pre-concentration with a simple ionic liquid-based dispersive liquid-liquid micro-extraction methodology. Central European Journal of Chemistry, 8 (3), 617–625. 38 Yoshikuni, N., Baba, T., Tsunoda, N., & Oguma, K. (2005). Aqueous two-phase extraction of nickel dimethylglyoximato complex and its application to spectrophotometric determination of nickel in stainless steel. Talanta, 66 (1), 40–44. 39 Safavi, A., Abdollahi, H., Hormozi Nezhad, M. R., & Kamali, R. (2004). Cloud point extraction, preconcentration and simultaneous spectrophotometric determination of nickel and cobalt in water samples. Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy, 60 (12), 2897–2901. 40 Ramachandraiah, C., Rajesh Kumar, J., Janardhan Reddy, K., Lakshmi Narayana, S., &, Varada Reddy, A. (2008). Development of a highly sensitive extractive spectrophotometric method for the determination of nickel(II) from environmental matrices using N-ethyl- 3-carbazolecarboxaldehyde-3-thiosemicarbazone. Journal of Environmental Management, 88 (4), 729–736. 41 Sarma, L. S., Kumar, J. R., Reddy, K. J., Thriveni, T., & Reddy, A. V. (2008). Development of highly sensitive extractive spectrophotometric determination of nickel(II) in medicinal leaves, soil, industrial effluents and standard alloy samples using pyridoxal-4-phenyl-3- thiosemicarbazone. Journal of Trace Elements in Medicine and Biology, 22 (4), 285–295. 42 Liu, Y., Chang, X., Wang, S., Guo, Y., Din, B., & Meng, S. (2004). Solid-phase spectrophotometric determination of nickel in water and vegetable samples at sub-μg l−1 level with o-carboxylphenyldiazoaminoazobenzene loaded XAD-4. Talanta, 64 (1), 160–166.

Synthesis of Diacylglycerols from Monoacylglycerols and Oleic Acid through Lipase SMG1-Catalyzed Esterification

Weifei Wang1,Yang Xu2, Yonghua Wang2* 1) School of Bioscience and Bioengineering, South China University of Technology,Guangzhou, 510640, People’s Republic of China, [email protected] 2) College of Light Industry and Food Sciences, South China University of Technology

Abstract The ability of lipase SMG1 to synthesize highly pure diacylglycerols (DAG) by esteriﬁcation of monoacylglycerols (MAG) and oleic acid was investigated. The optimized results for the esterification were achieved with lipase SMG1 at a concentration of 120 U/g (U/g, with respect to total reactants), an oleic acid/hydroxyl group (in MAG) molar ratio of 4:1, molecular sieves 10% (w/w, with respect to total reactants), and 35°C, and DAG content was 92.01% for 6 h of reaction under above conditions. The DAG products contained 91.78% unsaturated fatty acid residues. After use in three consecutive cycles (a total of four reaction trials), lipase SMG1 retained 48.1% of its initial activity.The finding on the synthesis of highly pure DAG by lipase SMG1 will push the enzyme’s application in the oil and fats industry. Keywords: Diacylglycerols, lipase SMG1, oleic acid, monoacylglycerols

*Corresponding Author Yonghua Wang, College of Light Industry and Food Sciences, South China University of Technology, Guangzhou 510640, People’s Republic of China. E-mail: [email protected]

Introduction In recent years, diacylglycerols (DAG) have been widely recognized as functional oils for the prevention of obesity (Maki et al., 2002) and of other lifestyle-related diseases (Fujii et al., 2007). The versatility of DAG oil has been well developed in numerous applications, for examples, in cooking oil, frying oil, shortenings, margarines, and other products with taking account of specific physiological benefits. Some new physical and chemical properties of DAG rich oil such as the effect of substitution of triacylglycerol (TAG) with DAG in meat emulsions (Miklos et al., 2011), crystallization kinetics of diacylglycerol rich palm oil (Saberi et al., 2011), physicochemical properties of various palm-based diacylglycerol oils (Saberi et al., 2011), and other properties (Cheong et al., 2009) have been investigated recently. The outcomes of these studies do encourage the future exploitation and applications of DAG oils in food industry. DAG has been evaluated and justified as “Generally Recognized As Safe (GRAS)” by Food and Drug Administration (Morita et al., 2009).

279 280 Proceedings ASIAHORCS 2013

Many researchers have paid central attention on the enzymatic production of DAG by esteriﬁcation, glycerolysis and partial hydrolysis of oils and fats because of the beneficial advantages of employing enzymes such as mild reaction conditions, high regioselectivity and high catalysis efficiency (Houdeet al., 2004), and it has been proved that enzymatic esterification is an effective way to produce high content of DAG. However separation of TAG and DAG needs extremely critical controlled conditions of temperature and vacuum (Lin and Yoo 2009). In the esterification process, the higher the esterification rate, the greater the TAG content is and the lower the DAG purity is (Watanabe et al., 2003). Therefore, more research in the production of DAG by lipase should be indispensable. In our previously studies, a novel mono- and diacylglycerol lipase (lipase SMG1) was expressed in recombinant pichia pastoris, and was verified applicable as a potential enzyme for the production of DAG of high purity (Wang et al., 2012; Xu et al., 2012).This study examined the feasibility of synthesizing highly pure diacylglycerols by enzymatic esteriﬁcation of monoacylglycerols and oleic acid with the employment of lipase SMG1. The effect of lipase loading, molar ratio of fatty acids to MAG and reaction temperature was investigated.

Materials and Methods Materials. Novozym435 (Candida antarctica B lipase immobilized on a macroporousresin) was purchased from Novozymes. The lipase SMG1 (7500U/g free lipase, lipase activity was determined according to Wang et al., (2012), was produced in lab as our previous report (Wang et al., (2012). Soybean oil was supplied by Kerry Oils & Grains Ltd. (Shenzhen, China). Glycerol (99.5%) containing 0.2% water was purchased from Guangzhou Chemical Reagent Factory (Guangzhou, China). Tert-butanol (99%) was purchased from the Guangzhou Chemical Reagent Factory (Guangzhou, China). Isooctane, n-hexane, acetone, 2-propanol were HPLC grade from Kermel Chemical Reagent Co., Ltd. (Tian jin). All acylglycerol standards (triolein, diolein, and monoolein), standards of 37 FA methyl esters, oleic acid, and molecular sieves (8-12 mesh beads) were obtained from Sigma (Shanghai, China). Preparation of MAGs. MAGs were produced through enzymatic glycerolysis of soybean oil as described by Zeng et al., (2010). Reaction products prepared from 100 g soybean oil were purified by a two-step molecular distillation (MD-S80, a short path falling film distiller, Handway Co. Ltd., Guangzhou, P.R.China). In the first step, the evaporation temperature was set at 110°C, the feed flow rate was 3 g/min, the pressure was 10 Pa and the scraper speed was 250 rpm. The conditions of the second step were set at a feed flow rate of 1.5 g/min, system pressure of 1 Pa, condenser temperature of 40°C, scraper speed of 250 rpm, and bioprocessing for food 281 evaporation temperature of 160°C. The final MAG products contained 95.3% (w/w) MAG and 4.7% (w/w) DAG. Esterification of MAGs with oleic acid. The esterification reaction was carried out in a 50 mL stoppered batch reactors with FA and MAGs produced from soybean oil. 10% molecular sieves (w/w, with respect to total reactants) were placed in the flask, and lipase was followed when the reaction temperature reached the desired level. The reactants were well blended in an orbital shaking water-bath operating at 200 rpm for 12 h. Aliquots of reaction mixture were withdrawn at periodic intervals and subjected to HPLC analyses. Each esterification experiment was conducted in triplicate. Effect of enzyme load.Enzyme load of native lipase SMG1 of 30, 60, 90, 120 and 150 U/g were conducted to elucidate their effects on the esterification reaction. The reactions were carried out at 30°C using a molar ratio of oleic acid to MAG in the initial mixture of 2:1 (mol/mol). Effect of the molar ratio of oleic acid to MAG. The esterification reactions of the mixture of MAGs with oleic acid were studied using different molar ratios of oleic to MAG (1:1, 2:1, 3:1, 4:1, and 5:1 mol/mol). Trials were conducted at 30°C and carried out using 120 U/g lipase SMG1 (U/w, with respect to total reactants). Effect of temperature.The effects of temperatures (20, 25, 30, 35 and 40°C) on the esterification of MAGs and FA were conducted using an enzyme loading of 120U/g (U/w with respect to total reactants) and a molar ratio of free oleic acid to MAG of 4:1 (mol/mol). Stability study. To assess the stability of the native biocatalyst lipase SMG1, we conducted replicate trials of reactions by recovering and transferring the enzyme to a fresh substrate mixture. After a time corresponding to one complete reaction cycle (6 h), 20 mL n-hexane was added to the reaction mixture and the resulting suspension was then filtered to recover the enzyme. The enzyme was then washed with10 mL hexane in order to remove residual oil and then dried in ambient air for 2 h to remove the hexane. The remaining activity was measured in terms of the increase in DAG content for each cycle. HPLC analysis of acylglycerols in reaction mixture. Reaction products were analysed in triplicate by Normal Phase HPLC (NP-HPLC) to separate and quantify the acylglycerols. A Waters 2695 HPLC apparatus was equipped with a Phenomenex Luna column (Phenomenex Corporation, 4.6 mm i.d. × 250 mm, 5 µm particle size) maintained at 25°C and a refractive index detector. The mobile phase was n-hexane and 2-propanol (15:1 v/v). The flow rate was 1 mL/min and the injection volume was 10 µL. Peaks in HPLC were evaluated by comparison of their retention times with those of known standards. Peak 282 Proceedings ASIAHORCS 2013

percentages and areas were calculated using Waters 2695 integration software. Reaction products (20 µL) were dissolved in 1 mL of n-hexane and 2-propanol (15:1 v/v) and then filtered through a 0.45 µm nylon syringe filter in order to remove the enzyme. Analysis was carried out in triplicate, and the values were of the average of triplicate measurements. FA composition analysis of DAG. To determine the FA composition of DAG product after esterification, the identification of acylglycerols by thin-layer chromatography (TLC) was carried out on GF254 silica gel plates (100 × 200 mm, 0.20–0.25 mm of thickness, Branch of Qingdao Haiyang Chemical Plant, Qingdao) as described previously (Wang et al., 2012). The DAG band was scraped off for the analysis of total FA composition. The FA composition was determined as fatty acid methyl esters (FAME) according to ISO 5509:2000 (E) (ISO Method 5509, 2000). The samples were methylated to FAME and then were separated on a capillary column CP-Sil 88 (60 m × 0.25 mm × 0.2 μm; Dikma Technologies, Beijing, China) by an Agilent 7890A gas chromatograph (GC).

Results and Discussion Effects of enzyme loading on the esteriﬁcation reactions.The effect of enzyme loading on MAG conversion was investigated. The reaction was performed at 30°C with a molecular ratio of 2:1 (oleic acid s to MAG). Lipase SMG1 loading was set to be 30 U/g, 60 U/g, 90 U/g, 120 U/g and 150 U/g (with respect to total reactants), respectively. The progress of the esteriﬁcation reaction was monitored until quasi-equilibrium was approached, and results are shown in Figure 1. A faster MAGs conversion was obtained at the initial reaction as the enzyme loading increased from 30 U/g to 120 U/g, suggesting that high enzyme loading will increase the reaction velocity. With the reaction proceeding, the equlilibrium end-point was observed, and virtually complete conversions to DAG were achieved at 9 and 12 h with 150 U/g and 120 U/g lipase (w/w, with respect to total reactants) respectively (Figure 1), and DAG content increased slightly when the enzyme loading was further increased to 150 U/g. The obtained results are expected on the basis of classical lipase-catalysis effects (Cao et al., 2013). Therefore, the enzyme load of 120 U/g was used in subsequent experiments and after 12 h the DAG content in the reaction products was 89.51%. Effect of the molar ratio of oleic acid/MAG. Reactions were performed at 30°C with lipase loading 120 U/g to investigate the effect of oleic acid/MAG molar ratio on MAG conversion. Molar ratio of oleic acid to MAG varied from 1:1 to 5:1. The results are presented in Figure 2. It was observed that equilibrium MAG conversion and reaction rate changed with the oleic acid/MAG molar ratio. When bioprocessing for food 283

Figure 1. Effects of enzyme loading on esteriﬁcation reaction. Conditions: 2.0 g MAGs, 3.07 g oleic acid (2 mol oleic acid/mol MAG), 0.57 g molecular sieves (10%, w/w, with respect to total reactants), 30°C, 200 rpm.

Figure 2. Effects of the molar ratio of oleic acid to MAG on the esterification reaction. Conditions: 2.0 g MAGs,120 U/glipase SMG1 (U/w, with respect to total reactants), 0.57 g molecular sieves (10%, w/w, with respect to total reactants), 30°C, 200 rpm. the reaction proceeded, not only reaction rate but MAG conversion and DAG product had increased with the molar ratio of oleic acid to MAG increasing. The equilibrium MAG conversions to DAG were achieved at 6 h and 9 h when molar ratio of oleic acid to MAG was 4:1 and 3:1 respectively, and with corresponding DAG content in the reaction mixture of 91.7% and 82.16%. It is well known that lipase-catalysed esterification reaction follows a reversible kinetics. Excess oleic acid could inhibit the backward reaction and shift the equilibrium towards the DAG production. 5:1 molar ratio of oleic acid to MAG was also performed 284 Proceedings ASIAHORCS 2013

but less accumulation of DAG product was achieved. Thus, the molar ratio of oleic acid to MAG in the MAGs was fixed at 4:1 in the following experiments. Effects of temperature. The effect of temperature on MAG conversion were investigated at 4:1 oleic acid/MAG with enzyme loading 120U/g. the temperature was set from 20°C to 40°C. Figure 3 depicts the increases in DAG content observed as a function of time at several different temperatures. Much more DAG and faster quasi-equilibrium was obtained in the trial at 35°C (92.01% of DAG after 6 h reaction) than at lower temperatures (20 to 30°C), which suggests that a higher temperature obviously increased the equiliburium conversion and reaction rate. It is mainly because higher temperature may provide more energy to collide the molecule and then reconstitute new chemicals. The lowest DAG production was observed at 40°C as the lipase was denatured by high temperature. Because the melting points of MAG (14°C for mono-linolein, 35°C for mono-olein) (Hernández-Martín and Otero 2008) are higher than those of other components of the reaction mixture, operation at temperatures above these melting points serves to liquefy the MAG, thereby facilitating the reaction. Moreover, the viscosity of the reaction mixture decreases with the temperature rising. For these reasons, 35°C was selected for use in subsequent experiments.

Figure 3. Effect of temperature on the esterification reaction. Conditions: 2.0 g MAGs, 6.14 g free oleic acid (4 mol oleic acid/mol MAG), 120 U/g lipase SMG1 (U/w, with respect to total reactants), 0.814 g molecular sieves (10%, w/w with respect to total reactants), 200 rpm.

FA Compositional of DAG. The FA compositions of DAG product in the acylglycerols are summarized in Table 2. Inspection of Table 2 demonstrates that the increase in C18:1 was appreciable as a consequence of the large amount of oleic participating in the esteriﬁcation reaction. bioprocessing for food 285

Table 2. Composition of the FA composition of the soybean oil, the MAGs used as precursor for the esterification and the product of esterification with oleic acid. Esterification mixture Index MAG (DAG band) Acylglycerol Profile (%) TAG - - DAG 4.7 100 MAG 95.3 - FA Compositions (%) C16:0 9.59 5.01 C18:0 6.36 3.21 C18:1 24.07 63.14 C18:2 55.1 26.11 C18:3 4.23 2.09 Others (unsaturated FA) 0.65 0.44 Total saturated FA 9.59 8.22 Total unsaturated FA 90.41 91.78

Enzyme Reuse—Multiple Use of the Native Enzyme. Several esterification trials involving multiple use of free lipase SMG1 were carried out in order to ascertain the stability of this enzyme. The results are represented in Figure 4. The point corresponding to cycle 0 equals to the activity of the fresh lipase used in the first reaction trial (taken as 100%). The activity of the lipase was calculated on the basis of the conversion achieved at 6 h reaction for each circle. The activity of lipase SMG1 had diminished by 48.1% after the third cycle (after it had been used to carry out a total of four reaction trials). This can be attributed to several factors, such as low thermal stability of free lipase SMG1 and loss of enzyme during recovery process involving extraction and washing with n-hexane. Furthermore, according to the previous experiments with several immobilized enzymes in our lab, it suggests that exposure of the lipase SMG1 to n-hexane is probably not responsible for the loss of lipase activity. Since enzymes placed in hydrophobic water, immiscible solvents like n-hexane tend to retain a layer of essential water which allows them to maintain their native conformation, as well as sufficient flexibility for catalytic activity. Moreover, improved results might be acquired if the enzyme were immobilized on an appropriate support.

Conclusions Esterification of FA and MAGs catalysed by lipase SMG1 is an efficient way to produce highly pure DAG products. 92.01% of DAG content was achieved at the optimal conditions with lipase SMG1 catalyst at a concentration of 120 U/g (U/w with respect to total reactants), oleic acid/MAG molar ratio of 4:1, molecular sieves 10% (w/w with respect to total reactants) and 35°C. 286 Proceedings ASIAHORCS 2013

Figure 4. Operational stability of lipase SMG1. Conditions: 2.0 g MAGs, 6.14 g oleic acid (4 mol oleic acid/mol MAG), 120 U/glipase SMG1 (U/w, with respect to total reactants), 0.814 g molecular sieves (10%, w/w with respect to total reactants), 35°C, 200 rpm.

The findings that lipase SMG1, which is specific for mono- and diacylglyceol, could synthesize high pure DAG, indicate that lipase SMG1 may have the potential for industrial application. However, its widespread use is dramatically restricted due to the difficult recovery and reuse of the free lipase. There was only 48.1% of its initial activity retained when lipase SMG1 was used in three consecutive cycles (a total of four reaction trials). Thus, it is highly significant to develop the working on enzyme immobilization and molecular modification of lipase SMG1 to obtain the enzyme with high stability and catalytic efficiency.

Acknowledgement This work was made possible with funding provided by the National Science Funds for the Excellent Youth Scholars (No. 31222043).

References Cao, Y., Wang, W. F., Xu, Y., Yang, B., & , Wang Y. H. (2013). Enzymatic synthesis of extremely pure triacylglycerols enriched in conjugated linoleic acids. Molecules, 8, 9704–9716. Cheong, L. Z., Tan, C. P., Long, K., Yusoff M. S. A., & Lai O. M. (2009). Physicochemical, textural and viscoelastic properties of palm diacylglycerol bakery margarine during storage. Journal of the American Oil Chemists’ Society, 8, 723–731. Fujii, A., Allen, T. J., & Nestel, P. J. A. (2007). 1,3-diacylglycerol-rich oil induces less atherosclerosis and lowers plasma cholesterol in diabetic apoE-deficient mice. Atherosclerosis, 1, 55–61. Houde, A., Kademi, A., & Leblanc, D. (2004). Lipases and their industrial applications. Applied Biochemistry and Biotechnology, 1, 155–170. Hernández-Martín, E., & Otero, C. (2008). Selective enzymatic synthesis of lower acylglycerols rich in polyunsaturated fatty acids. European Journal of Lipid Science and Technology, 4, 325–333. ISO Method 5509, Animal and Vegetable Fats and Oils—Preparation of Methyl Esters of Fatty Acids, 12-23-2000. bioprocessing for food 287

Lin, S. W., & Yoo, C. K. (2009). Short-path distillation of palm olein and characterization of products. European Journal of Lipid Science and Technology, 2, 142–147. Maki, K. C., Davidson, M. H, Tsushima, R., Matsuo, N.,Tokimitsu, I., Umporowicz, D. M., Dicklin, M. R., Foster, G. S., Ingram, K. A., Anderson, B. D., Frost, S. D., & Marjorie, B. (2002). Consumption of diacylglycerol oil as part of a reduced-energy diet enhances loss of body weight and fat in comparison with consumption of a triacylglycerol control oil. The American Journal of Clinical Nutrition, 6, 1230–1236. Miklos, R., Xu, X., & Lametsch, R. (2011). Application of pork fat diacylglycerols in meat emulsions. Meat Science, 3, 202–205. Morita, O., & Soni, M. G. (2009). Safety assessment of diacylglycerol oil as an edible oil: A review of the published literature. Food and Chemical Toxicology, 1, 9–21. Saberi, A. H., Lai, O. M., & Toro-Vázquez, J. F. (2011). Crystallization kinetics of palm oil in blends with palm-based diacylglycerol. Food Research International, 1, 425–435. Saberi, A. H., Kee, B. B., Lai, O. M., & Miskandar, M. S. (2011). Physico-chemical properties of various palm-based diacylglycerol oils in comparison with their corresponding palm-based oils. Food Chemistry, 3, 1031–1038. Watanabe, T., Shimizu, M., Sugiura, M., Sato, M., Kohori, J., Yamada, N., & Nakanishi, K. (2003). Optimization of reaction conditions for the production of DAG using immobilized 1, 3-regiospecific lipase lipozyme RM IM. Journal of The American Oil Chemists’ Society, 12, 1201–1207. Wang, W. F., Li, T., Qin, X., Ning, Z. X., Yang, B., & Wang, Y. H. (2012). Production of lipase SMG1 and its application in synthesizing diacylglyecrol. Journal of Molecular Catalysis B: Enzymatic, 77, 87–91. Wang, W. F., Li, T., Ning, Z. X., Wanga, Y. H., Yang, B., Ma, Y. J., & Yang, X. Ql(2012). A process for the synthesis of PUFA-enriched triglycerides from high-acid crude fish oil. Journal of Food Engineering, 3, 366–371. Xu, D., Sun, L. J., Chen, H. Y., Lan, D. M., Wang, Y. H., & Yang, B. (2012). Enzymatic synthesis of diacylglycerols enriched with conjugated linoleic acid by a novel lipase from malassezia globosa. Journal of The American Oil Chemists’ Society, 7, 1259–1266. Zeng, F. K., Yang, B., Wang, Y. H., Wang, W. F., Ning, Z. X., & Li, L. (2010). Enzymatic production of monoacylglycerols with camellia oil by the glycerolysis reaction. Journal of The American Oil Chemists’ Society, 5, 531–537.

Application of Plackett-Burman Design on the Sensory Analysis of Sweet potato-pineapple Wine with Probiotic Lactobacillus paracasei

Domingo P. Lodevico1* and Roberta D. Lauzon2 1 Department of Food Science 2Department of Food Science and Technology,Visayas State University, Visca, Baybay City, Leyte, 6521-A, Philippinese-mail: [email protected]

Abstract The present study provides valuable information on the medium components that significantly affect the sensory attributes of sweet potato-pineapple wine with probiotic Lactobacillus paracasei through the application of Plackett-Burman design as a screening tool. It aimed to screen and identifies the medium components that significantly affect the sensory attributes of the product in terms of color, clarity, aroma, flavor and general acceptability through a 12-runs, 11-variables Plackett-Burman design. Acidity, fermentation time, fermentation temperature, Lactobacillus paracasei cells, amount of sweet potato, amount of pineapple extracts, pineapple maturity, pasteurization time and refined sugar with two dummies were the medium components investigated. Statistica software version 6.0 was used in data analysis. Results revealed that fermentation temperature and fermentation time affect the color while clarity was influenced by most of the medium components except pasteurization time. Aroma was affected by sugar levels and Lactobacillus paracasei cells whereas flavor was significantly affected by sugar and pH. The general acceptability was influenced by sugar, pH, fermentation time and amount of sweet potato. The top contributing medium components on the sensory analysis of probiotic sweet potato-pineapple wine include fermentation temperature, amount of sugar and pH which may serve for further studies like optimization. Keywords: Screening design, fermentation temperature, sugar, pH, Lactobacillus paracasei, probiotic

*Corresponding Author Department of Food Science Central Mindanao University, Musuan, Bukidnon, 8710, Philippines E-mail: [email protected]

Introduction Wine as a product of fermentation has long been acted as an important solvent for medications (Jackson, 2008) and is considered as a functional food (Oke et al., 2007). The beneficial effects of wine on human health may originate from their non-alcoholic components, such as phenolic compounds particularly flavonoids. Considering the alcoholic components of wine, the benefits of light-to-moderate drinking of alcohol which are associated with a lower risk of coronary heart disease compared with non-drinkers is due to known biological effects of ethanol (Sandler and Pinder, 2003). Although there are detrimental issues on the effects of heavy alcohol consumption, scientists are still unraveling on any progress on the

289 290 Proceedings ASIAHORCS 2013

complex relationships between alcohol and chronic diseases. However, it is still recommended by several researchers to moderately consume alcoholic beverages which give distinct health benefits. Common traditional wines in the Philippines are lambanog, bahalina, basi and tapoy which are usually made from coconut, nipa sap, sugarcane and rice, respectively. Wine from root crops particularly sweet potato and yam, in combination with other fruits, have been developed at the Department of Food Science and Technology of the Visayas State University due to the growing awareness and interest on the health benefits from these raw materials. Preliminary studies were conducted on the development of probiotic fruit and root crop wines and it was found acceptable. However, to make the product competitive in its commercial counterpart, there is a need for further study to come up with quality products such as screening and optimization on the process formulation in wine production. Purple sweet potato contains more types of anthocyanin and acylated anthocyanin than fruits and other vegetables and has a comparatively higher degree of stability in heat and light (Tsukui et al., 2002). Thus, its expanded use as a new type of processed food product in the form of fermented alcoholic liquor made from these roots is desirable from this perspective. Wine made out of sweet potato in combination with pineapple which contains proteolytic enzyme known as bromelain plays a role as nutraceutical (Bartholomew et al., 2003). In addition, integration of beneficial microorganisms in food and beverage has been accepted by the society due to the desirable health benefits that the consumer can acquire. Thus, this study will explore to produce an extraordinary health promoting alcoholic beverage with the association of probiotic microorganism. Designs in product development have also expanded from screening to complex optimization using response surface experiments. Plackett-Burman is an example of a two-level screening design which offers up to 127 variables in a study. Screening design is very useful and arguably the most popular for industrial experimentation since it examines many factors to see which have the greatest effect on the results of a process. This only requires a few experimental runs, and thus, affordable and efficient way to improve a process (JMP, 2005). In this context, the study aimed to screen and identify the significant medium components that will affect the sensory acceptability in terms of color, clarity, aroma, flavor and general acceptability on the process formulation of sweet potato- pineapple wine with probiotic Lactobacillus paracasei through Plackett-Burman experimental design. bioprocessing for food 291

Materials and Methods Procurement of Materials. Ripe Queen variety pineapples and purple sweet potato were purchased at Baybay City wet supermarket and at Abuyog, Leyte, respectively. Lactobacillus paracasei from Chamyto yogurt drink, a product manufactured by Nestle, was purchased in Tacloban City. It was placed in a container with enough ice to maintain the low temperature for the microorganism to survive during transport. Other ingredients and materials such as yeasts (Saccharomyces cerevisiae), sugar and plastic hose were bought from the nearby markets of Baybay and Ormoc City. All materials in this study were sanitized in chlorinated water (300 ppm) using commercial bleach containing 5.25% by weight of sodium hypochlorite for 15 minutes and air-dried. Sterilization process of bottles, test tubes, petri plates and culture media were performed using an autoclave for 15 minutes, 121°C and 15 psi. Isolation, Purification and Identification of the Probiotic Microorganism. The probiotic strain Lactobacillus paracasei was isolated from Chamyto yogurt drink using serial dilution and spread plate technique as described by Tortora et al., (2001). The cultures were grown at 37°C for 72 hours in the Man, Rogosa and Sharpe (MRS) agar plates. Morphologically distinct and well-isolated colonies were picked and transferred to new MRS agar plates by streaking. Finally, pure colonies were obtained. Macroscopic appearance of the colonies was examined for cultural and morphological characteristics. Color, form, surface, margin, elevation, stab culture and nutrient broth characteristics were recorded. Bacterial isolate was tested for biochemical tests through catalase and fermentation of sugar. Cell morphology was examined after gram staining. Sweet Potato-Pineapple Wine Processing. Sweet potato-pineapple wine was processed following the method used by Lauzon and Modina (1998) with modifications. Sweet potato and pineapple were washed, rinsed with chlorinated water and peeled. Sweet potatoes were cooked in boiling water and cooled after 10 minutes of boiling. A clean cloth was used to extract the cooked sweet potato. Pineapples were blend and the juice was collected, mixed with sweet potato extracts of one part and 3 parts respectively. The pH and TSS were adjusted, pasteurized at 82°C and fermented for 1 and 3 weeks. After fermentation, Lactobacillus paracasei cells were added and aged for 4 weeks. Sensory Evaluation and Plackett-Burman Experimental Design. A 9-point Hedonic scale rating was carried out to assess the acceptability for each sensory attributes of the different runs in the Plackett-Burman design. The sensory panel was composed of ten participants comprising five professors in the Department of Food Science and Technology and five graduate students and staff of the Philippine Root crops, Visayas State University. 292 Proceedings ASIAHORCS 2013

Plackett-Burman design was employed to screen out the medium components which could affect the process formulation of the product. Table 1 presents the values assigned in a 12-run with 11 medium components (Tyssedal et al., 2006). Data Analysis. All results were tabulated in Microsoft Excel 2010 and ran in statistical software version 6.0 for analysis. Pareto charts at p < 0.05 were used to elucidate the medium components that significantly affect most on the process formulation of the product.

Results and Discussion Sensory evaluation is important in product development, may it be a food or beverage, since this aid in conceptualizing the product to launch and commercialize if the sample under study is enhanced and accepted by consumers. With numerous variables affecting the process formulation in relation to the production of sweet potato pineapple wine with probiotic Lactobacillus paracasei, Plackett-Burman design was used to screen and identify the significant medium components that influenced most on the acceptability of the product through the different sensory attributes. Table 1 shows the distribution of factors according to the matrix design and the means of the general acceptability as yield for each runs. General acceptability of the product ranged from 4.60–7.10 which is equivalent to “dislike slightly” and “like moderately” in the 9-point Hedonic scale, respectively. This can be supported by the effect estimates of the medium components presented in Figures 1a-e where high and low values can be observed designated as (+) and (-) signs, respectively. Positive values denote an increase of value of the medium component which will gain higher acceptability of the product. On the other hand, a negative value implies a decrease in sensory acceptability rating of the product as the levels of the medium component are increased. Statistical analysis revealed that fermentation temperature and fermentation time significantly affects the color of the product (Figure 1a). Such effect can be attributed to the degradation of anthocyanin at varying temperatures. This in agreement of the findings reported by Mori et al., (2007) and He et al., (2012) that the loss of anthocyanin in red wine exposed to high temperature reduced to less than half of the total content of anthocyanin of the control. In addition, longer fermentation time may slightly degrade the anthocyanin. Clarity as affected by fermentation temperature increases the acceptance of the product if low temperature is applied (Figure 1b). Noting that fermentation can be described as a turbulent activity and create heat naturally. It begins at about 20°C, but temperatures may rise to 30° to 32°C. Yeast ceases to work if the temperature rises above approximately 35°C. Thus, temperature control is bioprocessing for food 293 necessary. Cooler fermentations aid the growing of yeast colonies and give higher alcoholic degrees (Grainger and Tattersall, 2005). In terms of pH as the second contributing factor for clarity, wines that have high acidity particularly if an acid has been added in the process, the product may appear to be bright. A young wine for example that appears dull probably has a high pH (low acidity) which is an indicative of poor quality and total lack of aging potential (Grainger, 2009). Moreover, Lactobacillus paracasei was also noted to affect the clarity of the product. Bacteria are the most frequent causal agents as source of haziness since it forms long macroscopic filaments, producing a ropiness condition. Disruption of these filaments generates turbidity and an oily texture (Jackson, 2008). Aroma is usually associated with odorous, volatile compounds (Lambrechts and Pretorius, 2000). The same discussion has made by Jackson (2008) that odorants and olfactory stimulation in wine may be influenced by the presence of other constituents in wine such as sugar, ethanol, oil and other macromolecules. As presented in Figure 1c, sugar has significantly influenced aroma than the Lactobacillus paracasei. Similar finding was also reported by Kumoroet al., (2012) on the fermentation of jackfruit juice with initial sugar concentrations of less than 14% (w/w) having weaker jackfruit aroma. The present study suggests that as sugar is increased, intense aroma of the product may also be perceived by the panelists. Flavor is a wine’s most important distinguishing characteristic. Fermentative flavor is not only brought about by the conversion of directly fermentable substances, but also by the long-chain fatty acids, organic nitrogen-containing compounds, sulfur-containing compounds and many others (Grainger, 2009). In this study, results revealed that an increase in the amount of sugar and pH of the product will result to higher acceptability (Figure 1d). It can be supported by yeast metabolism during fermentation especially for sugar as the main effect for the probiotic wine flavor because yeast or other microorganisms may produce wide range of esters (Fugelsang and Edwards, 2007). In terms of the general acceptability, analysis shows that sugar, pH and fermentation temperature are the most contributing factor that significantly influenced the product at p < 0.05 (Figure 1e). These three medium components can be observed to consistently give impact with the other sensory attributes of the product. This work demonstrates that these medium components may be used as basis for further studies such as response surface methodology in optimizing the product. 294 Proceedings ASIAHORCS 2013

Conclusions Based on the findings, fermentation temperature, amount of sugar and pH were the top contributing medium components that strongly affect the sensory attributes in producing sweet potato-pineapple wine with probiotic Lactobacillus paracasei. Therefore, these three variables may be used in optimizing the process formulation of the product through response surface methodology.

Acknowledgement The authors would like to thank the Department of Science and Technology- Science Education Institute (DOST-SEI) through the Philippine Council for Agriculture, Aquatic and Natural Resources Research and Development (PCAARRD) for the financial support of this study. The technical assistance of Ms. Dulce Alibangbang is gratefully acknowledged. Deep appreciation is extended to Dr. Felix J. Amestoso of the Department of Food Science and Technology, Dr. Candelario L.Calibo of the Department of Pure and Applied Chemistry, and Dr. Lolito C. Bestil of the Department of Animal Science, all from VSU for the suggestions made for the improvement of the said research.

References Bartholomew, D. P., Paull, R. E., & Rohbach, K. G. (2003). (Eds.), The Pineapple: Botany, Production and Uses. CABI Publishing. Fugelsang, K. C., & Edwards, C. G. (2007). Wine Microbiology Practical Applciations and Procedures, Second edition. Springer. Grainger, K. (2009). Wine Quality: Tasting and Selection, Food Industry Briefing Series. Wiley Blackwell. Grainger, K., & Tattersall, H. (2005). Wine production: Vine to Bottle, Food Industry Briefing Series. Blackwell. He, F., Liang, N., Mu, L., Pan, Q., Wang, J., Reeves, M. J., & Duan, C. (2012). Anthocyanins and their variation in red wines I. monomeric anthocyanins and their color expression. Molecules, 17, 1571–1601. Jackson, R. S. (2008). Wine Science: Principles and Applications, Third Edition. Elsevier, Inc. JMP. (2005). Design of experiments, Release 6. Kumoro, A. C., Sari, D. R., Pinandita, A. P. P., Retnowati, D. S., & Budiyati, C. S. (2012). Preparation of wine from jackfruit (Artocarpus heterophyllus Lam) juice using baker yeast: Effect of yeast and initial sugar concentrations. World Applied Sciences Journal, 16 (9), 1262–1268. Lambrechts, M. G., & Pretorius, I. S. (2000). Yeast and its importance to wine aroma. South African Journal Of Enology and Viticulture, 21, Special Issue. Lauzon, R. D., & Modina, V.P. (1998). Production and quality evaluation of rootcrop wine. Unpublished Research, Department of Food Science and Technology, Visca, Baybay, Leyte. bioprocessing for food 295

Mori, K., Goto-Yamamoto, N., Kitayama, M., & Hashizume, K. (2007). Loss of anthocyanins in red-wine grape under high temperature. Journal of Experimental Botany, 58 (8), 1935–1945. Oke, M., G. Paliyath, and K. H. Fisher. (2007). In Shetty, K., G. Paliyath, A. L. Pometto and R. E. Leviin (eds.) Functional Foods and Biotechnology. CRC. Taylor and Francis. New York.p. 322. Sandler, M., & Pinder, R. (2003). (Eds.), Wine: A Scientific Exploration. London and New York: Taylor and Francis. Shetty, K., Paliyath, G., Pometto, A. L., & Levin, R. E. (2007). (Eds.), Functional Foods and Biotechnology. CRC. New York: Taylor and Francis. Tortora, G. J., Funke, B. R., & Case, C. L. (2001). Microbiology An Introduction, Seventh Edition. Tsukui, A. T., Murukami, R., Shiina, R., & Hayashi, K. (2002). Effect of alcoholic fermentation on the stability of purple sweet potato anthocyanins. Food Science and Technology Research, 8 (1), 4–7. Tyssedal, J., Grinde, H., & Rostad, C. C. (2006). The use of a 12-run Plackett-Burman design in the injection moulding of a technical plastic component. Quality and Reliability Engineering International, 22, 651–657. 296 Proceedings ASIAHORCS 2013 4.36 6.78 5.60 6.90 4.60 7.10 5.91 6.00 6.20 6.50 5.80 6.00 General Acceptability 2 1 (-) 1 (-) 1 (-) 1 (-) 1 (-) 1 (-) 2 (+) 2 (+) 2 (+) 2 (+) 2 (+) 2 (+) Dummy Dummy 1 1 (-) 1 (-) 1 (-) 1 (-) 1 (-) 1 (-) 2 (+) 2 (+) 2 (+) 2 (+) 2 (+) 2 (+) Dummy Dummy 25 (-) 25 (-) 25 (-) 25 (-) 25 (-) 25 (-) Sugar Sugar 30 (+) 30 (+) 30 (+) 30 (+) 30 (+) 30 (+) (°Brix) Refined Refined 1 (-) 1 (-) 1 (-) 1 (-) 1 (-) 1 (-) 2 (+) 2 (+) 2 (+) 2 (+) 2 (+) 2 (+) time (mins.) Pasteurization Pasteurization green (-) green (-) green green (-) green green (-) green green (-) green (-) green Pineapple maturity (color) maturity yellow-orange (+) yellow-orange yellow-orange (+) yellow-orange (+) yellow-orange yellow-orange (+) yellow-orange (+) yellow-orange yellow-orange (+) yellow-orange 350 (-) 350 (-) 350 (-) 350 (-) 350 (-) 350 (-) 450 (+) 450 (+) 450 (+) 450 (+) 450 (+) 450 (+) Amt. of Amt. juice (mL) pineapple 400 (-) 400 (-) 400 (-) 400 (-) 400 (-) 400 (-) 500 (+) 500 (+) 500 (+) 500 (+) 500 (+) 500 (+) Amt. of Amt. juice (mL) sweetpotato sweetpotato (-) (-) (-) (-) (-) (-) (+) (+) (+) (+) (+) (+) 7 7 7 7 7 7 9 9 9 9 9 9 (cells) 1 x 10 1 x 10 1 x 10 1 x 10 1 x 10 1 x 10 1 x 10 1 x 10 1 x 10 1 x 10 1 x 10 1 x 10 L. paracasei (°C) 24.0 (-) 24.0 (-) 24.0 (-) 24.0 (-) 24.0 (-) 24.0 (-) 27.5 (+) 27.5 (+) 27.5 (+) 27.5 (+) 27.5 (+) 27.5 (+) Ferm. temp. Ferm. 3(+) 1 (-) 1 (-) 1 (-) 1 (-) 1 (-) 1 (-) 3 (+) 3 (+) 3 (+) 3 (+) 3 (+) time Ferm. Ferm. (weeks) (pH) Acidity 6-6.5 (-) 6-6.5 (-) 6-6.5 (-) 6-6.5 (-) 6-6.5 (-) 6-6.5 (-) 6-6.5 (-) 5-5.5 (+) 5-5.5 (+) 5-5.5 (+) 5-5.5 (+) 5-5.5 (+) 1 6 2 3 5 8 9 4 7 10 11 12 Run Medium components for Plackett-Burman design matrix in 12-runs for up to 11 factors. components for Plackett-Burman 1. Medium Table (+) high value/level value/level (-) low bioprocessing for food 297

Pareto Chart of Standardized Effects; Variable: color 11 Factor Screening Design; MS Residual=2.152954 DV: color

(3)fermentation temp. -2.59189

(2)fermentation time -2.32146

(10)dummy1 1.706072

(9)sugar 1.606692

(5)sweetpotato -1.60261

(4)L. paracasei 1.31977

(1)pH .6651677

(8)pasteurization time -.556416

(7)pineapple maturity -.225394

(6)pineapple .1222275

p=.05 Effect Estimate (Absolute Value)

Figure 1a. Effects on the color attribute

Pareto Chart of Standardized Effects; Variable: flavor 11 Factor Screening Design; MS Residual=2.206997 DV: flavor

(9)sugar 2.314327

(1)pH 2.041675

(3)fermentation temp. -1.60717

(5)sweetpotato -1.27793

(10)dummy1 1.202421

(7)pineapple maturity -1.14973

(2)fermentation time -.754224

(4)L. paracasei .6083052

(6)pineapple -.286057

(8)pasteurization time -.245984

p=.05 Effect Estimate (Absolute Value)

Figure 1b. Effects on the clarity attribute 298 Proceedings ASIAHORCS 2013

Pareto Chart of Standardized Effects; Variable: general acceptability 11 Factor Screening Design; MS Residual=2.414203 DV: general acceptability

(9)sugar 2.886449

(1)pH 2.689093

(3)fermentation temp. -2.44503

(5)sweetpotato -2.14112

(10)dummy1 1.492372

(4)L. paracasei 1.329406

(7)pineapple maturity -1.3273

(2)fermentation time -.941258

(6)pineapple -.58107

(8)pasteurization time -.115754

p=.05 Effect Estimate (Absolute Value)

Figure 1c. Effects on the aroma attribute

Pareto Chart of Standardized Effects; Variable: clarity 11 Factor Screening Design; MS Residual=1.998986 DV: clarity

(3)fermentation temp. -4.56915

(1)pH 4.49683

(4)L. paracasei 4.291581

(5)sweetpotato -3.69369

(6)pineapple -2.58844

(9)sugar 2.503802

(2)fermentation time -2.26855

(7)pineapple maturity -2.0489

(10)dummy1 1.411166

(8)pasteurization time -.568821

p=.05 Effect Estimate (Absolute Value)

Figure 1d. Effects on the flavor attribute bioprocessing for food 299

Pareto Chart of Standardized Effects; Variable: aroma 11 Factor Screening Design; MS Residual=2.344538 DV: aroma

(9)sugar 2.238545

(4)L. paracasei 2.192144

(1)pH 1.383637

(6)pineapple -1.36751

(10)dummy1 1.305755

(5)sweetpotato -1.30303

(3)fermentation temp. -1.19592

(7)pineapple maturity -.952887

(8)pasteurization time -.79057

(2)fermentation time -.235896

p=.05 Effect Estimate (Absolute Value)

Figure 1e. Effects on the general acceptability

Short Communication of Oral Presentations

Enhanced 1,3-Propanediol Production in Lactobacillus reuteri by Repeated Fed-batch Fermentation

Subramanian Ramalingam*, Pandiaraj Suppuram and Hema Venkatesan Centre for Biotechnology, Anna University, Chennai, INDIA

Abstract There is an urgent need for the production of valuable chemicals like 1,3-propanediol (1,3-PD) from glycerol, a waste product from biodiesel industry. Since 1,3-PD has biomedical and healthcare applications, it would be suitable to produce it in an organism with wide acceptability like Lactobacillus reuteri. However, lower cell density as well as reduced product titres seems to be the key factors limiting process development. To address these issues, a repeated fed-batch strategy has been presented in the current study. A 2.5-fold increase in biomass and 5 fold increase in 1,3-PD concentration could be achieved in repeated fed-batch as compared to the batch mode of fermentation. Metabolic flux analysis was also carried out to assess the suitability of recombinant L. reuteri harboring E. coli alcohol dehydrogenase (yqhD) for the 1,3-PD process development. When compared to native strain, recombinant L. reuteri 2.8 and 2.5 fold increases in specific production rate of 1,3-PD and lactate were observed, respectively. The 2.2 and 3.4 fold increases in specific consumption rate of glucose and glycerol was also observed.

*Corresponding Author Kotturpuram, Chennai, Tamil Nadu 600025, India E-mail: [email protected]

Introduction Biological processes are eco-friendly and sustainable alternatives to conventional chemical processes for production of several industrially important bulk chemicals like succinic acid, lactic acid, 1, 3-propanediol, 1, 4- butanediol, and so on. (Biebl et al., 1998; Chotani et al., 2000; Song and Lee, 2006). Such processes could be economically viable if they are based on renewable feedstocks. Glycerol, a surplus byproduct of the biodiesel industry, holds promises as a major feedstock for synthesis of platform chemicals such as 1, 3-propanediol (Zhu et al., 2002). Currently, 1, 3-propanediol (1,3-PD) has attracted worldwide interest due to its enormous applications in polymers, cosmetics, foods, adhesives, lubricants, laminates, solvents, antifreeze and medicines (Homann et al., 1990; Colin et al., 2000; Zhu et al., 2002; Cheng et al., 2007). The biological route involves 1,3-PD production by microorganisms like Klebsiella, Citrobacter, Enterobacter, Clostridia and Lactobacilli (Biebl et al., 1999; Saxena et al., 2009). Amongst these, Clostridium butyricum and Klebsiella pneumoniae are considered to be the best producers (Gonzalez-Pajuelo et al., 2006). 1,3-PD concentrations in the range of around 40–100 g/L have been

303 304 Proceedings ASIAHORCS 2013

obtained with these producers (Celinska, 2010). The product levels of the native producers have been improved using various bioprocess strategies. Metabolic engineering is currently being attempted to further enhance the product levels (Saxena et al., 2009). The non-native producers,Escherichia coli and Saccharomyces cerevisiae, have also been engineered for 1,3-PD production. In S. cerevisiae, the products have

been obtained at the low level because of ineffective transport of vitamin 12B that is required for 1,3-PD production. On the other hand, E. coli has been metabolically engineered by DuPont and Genencor International, Inc., to produce 1,3-PD at a concentration of 135 g/L, (Maervoet et al., 2011). A major concern with the existing 1,3-PD producers is that a majority of them are opportunistic pathogens, which are less suitable for niche applications in food, cosmetic and biomedical industries. In this context production of 1,3-PD for niche applications, using non-pathogenic organisms like Lactobacillus reuteri (Generally Regarded as Safe), is an attractive option. In L. reuteri, 1,3-PD is produced during the anaerobic fermentation of glycerol in a two-step process, wherein glycerol is first dehydrated by glycerol dehydratase to an intermediate, 3-hydroxypropionaldehyde (3-HPA), that is ultimately reduced to 1,3-PD by a NADH-dependent 1,3-PD oxidoreductase (1,3 PDOR). However, L. reuteri is able to form 1,3-PD, only upon cofermentation with glucose (El-Ziney et al.,1998). The reducing equivalents (NADH) generated by glycolysis are recycled during the reduction of 3-HPA to 1,3-PD (Luthi-Peng et al., 2002). Redox balance thus plays a crucial role in linking glucose and glycerol metabolism in L. reuteri. Much work has been done for enhancing 1,3-PD levels in other organisms. However, relatively less attention has been paid to improve 1,3-PD productivity in L. reuteri. In this study, repeated fed-batch cultivation was carried out to improve product titres and maximise cell density.

Materials and Methods Microbial Strains. The L. reuteri strain ATCC 55730 was obtained from Biogaia (Sweden) and the recombinant L. reuteri HR2 carrying yqhD, a NADPH-dependent alcohol dehydrogenase, was generated in an earlier study (Vaidyanathan et al., 2011). Media and growth conditions. L. reuteri strains were grown at 37°C in MRS broth (Vaidyanathan et al., 2011). The recombinant strain was cultured in media containing erythromycin (5 μg/mL). A semi-defined medium was used for metabolic flux analysis without lactose, but with glucose (28 mM) and glycerol (69 mM). Casamino acids in the medium were replaced with casein enzyme bioprocessing for food 305 hydrolysate type I. Growth was monitored by measuring the absorbance at 600 nm. Cell dry weight (CDW) was calculated from a predetermined relationship between L. reuteri CDW and optical density (1 OD600 corresponded to 0.33 g/L CDW). Batch fermentation. The inoculum for the batch reactor was grown in 150 mL MRS broth with erythromycin at 37°C until an OD600 of 0.8 –1.0 was reached. The seed was then inoculated into a 2 L fermentor (KLF 2000-Bioengineering AG, Switzerland) filled with 1.2 L MRS medium containing erythromycin and glycerol (25 g/L). Glucose to glycerol ratio of 1:2.5 has been used in this study for elevated 1,3-PD synthesis (Tobajas et al., 2009). Fermentation was carried out at 37°C and 250 rpm, in an anaerobic condition. The pH was maintained at 5.5 by the addition of 1.5 M NaOH or 1.5 M H3PO4 (El-Ziney et al., 1998). The anaerobic condition was established by flushing with sterile nitrogen. At 0.8 OD600, the culture was induced with 50 ng/mL of sakacin P induction peptide (SppIP). Samples were removed periodically for determining OD600. The culture supernatant was stored at -20°C, to be used later for metabolite analysis (Vaidyanathan et al., 2011). Metabolic flux analysis.The metabolic flux analysis for glucose and glycerol, the grown cells consisted of five intracellular reactions and five extracellular fluxes, lactate, acetate, ethanol, 3-HPA and 1,3-PD. The metabolic fluxes through phosphoketolase (PKP), Embden-Meyerhof (EMP) and glycerol dissimilation pathways were estimated for the period of maximum growth rate as described by Årsköld et al., (2008). The fluxes in the stoichiometric model, were derived from the relationship Qx = μmax * Yx, where Qx is flux of the specific metabolite x (expressed as mol of x/mol biomass/h), μmax represents maximum specific -1 growth rate (h ) and Yx represents the specific metabolite production (mol of x/ mol biomass). The carbon balances were determined for control and uninduced recombinant L. reuteri strains, based on the total amount of carbon-containing products and biomass formed (in C-Mol) and the amount of glucose and glycerol consumed (in C-Mol). Carbon balances for glucose estimated during the exponential growth phase in control and uninduced cultures were found to close on C- mol basis at ~103%. However, the fluxes could not be analysed for the induced recombinant strain since carbon balance closure could not be attained (data not shown). Carbon dioxide production was calculated from the stoichiometric relationship with acetate and ethanol production. Repeated Fed-batch cultivation. The Repeated fed-batch cultivation was carried out in a 7 L stirred bioreactor with an initial working volume of 5 L. During cultivation, the initial batch medium contained 20 g/L glucose, 10 g/L glycerol and 2 g/L of acetate. The feed to the fed batch bioreactor contained 333 g/L of glucose and 222 g/L of glycerol. The glucose/glycerol feeding was started after 306 Proceedings ASIAHORCS 2013

glucose was completely consumed from the batch medium, at a feed rate of 18 ml/h to prevent the accumulation of glycerol in the medium. The repeated fed-batch was conducted for 3 cycles and in each cycle, 10% (v/v) of fermentation broth was removed from the fermentor. Quantification of substrates and metabolites.HPLC (Shimadzu LC-10AT VP) equipped with a refractive index detector (RID) and aminex HPX-87H column (300 × 78 mm, Bio-Rad, USA) was used for determining the concentrations of glucose, glycerol, 1,3-PD, ethanol, lactate,3-HPA and acetate in the culture broth as described earlier (Vaidyanathan et al., 2011). 3-HPA standard was synthesized in the lab using resting cells of L. reuteri ATCC 55730 and quantified using HPLC as described by Spinler et al. (2008).

3.5 3 2.5 2 1.5 1 0.5 formation(g/gh) 0

Lactate Acetate Ethanol Glucose Glycerol Reuterin Specific rates of rates substrateSpecific uptake product /

1,3-propanediol Figure 1. Specific rates of substrate uptake and product formation in the logarithmic phase of batch fermentation using native (white bar) and recombinant Lactobacillus reuteri strains (black bar).

Results 1,3-PD production by batch fermentation Batch fermentation of L. reuteri was carried out with native strain as a control to assess the impact of yqhD on substrates consumption, by product formation and 1,3-PD production. Upon over expression of yqhD in L. reuteri significant changes in specific rates of substrate uptake, product formation and byproduct formation were observed. When compared with native strain, recombinant L. reuteri achieved 34% increase in Specific 1,3-PD productivity and 15% increase in molar yield. Interestingly, the specific rates of formation of lactate and ethanol were higher and that of acetate lower in the recombinant culture, relative to the native strain. These changes in specific rates of substrate uptake, product formation bioprocessing for food 307 and byproduct formation were attributed mainly to the preferential utilization of NADPH by yqhD and diversion of NADH to byproduct forming reactions. Metabolic flux analysis. To perform metabolic flux analysis, un-induced recombinant strain (with a reasonable basal-level expression of yqhD gene) was considered with the native strain as control. Carbon closure of ~ 103% for glucose was obtained while it was less than 90% for glycerol in both the strains (data not shown). This deficit is ascribed to degradation of 3-HPA (LuthiPeng et al., 2002b). Absolute fluxes (mol·mol biomass-1·h-1) in pathways involving central carbon metabolism and glycerol dissimilation were determined at the following nodes: (1) Glucose-6-phosphate node at the junction of phosphoketolase and Embden-Meyerhof-Parnas pathways; (2) Acetyl phosphate node. An increase in the absolute fluxes of glucose-glycerol pathways was observed in the recombinant strain. Expression of yqhD enhanced the conversion of glycerol to 1,3-PD and reuterin, leading to more than two-fold increase in glycerol uptake rate (Table 1). Since yqhD preferentially uses NADPH for 3-HPA conversion, this cofactor needs to be regenerated through the PKP pathway. We observed a two-fold increase in flux through the PKP pathway which is required for NADPH generation and redox balancing.

Table 1. Impact of yqhD on specific rates of substrate uptake, product and byproduct formation in comparison with native strain. Fold increase in specific rates of substrate uptake, product and by Strain product formation in comparison with native strain. Glucose Glycerol 1,3-PD Lactate L. reuteri HR2 2.2 2.4 2.8 2.5

Repeated Fed-batch cultivation for enhancing 1,3-PD productivity. Based on the flux analysis results it was found that, the recombinantL. reuteri harbouring yqhD could produce 2.8 fold 1,3-PD when compared to native strain. In order to further improve cell density as well as 1,3-PD productivity, Repeated fed-batch cultivation was carried out using L. reuteri ATCC 55730 (Data not shown) and L. reuteri HR2, by repeatedly replacing a portion of culture with feed comprising of glucose/glycerol at a rate of 18 ml/h. The molar ratio of glucose/glycerol in the feed was maintained at 1.5 for all the cycles. Fermentation was carried out for 102 hours and the maximum biomass obtained was 4.29 g/L (Figure 2 and 3). 1,3-PD concentration increased significantly after each cycle and by the end of the third cycle, it reached upto 45.9 g/L with a productivity of 0.72 g/L/h. The maximum productivity of 1.48 g/L/h was observed during first cycle. 3-HPA accumulation was not observed 308 Proceedings ASIAHORCS 2013

Figure 2. Product formation, substrate consumption and biomass formation profile of unaerated repeated fed-batch fermentation of L. reuteri with glucose/glycerol feed of molar ratio 1.5.

Figure 3. Byproduct product and biomass formation profile of unaerated repeated fed-batch fermentation of L. reuteri with glucose/glycerol feed of molar ratio 1.5

due to high concentration of glucose, which facilitated the conversion of 3-HPA to 1,3-PD. In the third cycle, glycerol started accumulating in the medium but accumulation of glucose was observed only after the third cycle. Maximum biomass was achieved during the first cycle but after that, there was no further increase in biomass which could have caused by inadequate supply of glucose. The absence of residual glucose confirms the inadequacy of glucose supply. Oscillation in lactate levels could be correlated with the oscillation in biomass, whenever there is a decrease in lactate level and an increase in biomass level was observed. Lactate and acetate were produced to a maximum of ~23 g/L and ~15 g/L respectively. bioprocessing for food 309

Discussion To enhance 1,3-PD productivity, it is vital to reduce the accumulation of toxic metabolites and improve cell density. In batch fermentation of L. reuteri, 1,3-PD concentrations of 13.0 to 28.7 g/L has been achieved by optimizing the glucose to glycerol ratio in the medium (Tobajas et al., 2009; Baeza-Jimenez et al., 2011). Further by metabolic engineering strategies, an increase in specific productivity by 30% has been attained (Vaidyanathan et al., 2011). In all cases, the maximum biomass reached was less than 2.5 g/L (corresponding to OD600 of 7.6). Enhancing the productivity further, would require the build up of much higher cell density. The accumulation of toxic metabolite, 3-HPA, causes enzyme inactivation by reacting non-specifically with sulfhydryl groups (Vollenweider et al., 2010). This results in poor growth and 1,3-PD productivity. In order to overcome this limitation, we have developed a repeated fed-batch process, where a part of culture was removed and supplied with fresh feed containing glucose and glycerol in specific intervels. The ratio of glucose glycerol was maintained at 1.5 in order to prevent 3-HPA accumulation and to provide sufficient NADH for 1,3-PD production. We have achieved a 1,3-PD concentration of 45.9g/L. In the future, further improvement in 1,3-PD production could be achieved by eliminating byproduct forming reactions which competes with cofactors.

Acknowledgement This work was supported by the grant (No. SR/SO/BB-39/2008) from Depart- ment of Science and Technology, New Delhi-110 016, India. We also gratefully acknowledge Biogaia AB, Sweden, for kindly providing us with Lactobacillus reuteri ATCC 55730.

References Årsköld, E., Lohmeier-Vogel, E. M., Cao, R., Roos, S., Rådström, P., & van Niel, E. W. J. (2008). Phosphoketolase pathway dominates in Lactobacillus reuteri ATCC 55730 containing dual pathways for glycolysis. Journal of Bacteriology, 190, 206–212. Baeza-Jiménez, R., López- Martinez, L. X., De la Cruz-Medina, J., Espinosa-de-los-Monteros, J. J., & García-Galindo, H. S. (2011). Effect of glucose on 1,3-propanediol production by Lactobacillus reuteri. Revista Mexicana de Ingenierίa Quίmica, 10, 39–46. Biebl, H., Menzel, K., Zeng, A. P., & Deckwer, W. D. (1999). Microbial production of 1,3-propanediol. Applied Microbiology and Biotechnology, 52, 289–297. Biebl, H., Zeng, A. P., Menzel, K., & , Deckwer, W. D. (1998). Fermentation of glycerol to 1,3-propanediol and 2,3-butanediol by Klebsiella pneumoniae. Applied Microbiology and Biotechnology, 50, 453–457. Celińska, E. (2010). Debottlenecking the 1,3-propanediol pathway by metabolic engineering. Biotechnology Advances, 28, 519–530. 310 Proceedings ASIAHORCS 2013

Cheng, K. K., Zhang, J. A., Liu, D. H., Sun, Y., Liu H. J., & Yang, M. D (2007). Pilot-scale production of 1,3-propanediol using Klebsiella pneumoniae. Process Biochemistry, 42, 740–744. Chotani, G., Dogde, T., Hsu, A., Kumar, M., LaDuca, R., Trimbur, D., Weyler, W., & Sanford, K. (2000). The commercial production of chemicals using pathway engineering.Biochimica et Biophysica Acta, 1543, 434–455. Colin, T., Bories, A., & Moulin, G. (2000). Inhibition of Clostridium butyricum by 1,3-propanediol and diols during glycerol fermentation. Applied Microbiology and Biotechnology, 54, 201–205. Drożdżyńska, A., Leja, K., & Czaczyk, K. (2011). Biotechnological production of 1,3-propanediol from crude glycerol. Journal of Biotechnology, Computational Biology and Bionanotechnology, 92 (1), 92–100. El-Ziney, M. G., Arneborg, N., Uyttendaele, M., Debevere, J., & Jakobsen, M. (1998). Char- acterization of growth and metabolite production of Lactobacillus reuteri during glucose/ glycerol cofermentation in batch and continuou cultures. Biotechnology Letters, 20, 913–916. Gonzalez-Pajuelo, M., Meynial-Salles, I., Mendes, F., Soucaille, P., & Vasconcelos, I. (2006). Microbial conversion of glycerol to 1,3-propanediol: physiological comparison of a natural producer, Clostridium butyricum VPI 3266, and an engineered strain, Clostridium acetobutylicum DGI(pSPD5). Applied and Environmental Microbiology, 72 (1), 96–101. Homann, T., Tag, C., Biebl, H., Deckwer, W. D., & Schink, B. (1990). Fermentation of glycerol to 1,3-ropanediol by Klebsiella and Citrobacter strains. Applied Microbiology and Biotechnology, 33, 121–126. Jarboe, L. R. (2010). YqhD: a broad-substrate range aldehyde reductase with various applications in production of biorenewable fuels and chemicals. Applied Microbiology and Biotechnology, 10, 2912–2919. Krauter, H., Willke, T., & Vorlop, K. D. (2012). Production of high amounts of 3-hydroxypropionaldehyde from glycerol by Lactobacillus reuteri with strongly increased biocatalyst lifetime and productivity. New Biotechnology, 29 (2), 211–217. Lüthi-Peng, Q., Dileme, F. B., & Puhan Z. (2002). Effect of glucose on glycerol bioconversion by Lactobacillus reuteri. Applied Microbiology and Biotechnology, 59, 289–296. Maervoet, V. E. T., De Mey, M., Beauprez, J., De Maeseneire, S., & Soetaert, W. K. (2011). Enhancing the microbial conversion of glycerol to 1,3-Propanediol using metabolic engineering. Organic Process Research & Development, 15, 189–202. Nakamura, C. E., & Whited, G. M. (2003). Metabolic engineering for the microbial production of 1,3-propanediol. Current Opinion in Biotechnology, 14, 454–459. Papanikolaou, S., Ruiz-Sanchez, P., Pariset, B., Blanchard, F., & Fick, M. (2000). High production of 1,3-propanediol from industrial glycerol by a newly isolated Clostridium butyricum strain. Journal of Biotechnology, 77, 191–208. Pflügl, S., Marx, H., Mattanovich, D. and M. Sauer. (2012). 1,3-Propanediol production from glycerol with Lactobacillus diolivorans. Bioresource Technology, 119C, 133-140. Saxena, R. K., Anand, P., Saran, S. and J. Isar. (2009). Microbial production of 1,3-propanediol: recent developments and emerging opportunities. Biotechnology Advances, 27, 895-913. bioprocessing for food 311

Schutz, H. and F. Radler. (1984). Anaerobic reduction of glycerol to 1,3-propanediol by Lactobacil- lus brevis and Lactobacillus buchneri. Systematic and Applied Microbiology, 5, 169-178. Song, H. and S. Y. Lee. (2006). Production of succinic acid by bacterial fermentation. Enzyme and Microbial Technology, 39, 352-361. Sørvig, E., Mathiesen, G., Naterstad, K., Eijsink, V. G. H. and L. Axelsson. (2005). High-level, inducible gene expression in Lactobacillus sakei and Lactobacillus plantarum using versatile expression vectors. Microbiology, 151, 2439-2449. Spinler, J. K., Taweechotipatr, M., Rognerud, C. L., Ou, C. N., Tumwasorn, S. and J. Versalovic. (2008). Human-derived probiotic Lactobacillus reuteri demonstrate antimicrobial activities targeting diverse enteric bacterial pathogens. Anaerobe, 14, 166-171. Talarico, T. L., Axelsson, L. T., Novotny, J., Fiuzat, M. and W. J. Dobrogosz. (1990). Utilization of glycerol as a hydrogen acceptor by Lactobacillus reuteri: purification of 1, 3-propanediol:NAD+ oxidoreductase. Applied and Environmental Microbiology, 56, 1195-1197. Tobajas, M., Mohedano, A. F., Casas, J. A. and J. J. Rodriguez. (2009). Unstructured kinetic model for reuterin and 1,3-propanediol production by Lactobacillus reuteri from glycerol/glucose cofermentation. Journal of Chemical Technology and Biotechnology, 84, 675-680. Vaidyanathan, H., Kandasamy, V., Gopal Ramakrishnan, G., Ramachandran, K., Jayaraman, G. and S. Ramalingam. (2011). Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri. AMB Express, 1, 37. Vollenweider, S., Evers, S., Zurbriggen, K. and C. Lacroix. (2010). Unraveling the HPA system: an active antimicrobial agent against human pathogens. Journal of Agricultural and Food Chemistry, 58, 10315–10322. Xu, Y. Z., Guo, N. N., Zheng, Z. M., Ou, X. J., Liu, H. J., & Liu, D. H. (2009). Metabolism in 1,3-propanediol fed-batch fermentation by a D-lactate deficient mutant of Klebsiella pneumoniae. Biotechnology and Bioengineering, 104, 965–972. Yang, G., Tian, J., & Li, J. (2007). Fermentation of 1,3-propanediol by a lactate deficient mutant of Klebsiellaoxytoca under microaerobic conditions. Applied Microbiology and Biotechnology, 73, 1017–1024. Zhang, Z., Li, Y., Du, C., Liu, M., & Cao, Z. (2006). Inactivation of aldehyde dehydrogenase: a key factor for engineering 1,3-propanediol production by Klebsiella pneumoniae. Metabolic Engineering, 8, 578–586. Zhu, M. M., Lawman, P. D., & Cameron, D. C.(2002). Improving 1,3-propanediol production from glycerol in a metabolically engineered Escherichia coli by reducing accumulation of sn-glycerol-3-phosphate. Biotechnology Progress, 18, 694–699. Zhuge, B., Zhang, C., Fang, H., Zhuge, J., & Permaul, K. (2010). Expression of 1,3-propanediol oxidoreductase and its isoenzyme in Klebsiella pneumoniae for bioconversion of glycerol into 1,3-propanediol. Applied Microbiology and Biotechnology, 87, 2177–2184.

Microbial Factory Technology for Production of Food Bio-chemicals using Renewable Biomass

Yong-Cheol Park* Department of Bio and Fermentation Convergence Technology, Kookmin University

Abstract For sustainable development, many research groups have made an effort to change the currently available crude oil to the renewable biomass as resource. To overcome the general problems of corn- and sugar-based biomass, non-food biomass such as cellulosic biomass (tree, straw, agricultural residue et al.,) has been observed as the alternative biomass for production of biochemicals. By decomposition of cellulosic biomass, various mono-sugars are released and most abundant sugars of glucose and xylose should be converted to biochemicals for gaining their price competitiveness against petroleum-oriented chemicals. To develop a commercially available bioprocess, meanwhile, engineering of genetic and microbial systems should be complementary to bioprocess engineering by feed-forward and feed-back cycles. Microbial Factory Technology (MFT) armed with genetic, microbial and metabolic engineering, –omic technology and fermentation optimization is a promising technology able to meet the system and process complementation, and applicable for rapid development of biochemical production process. In this presentation, microbial systems were engineered by MFT for mass production of food biochemicals such as xylitol, D-ribose and coenzyme Q10. The engineered microorganisms of Saccharomyces cerevisiae, Bacillus subtilis and Escherichia coli could produce the target food chemicals with high conversion yields and production rates. Thus, high titers of xylitol, D-ribose and coenzyme Q10 were able to be obtained by fermentation optimization. Keywords: Renewable biomass, microbial factory technology, metabolic engineering, xylitol, D-ribose, fermentation

*Corresponding Author Kookmin University Seoul, 136-702, Korea, E-mail: [email protected]

As a resource for biochemical production, renewable cellulosic biomass has been researched by several groups because it is the most abundant non-food resource and is renewed by solar energy and carbon dioxide fixation (Baket al., 2009; Hahn- Hägerdal et al., 2007). Cellulosic biomass consists of cellulose, hemicelluloses and lignin. By physical, chemical and/or biological treatment, the biomass is depolymerized mainly into several monosugars such as glucose, xylose, arabinose, mannose and so on (Bak et al., 2009; Saha, 2003). As xylose, the second abundant monosaccharide, is a representative of five-carbon sugar, it should be utilized as a carbon source in order to produce biochemicals from cellulosic biomass efficiently (Jin et al., 2000). To develop a commercially available bioprocess, engineering of genetic and microbial systems should be complementary to bioprocess engineering by feed-forward and feed-back cycles. Microbial Factory Technology (MFT)

313 314 Proceedings ASIAHORCS 2013

armed with genetic, microbial and metabolic engineering, –omic technology and fermentation optimization is a promising technology able to meet the system and process complementation, and applicable for rapid development of biochemical production process. Through MFT using cellulosic biomass, in this study, key-technologies for production of food biochemicals such as xylitol and ribose were introduced.

First, xylitol (C5H12O5, CAS No. 87-99-0) is a natural sweetener with a number of advantageous properties. As xylitol has a positive enthalpy for solubilization, an extreme cooling and caries preventative effects, xylitol has been commercially used in chewing gums, candies, toothpastes and mouthwashes. Xylitol is also safe for diabetes because it does not require insulin for metabolic regulation (Schiweck and Ziesenitz, 1996). As a platform chemical, xylitol was chosen as one of the top 12 value-added chemicals produced from biomass (Werpy and Petersen, 2004). It can be converted to various compounds for rare sugar production (Granström et al., 2007) and polymer synthesis such as xylaric acid and glycols, directly polymerized for production of unsaturated polyester resin (Werpy and Petersen, 2004). In 2007, the annual production of xylitol was estimated between 20,000 and 40,000 ton per year with a market value of 40-80 M€ (Granström et al., 2007). For production of xylitol, chemical and microbial processes have been developed using xylose as a starting material (Toivari et al., 2007). For chemical processes, highly pure xylose is hydrogenated to xylitol by nickel, ruthenium and rhodium catalysts at high temperatures and pressure (da Silva and Chandel, 2012). Regarding the sustainability issue, microbial production of xylitol has gained an interest from academia and industries. Microbial conversion of xylose to xylitol has been developed using Candida, Saccharomyces, Pichia and Escherichia species. Second, a five-carbon sugar, D-ribose, has been served as a starting material

for the production of riboflavin (vitamin B2) as well as used for animal feed additives, cosmetics and foods (Park et al., 2006). To produce D-ribose, enzymatic hydrolysis of yeast RNA and chemical synthesis using arabinose, glucose and gluconic acid have been established, but these showed some disadvantages of low yield and complex processes for recovery and purification (Parket al., 2004; Wu et al., 2009). Its biological production has been developed by fermentation of transketolase-deficient microbial strains. Among several bacterial strains lacking transketolase activity, Bacillus subtilis and B. pumilus have been recognized as high D-ribose producer. For example, B. subtilis ATCC 21915 produced D-ribose from glucose with 48% yield (Wulf and Vandamme, 1997). Various carbon sources were used to produce D-ribose (Park and Seo, 2004) and corn steep liquor was effective for a large-scale production (Srivastava et al., 2012). Citrate enhanced the carbon fluxes in the pentose phosphate pathway and tricarboxylic acid cycle, and also reduced fluxes in the glycolysis, yielding 83.4 bioprocessing for food 315 g/l D-ribose concentration from glucose (Wu et al., 2009). Supplementation of aromatic amino acids increased D-ribose production yield and suppressed the formation of gluconic acid by-product (Srivastava and Wangikar, 2008). When a D-ribose-producing mutant was grown on glucose with a second substrate, catabolite repression on utilization of the second substrate was not found (De Wulf et al., 1996; Park et al., 2004; Park and Seo, 2004). Increased concentrations of glucose, ammonium sulfate and potassium ion increased cell mass and byproduct formation, but reduced D-ribose production yield by a transketolase deficient B. pumilis strain (Srivastava and Wangikar, 2008). Disruption of a transketolase gene (tkt) by a genetic method allowed a wild type of B. subtilis 168 strain to be able to produce D-ribose from glucose and xylose, a five-carbon sugar present in lignocellulosic biomass (Park et al., 2006). In our laboratory, we screened a B. subtilis JY1 mutant lacking transketolase and the glucose-specific enzyme II of the phosphoenolpyruvate-mediated sugar transferase system (PTS) (Park and Seo, 2004) and constructed a high D-ribose producing B. subtilis SPK1 strain from the JY1 mutant. Also, a series of recombinant B. subtilis strains were developed to convert xylose to D-ribose efficiently. Among various fermentation conditions affecting D-ribose production, two critical factors of oxygen supply and mixed sugar concentration were important in batch cultivation of B. subtilis SPK1 using xylose and glucose as carbon sources.

Acknowledgement This work was financially supported by the National Research Foundation of Korea (NRF) Grant (NRF-2013R1A2A2A01004806), funded by the Korean Ministry of Science, ICT and Future Planning.

References Bak, J. S., Ko, J. K., Choi, I. G., Park, Y. C., Seo, J. H., & Kim, K. H. (2009). Fungal pretreatment of lignocellulose by Phanerochaete chrysosporium to produce ethanol from rice straw. Biotechnology and Bioengineering, 104, 471–482. da Silva, S. S., & Chandel, A. K. (2012). D-Xylitol: Fermentative production, application and commercialization. Heidelberg: Springer. De Wulf, P., Soetaert, W., Schwengers, D., & Vandamme, E. J. (1996). D-Glucose does not catabolite repress a transketolase-deficient D-ribose-producing Bacillus subtilis mutant strain. Journal of Industrial Microbiology and Biotechnology, 17, 104–109. Granström, T., Izumori, K., & Leisola, M. (2007). A rare sugar xylitol. Part II: biotechnological production and future applications of xylitol. Applied Microbiology and Biotechnology, 74, 273–276. Hahn-Hägerdal, B., Karhumaa, K., Fonseca, C., Spencer-Martins, I., & Gorwa-Grauslund, M. (2007). Towards industrial pentose-fermenting yeast strains. Applied Microbiology and Biotechnology, 74, 937–953. 316 Proceedings ASIAHORCS 2013

Jin, Y. S., Lee, T. H., Choi, Y. D., Ryu, Y. W., & Seo, J. H. (2000). Conversion of xylose to ethanol by recombinant Saccharomyces cerevisiae containing genes for xylose reductase and xylitol dehydrogenase from Pichia stipitis. Journal of Microbiology and Biotechnology, 10, 564–567. Park, Y. C., Choi, J. H., Bennett, G. N., & Seo, J. H. (2006). Characterization of D-ribose biosynthesis in Bacillus subtilis JY200 deficient in transketolase gene.Journal of Biotechnology, 121, 508–516. Park, Y. C., Kim, S. G., Park, K., Lee, K. H., & Seo, J. H. (2004). Fed-batch production of D-ribose from sugar mixtures by transketolase-deficient Bacillus subtilis SPK1. Applied Microbiology and Biotechnology, 66, 297–302. Park, Y.C., & Seo, J. H. (2004). Optimization of culture conditions for D-ribose production by transketolase-deficient Bacillus subtilis JY1. Journal of Microbiology and Biotechnology, 14, 665–672. Saha, B. (2003). Hemicellulose bioconversion. Journal of Industrial Microbiology and Biotechnology, 30, 279–291. Schiweck, H., & Ziesenitz, S.C. (1996). Physiological properties of polyols in comparison with easily metabolisable saccharides, in: Advances in Sweetners, (Ed.) T. H. Grenby, Blackie Academic & Professional. Glasgow, UK, pp. 56–84. Srivastava, R., Maiti, S., Das, D., Bapat, P., Batta, K., Bhushan, M., & Wangikar, P. (2012). Metabolic flexibility of D-ribose producer strain ofBacillus pumilus under environmental perturbations. Journal of Industrial Microbiology and Biotechnology, 39, 1227–1243. Srivastava, R. K., & Wangikar, P.P. (2008). Combined effects of carbon, nitrogen and phosphorus substrates on D-ribose production via transketolase deficient strain of Bacillus pumilus. Journal of Chemical Technology and Biotechnology, 83, 1110–1119. Toivari, M. H., Ruohonen, L., Miasnikov, A. N., Richard, P., & Penttilä, M. (2007). Metabolic engineering of Saccharomyces cerevisiae for conversion of D-glucose to xylitol and other five- carbon sugars and sugar alcohols. Applied and Environmental Microbiology, 73, 5471–5476. Werpy, T., & Petersen, G. (2004). Top value added chemcials from biomass: Volume 1-Results of screening for potential candidates from sugars and synthesis gas. U.S. Department of Energy, Oak Ridge. Wu, L., Li, Z., & Ye, Q. (2009). Enhanced D-ribose biosynthesis in batch culture of a transketolase-deficient Bacillus subtilis strain by citrate. Journal of Industrial Microbiology and Biotechnology, 36, 1289–1296. Wulf, P. D., & Vandamme, E. J. (1997). Production of D-ribose by fermentation. Applied Microbiology and Biotechnology, 48, 141–148. Innovative Thermal and Non-thermal Treatments for Food Safety

Dong-Hyun Kang Department of Food and Animal Biotechnology, Seoul National University

Significant increases in foodborne illnesses over the past few decades have been reported. Various thermal and non-thermal sterilization methods have been studied to guarantee the microbiological safety of food products. Superheated steam (SHS), near-infrared (NIR) heating, ohmic heating, radio frequency (RF) heating, and microwave (MW) heating are promising alternatives to conventional thermal sterilization methods. The main advantage of using SHS is the large amount of heat transferred to food when steam condenses on food surfaces, which rapidly increases the surface temperature. We compared the effectiveness of saturated steam (SS) and SHS in the inactivation of Escherichia coli O157:H7, Salmonella typhimurium, and Listeria monocytogenes biofilms on polyvinyl chloride (PVC) and stainless steel (1). Biofilms were formed on PVC and stainless steel coupons by using a mixture of three strains each of three foodborne pathogens at 25°C. After biofilm development, PVC and stainless steel coupons were treated with SS at 100°C and SHS at 125, 150, 175, and 200°C for 5, 10, 20, and 30 s on both sides. The viable cell numbers of biofilms were significantly (p < 0.05) reduced as SHS temperature and exposure time increased. For all biofilm cells, SHS treatment resulted in an additional log reduction compared to SS treatments. After exposure to 200°C steam for 30 s or 10 s on PVC or stainless steel, respectively, the numbers of biofilm cells were reduced to below the detection limit (1.48 log). This study demonstrated that SHS treatment effectively reduced populations of biofilm cells and reduced disinfection time compared to SS treatments and further evaluated its potential as an excellent intervention for controlling microbial biofilms and enhancing safety in the food processing industry. NIR heating is gaining popularity because of its higher thermal efficiency and fast heating rate/response time compared to conventional heating. We investigated the efficacy of near-infrared (NIR) heating to reduce S. typhimurium, E. coli O157:H7, and L. monocytogenes in ready-to-eat (RTE) sliced ham compared to conventional convective heating, and the effect of NIR heating on quality was determined by measuring the color and texture change (2). A cocktail of three pathogens was inoculated on the exposed or protected surfaces of ham slices, followed by NIR or conventional heating at1.8 kW. NIR heating for 50 s achieved 4.10, 4.19, and 3.38log reductions in surface-inoculated S. typhimurium,

317 318 Proceedings ASIAHORCS 2013

E. coli O157:H7, and L. monocytogenes, respectively, whereas convective heating needed 180 s to attain comparable reductions for each pathogen. There were no statistically significant (P>0.05) differences in reduction between surface- and internally inoculated pathogens at the end of NIR treatment (50 s). However, when treated with conventional convective heating, significant (P < 0.05) differences were observed at the final stages of the treatment (150 and 180 s). Color values and texture parameters of NIR treated (50-s treatment) ham slices were not significantly (P > 0.05) different from those of non-treated samples. These results suggest that NIR heating can be applied to control internalized pathogens as well as surface-adhering pathogens in RTE sliced meats without affecting product quality. Ohmic heating, RF, and MW heating are regarded as volumetric forms of heating in which thermal energy is generated directly inside the food. Therefore, a high-quality food product as well as one that is microbiologically safe can be successfully manufactured in a short processing time.We investigated the efficacy of continuous ohmic heating for reducing E. coli O157:H7, S.typhimurium and L. monocytogenes in orange juice and tomato juice (3). Orange juice and tomato juice were treated with electric field strengths in the range of 25–40 V/ cm for different treatment times. The temperature of the samples increased with increasing treatment time and electric field strength. The rate of temperature change for tomato juice was higher than for orange juice at all voltage gradients applied. Higher electric field strength or longer treatment time resulted in a greater reduction of pathogens. E. coli O157:H7 was reduced by more than 5 log after 60-, 90- and180-s treatments in orange juice with 40, 35 and 30 V/cm electric field strength, respectively. In tomato juice, treatment with 25 V/cm for 30 s was sufficient to achieve a 5-log reduction in E. coli O157:H7. Similar results were observed in S. typhimurium and L. monocytogenes. The concentration of vitamin C in continuous ohmic heated juice was significantly higher than inconventionally heated juice (P < 0.05). Also we investigated the efficacy of radio-frequency (RF) heating to inactivate S. typhimurium and E. coli O157:H7 in peanut butter cracker sandwiches using creamy and chunky commercial peanut butter and to determine the effect on quality by measuring color changes and sensory evaluation (4). Samples were treated for a maximum time of 90 s in a 27.12 MHz RF heating system. Samples were prepared in the form of peanut butter cracker sandwiches and placed in the middle of two parallel-plate electrodes. After 90 s of RF treatment, the log reductions of S. typhimurium and E. coli O157:H7 were 4.29 and 4.39 log CFU/g, respectively, in creamy peanut butter. RF treatment of chunky peanut butter for 90 s also significantly (P < 0.05) reduced levels ofS . typhimurium and E. coli O157:H7 by 4.55 log CFU/g and 5.32 log CFU/g. Color values and sensory characteristics of the RF treated peanut butter and crackers bioprocessing for food 319 were not significantly (P > 0.05) different from the control. These results suggest that RF heating can be applied to control pathogens in peanut butter products without affecting quality. Non-thermal sterilization methods such as ultrasound (US), ultraviolet (UV) radiation, antimicrobial gas and aerosol, among others, have the ability to inactivate foodborne pathogens consequently preserving the sensory and nutritional quality of food products. US could be combined with several aqueous sanitizers to enhance the antimicrobial activity. We compared the effectiveness of individual treatments (ultrasound and organic acids) and their combination on reducing foodborne pathogens on organic fresh lettuce (5). Lettuce leaves were inoculated with a cocktail of three strains each of E. coli O157:H7, S. typhimurium, and L. monocytogenes and treated with ultrasound (40 kHz) alone, organic acids (0.3, 0.5, 0.7, 1.0, and 2.0% of malic acid, lactic acid, and citric acid) alone and combined with ultrasound and organic acids for 5 min. For all 3 pathogens, the combined treatment of ultrasound and organic acids resulted in additional 0.8 to 1.0 log reduction compared to individual treatments, without causing significant quality change (color and texture) on lettuce during 7 day storage. The maximum reductions of E. coli O157:H7, S. typhimurium, and L.monocytogenes were 2.75, 3.18, and 2.87 log CFU/g observed after combined treatment with ultrasound and 2% of organic acid for 5 min, respectively. Our results suggest that the combined treatment of ultrasound with organic acids was effective at increasing pathogen reduction compared to individual treatments without significantly affecting quality, and demonstrates its potential as a novel method to increase the microbial safety on organic fresh lettuce. UV radiation does not leave a residue and does not involve high cost. The effect of various conditions on inactivation of foodborne pathogens and quality of fresh-cut lettuce during ultraviolet (254 nm, UVC) radiation was investigated (6). Lettuce was inoculated with a cocktail of E. coli O157:H7, S.typhimurium, and L. monocytogenes and treated at different temperatures (4 and 25°C), distances between sample and lamp (10 and 50 cm), type of exposure (illuminated from one or two sides), UV intensities (1.36 to 6.80 mW/cm2), and exposure times (0.5 to 10 min), sequentially. UV treatment at 25°C for 1 min achieved 1.45-, 1.35-, and 2.12-log reductions in surface-inoculated E. coli O157:H7, S.typhimurium, and L. monocytogenes, respectively, whereas the reduction of these pathogens at 4°C was 0.31,0.57, and 1.16 log, respectively. UV radiation was most effective when distance from UV lamp to the sample was minimal (10 cm) and radiation area was maximal (two-sided exposure). All UV intensities significantly (P < 0.05) reduced the three pathogens after 10 min exposure, but the effect of treatment was correlated with UV intensity and exposure time. Color values and texture parameters of lettuce subjected to UV treatment under the optimum conditions 320 Proceedings ASIAHORCS 2013

(25°C, 10 cm between sample and lamp, two-sided exposure, 6.80 mW/cm2) were not significantly (P > 0.05) different from those of non-treated samples up to 5 min exposure. However, these qualities significantly (P b 0.05) changed at prolonged treatment time. These results suggest that UV radiation under optimized conditions could reduce foodborne pathogens without adversely affecting color quality properties of fresh-cut lettuce. Antimicrobial gas and aerosol could be used to increase the microbial safety of fresh produce during transportation and storage. These novel thermal and non-thermal sterilization methods hold potential for producing high-quality and safe food products. We determined the effect of aerosolized sanitizers on the inactivation of E.coli O157:H7, S. typhimurium, and L. monocytogenes biofilms (7). Biofilms were formed on a stainless steel and polyvinyl chloride (PVC) coupon by using a mixture of three strains each of three foodborne pathogens. Six day old biofilms on stainless steel and PVC coupons were treated with aerosolized sodium hypochlorite (SHC;100 ppm) and peracetic acid (100, 200, and 400 ppm) in a model cabinet for 5, 10, 30, and 50 min. Treatment with 100 ppm PAA was more effective than the same concentration of SHC with increasing treatment time. Exposure to 100 ppm SHC and PAA for 50 min significantly (pb0.05) reduced biofilm cells of three foodborne pathogens (0.50 to 3.63 log CFU/coupon and 2.83 to more than 5.78 log CFU/coupon, respectively) compared to the control treatment. Exposure to 200 and 400 ppm PAA was more effective in reducing biofilm cells. Biofilm cells were reduced to below the detection limit (1.48 log CFU/coupon) between 10 and 30 min of exposure. The results of this study suggest that aerosolized sanitizers have a potential as a biofilm control method in the food industry.

References Ban, G. H., & Kang, D. H. (2014). A comparison of saturated steam and superheated steam for inactivation of Escherichia coli O157:H7, Salmonella Typhimurium, and Listeria monocytogenes biofilms on polyvinyl chloride and stainless steel. Food Control, 40, 344–350. Ha, J. W., Ryu, S., & Kang, D. H. (2012). Evaluation of near-infrared pasteurization in controlling Escherichia coli O157:H7, Salmonella Typhimurium, and Listeria monocytogenes in ready-to-eat sliced ham. Applied and Environmental Microbiology, 78, 6458–6465. Lee, S. Y., Sagong, H. G., Ryu, S., & Kang, D. H. (2012). Effect of continuous ohmic heating to inactivate Escherichia coli O157:H7, Salmonella Typhimurium and Listeria monocytogenes in orange juice and tomato juice. Journal of Applied Microbiology, 112, 723–731. Ha, J. W., Ryu, S., & Kang, D. H. (2013). Inactivation of Salmonella Typhimurium and Escherichia coli O157:H7 in peanut butter cracker sandwiches by radio-frequency heating. Food Microbiology, 34, 145–150. bioprocessing for food 321

Sagong, H. G., Lee, S. Y., Chang, P. S., Heu, S. G., Ryu, S., Choi, Y. J., & Kang, D. H.. (2011). Combined effect of ultrasound and organic acids to reduce Escherichia coli O157:H7, Salmonella Typhimurium, and Listeria monocytogenes on organic fresh lettuce. International Journal of Food Microbiology, 145, 287–292. Kim, Y. H., Jeong, S. G., Back, K. H., Park, K. H., Chung, M. S., & Kang, D. H. (2013). Effect of various conditions on inactivation of Escherichia coli O157:H7, Salmonella Typhimurium, and Listeria monocytogenes in fresh-cut lettuce using ultraviolet radiation. International Journal of Food Microbiology, 166, 349–355. Park, S. H., Cheon, H. L., Park, K. H., Chung, M. S., Choi, S. H., Ryu, S., & Kang, D.H. (2012). Inactivation of biofilm cells of foodborne pathogen by aerosolized sanitizers. International Journal of Food Microbiology, 154, 130–134.

Posters

Effect Of Purple Sweet Potato Extract (Ipomoea batatas L.) on the Antioxidant Activity and Nutritional Composition of Diabetes Cookies Based on White Sweet Potato

Ervika Rahayu N. H.1*, Dini A.1, M. Angwar1, Wiwin W.1, Suharwadji2 1Division of Food Science, Technical Implementation Unit for Development of Chemical Engineering Processes, Indonesian Institute of Sciences 2Division of Environmental and Industrial Physics, Research Center for Physics, Indonesian Institute of Sciences, Cisitu-Sangkuriang, Bandung, Indonesia

Abstract The high obesity and decreased physical activity stimulate health issues with the emergence of various degenerative diseases and diabetes mellitus in Indonesia. The research on functional food for diabetes mellitus have been initiated since 2010, through development of cookies from white sweet potato. Purple sweet potato is known to contain antioxidant compounds, i.e. anthocyanin in high quantities. One of antioxidants functions is to suppress oxidative stress in diabetic patient. The purpose of this study is to investigate the effect of purple sweet potato extract addition on antioxidant activity and nutritional composition of diabetes cookies based on white sweet potato. Research methodologies consist of i) creating extract of purple sweet potato, ii) optimizing cookies, and iii) analyzing antioxidant activity and nutritional composition of the product. Purple sweet potato extracts were added to two types of cookies, i.e.i) cookies with protein source from tempeh-eggs (cookies A) and cookies with protein source from tempeh-fish (cookies B). The results showed the addition of purple sweet potato extract can improve antioxidant activity of 5.27% on cookies A and 9.57% on cookies B. There is a change in the nutritional composition of cookies A, as indicated with the increase of fat and protein content amounted 5.80% and 3.42% respectively; and the decrease of ash, crude fiber, and sugar reduction content amounted 6.85%, 1.42% and 8% respectively. Therefore, protein content of cookies B increased 2.54%, while content of ash, fat, crude fiber and reduced sugars decreased 2.46%, 1.28%, 2.78% and 10.15% respectively. Keywords: White sweet potato cookies, purple sweet potato extract, diabetes mellitus, antioxidant activity, nutritional composition

*Corresponding Author Gading, Playen, Gunungkidul, Yogyakarta, Indonesia *E-mail: [email protected], [email protected]

Introduction The high obesity and decreased physical activity stimulate health issues as indicated with the emergence of various degenerative diseases and diabetes mellitus in Indonesia. In Indonesia, the results of Basic Health Research (Riskesdas) in 2007 showed that diabetes was the second cause of death in urban areas and about 5.8% of the rural population were died from diabetes. It was also predicted that the number of people with diabetes will reach 213 million people in year 2030

325 326 Proceedings ASIAHORCS 2013

(Anonym, 2009). The increase of diabetes case in Indonesia stimulate researchers to overcome the disease through new research technologies. Researches on functional food for diabetes mellitus have been initiated since 2010, through development of cookies from white sweet potato. Besides that, purple sweet potato (Ipomoea batatas L.) is known to contain antioxidant compounds, i.e. anthocyanins in high quantities. Anthocyanin content of fresh purple sweet potato is about 0,4-0,6 mg/g wet basis (Anonym, 2008). Many research showed that antioxidants play a role in suppressing oxidative stress due to the condition of hyperglycemia in the body. Hyperglycemia is a symptom of diabetes that occurs when blood glucose levels become very high. Hyperglycemia can induce oxidative stress through the polyol pathway, AGE formation, and auto-oxidation of glucose (Widowati, 2008). Hyperglycemia will cause auto- oxidation of glucose to form free radicals, auto-oxidative glycosylation, and increased polyol pathway which will reduce antioxidants in the body (Ahmed, 2005). Many researches showed the beneficial effect of anthocyanin as antioxidant to hyperglycemia and diabetes condition such as decrease blood glucose, decrease free radical production, increase insulin secretion, and inhibit insulin resistance (Guo et al., 2007; Jawi et al., 2008; Nizamutdinova et al., 2009). However, many studies have not led to the production of functional food products containing antioxidants for people with diabetes. In this regard, research on the production of functional foods for diabetic patients with the addition of an antioxidant extract from purple sweet potato is required. This research aims to study the effect of purple sweet potato extract (Ipomoea batatas L.) on the antioxidant activity and nutritional composition of diabetes cookies based on white sweet potato.

Methods The raw materials used in this research were local purple sweet potatoes var. Ayam obtained from Srigading, Sanden, Bantul, and white sweet potatoes var. Merketek obtained from Magelang. Research methodologies consist of i) creating extract of purple sweet potato, ii) optimizing cookies, and iii) analysing antioxidant activity and nutritional composition of the product. Purple sweet potato extracts were added to two types of cookies, i.e. cookies with protein source from tempeh-eggs (cookies A) and cookies with protein source from tempeh-fish (cookies B). The pretreatment of purple sweet potato was required before extracted. The purple sweet potato was turned into flour first using cabinet dryer with temperature condition about 50°C during 8 hours as described in Figure 1. bioprocessing for food 327

Figure 1. Procedure of making purple sweet potato flour before antioxidant was extracted

The procedure to make an antioxidant extract from purple sweet potato referred to Jiao et al., (2012) with some modification as described in Figure 2. Purple sweet potato flour was extracted to obtain anthocyanin as antioxidant using ethanol solvent. Then, it was evaporated with rotary evaporator 50°C for 8 hours. The N2 gas was used for reducing the ethanol content.

Figure 2. Procedure of extracting antioxidant from purple sweet potato

Furthermore, the extract is added to white sweet potatoes cookies before cookies baking. The procedure of making cookies can be described in Figure 3. This method referred to Meyer (2005) and Hertati (2007) with some modification. 328 Proceedings ASIAHORCS 2013

Figure 3. Procedure of making cookies with antioxidant extract

Purple sweet potato extracts were added to two types of cookies, i.e. cookies with protein source from tempehh-eggs (cookies A) and cookies with protein source from tempehh-fish (cookies B). Antioxidant activity and nutritional analysis were then carried out, which includes fat, protein, ash, crude fiber and sugar content. Antioxidant activity was measured with DPPH radical scavenging method.

Results Research methodologies consisted of i) creating extract of purple sweet potato, ii) optimizing cookies, and iii) analysing antioxidant activity and nutritional composition of the product. Creating extract of purple sweet potato. The purple sweet potato flour pretreatment was needed before extraction process. Flour process is performed to simplify the process of extraction, due to high water content of fresh purple sweet potato. Flouring process was carried out by drying the fresh purple sweet potato using artificial dryer, i.e. the cabinet drier. The research results showed that the fresh purple sweet potato has water content of 63.69% and anthocyanin of 44.24 mg/100 g wet weight or 121.85 mg/100 g dry weight. Purple sweet potato which was used is containing anthocyanin at medium level. Jusuf et al., (2008) reported a purple sweet potato clones of MSU 01022-12 in Balitkabi, Malang which also contains medium anthocyanin in the amount of 33.9 mg/100 g tuber. Flouring process produces yield of 27.22%. The purple sweet potato flour has a water content of 5.28% and anthocyanin content of 91.86 mg/100 g of flour or 96.98 mg/100 g dry weight. Having obtained the purple sweet potato flour, antioxidant extraction with ethanol and analysis of anthocyanin was done. The result showed that the extraction process produces the extract containing 8.31 mg/g anthocyanin. Extraction of antioxidants from 150 g of purple sweet potato bioprocessing for food 329 flour with 750 ml of ethanol solvent will get 1.64 g of purple yam pasta extract which have antioxidant activity for capturing free radical activity equal to 76% by DPPH assay. Optimizing cookies. The antioxidant extract is then fortified into two kinds of cookie dough. Formulation of diabetes cookies refers to the results of the Thematic Research in 2011 (Ariani et al., 2011) which use a white sweet potato flour with formulation as seen in Table 1 and Table 2. The difference of both formulation lies in the use of local flour as protein source, where cookies A using tempeh-egg flour and cookies B using tempeh-fish flour.

Table 1. Formulation of Cookies A Ingredients Cookies A (g) white sweet potato flour 120 wheat flour 80 inulin 40 agar-agar flour 5 tempeh-egg flour 19 skim 7,5 vanilla 2,5 baking powder 1 eggs 35 margarine 100 sorbitol 90

Table 2. Formulation of Cookies B Ingredients Cookies B (g) white sweet potato flour 120 wheat flour 80 inulin 40 agar-agar flour 5 tempeh-fish flour 19 skim 7,5 vanilla 2,5 baking powder 1 eggs 35 margarine 100 sorbitol 90

The next stage is to fortify the diabetes cookies based on sweet potato with antioxidants extract from purple sweet potato. The total amount of 0.23 g pasta antioxidant extract of purple sweet potato was mixed into 500 g of dough of cookies A and cookies B. The mixing is performed before the dough is baked. 330 Proceedings ASIAHORCS 2013

Analysing antioxidant activity and nutritional composition of the product. To determine the antioxidant activity changes during the process of making cookies, cookies without fortification formulation of antioxidant extracts are also made. The antioxidant activity in cookies without and with fortification is then analysed as can be seen in Figure 4. Antioxidant activities of cookies A and of cookies B without the addition of antioxidant extract are 4.02% and 3.52%. Once extracts was added, antioxidant

Figure 4. Comparison of the antioxidant activity of cookies A and cookies B with or without the addition of an antioxidant extract

activity of cookies A and cookies B were 9.29% and 13.09% respectively. The results showed the addition of purple sweet potato extract can improve antioxidant activity of 5.27% on cookies A and 9.57% on cookies B. Based on these results, it is known that cookies without antioxidants fortification have antioxidant activity possibly originated from phenolic compounds in the white sweet potato (Niwa et al., 2011). Given the antioxidant extract fortification on cookies A and cookies B, the analysis result of antioxidant is increased. Although the amount of the antioxidant added to the two kinds of dough is the same (0:23 g), the result of antioxidant activity is measurably different. The increase of antioxidant activity in cookies B is greater than cookies A. This possibly occurs because the formulations of cookies are also different, hence it will affect the antioxidant activity formed. In addition to antioxidant activity testing, the nutritional content of cookies was also tested to find out the effects of antioxidants extract addition toward the nutritional content of final product. The results of the nutritional content analysis can be seen in Table 3 for cookies A and Table 4 for cookies B. bioprocessing for food 331

The water content of cookies A without the addition of extract is equal to 5.26%. Whereas, the additional of antioxidant extract can increase the water

Table 3. Nutritional content of cookies A Analysis Cookies A Cookies A + antioxidant extract %wb %db %wb %db Ash 2,3105 2,4388 2,436 2,6059 Fat 22,4185 23,6636 20,8375 22,2905 Protein 7,8115 8,2453 7,4445 7,9636 Crude fiber 2,146 2,2652 2,1475 2,2972 Reduced Sugar 9,168 9,6772 9,77 10,4513 content until 6.25%. As shown in Table 3 (nutritional composition based on dry basis), there is a change in the nutritional composition of cookies A, as indicated with the increasing content of fat and protein amounted 5.80% and 3.42% respectively; and the decreasing content of ash, crude fiber, and sugar reduction amounted 6.85%, 1.42% and 8% respectively. Hardoko et al., (2008) also reported an increase in fat and decrease in ash content in cookies substituted with purple sweet potato flour compared to the control cookies. Morales et al., (2009) reported that the antioxidant activity of the cookies is affected with duration of roasting time. Further revealed with a risk/benefit index, based on the concomitant formation of neo-formed contaminants and substances with antioxidant activity (potentially health-promoting substances), rapidly increased with increased temperature and time of baking. Misan et al., (2011) reported that supplementation of cookies with a mixture of Petroselinifructus, Frangulae cortex, Menthapiperitae folium, Carvifructus which have antioxidant activity can retard the process of lipid oxidation and elevate antioxidant activity of the cookies.

Table 4. Nutritional content of cookies B Analysis Cookies B Cookies B + antioxidant extract %wb %db %wb %db Ash 2,4455 2,6048 2,504 2,6689 Fat 21,184 22,5639 21,4405 22,8524 Protein 8,029 8,5520 7,8195 8,3344 Crude fiber 2,1205 2,2586 2,178 2,3214 Reduced Sugar 9,01 9,5969 9,918 10,5711 332 Proceedings ASIAHORCS 2013

The water content of cookies B without the addition of extract is equal to 6.12%. With the addition of antioxidant extract, cookies water content increased to 6.18%. As shown in Table 4 (nutritional composition based on dry basis), there is a change in the nutritional composition of cookies B, protein content was increased 2.54%, while content of ash, fat, crude fiber and reduced sugars were decreased 2.46%, 1.28%, 2.78% and 10.15% respectively. The analysis data shown that the addition of an antioxidant extract of purple sweet potato has an influence on the nutritional content of cookies. Azni (2013) showed that substituting purple sweet potato flour with different tempeh flour gave a significant effect to the ash content, protein content and taste of cookies, but no significant effect to the water content, colour, texture, aroma, overall and organoleptic assessment in children. Both formulation of cookies A and cookies B had increased protein content with the addition of an antioxidant extract. The difference of ash content in the study is due to the differences in ash content contained in the raw material.

Acknowledgement This study was supported as part of an incentive program by Indonesian Institute of Sciences. We thank Sri Endartini and Nunung for their assistance in sample preparation during this research.

Reference Ahmed, R. G. (2005). The physiological and biochemical effects of diabetes on the balance between oxidative Stress and antioxidant defense system. Medical Journal of the Islamic World Academy of Sciences, 15, 31–42. Anonym. (2008). Ubi jalar kaya zat gizi dan serat. www.dinkesjatim.go.id. Retrieved on 10 November 2010. Anonym, (2009). Tahun 2030 prevalensi-diabetes-melitus-di-indonesia-mencapai-213-juta-orang. www.depkes.go.id. Retrieved on 10 July 2013. Azni, M. E. (2013). Evaluation quality of cookies with purple sweet potato flour (Ipomea batatas L.), tempeh flour, and small shrimp flour (Aceteserythraeusc). Thesis. Riau University: Indonesia. Ariani, D., Angwar, M. and S. Sentana. (2011). Pengembangan makanan fungsional berbasis umbi-umbian bagi penderita diabetes. Laporan Teknis Kegiatan Penelitian Tematik 2011. Yogyakarta: UPT BPPTK LIPI. Guo, H., Ling, W., Wang, Q., Liu, C., Hu, Y., Xia, M., Feng, X., & Xia, X. (2007). Effect of anthocyanin-rich exract from black rice (Oryza sativa L. Indica) on hyperlipidemia and insulin resistance in fructose-fed rats. Plant Foods for Human Nutrition, 62, 1–6. Hardoko, N. L., & Siregar, T. M. (2008). Utilization of purple sweet potato flour (Ipomoea batatas L. Poir) as natural antioxidant source in cookies. Jurnal Ilmu dan Teknologi Pangan, 6 (1). bioprocessing for food 333

Hertati, R. (2007). Indek glikemik dan efek hipoglikemik kue kering dan roti tawar berbasis tepung garut (Marantha arundinaceae) dan tepung ubi jalar (Ipomoea batatas). Thesis. Gadjah Mada University: Yogyakarta. Jawi, I. M., Dewa, N. S., & Agung N.S. A. (2008). Ubi jalar ungu menurunkan kadar MDA dalam darah dan hati mencit setelah aktivitas fisik maksimal.Jurnal Veteriner, 9 (2), 65–72. Jiao, Y., Yanjie, J., Weiwei, Z., & . Yang, Z. (2012). Studies on antioxidant capacity of anthocyanin extract from purple sweet potato (Ipomoea batatas L.). African Journal of Biotechnology, 11 (27), 7046–7054. Jusuf, M., Rahayuningsih, & Ginting, E. (2008). Ubi Jalar Ungu. Balai Penelitian Tanaman Kacang-kacangan dan Umbi-umbian, Malang. Warta Penelitian dan Pengembangan Pertanian, 30 (4). Meyer, D. (2005). Low GI and low carbohydrate: Product development with inulins claims and labelling. Seminar Food and Drink Innovations. Sensus Manager Scientific and Regulatory Affair. Misan, A., Mimica, D. N., Sakac, M., Mandic, A., Sedej, I., Simurina, O., & V. Tumbas. (2011). Antioxidant activity of medical plant extracts in cookies. Journal of Food Science, 76 (9), 1239–1244. Morales, F. J., Martin, S., Acar, O., Lorenzo, G. A., & V. Gokmen. (2009). Antioxidant activity of cookies and its relationship with heat-processing contaminants: a risk/benefit approach. European Food Research and Technology, 228, 345–354. Niwa, A., Takashi, T., & Hideaki, H. (2011). Ipomoea batatas and Agarics blazei ameliorate diabetic disorders with theurapeutic antioxidant potential in streptozotocin-induced diabetic rats. Journal of Clinical Biochemistry and Nutrition, 48 (3), 194–202. Nizamutdinova, I. T., Jin, Y. C., Chung, J. I., Shin, S. C., Lee, S. J., Seo, H. G., Lee, J. H., Chang, K. C., & Kim, H. J. (2009). The anti-diabetic effect of anthocyanins in streptozotocin- induced diabetic rats through glucose transporter 4 regulation and prevention of insulin resistance and pancreatic apoptosis. Molecular Nutrition & Food Research, 53, 1419–1429. Widowati, Wahyu. (2008). Potensi Antioksidan sebagai Antidiabetes. JKM, 7 (2), 192–202.

Pasting Properties of Pedada (Sonneratia caseolaris) Fruit Flour and Wheat Flour Mixtures

Jariyah, Simon1*, B.Widjanarko2, Yunianta2, Teti Estiasih2, Peter A. Sopade3 1Doctoral Program of Food Science and Technology, Faculty of Agriculture Technology 2 Food Science and Technology, Faculty of Agriculture Technology, Brawijaya University, Malang 3Centre for Nutrition and Food Sciences, Queensland Alliance for Agriculture and Food Innovation, University of Queensland, Australia

Abstract The pasting properties of pedada fruit flour (PFF) mixed (0–100%) with wheat flour (WhF) were studied in water using the Rapid Visco-Analyser (RVA). The pedada fruit flour did not change the pasting patterns of the mixtures, and the pasting temperatures ranged from 66.2–68.8°C. The pedada fruit flour significantly (p < 0.05) decreased the pasting parameters of the mixtures, as it diluted the starch contents. For the PFF:WhF mixtures, the peak viscosity decreased from 4079 to 1651 cP. The pedada fruit flour did not change the setback viscosity of the PFF:WhF mixtures, and there were significant positive correlations (r ≥ 0.78; p ≤ 0.01) between the breakdown and peak viscosities of the mixtures. In pedada fruit composite flours, therefore, more starch-containing base flours are required to achieve the same consistency as the undiluted flours. Keywords: Pedada fruit flour, Wheat flour, Pasting properties

*Corresponding Author Brawijaya University, Malang E-mail: [email protected]

Introduction Pedada (Sonneratia caseolaris) is a species of mangrove which grows at the riverside in Wonorejo, Surabaya. Generally, fruit harvest occurs from July to September. At present, this fruit is consumed only at domestic level. During harvest, each pedada tree can produce up to two kg per day. Ripen fruits cannot be stored under room temperature for more than a day as the fruit perishes rapidly and becomes vulnerable to insect damages. The ripened fruits ofS. caseolaris have an appealing flavor and taste, a result of the inherent high moisture content of fresh fruit. Hence, it could be used to prepare a flour. Previous research has shown that the pedada fruit flour (PFF) is rich in dietary fiber (63.70%) and also has high levels of phenolic compounds (30.61 mg GAE/g of PFF). In medicine, pedada fruits are used as analgesic and anti-inflammatory agent, anti-bacteria, and they possess hepatoprotective and hypoglycemic activity (Bandaranayake, 2002; Sadhu et al., 2006; Charoenteeraboon et al., 2007; Minqing et al., 2009; Ashok et al., 2010). Therefore, pedada fruit flour can be

335 336 Proceedings ASIAHORCS 2013

added to food as a supplement to enhance the beneficial health properties of a variety of food products. Various food products have been produced from it, including syrup, cakes (Kesemat, 2007) and understanding its pasting properties when mixed with wheat flour will further enhance its utilization as a functional ingredient. The research used wheat flour for the mixtures with pedada fruit flour because it is widely used for bakery product. The objective of this study was to observe the pasting properties of the pedada fruit flour when mixed with wheat flour.

Materials and Methods Materials. Pedada fruit (Sonneratia caseolaris) was obtained from Wonorejo, Surabaya, East Java. Plain wheat flour was obtained from a local shop in Brisbane, Australia, where the studies were done. Wheat flour were mixed with the pedada fruit flour in ratios 0–100%, with the mixing done in a rotary mixer overnight (about 12 hr) for homogeneity before analysis.

Methods Processing of pedada fruit flour (PFF). The pedada (Sonneratia caseolaris) fruits were collected and selected randomly from different parts of pedada trees, and were immediately transferred to the laboratory, where they were peeled and blended with distilled water (1:3). The resulting dispersion was sieved 50 mesh to remove seeds and, was dried in a cabinet drier for 15–18 h at 50–60°C, and grounded to pass through 80 mesh sieve. Pasting properties. The pasting properties of the mixtures of the wheat flour with the PFF were determined using the Rapid Visco Analyser (RVA-4, Newport Scientific Pty Ltd., Warriewood, NSW2102, Australia). Distillled water was added to the sample mixtures to give a total weight of 25 g and 15% solids content (from preliminary studies). The RVA Standard Profile 1 (Mahasukhonthachatet al., 2010) was used, and pasting parameters were obtained using Thermocline for Windows. In order to further characterise the pasting properties, the visosity breakdown ratios (BDR) was defined as the ratio of trough to peak viscosity (Waramboi et al., 2011). Statistical Analysis. Samples were randomised and duplicated in all the analyses above. The Minitab_ ver15 software (Minitab Inc., 1829 Pine Hall Road, State College, PA 16801-3008, USA) was used for analysis of variance (ANOVA). A 95% confidence level was used to judge significance. Instead of the standard deviations of the means, standard errors of the means (SE of mean), as obtained from the Minitab, are reported. bioprocessing for food 337

Results and Discussion Pasting Behaviors of Pedada Fruit Flour-Wheat Flour Mixtures. The pedada fruit flour did not significantly (p > 0.05) affect the setback viscosity of the PFF:WhF mixtures (Table 1). This shows that the pedada fruit flour affected the pasting parameters differently. The higher peak, trough and final viscosities at (20:80) compared with that of (0:100) were in order of 5,679.0 cP vs 4,079.3 cP, the trough viscosities 2,777.0 cP vs 1,767.0 cP, final viscosities 3,989.0 cP vs 2,321.3 cP, respectively. Of particular mention is the increase in the pasting parameters at the 20% substitution (PFF:WhF, 20:80). Perhaps, the pedada fruit flour interacted with the starch and non-starch (e.g. protein and fiber) components of the wheat flour to increase swelling. Sasakiet al., (2000) reported that addition of non-starch polysaccharide to wheat flour can increase peak and breakdown viscosity and cause rigid gel as water binding capacity is modified.

Table 1. Pasting Properties of Pedada Fruit Flour Mixtures With Wheat Flour Fraction PV(cP) TV (cP) BV (cP) FV (cP) SV (cP) PT (0C) Mang:WhF 0:100 4079.3± 305.5b 1767.0±31.6c 2977.3±284.4a 2321.3±1053.0b 1219.3±516.3a 66.2±0.5a 20:80 5679.0± 218.1a 2777.0±52.9a 2902.0±171.9a 3938.0±91.1a 1161.0± 49.7a 68.0±0.5a 40:60 4230.7± 64.8b 1929.3±53.9b 2301.3±12.3b 2868.0±68.2ab 938.7± 16.9a 68.7±0.3a 60:40 2907.0±58.7c 1418.0±40.6bc 1489.0±22.8c 2321.3±40.5b 903.3± 7.1a 68.0±0.6a 80:20 1650.7±74.8d 1063.0±46.1c 587.7±49.7d 1902.7±49.7b 839.7± 3.7a 68.8±0.5b a,b.c,d, Superscript with different letter show significant difference ( p < 0.05) by least significant difference test. PV: peak viscosity, TV: trough viscosity, BD: breakdown viscosity, FV: final viscosity, SV: setback viscosity, PT: pasting temperature, PFF: pedada fruit flour, WhF: wheat flour

Figure 1 showed that the addition of pedada fruit flourat 40, 60 and 80% reduced the peak, trough, breakdown and final viscosity when the pasting temperatures increased. The final viscosity is the most commonly used parameter to define sample quality, as it indicates the ability of the material to form a viscous paste or gel after cooking and cooling (Sopade et al., 2006). There was a significant positive correlation (r=0.89, p ≤ 0.01) observed between peak viscosity and breakdown (Figure 2). The breakdown viscosity is caused by rupture of the swollen granules as reported by Collar et al., (2006). The observed decrease in breakdown viscosity following the addition of pedada fruit flour to wheat flour mixtures might be attributed to a decreased rate of starch granule rupturing during RVA processing caused by decrease in the rate and extent of water absorption by starch granules. 338 Proceedings ASIAHORCS 2013

Figure 1. The curve pasting of pedada fruit flour (0, 20, 40, 60 and 80%) mixtures with wheat flour

Figure 2. Relationship between peak and breakdown viscocity of pedada fruit flour mixtures with wheat flour bioprocessing for food 339

The lower values for pasting viscosities are an indication of a reduction in starch available for gelatinization. This reduction is likely due to a general reduction in the content of the pastes because of starch replacement with soluble and insoluble dietary fibers that can additionally retain more water from the starch granules (Collar et al., 2006; Be Miller, 2001). Therefore, the current study found that the soluble dietary fiber in pedada fruit flour i.e. pectins whereas insoluble dietary fiber i.e. cellulose, hemicellulose, lignin, both of them generally known to reduce the viscosity of starch are in agreement with other relevant studies.

Conclusions The pedada fruit flour did not affect the pasting temperature of the mixtures; it suggested that the pectin and other fibre components did not preferentially bind or withdraw water from the starches in the wheat flour. This study revealed that less pedada fruit flour is required to maintain the viscosity of composite flours. It is suggested that mangrove fruit flour can be used in food products by which the ongoing research on food product development is carried out.

Acknowledgement This study was conducted at the Centre for Nutrition & Food Sciences, Queensland Alliance for Agriculture & Food Innovation, University of Queensland, St Lucia, QLD 4072, Australia.

References Ashok, K. T., Viswanadh, V., Ponnapali, M. G., Amtul, Z. A., Radhakrishnan, S. V. S., Sachin, B. A., Madhusudana, K., & Janaswamy, M. R. (2010). Oleanic acid-an α-Glucosidase inhibitory and antihyperglycemic active compound from the fruits of Sonneratia caseolaris. Journal Medicinal and Aromatic Plants, 1,19–23. Bandaranayake, W. M. (2002). Bioactive, bioactive compounds and chemical constituents of mangrove plants. Wetlands Ecology and Management, 10, 421–452. Be Miller, J. N. (2011). Pasting, paste, and gel properties of stacrh-hydrocolloid combinations. Review Carbohydrate Polymers, 86, 386-423. Charoenteeraboon, J., Wetwitayaklung, P., Limmatvapirat, C. , & Paechamud, T. (2007). Hepatoprotective activity from various parts of Sonneratia caseolaris. Plant Medica, 73, 561. Collar, C., Santos, E., & & Rosell, C. M. (2006). Significance of dietary fiber on the viscosimetric pattern of pasted and gelled flour-fiber blends. Cereal Chemistry, 83, 370–376. Kesemat. (2007). The potential of mangrove fruit as an alternative food source. http://www. kesemat.undip.ac.id. Accessed on 16/06/2011. Mahasukhonthachat, K., Sopade, P. A., & Gidley, M. J. (2010). Kinetics of starch digestion and funtional properties of twin-srew extruded sorghum. Journal of Cereal Science, 51, 392–401. 340 Proceedings ASIAHORCS 2013

Minqing , T. D., Haofu, L. I., & Xiaoming, W. B. (2009). Chemical constituents of marine medical mangrove plant Sonneratia caseolaris. Chinese Journal of Oceanology and Limnology, 27, 288–296. Sadhu, S. K., Ahmed, F., Ohtsuki, T., & Ishibashi, M. (2006). Favonoid from Sonneratia caseolaris. Journal Natural Medicine, 60, 264–265. Sasaki, T., Yasui, T., & Matsuki, J. (2000). Influence of non-starch polysaccharides isolated from wheat flour on the gelatinization and gelation of wheat starches. Food Hydrocolloids, 14, 295–303. Sopade, P. A., Hardin, M., Fitzpatrick, P., Desmee, H., & Halley, P. (2006). Macromolecular interactions during gelatinisation and retrogradation in starch- whey systems as studied by Rapid Visco-Analyser. International Journal of Food Engineering, 2, 1–15. Waramboi, J. G., Dennien, S., Gidley, M. J. & Sopade, P. A. (2011). Characterisation of sweetpotato from Papua New Guinea and Australia: Physicochemical, pasting and gelatinisation properties. Journal of Food Chemistry, 126, 1759–1770. Risk Analysis for Staphylococcus aureus in Frozen Pork Meat in the Philippines using the Risk Ranger Tool

Benjamin A. Gonzales* Efren R. Regpala Department of Food Science and Nutrition, University of the Philippines

Abstract This paper applied the risk ranger tool to assess the risk of staphylococcal enterotoxin poisoning involved with frozen pork meat consumption in the Philippines; and to validate the counts and associated risk factors of Staphylococcus aureus in frozen raw meat sold under open-air marketplace conditions. Twelve food poisoning outbreak incidences with the suspect involvement of Staphylococcus aureus have been recorded locally since 1995. The hazard was identified to be an incapacitating dose of Staphylococcal enterotoxin, classified as a mild hazard that affects all members of the consuming population. Consumption of pork from frozen sources was calculated to be at 2.5 g per capita per day. Common forms of processing were deemed to be ineffective in hazard elimination, and recontamination was found to be common, especially through human handling. The risk ranger rating generated was 57/100, or a 1/26,000 chance of being intoxicated after eating products prepared from wet market- bought frozen pork. Counts of Staphylococcus aureus in marketplace conditions monitored within an 8-hour selling period was all already at least 5 log CFU at time 0, with pH ranging from 6.15 to 7.42. Inadequate frozen storage conditions were found for local meat, which had a temperature of 9 –11°C. Larger scale validation studies are recommended for better results. Keywords: Risk ranger, pork meat, wet market, Staphylococcus aureus, enterotoxin, frozen

*Corresponding Author University of the Philippines Diliman Quezon City, 1101, Philippines E-mail: [email protected]

Introduction Staphylococcal food poisoning occurs when people ingest food that has been improperly prepared or stored. To date, there have been at least 21 enterotoxins associated with Staphylococcus aureus reported elsewhere. The severity of the illness depends on the amount of food ingested, the amount of toxin in the ingested food and the general health of the victim, and can range from gastro-intestinal disorders, wound infection, toxic shock, and, in very rare cases, may lead to death (Schelin et al., 2011; Stolmakova, 1968). In the Philippines, there had been 12 cases of food borne illness outbreaks related to Staphylococcus aureus recorded by the Department of Health since 1995. Out of these outbreaks, 3 were associated with products containing pork such as spaghetti with meat sauce, and hotdogs. Staphylococcus aureus are common contaminants in uncooked meat, together with spoilage microorganisms (Doulgeraki et al., 2012). In a study done in the USA, it was found that half of meat and poultry in retail outlets (chilled or frozen

341 342 Proceedings ASIAHORCS 2013

storage and display) were positive for S. aureus (Park, 2011). Improper handling of meat has been seen as a source of Staphylococcal contamination that could lead to food poisoning (Argudin et al., 2010). The growth condition limits for Staphylococci involve pH ranging from 4–10, and temperature from 6–48°C. Consequently, enterotoxin production condition limits are 10–46°C, at a pH range of 5–9.6 (Schelin et al., 2011). It has been reported, both from tests and actual outbreak studies, that Staphylococcal enterotoxin production occurs when Staphylococcus aureus populations reach 5 to 6.5 log CFU/g (Holmberg et al., 1984; BBB–Staphylococcus aureus, N.D.; Albrecht, N.D.; Ninal et al., 2005; Fujikawa et al., 2006). About 20–100 ng of toxin is enough for poisoning symptoms to manifest (Schelin et al., 2011). In controlled conditions, as much as 578 μg/ml of enterotoxin was produced by Staphylococci in a span of 10 hours (Metzger et al., 1973). Normal cooking methods will not be enough to inactivate the heat stable toxins, as these can withstand temperatures of 96–98°C for 90 minutes. Thus, prevention of contamination and conditions that can lead to enterotoxin production is the best course of action to deal with S. aureus. In the Philippines, the local government laws state that chilled, thawed, and frozen meat, must have no intermingling. In addition, there is no fixed time limit for how long chilled, frozen, or thawed meat can be sold. There is, however, a prohibition from re-freezing thawed meat that had not been sold at the end of the said selling period (Alcala, 2012). This study applies the Risk Ranger––a peer-reviewed, spreadsheet-based risk assessment software tool––to evaluate the risks associated with Staphylococcus aureus in frozen pork meats that are sold in Philippine wet markets. Risks are quantified by answering 11 questions using various numerical and semi-quantitative inputs. Furthermore, to validate the risk ratings obtained, the conditions related to toxin production (time, pH, initial Staphylococcal microbial load) in warm and frozen pork in wet markets, in relation to the above mentioned administrative order, were investigated.

Materials and Methods Risk Assessment. The eleven questions of the risk ranger tool were answered by conducting a literature review from journal articles, interviews, archives, and records from both foreign and local statistical and food outbreak databases. Examples of local data include those from government institutions such as the National Statistics Office (NSO), Food and Nutrition Research Institute (FNRI), Bureau of Agricultural Statistics (BAS), National Meat Inspection Service (NMIS) and Department of Health (DOH). Upon consolidating information pertinent to bioprocessing for food 343 a question, the authors agreed upon the answer or choice to be used as input for the risk assessment tool. A validation experiment was then done to compare the risk rating obtained with the microbial parameters under wet market conditions. Wet Market Validation. Wet markets within a 1-hour travel radius from the laboratory were surveyed. From three major wet markets that were initially identified, the Farmer’s Market in Cubao, and the Commonwealth Market, both in Quezon City, were chosen. One vendor for frozen meat per wet market was enlisted and oriented beforehand about the nature and scope of the project. Markets were visited on separate Saturdays, during peak market hours - from 4 am, and ending at around 12–1 pm, to obtain meat samples. Roughly 1 kg newly unboxed or taken out frozen meats were bought upon arrival at the market stalls. Meats were divided into 5 equal parts. One part was taken by the investigators every 2 hours for sampling, while the rest were stored under the actual selling conditions-unboxed frozen meats on the open-air displays; frozen meat samples from Farmer’s Market in Cubao in a chest freezer. Samples were transported to the laboratory within 1 hour, wrapped in the vendors’ polyethylene bags, and stored in chilled, insulated containers (0–7°C) while in transit. Samples were prepared immediately upon arrival at the laboratory. Fifty grams of meat were aseptically weighed in a top loading balance (Sartorius TE 212, d = 0.01 g), and then blended (Oster Osterizer, 350 w) with 450 ml of previously sterilized buffered peptone diluent (Hi Media). The homogenized meat was further serially diluted to reach a 10–3 concentration. Plating and Inoculation. Samples from 10-2 and 10-3 were inoculated into previously prepared plates containing Baird Parker (Hi Media) agar with egg yolk tellurite. Following the method from the Bacteriological Analytical Manual (Bennett and Lancette, 2001), 1 ml from each dilution was divided into 3 plates (0.4, 0.3, 0.3 ml). The plates were then allowed to stand for 1 hour prior to inverted storage at 37°C. Counts were read after 45–48 hours of incubation. Counts from the 3 plates were added and reported as CFU/g of gram positive Staphylococci after factoring in dilution. Confirmatory tests for Staphylococcus aureus were no longer done because of resource limitations. The meat pH was directly measured by sticking the pH meter probe into the muscle part of the meat that was leftover after aseptic weighing. Measurement was done after calibrating the pH meter (Eutech Cyberscan 500) at pH buffers 4 and 7, under a constant temperature of 29°C + 0.50. Readings were done in triplicate and reported as means. Temperature measurement. The temperatures of the chilled meats were measured using a handheld infrared thermometer every time a sample was being obtained 344 Proceedings ASIAHORCS 2013

from the vendors. The newly unboxed samples from Commonwealth Market, however, were not monitored due to certain circumstances.

Results and Discussion Risk Assessment. The risk ranger tool uses a systematic approach that covers the product life from raw form, to processing, post processing control, final preparation, and end-user consumption. In this case, the product identified was frozen raw pork meat, the main process is freezing, post process control involves cold chain, and the final preparation is cooking. The hazard identified was not the pathogen itself, but rather the toxins produced. For quantification, however, the hazard was then defined to be a Staphylococcal viable count of > 5 log CFU/g, which is the population at which toxin production was found to occur. (Holmberg and Blake, 1984; BBB–Staphylococcus aureus, N.D.; Albrecht, N.D.; Ninal and Vasquez, 2005). Tables 1 and 2 summarize the questions, inputs, and outputs obtained from the risk ranger tool. In all confirmed cases of Staphylococcal food poisoning in the Philippine since 1995, no deaths were reported. In the USA, an estimation model based on compilations of actual data on food borne illness frequencies showed an annual occurrence of 185,060 cases of food borne illness,1,753 hospitalizations, and 2 deaths for S. aureus (Mead et al., 1999). In Europe, out of 84 incidences related to Staphylococcus aureus in 2009, 840 cases were recorded, with 153 hospitalizations, and 2 deaths (“European Food Safety Authority”, 2012). Hazard severity was agreed upon to be “mild”, which sometimes requires medical attention. In the above-mentioned studies, otherwise healthy individuals from all ages from infant to more than 65 years old were found to be victims, hence, the general population was considered susceptible. Population-related inputs were calculated based on the latest census population of 92.34 M (National Statistics Office, 2010), adjusted for 2-year growth by factoring in the average annual growth rate. Percentage of Islamic population was also considered in determining the consuming proportion. Per capita pork consumption information was obtained from statistical data (Bureau of Agricultural statistics, 2010). Data for frozen meat consumption was interpolated from pork importation data from 2006–2010 (Bureau of Agricultural Statistics, 2010; Mojica-Sevilla, 2011; USDA Foreign Agricultural Report, 2010). In a 5-year (2003–2008) study by van der Wolf et al., (2012), S. aureus was isolated from 144 out of 22,608 or 0.6% of post-mortem pigs. These were found mostly in the joints and internal organs. The 0.6% accounts only for the presence of S. aureus, not necessarily in amounts or under conditions that would encourage toxin production. The closest option of 1% was therefore chosen for raw material contamination. bioprocessing for food 345

Table 1. Risk Ranger questions and inputs Question Answer/Input Hazard Severity Mild – sometimes requires medical attention Susceptibility of population General – all members of the population Frequency of consumption (days per 100 g 40 consumption) Proportion of population consuming the Most (75%) product Size of consuming population 97,594,040 Contamination probability of raw product per Infrequent (1%) serving Effect of processing No effect on hazards Potential for recontamination after processing Major (50% frequency) Effectiveness of post-processing control system Controlled – mostly reliable systems in place (3- fold increase) Increase in post processing contamination 1000-fold increase needed to cause infection or intoxication Effect of preparation before eating Meal preparation has no effect on the hazards

Table 2. Risk Ranger output Parameter Output Risk Ranger Rating 57/100 Chance of intoxication 1/26,000

The lower limit for Staphylococcal growth and enterotoxin production are 6 and 10°C, respectively (Schelin et al., 2011). The freezing of meat, therefore, does not encourage the growth of pathogens or the increase in the amount of hazardous toxins. In assessing recontamination, both contamination with pathogens, and the increase to acceptable levels during the cold-chain were considered. Human handling is seen as a common cause for staphylococcal contamination (Argudin, et al., 2010). Some internationally recorded outbreaks involving staphylococcal enterotoxins involved S. aureus from human sources, and not for the raw material flora (Doyle et al., 2011). In American retail stores, over 50% of the meat were found to be contaminated with S. aureus pathogens (Park, 2011). Though it was not possible to accurately quantify the chance of contamination after the freezing process, the major or 50% frequency was chosen over the 1% or minor option. In terms of post-processing controls, the “mostly reliable systems in place” option was chosen based on the NMIS guidelines for the accreditation, registration and licensing of meat importers (Molina, 2007) and the Meat Inspeciton Code of the Philippines (Yabes and Yabes, 2004). The aforementioned laws require recording systems, biosecurity measures and sanitary permits from the importers. Furthermore, the NMIS has been granted enough power to enforce and monitor policies pertaining to hygiene and sanitation. 346 Proceedings ASIAHORCS 2013

Although most product standards do not place limits for Staphylococcus aureus for raw meat, the general limit for other products is < 2 CFU/g. Hence, a minimum of 3-log increase or 1000-fold is required to reach the 5 log CFU/g population. For cooking prior to consumption, no effect on the hazard was determined, based on the established heat stability (96–98°C for 90 minutes) of Staphylococcal enterotoxins (Stolmakova, 1968). The risk rating of 57/100 translates to 1/26,000 chance of being intoxicated or 1,000,000 cases of intoxication per year for the entire population. The number obtained is very high compared to the confirmed recorded incidences from DOH data, but is possible if unrecorded cases of intoxication were to be included. It should be noted that the risk ratings may vary depending on where the delineations for “process”, “post process”, and “preparation before eating” are placed. In this case, the main effect was the initial freezing, while the post processes involve the cold chain, and finally, preparation steps as those done in the household immediately prior to consumption. Validation Study. Validation was done to check if prevailing market conditions would encourage microbial growth to levels sufficient for toxin production. Because of the limited resources for this investigatory project, the countable range for gram positive Staphylococci was limited to up to 5.78 log CFU/g only. From Table 3, it can be seen that no samples had counts below 5 log CFU/g. This implies that even at time 0, the carcasses are already contaminated with Staphylococci to a point where toxin production is possible (Holmberg and Blake, 1984). The frozen local meat was presumed to be from leftovers that have not been sold during the previous day. Evidently, the initial count was higher than that of the imported, newly unboxed frozen meat. The local meat was also the first to display degradation in organoleptic properties, as an unpleasant aroma was observed starting from the 4th hour of sampling. Aside from the possibility of enterotoxin production in raw meats, high initial counts for a pathogen like S. aureus might also lower the effectiveness of cooking methods in reducing their counts. In a study by Manguiat and Fang, (2013), pork meat, even after grilling, contained as much as 3.9 log CFU/g of S. aureus, implying that initial microbial loads for raw meat can be much higher. The typical limit for S. aureus in ready to eat foods is < 2 log CFU/g. Though the samples were stored in the prevailing selling conditions of the wet markets for up to 8 hours, in reality, the turnover for both carcasses and boxed, imported frozen meat, are much faster. It was observed that carcasses that were displayed by 4 am were already gone before 9 pm. Consequently, 20 kg boxes of frozen imported meats that were taken out fresh from the freezers for retail sale were sold within less than an hour. bioprocessing for food 347

The pH for optimal Staphylococcal enterotoxin production were determined to be around 6.5–7.3 (Jarvis et al., 1973) or 7–8 (Metzger et al., 1973). Although Table 3. Microbial counts for gram positiveStaphylococci in meat samples (log CFU/g) Time (h) Frozen, Local Frozen, Imported 0 >5.78 5.00 2 >5.78 5.31 4 >5.78 >5.78 6 >5.78 >5.78 8 >5.78 >5.78

Frozen, Local–Farmers Cubao Market Frozen Imported–Commonwealth Market

Figure 1. pH of meat samples over time pH values fluctuated over time, most of the points are well within the range set by Jarvis et al. (1973) for toxin production. This further increases the theoretical risk of toxin production, provided that temperature is also optimal for cell growth and toxin synthesis. The frozen local temperature was measured to be 9–11°C during the whole duration of thaw study. Meanwhile, the investigators were not able to obtain the temperatures for the imported frozen meat. Nonetheless, the local meat temperatures were actually closer to chilled temperatures, which consequently supports the slow but positive growth and toxin production of the pathogen, which occurs at > 6°C and > 10°C, respectively. In the Administrative Order 6 (Alcala, 2012) of the government, chilled temperatures should not go above 10°C. 348 Proceedings ASIAHORCS 2013

Conclusions While staphylococcal intoxication is rarely lethal, risk assessment results indicate that at most, around 1% of the whole population will be affected by eating products made from frozen pork. Initial validation studies suggest that the risk may be higher if actual wet market practices are incorporated on top data from previous studies. Initial counts for presume re-frozen local pork are also higher compared to imported ones. It is recommended that this study be done on a larger scale, and with risk assessment being more definite. Results from further study may help in updating laws and practices relevant to the importation, storage and sale of frozen meat.

Acknowledgement The authors would like to express their gratitude to Dr. Maria Patricia V. Azanza for her guidance in conducting this study.

References Alcala, P. J. (2012). Administrative Order 06 Series of 2012: Rules and regulations on hygienic handling of chilled, frozen, and thawed meats in meat markets. Department of Agriculture. Web. 17 October 2013. Albrecht, J. A. (N.D.). Staphylococcus aureus. University of Nebraska Extension Services Food Safety.Web. 24 September 2012. Argudin, M. A., Mendoza, M. C., & Rodicio, M. R. (2010). Food Poisoning and Staphylococcus aureus Enterotoxin. Toxins, 2 (7), 1751–1773. BBB – Staphylococcus aureus. (N.D.) Foodborne Pathogenic Microorganisms and Natural Toxins Handbook. N.D. fda.gov. Web. 24 September 2012. Bennett, R. W., & Lancette, G. A. (2001). BAM: Staphylococcus aureus. U.S. Food and Drug Administration. Web. September 2013. Bureau of Agricultural Statistics. (2010). Query Results. Retrieved October 20, 2013, from Country Stat Philippines: retrieve from http://countrystat.bas.gov.ph/selection.asp. Bureau of Agricultural Statistics. (2012). Livestock: Supply Utilization Accounts. countrystat. bas.gov.ph. Web. Doyle, M. E., Hartmann, F. A., & Lee Wong, A.M. (2011). Sources of Methicillin-Resistant Staphylococcus aureus (MRSA) and Other Methicillin-Resistant Staphylococci: Implica- tions for our Food Supply?. University of Wisconsin, Madison. Fujikawa, H., & Morozumi, S. (2006). Modeling Staphylococcus aureus growth and enterotoxin production in milk. Food Microbiology, 23, 260–267. Dayrit, M. M., Roces, M. C. R., Magboo, F. P., Medina, I. G., Roque Jr., V. G., Adore-Arce, L. P., & Catindig, N.T. (1995). Food Poisoning Outbreak During the Junior-Senior Prom of Sto Nino de Cabuyao. Department of Health, Manila. bioprocessing for food 349

Dayrit, M. M., Roces, M. C. R., Magboo, F. P., Abad-Viola, G. B., Trabajo, M. E., Roque Jr., V. G., & Cuenco, W. A. (1995). Food Poisoning Outbreak at the EPZA Resettlement Area, Angeles City. Department of Health, Manila. Doulgeraki, A. I., Ercolini, D., Villani, F., & Nychas, G. E. (2012). Spoilage microbiota associated to the storage of raw meat in different conditions.International Journal of Food Microbiology, 157, 130–141. European Food Safety Authority. (2011). The European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-borne Outbreaks in 2009. EFSA Journal, 9 (3), 2090. [378 pp.]. doi:10.2903/j.efsa.2011.2090. Goco, B. A., Lopez, C., Grafil, I., Castillo, T., & Roces, C. (2001). Staphylococcal Food Poisoning in a Public School, Bulacan, 2001. Department of Health, Manila. Holmberg, S. D., & Blake, P. A. (1984). Staphylococcal Food Poisoning in the United States. The Journal of the American Medical Association, 251 (4), 487–489. Jarvis, A. W., Lawrence, R. C., & Pritchard, G. G.. (1973). Production of Staphylococcal Enterotoxins A, B, and C Under Conditions of Controlled pH and Aeration. Infection and Immunity, 7 (6), 847–854. Manguiat, L.S., & Fang, T. J. (2013). Microbial quality of chicken- and pork-based street-vended foods from Taichung, Taiwan, and Laguna, Philippines. Food Microbiology, 36, 57–62. Mead, P.S., Slutsker, L., Dietz, V., McCraig, L.F., Bresee, J.S., Shapiro, C., Griffin, P.M., Tauxr, R.V. (1999). Food-Related Illness and Death in the United States. Emerging Infectious Diseases. (5) 607–25. Metzger, J. F., Johnson, A. D., Collins II, W. S., & McGann, V. (1973). Staphylococcus aureus Enterotoxin B Release (Excretion) Under Controlled Conditions of Fermentation. Applied Microbiology, 25 (5), 770–773. Mojica-Sevilla, F. (2011). The Battle over Pork Importation. http://www.ats-sea.agr.gc.ca/ ase/5986-eng.htm. Web. 8 August 2012. Molina, J. Q. (2007). Administrative order o1 Series of 2007: Accreditation, Registration, and Licensing of Meat Importers , Brokers, Exporters, Traders or Handlers. Department of Agriculture, Quezon City. National Statistics Office. (2010). Home National Statistics Office. Retrieved October 20, 2013, from National Statistics Office: http://web0.psa.gov.ph/. Ninal, M. O., & Vasquez, M. V. R. P. (2005). Staphylococcal Food Intoxication among attendees of the day-care graduation in Barangay Murcia, Concepcion,Tarlac. Department of Health, Manila. Park, A. (2011). What’s Lurking in Your Meat and Poultry? Probably Staph. Time Healthland. Web. 23 September 2012. Roces, M. C. R., Abad-Viola, G. B., & Tolentino, O. P. (1998). Final Report on Food Poisoning Outbreak in Quezon City High Schools. Department of Health, Manila. Roces, M. C. R., Abad-Viola, G., Verdadero, C. P., Brillantes, C. F., & Mendoza, R. Report of Food Poisoning Incident Due to Staphylococcus aureus. Department of Health, Manila. Roces, M. C. R., Abad-Viola, G. B., Fantone, J. F., & Verdadero, C. P. (1998). Final Report on Food Poisoning in Marulas, Valenzuela. Department of Health, Manila. 350 Proceedings ASIAHORCS 2013

Roces, M. C. R., Abad-Viola, G. B., Brillantes, C. F. C., Verdadero, C. P., Roque Jr., V. G., Mendoza, R. O., & Cuenco, W. (1998). Final Report on the Food Poisoning Outbreak in Isabelo de Los Reyes Elementary School, Tondo, Manila. Department of Health, Manila. Roces, M. C. R., Abad-Viola, G. B., Navarro, J. R. P. & Tolentino, O. P. (1998). Food Poisoning Incident in Bangkal 2, Makati City. Department of Health, Manila. Roces, M. C. R., Abad-Viola, G., Pangue, E. P., & Navarro, R. P. (1999). Report of Food Poisoning Incident in Tierra Vista Heights Subdivision, Marikina City. Department of Health, Manila. Roces, M. R. R., Gamaro, M. R. S., Orosco, N. T., Grafil, I. A., Bermudez, M. T. C., & Palaypayon, N. S. (2000). Final Report on Food Poisoning in Payatas, Quezon City. Department of Health, Manila. Roces, M. C. R., Castillo, M. T. G., Goco, B. A., Lopez, C. E., & Grafil, I. A. (2001). Food Poisoning Incident in Lolomboy, Bocaue, Bulacan. Department of Health, Manila. Samonte, G. M. (2004). Staphylococcal foodborne disease outbreak among Philippine Supreme Court Employee During the Employees Association General Assembly –Philippine 2004. Department of Health, Manila. Schelin, J., Wallin-Carlquist, N., Cohn, M. T., Lindqvist, R., Barker, G. C., & Radstrom, P. (2011). The formation of Staphylococcus aureus enterotoxin in food environments and advances in risk assessment. Virulence, 2 (6), 580–592. Stolmakova, A. I. (1968). Staphylococcal Enterotoxin. DTIC Online. Web. 13 October 2012. Van der Wolf, P. J., Rothkamp, A., Junker, K., & de Neeling, A.J. (2012). Staphylococcus aureus (MSSA) and MRSA (CC398) isolated from post-mortem samples from pigs. Veterinary Microbiology, 158, 136–141. Yabes, O. G., & Nazareno, R.P. (2004). Republic Act 9296: Meat Inspection Code of the Philippines. Congress of the Philippines, Metro Manila. Food Science Policy

Full Paper of Oral Presentations

In Search for Ocean-Based Food Sustainability: RCO-LIPI Mission

Zainal Arifin* Research Centre for Oceanography (RCO), Indonesian Institute of Sciences

Abstract The Indonesian population has increased dramatically in the last 60 years, from 84.7 million in 1950, to 238.0 million in 2011, and it is predicted that by 2025 it will reach about 279.3 million. This increased population, along with climate change and the increased demand for fossil fuel, will dominate the Indonesian research agenda in the coming decades. If these factors are not well-managed, there will be negative implications for natural resources, and for environmental and social conditions. The increase in population will lead to the overexploitation of resources both biological and mineral, the degradation of the habitat and a reduction in livelihood opportunities. Considering these issues, and looking ahead to the next 15 years, the Research Centre for Oceanography-Lembaga Ilmu Pengetahuan Indonesia (RCO-LIPI) has focused its mission on how to maintain and restore the health of Indonesian seas in order to provide livelihoods for people, and to meet societal needs in a time of rapid change. The RCO-LIPI research agenda will focus on four main areas: (1) understanding and valuing marine biodiversity, (2) development of the concept of ocean health to support food sustainability, (3) development of marine bio-resources through mariculture and biotechnology, and (4) understanding the role of ocean under climate change conditions. These four research areas that link to societal needs will be initiated through close cooperation with domestic and international research institutes, universities, and industries. Keywords: Food sustainability, RCO, climate change, Marine pollution, Biotechnology

*Corresponding Author Jln. PasirPutih I, AncolTimur Jakarta 14430, Indonesia E-mail: [email protected]

Background Indonesia’s territory is almost 70 percent covered by seas, with 13,466 islands and about 11,000 coastal villages, and it is the center of marine biodiversity in the world. It is not surprising that the sea is an essential aspect in the lives, livelihood and environment of Indonesian people. Fish and seafood are a primary source of protein in many areas, especially in eastern Indonesia. By 2025, the Indonesian demand for fish and seafood is expected to rise, mainly due to an increase in population to about 279 million people. The Indonesian seas can be a large part of the solution to this national food security challenge. In the early 1980s, the Brundtland Report defined sustainable development as development that meets the needs of the present without compromising the ability of the future generations to meet their own needs. Following on from the United Nations Convention on the Law of the Sea (UNCLOS) and the World Summit on Sustainable Development, the Indonesian government has advanced

355 356 Proceedings ASIAHORCS 2013

in its efforts in managing the ocean and coasts, and their living and non-living resources. Despite these efforts, progress has been very limited in many of the priority areas. It is evident that the majority of fish stocks are depleted; coastal habitats continue to be lost or degraded; the hypoxic zones are increasing; and invasive species are expanding. Moreover, the impact of climate change has increased the environmental pressure on the ocean and coasts, such as increasing ocean stratification and reducing nutrient mixing, thus reducing the natural productivity services that can lead to significantly diminished food security from fisheries (Boyce et al., 2010). As almost 60 percent of Indonesian fish come from small scale, mostly traditional, fisheries, the Government of Indonesia has recently pledged about US$63 million for the conservation of coral reefs and associated ecosystems in eastern Indonesia. The Government of Indonesia also pledged to place 20 million hectares of marine territory under marine conservation area management by 2020. So far, approximately 14 million hectares have been demarcated and 5.5 million hectares have been brought under management plans (COREMAP-CTI, 2013). Hence, the conservation and utilization of ocean resources will continue to be an important component of Indonesian economic growth and prosperity. Indonesia will face serious food security issues in the coming decades if a long-term solution to overcome this challenge is not designed and prepared. One of the solutions is actually right in front of our eyes: the high biodiversity of marine life with its potential as a source of health food and drugs, combined with the application of marine biotechnology to utilize these marine bio-resources. There are two approaches to the search for ocean-based food security in order to prevent future catastrophe; these are 1) utilization of coastal bio-resources and 2) exploring the Indonesian exclusive economic zone and beyond. In the present paper, I will focus on the food security issue with an emphasis on food sustainability from the ocean. RCO Mission Toward Ocean-based Food Sustainability. The Indonesian population has increased dramatically in the last 60 years, from 84.7 million in 1950, to 238 million in 2011, and it is predicted by 2025 the Indonesian population will reach about 279.3 million. This increased population, along with climate change issues and the demand for fossil fuel, will dominate the Indonesian research agenda in the next decades. In the context of food security, RCO needs to take several supported steps in order to meet Indonesia’s demand for food such as a change in policy direction, in its research program and infrastructure, as well as an increased research budget. Developing an ocean-based policy may be challenging when most top manag- ers in this country have a terrestrial vision. It would actually be easier if we learned food science policy 357 from the experience of Japan which is ocean-oriented in its development. The Japanese Government policy, their Basic Plan on Ocean Policy (approved by the Japanese Cabinet on April 26th, 2013), states that 1) international cooperation and contribution to international community, 2) wealth and prosperity through ocean development and utilization of the sea, 3) from country protected by the sea to a country that protects the sea, and 4) venturing into the unexplored frontier (Hotta, 2013). This ocean policy was followed by the Strategy on Science, Technology and Innovation (approved by the Japanese Cabinet on June 7th, 2013) stating its commitment to 1) an economy that maintains the world-top-class economic strength and develops sustainably, 2) a society where people can enjoy wellness, security and safety, and 3) an economic society that harmonize with the world and contributes to the progress of mankind. There have been great changes in the area of oceanography in Indonesia in the last ten years. The Aceh tsunami on 26 December 2004 changing the way ocean research is carried out in Indonesia and ocean research and subsequently development conducted by RCO (LIPI) has significantly progressed beyond its original domains. At the same time, society is demanding relevant and applicable research more than ever before, and greater efforts have been made to meet societal expectation. Considering this and looking forward to the next 15 years, RCO has decided to rethink its goals and redefine its research agenda, especially in the area of ocean-based food security. The research agenda will focus on four main areas: 1) understanding and valuing marine biodiversity; 2) development of the concept of ocean health to support food sustainability; 3) development of marine bio-resources through mariculture and biotechnology and 4) understanding the role of ocean under climate change condition (Figure 1). These four research areas that link to societal needs will be initiated through close cooperation with domestic and international research institutes, universities, and industries. Understanding and valuing marine biodiversity. The Indonesian coral reef and its associated ecosystems are a significant productive asset for the country and the millions of fisher people that depend on it. Coral reef ecosystems in Indonesia are also the most diverse in the world, with about 18% of the world’s coral reefs or 5.1 million hectares, and it is considered the epicenter of marine biodiversity in the Coral Triangle. The reefs are diverse in both physical structure (ranging from fringing reefs and atolls to barrier reefs) and in biological community structure, supporting an array of coral species (590 species of stony coral), reef fish (2,500 species), molluscs, crustaceans, and associated fauna and flora (COREMAP-CTI, 2013). 358 Proceedings ASIAHORCS 2013

Despite the high potential of its marine resources, Indonesia is facing various challenges, especially, coastal degradation, destructive fishing and overfishing. As fisheries are critical to Indonesian peoples for food security, as income and livelihoods for communities, and because of their social and cultural importance, the sustainable management of coral-reefs and associated resources (mangroves and seagrasses) are of utmost importance (Figure 2). Hence, it is important to understand the interaction between components of ecosystems in order to manage biodiversity and bio-resource sustainability. Furthermore, valuing and utilizing coral reef, mangrove, and sea-grass resources are fundamental aspect of the management process.

Figure 1. Four research areas that support ocean-based food sustainability

Figure 2. Three main coastal ecosystems (mangrove, seagrass and coral reefs) that support fish and seafood production (photo: W. Kiswara)

RCO-LIPI through research and monitoring of three main coastal ecosystems, mangrove, seagrass and coral reef, will help to maintain and improve the quality of ocean-based food sources over the next five years. Research on ecosystem connectivity aspects through DNA barcoding, life histories of species, and population dynamics, will constitute the main agenda. In partnership with the University of Queensland (Australia), ZMT (German), IOC-UNESCO Westpac and other international organizations, RCO-LIPI will explore the fundamental food science policy 359 relationship between the ecological values of healthy mangrove, seagrass and coral reef ecosystems and the economic value of their ecosystem services. Moreover, through open sea expeditions Widya Nusantara Expedition, RCO-LIPI will explore the Indonesian Exclusive Economic Zone (I-EEZ) to discover not only potential food sources and deep-sea microbes with potential as medicine but also any potential alternative energy sources from the Indonesian seas. Development of the concept of health of the ocean to support food sustainability. The Asian oceanic rim is the world’s most economically dynamic region, with 61% of global population and 14 of the world’s 20 top container ports (Thranert, 2013; Figure 3).This rapid development through industrialization and urbanization has led to economic success in many Asian rim countries including Indonesia, but it has not been without negative impact on the natural seascape, and habitat of fisheries. For example, the areas along the main shipping lanes have been regularly faced with tar-ball pollution from cargo ships and tankers, such as in Riau Archipelago and the coastal area along the Malacca Strait. Transportation of alien species is also a problem with its potential to destroy the local habitat and to change marine biodiversity. Furthermore, most northern coastal Java seascapes have been altered so that what used to be mangrove forest belts producing shrimps and milkfishes in the 1960s has now become an unproductive zone due to pollution and an aerobic or hypoxic condition.

Figure 3. Main shipping lanes pass through Indonesian archipelago (Thranert, 2013). 360 Proceedings ASIAHORCS 2013

Excess nutrients from sewage outfall and agricultural runoff have contributed to a rise in the number of hypoxia or anoxic areas resulting in the collapse of some ecosystems (IOC/UNESCO, 2011). Similar conditions have arisen in Indonesian coastal waters in recent years, for example urban coastal areas (Jakarta Bay, Ambon Bay, Lampung Bay) have experience phytoplankton blooming followed by fish-kill due to anoxic conditions. The disposal of tailings from mining (Poling et al., 2002), port and harbor operations, urban development and construction, and manufacturing, among other things, are all sources of marine pollution that are threatening coastal and marine habitats. These various forms of marine pollution impair the ocean’s capacity to provide food and other marketable and non-marketable services. At a global level, coastal habitats are under pressure, with about 20% of the world coral reef lost and another 20% degraded (Wilkinson 2008 in IOC/ UNESCO et al., 2011). Mangroves have been reduced to 30% to 50% of their historical cover, and about 29% of seagrass meadows have disappeared since the early eighteen hundreds (Nellemann et al., 2009 in IOC/UNESCO et al., 2011). A similar situation is also occurring in Indonesia, although in many coastal areas the habitat destruction is slowing down due to both community and government efforts such as coral reef rehabilitation programs (COREMAP). Under COREMAP, RCO-LIPI in closed cooperation with the Ministry of Fisheries and Marine Affairs is responsible for monitoring and evaluation the health of coral reef and its associated ecosystems at national level. RCO-LIPI also supports ocean health through research activities on the development of early warning indicators of pollution and indices of the health of the coast and ocean ecosystems. Bioremediation and restoration of damaged ecosystems are also an integral part of the research agenda for managing the impact of both land and marine-based pollution. Development of marine bio-resources through mariculture and biotechno logy. Marine living resources are important to Indonesia for food security, as income and livelihood for local communities, as well as providing social and cultural assets. Most Indonesian fish production is from capture fisheries even though capture fishing is stagnating. In contrast, mariculture is increasing and continues to expand as the demand for food fish and seafood increases. At present, mariculture in Indonesia is not well developed compared to the agricultural sector. Yet the potential species to be cultured and the availability of areas to be developed are very promising for food sustainability in Indonesia. On average, fewer than 7% of the total numbers of species have been utilized (Table 1). An average of bio-resources utilization is as follows, 2.6% for fishes, 6.5% for crustaceans, 1.0% for bivalves, 2.8% for gastropods, 1.9% for sea cucumbers and 0.6% for macroalgae. The number of species that has been cultured could be food science policy 361

Table 1. Total number of marine living resources and current utilized species (data from picto- rial R & D Centre for Fisheries Resources) Taxonomic group Total Number of Number of Utilized Note Species species Fishes 3476 82 Food source Crustaceans 309 20 Food source and health food Bivalves 2000 20 Food source Gastropods 494 14 Food source Echinoderms 557 11 Food and Health food Macro-algae 981 6 Health food source, cosmetics Sponge 907 - Potential for drugs source even lower than the average for bioresource utilization. So, there is great potential for developing mariculture, not only for supplying food, but also for health and medicines (drugs). Major changes in mariculture practices will become the trend in the next decades as the concept of the blue carbon economy becomes part of the mainstream economy (Dahuri, 2013). Currently, mariculture or aquaculture predominantly focuses on carnivorous fishes, shrimps and mud crabs. Blue practice in mariculture will promote the growth of extractive species such as seaweed, shellfish and lower trophic level farming which convert food to fish protein more efficiently than carnivorous species. The RCO research program on the development of bio-resources will focus on the integrated multi-trophic levels aquaculture (IMT). At present, RCO develops several potential candidates for IMT culture, such as abalone, top-shells, marine snail and sea cucumber, along with seaweed or milkfish. Moreover, bioresource development will also utilize biotechnology instrument to improve product quality and product safety. Hence, the selection of potential species will become a part of RCO-LIPI’s effort to meet the needs of fisher people and help them develop existing and new food products. The ocean under climate change conditions. Climate change and climate variability alter ocean conditions include water temperature, ocean currents, ocean stratification and coastal upwelling. Such changes in ocean conditions affect primary productivity, species distribution, community and food-web structures that have direct and indirect impacts on the distribution and productivity of marine organisms (Cheung et al., 2010). He also stated that fish and invertebrates generally tend to shift their distributions toward higher latitudes and deeper water, with projected rates of range shift of about 30–130 km decade-1 towards the pole and 3.5 m decade-1 to deeper waters. Rising ocean temperatures are shifting the locations where given species of fish species can live and find food. The shifting catch potential due to rising ocean temperature was modelled by Cheung et al. (2010). He predicted that Indonesian 362 Proceedings ASIAHORCS 2013

Figure 4. Change in maximum catch potential (10 year average) from 2005 to 2055 under a higher greenhouse gas emission scenario (Cheung et al., 2010)

Economic Exclusive Zone region will lose up to 45% of its maximum catch potential due to rising seawater temperature (Figure 4). The results indicate that we need to develop a policy to guide adaptations that could minimize climate change impacts on fisheries. Oceans absorb large amounts of carbon dioxide, resulting in the pH decline; a recent study showed that pH concentration has declined by 30% since the industrial revolution. This rapid change in ocean chemistry, called ocean acidification, is threatening habitat such as coral, and the future of shellfish like oysters, clams and mussels. This will have an especially large impact on coastal communities whose diet depends heavily on fish and seafood. The mean cost of climate change for Indonesia, the Philippines, Thailand and Vietnam could be equivalent to losing 6.7% of combined GDP each year. The average yearly cost of adaptation measures in the four countries by 2020 is around $ 5 billion (ADB, 2013). Hence, to anticipate the impact of climate change on food security, climate change research at RCO-LIPI will focus on a climate change adaptation strategy for coastal communities. It will compare soft and hard adaptation strategies to cope with the impact of climate change on coastal communities that are socioeconomically vulnerable. Ocean acidification, biogeochemistry of carbon sink/source of coastal ecosystems (Hood et al., 2011), and development of the best species for aquaculture under climate change conditions will be among priorities on the research agenda in the coming years.

Conclusions To sustain the Indonesia seas as source of food and seafood, there should be an ocean policy shift, human resource development, and a focus on the revised ocean research agenda. In the context of research, several options can be pursued in order to maintain the ocean ecosystem as the source of food for Indonesia in the future, they are understanding of marine biodiversity and its values, utilizing marine resources through biotechnological development (mariculture and biotechnology), food science policy 363 maintaining and conserving the health of the ocean for food sustainability, and lastly to improve our understanding of the ocean under climate change conditions. To address the climate change issue, the paradigm of the blue carbon economy will be an important research agenda item in the coming years. RCO-LIPI will add to its agenda, undertaking research to better understand climate change and its impact, risks and vulnerability, and adaptation needs at local levels. Furthermore, RCO-LIPI also needs to develop a regional research and development network for ocean research among universities, industries and international organizations in order to strengthen its research capacity.

Acknowledgment I would like to thank all colleagues who have contributed to the idea on this RCO mission on the issue of food sustainability including Mr. W. Kiswara and Mr. Udhi, among others. Thanks are also extended to the Bureau of International Cooperation for Science and Technology LIPI for supporting my travel to attend the Asian Heads of Research Council (ASIAHORC) 2013. Last but not least, I would like to thank Dr. Mari Rydwen for helping to improve the manuscript.

References ADB. (2013). Food security in Asia and the Pacific. Asian Development Bank, Mandalayong City, Manila. Boyce, D. G., Lewis, M. R., & Worm, B. (2010). Global phytoplankton decline over the past century. Nature, doi:10 (1038), 591–596. Cheung, W. W. L., Lam, V. W. Y., Sarmiento, J. G., Kearney, K., Watson, R., Zeller, D., & Pauly, D. (2010). Large-scale redistribution of maximum fisheries catch potential in the global ocean under climate change. Global Change Biology, 16, 24–35, doi:10.1111 /j.1365-2486.2009.01995. COREMAP-CTI. (2013). Coral reef rehabilitation and management program –coral triangle initative (COREMAP-cti) Project. Report No: PAD376. Jakarta: World Bank Office. Dahuri, R. (2013). Blue strategy of Indonesia. Bogor: Rokhmin Dahuri Institute. P. 76. Hotta, H. (2013). Achievements and future vision of JAMSTEC. 7th World Ocean Forum 2013: Marine Megatrends in the Northeast Asian Rim, South Korea. P. 15–23. Hood, R. R., Navqi, S. A. W., Wiggert, J. D., Landry, M. R., Rixen, T., Beckley, L. E., Goyet, C., Cowie, G. L., & Maddison, L. M. (2011). Sustained Indian Ocean Biogeochemistry and Ecosystem Research (SIBER): Science Plan and Implementation Strategy. IMBER Report No. 4-SIBER Report No. 1. P.111. IOC/UNESCO, IMO, FAO, UNDP. (2011). A blue print for ocean and coastal sustainability. Paris:IO/UNESCO. P. 42. Poling, G., Ellis, D. V., Murray, J. W., Parsons, T. R., & Pelletier, C. A. (2002). Underwater tailing placement at Island Copper Mine. Society for Mining, Metallurgy. Thranert, O. (2013). Strategic trends 2013. Centre for Security Study, ETH Zurich.

Reveal About the Forgotten Potency of Food Germplasm other than Rice in Indonesia

Supli Effendi Rahim1 and Nurhayati Damiri2* 1 Head of Research Institute, Agrotechnology Department, Faculty of Agriculture, Palembang University 2 Agrotechnology Department, Faculty of Agriculture, Sriwijaya University

Abstract Indonesia is an agricultural country with high rice consumption as a staple food. This high rice consumption often causes shortage domestic supply. Government has to import rice and other food stuffs to fulfil the food needs which cannot be provided by domestic production. To reduce dependency on staple food rice, food diversification program is indispensable. Food diversification program can be a strategic move, considering the implementation which can be faster, as compared to other programs such as the intensification and expansion of planting area. This paper attempts to expose the forgotten potency of food germplasm other than rice in Indonesia. This paper suggests that land ownership should be reformed before food diversification program is implemented. Food crops other than rice are plentiful in species and offer a lot of benefits. All of the food crops, that contain reasonable amount of protein, lipid and carbohydrate, can grow well in most of Indonesia’s farmland and have the capacity to yield larger than rice. For example, cassava can yield up to 80 tonnes/ha and huge areas of sleeping land that can be planted for the food crops. All parties are required to change the mindset of “meals are equal to rice” to be “meals are not necessarily rice”. The use of technology on production process must be adopted at the district levels. The construction of the new mindset for the food habit on traditional food will raise the local awareness on consuming local food product. It must be supported by the media (printed and electronic) as means of promotion because the use of image building through media advertisement is an effective way to deliver the new mindset about traditional food to the consumer. Keywords: Food germplasm, diversification, yield potency, technology, food crops

*Corresponding Author Indralaya, Ogan Ilir, South Sumatra, Indonesia E-mail: [email protected]

Introduction The World Commission on Environment and Development (WCED) in 1987 called an attention to the two major issues and challenges facing world agriculture namely 1) the food needs of present and future must be met, and 2) the need for a new approach to agricultural development. In recent years, the world’s attention on food security is increasing because the demand on food continues to increase along with the world population growth. Food is widely produced, however world food is far from surplus, that is why so many people are still starving (Barichello, 2000).

365 366 Proceedings ASIAHORCS 2013

Developing food security in a country such as Indonesia is a kind of sharing responsibility between government, private and community. Food security is the fulfilment of the condition of the food which is up to the individual to the state, which is reflected in the availability of sufficient food, both in quantity and quality, safe, diverse, nutritious, equitable, and affordable and does not conflict with religion, beliefs, and culture of the community, to be able to live healthy, active, productive and sustainable (Indonesian National Decree no. 18 year 2012). In line with the definition of food security, academia and government agencies can play a role, either directly or indirectly, in increasing food diversification program to reduce the dependence on certain basic food. The food diversification program should consider the consumption pattern of Indonesian society which is still face some problem on the diversity, nutritional balance, safety, and the way to reduce the domination of rice as staple food (Food Security Agency, 2008; MOA, 2010). Indonesia is an agricultural country which has rich flora and fauna (Cahyana and Parlan, 2004). However, due to a mistake of the Indonesian Government which paid too much attention on rice as a staple food, it caused an unpleasant condition of food security. Rice consumption remains high from year to year. As a consequence, this country has to import rice with lots of quantity. Apart from rice, this country also imports a lot of wheat grain, wheat flour, cow meat, chicken meat, cassava, potatoes, corn, sugar and salt (See Table 1).

Table 1. Commodity Import volumes and value on 2012 Volum of import US $ No Commodity Countries of origin (millions ton) (millions) 1 Rice 1.8 945.6 Vietnam, Thailand, India, Pakistan, China 2 Corn 1.7 1200 India, Argentina, Pakistan, Brazil, USA 3 Soybean 1.9 USA, Malaysia, South Africa, Uru- guay, Canada 4 Grain of Wheat 6.3 2300 Australia, Canada, USA, Ukraina, India 5 Wheat flour 0.48 189 Sri Lanka, Turkey, Ukraina, Belgia, Australia 6 Sugar 0.09 62 Thailand, Australia, South Korea, Malaysia, New Zealand 7 Cow meat and 0.04 158 Australia, New Zealand, USA chicken meat 8 Salt 2.2 108 Australia, India, New Zealand, China, Germany 9 Cassava 0.013 3.4 Thailand, China, Vietnam 10 Potato 0.054 36.4 Australia, USA, China, Canada, Arab Saudi Source: Central Bureau of Statistics, 2013. food science policy 367

The abundant source of food, rich in flora and fauna, was apparently notable to reduce the Indonesia’s dependency on imported food. However, it cannot be done because the government fails to implement the food diversification program. Food diversification should lead to a better nutritional status and health, as well as the increased participation of society. According to Hariyadi et al., (2003) achieving food diversification can be done from two aspects, namely the consumption and production of base and focal point of development. Consumption aspect includes efforts to reduce rice consumption in daily foods, while production aspect includes efforts to produce foods other than rice. According to the Centers Consumption and Food Safety, National Food Security Agency (2006), the conceptual of food diversification can be seen from the components of the food system, the diversification of production, distribution and provision of food and food consumption. The problem is the consumption of food which not only about the balance of the composition, but also on the fulfillment of the nutritional adequacy. Nainggolan (2007) stated that one of the programs that are run by the Government of Indonesia is a food self-sufficient village program, the process of community empowerment which covered 604 villages in 180 districts. The affinity groups in food self-sufficient village program were trained to utilize locally available food (non-rice), associated with the local culture. The government expects rice consumption to be reduced from the current annual rate of 139 kp/capita to about 106 kg/capita in 2030. By having lower consumption on rice, the government will not spend too much energy on solving the rice problem and more importantly on maintaining people’s health. Food diversification program is selected as a key step on solving the problem on food security because the time on implementing the program is shorter than the other programs, such as the land expansion and land intensification. By using diversification program, people can utilize the available land by planting crops that can be consumed as staple food other than rice, such as breadfruit, corn, yams, and other tubers. Policy instruments are embodied in Presidential Decree No. 22/2009 on the Acceleration of Food Consumption Based on Local Resources. Operationalization of the regulation is followed by the Regulation of the Minister of Agriculture No. 43/Permentan/OT.140/10/2009, about The Acceleration Movement on Food Consumption Based on Local Resources (Food Security Agency, 2006). Food consumption patterns with high dependence on single type of food can cause some problems. First, the state of food will always be vulnerable because if there is a deficiency in this type of food, problem in the community will arise. In the state level, the government must import the food in which may cause dependence to the rice-exporting countries to fulfil the domestic market. Second, the pattern of food consumption that promotes one type of food cannot guarantee 368 Proceedings ASIAHORCS 2013

adequate nutritional balance. It means that in order to improve the nutritional quality of the food consumption patterns, it will require diversification (Siregar, 2009). Consumption of local food in each region should be developed in order to support the food security within Indonesia. This paper attempts to expose the forgotten potency of food germplasm other than rice in Indonesia namely breadfruit, taro, sweet potato, cassava and sago. Potency of food germplasm other than rice. Indonesia is a rich country in germplasm, including germplasm for food crops at the level of species. This paper will discuss some kinds of forgotten food crops namely breadfruit, taro, cassava, sago and sweet potatoes. Those kinds of forgotten crops will be used as the additional food crops other than rice and it can be cultivated on different agro- ecological zones. The properties of the first generation of plants will be inherited to the offspring generation. Quality germplasm will inherit the properties, for example, cassava butter will inherit the properties of cassava butter; sweet potatoes of Cilembu will inherit the properties of sweet potato Cilembu; any other plant groups will also inherit its properties (Soemantri et al., 2008). Tables 2, 3, 4, 5 and 6 show the comparison of the origin, agroclimate and usages for the selected food crops as sources of carbohydrate other than rice. Each of the food crops has plentiful species and offers a lot of usages. Table 3 shows that all the food crops contain reasonable amount of protein, lipid and carbohydrate. Those tables also show that all of the crops can grow well in a broad farmland within Indonesia. All of the food crops other than rice were understood to have the capacity to yield larger than rice yield, especially cassava that can yield up to 80 tonnes/ha. It can be seen on Table 5 that in all main islands of Indonesia there is an exist of soil type suitable for most of the forgotten food crops. There are huge areas of sleeping land that can be planted for the food crops if the government and the people want to get sufficient food in the future. The last table shows that there is an exit strategy to fulfill the gaps on food production and consumption which can be implemented to increase the total food production in Indonesia. Saleh et al., (2011) believed that Indonesia will reach a surplus in cassava if the intensification and extensification of cassava are well planned and carried out throughout the country. The authors have similar believe that all crops other than rice discussed here will make surplus in food availability, distribution and consumption, if all parties, including government, pay serious attention and make greater efforts to make the food diversification program on the basis of those local germplasm successfully. So then, Indonesia will definitely not need to import foods as sources of carbohydrate anymore. food science policy 369

Table 2. Comparing the origin, agroclimate and the usages of food crops No Name Origin Usages 1 Paddy rice, Family gramina- Benggala India, some Staple food, flour for cake, ceae; plentiful species said China noodle, for baby feed such red rice, animal feed 2 Breadfruit; a number of From nusantara and Like bread, flour for cake genus papua 3 Taro From South east Asia Food, greening program, Family araceae, plentiful animal feed etc species 4 Sago; From Maluku and Stape food, flour, cake, tradi- family Palmae Jussieu, sub- Papua tional food family Calamoideae, and genus Metroxylon. 5 Cassava; plentiful species Brazil, south America Food crop, various cakes, and cultivars bread, raw material for industries, bio-ethanol, and animal feed 6 Sweet potato; plentiful West of south In Korea- leaf and petiole species America used as healthy food

Table 3. Comparison of Nutrient Content for a Number of Food Products No Food material Nutrient Energy’(k. Protein Lipid Charbo. Ash Water cal) (g) (g) (g) (g) (g) 1 Rice 360 6.8 0.7 78.9 - 13.0 2 Breadfruit 670 1.1 1.8 27.1 - 3 Taro 376 3.4 0.8 88.7 1.4 5.7 4 Cassava flour 359 1.4 0.9 86.5 1.9 7.8 5 Purple sweet potato 375 3.0 0.55 89.5 - - 6 Yellow sweet potato 375 2.5 0.6 90.0 - - 7 White sweet potato 371 4.0 0.35 88.0 - - 8 Sago flour 353 0.7 0.2 84.7 - 14.0 9 Yam* 88 0.6 0.3 51.88 3.66 10.89

*for more details, see Nurhayati and Rahim (2013). 370 Proceedings ASIAHORCS 2013

Table 4. Comparing the agroclimate, yields potency, post harvest uses of selected food germplasm in Indonesia No Name Performance Agroclimate Potency yield (ton/ha) 1 Rice Grows in all types of soil, high 3–5 organic matter content, high rainfall (>200 mm/month), pH 5.5–5.75

2 Bread fruit Grow in different types of soil, such 16–20 as soil Podsolic Red Yellow, calcare- ous soils and tidal marsh. Grow well at 400 masl and rain of 2000 mm

3 Taro Can grow well on soils with high or- 4–16 ganic matter content, rain of around 1000 m, less than 1100 m asl

4 Sago Grows in freshwater marshes or 12–40 peat swamp areas and in areas along the river, around water sources, or in the swamp forest is not too high salinity 5 Cassava Grows in all types of soil, with 20–800 1500–2000 mm rain/year, soil with light texture and high organic matter is best, at 10–1500 m asl

6 Sweet po- Can grow in all types of soil, with 20–40 tato rain 750–1500 mm, best sandy clay loam soil and good drainage

Source: various sources. food science policy 371

Table 5. Distribution and area of soil types of inceptisol, alfisol and ultisol in Indonesia Soil type and area (000 ha) Sleeping Climate type (%) Province land Inceptisol Alfisol Ultisol (000 ha) Wet Dry North Sumatra 2517 36 855 244 100 0 West Sumatra 1700 14 1472 321 100 0 Riau 1676 0 2230 273 100 0 Jambi 1209 0 973 349 100 0 Bengkulu 894 0 609 166 100 0 South Sumatra 1635 0 1602 1022 100 0 Lampung 967 0 467 97 100 0 Total Sumatra 8638 50 6678 2383 West Java 1666 252 844 14 60 40 Central Java 1172 365 368 0 36 64 Yogyakarta 54 - 12 0 14 86 East Java 1399 436 26 0 19 81 Total Java 4231 1305 1250 14 East Nusa Tenggara 1963 296 56 785 6 94 West Kalimantan 3271 0 5744 1729 100 0 Central kalimantan 1932 0 4829 1172 100 0 East Kalimantan 5821 0 9827 1787 100 0 Total Kalimantan 11024 20400 4689 4688 South Sulawesi 2361 583 1558 996 63 37 South East Sulawesi 1479 197 722 282 62 38 Total Sulawesi 3840 780 2280 1278

Sources: Radjit et al. (2010). 372 Proceedings ASIAHORCS 2013

Table 6. Production gaps and strategy to increase the production of the food crops in the future No Food crop Current productivity Future productivity Prod. Strategy to increase (ton/ha) (ton/ha) Gap the yields

1 Paddy rice 3–5 7–10 4 Extensification and intensification 2 Breadfruit 10 30 20 Extensification and intensification 3 Taro 4 16 12 Extensification and intensification 4 Sago 12 40 28 Intensification

5 Cassava 10 80 70 Extensification and intensification 6 Sweet 10 40 30 Extensification potato

Source: a number of sources.

Land reform before food diversification. To move out of the food import dependency and poverty alleviation of farmers, Indonesia should build its self- sufficiency and food sovereignty (Swastika, 2011). What is important to realize that? First, we need to reform land ownership. Most of the farmers are having less than 0.5 ha of farmland, which is called the small farmers. Indonesia’s statistics data showed that the small farmers in Indonesia increased from 13.66 million people in 1993 to 15.60 million in 2008. This country has a comparison between the land and the narrowest in the world being 354 m2/capita in 2008 (Adnyana, 2005; Swatika, 2011). A large number of small farmers reflect the increasing number of farmers who are close to suffer in poverty situation. Second, if the land allocation was done from rich to poor peasant farmers, hence sovereignty and self-sufficiency can be achieved by exploiting the diversity of local foods which are derived from food germplasm such as breadfruit, taro, sago, cassava, and sweet potato. Third, establishing agriculture-based industries in rural areas. The establishment of such industries must be developed by the governments by making a good channeling with private companies. Integrated approach for food diversification.Developing non-rice commodities, as mentioned earlier, requires integrated approaches. Apart from technical approach, the development of non-rice commodities is to become widely accepted by the people in general. It is not an easy task, nor difficult. What is required here is that the Government of Indonesia must build a strong commitment to change the former mindset of most people in country from meals are equal to rice“ to become “meals are not necessarily rice”. food science policy 373

Having built a strong commitment to change such mindset, the technological approaches should be laid down. The use of advance technology on production must be part of the strategies and should be transferred to the district levels in all over Indonesia. The production of the food crops namely breadfruit, taro, sago, cassava and sweet potato must be in line with the industries in terms of its numbers, capacities and the organizations. To achieve reasonably high levels of productions of the crops, it should be well-guided in accordance with the technical guidance that is published by ministry of agriculture or alike. In the books, it should be made clear about the technology for production increase. The books must include the intensification purpose namely high yield varieties for certain areas, planting distance, dosages of fertilizers. For extensification purpose, it is widely open (as can be seen in Table 5) that huge areas of sleeping land are availabe in most provinces such as in Sumatra, Kalimantan and Sulawesi. Large areas of sleeping land are also available in Papua. The following strategies should also be applied in the development of foods of non-rice germplasm as a staple food: 1) Research and development continuously in order to explore various sources of traditional food from various regions and examines the characteristics of its superiority especially the nutritious for health. This is in line with the nature of traditional foods as a functional food. From the results of the research and finding, some potential species/diversity of traditional food could be selected, maintained and developed (Hidayat and Astuti, 2009); (Hidayat et al., 2001); (Hidayat and Munawaroh, 2009) . 2) Examine certain traditional foods that have some characteristics as a) the potential to be developed, both in terms of efficacy, and b) the chances for acceptance by consumers, and in terms of techno-economic analysis. For example, on tubers and cassava/manioc with improved processing methods and the use of technology into products, such as getuk “Trio”, getuk “Salatiga”, and getuk “Sukaraja”, and pempek palembang which led a significant increase in economic value and characterizes these areas respectively. 3) Improve the quality, security, and prestige of traditional foods such as the selection of raw materials and better supplementary materials, more hygienic handling and practical as well as better appealing presentation of the product. One of the absolute requirement of a food product is the safety on the possible or potential side effect that may cause health problems on consuming these foods. To produce food products for safety consumption, the treatment process should be kept as clean as possible in order to minimize the contaminants into the food. The presentation of traditional foods are generally still weak, even the food displays in traditional markets and sales made by sellers that mix vegetables, herbs, 374 Proceedings ASIAHORCS 2013

and so on. This makes traditional food labels increasingly familiar with cheap and unhygienic. Equipment for places serving traditional meals are not specific, often seen is “shabby”, for example, the seller of various kinds of porridge. The product presentation is closely related to the image of the product and to expand the consumer market acceptance. The presentation on traditional foods needs to be improved. Interesting presentation of the food products also cannot be separated from the way of packaging. Packaging can also be a characteristic of the product, such as packaging shapes of leaves, for example between meals arem-arem and patio will be different. In addition to packaging, traditional food producers should ideally be able to provide a lot of information as a means of promotion. Presentation is closely related to the image of excellence. Popularizing traditional food, including processing means practicality and usefulness for health in the broader consumer through various types of printed or electronic media is right on target. Traditional foods must be able to adapt to the changing demands of consumer’s lifestyle and their daily diet. Future generations are exposed to natural and increasingly fierce competition, demanding changes in lifestyle that emphasizes high efficiency. Families are likely no longer being able to prepare food that takes a long time, so that should be pursued traditional foods that can meet those needs. The use of technology must be done so that the traditional food dishes are more practical, such as the manufacture of spices/ingredients that are “instant”. To build the image of traditional foods while developing a good sense of belonging the local product proudly, it is very important to have the support of the media (printed and electronic) because the use of mass media is more effective to build the consumer image on the traditional food product. Moreover, there is support, guidance, and ongoing mentoring on traditional food businesses so that they as the main players always try to make a positive image on traditional foods.

ConcluSIONs The potency of food from germplasm other than rice in Indonesia is abundant. Surprisingly, Indonesia is noted as an importer country on large number of food commodities. On the other hand, the available food crops such as breadfruit, taro, sago, cassava and sweet potato can grow well in all over Indonesia. The potency of yields of those crops is far higher than rice, and even can reach 10 times greater than rice production. Land ownership should be reformed before food diversification is implemented. Currently, many farmers have only a portion of land of 354 m2 per capita. Food crops other than rice are plentiful in species and contain reasonable amount of food science policy 375 protein, lipid and carbohydrate. Those crops can grow well in all over Indonesia and have the capacity to yield larger than that of rice, especially cassava which can yield up to 80 tonnes/ha and huge areas of sleeping land that can be planted for the food crops to enable the achievement of sufficient food in many years to come. Government agencies, private companies and people are required to change a former mindset of most of the people in country “meals are equal to rice” to become “meals are not necessarily rice”. Technology production must be part of the strategies which is adopted at the district levels in all over Indonesia. Integrated socialization is needed, such as continuous advertisement on media, formal promotion by government agencies, and school authorities on food development strategy of non-rice germplasm. With the program, more people are expected to know and try to apply the knowledge in their daily lives. In the daily diet, people are expected to consume more traditional foods of non-rice as a staple food.

References Adnyana, M. O. (2005). Trajectories and landmarks, the road to sustainable food security in the era of free trade. Expert Researcher inaugural speech Agricultural Economics. Bogor. 31 August 2005. Agency for Agricultural Research and Development, Jakarta. Agricultural Research Centers and Development. (1999). Analysis Methodology Guidelines for Agro Ecological Zone. www.oocities.org/thetropics/lagoon/3449/PDF/aez.pdf. Accessed on 3 November 2013. Barichello, R. (2000). Evaluating Government Policy for Food Security: Indonesia. Berlin: University of British Columbia. Cahyana, L., & Parlan, T. M. (2004). Blurred portrait of Indonesian forests. Institute for Studies on Free Flow of Information (ISAI). Central Bureau of Statistics. (2013). Indonesian Beef Imports 40,338 tons this year. [Linked Periodical]. http://potensi-indonesia.com/p=1118. Food Security Agency. (2008). Development of Food Consumption directory. Jakarta: Department of Agriculture. Hariyadi, P., Krisnawati, B., & F. G. Winarno. (2003). Food diversification, private sector and local government initiatives. Jakarta: Forum employment diversification of food. Hidayat, S., & Munawaroh, E. (2009). Diversification in species of wild flora and their potency in mangrove area of Mangkutana, District of East Luwu. South Sulawesi. Seminar Proceeding of Etnobotany IV. Biodiversification, culture and science. Biological Research Center, LIPI, Bogor, Indonesia. Hidayat, S., & Astuti, I, P. (2009). Reserve forest potency of mount Kelud as germplasm of wild flora which has economic potency. Proceedings of 6th Basic Science National Seminar, Department of Physics, Faculty of Sciences Brawijaya University, Malang, East Java, Indonesia. 376 Proceedings ASIAHORCS 2013

Hidayat, S., Astuti, I. P., Munawaroh, E., & Wightman, G. (2001). Useful flora in forest area of Luku Melolo, east Sumba, Indonesia. Center for Conservation for vegetation of Great Garden Bogor, LIPI, parks and wild life Commision of the Nothern Territory, ACIAR. Karama, S. (2003). Potency, challenges and obstacles of cassava in supporting food safety. P 1-14 in: Koes Hartojo et al., (ed.). Empowering cassava to support national food safety and people agribusiness development. Institute for nut and tubers crops, Agency of agriculture research and development. Ministry of Agriculture. (2010). General Guidelines Acceleration Movement Food Consumption. Jakarta. Nainggolan, K. (2007). Dependence on Rice, Anticipation for 2030. http://www.sinarharapan. co.id/be/0706/04/sh04.html 23/12/2007. Nurhayati, & Rahim, S. E. (2013). Potency yam for food diversification and other uses in Indonesia. Paper presented at the 5th ASIAHORCs Joint Symposium, 27 November 2013 in Denpasar Bali Indonesia. Radjit, B. S., Prasetiaswati, N., Munip, A., & Saleh, N. (2010). Production technology, to mature early maturing cassava efficient, on dry land and the tidal potential yield of 40-60t/ha. Final technical report in 2010. Crops Research Institute for the Nuts and tubers. Saleh, N., Rahayuningsih, St. A., & Adie, M. M. (2011). Increase the production and quality of tuber plants. Crops Research Institute for the Nuts and tubers. Siregar, E. B. (2009). Study material changes in food consumption patterns North Sumatera. Journal of Innovation, 6 (2), 93–102. Soemantri, I. H, Hasanah, M., Adisoemarto, S., Thohari, M., Nurhadi, A., & Orbani, I. N. (2008). Knowing the germplasm of food plant. Accessed on 1 November 2013 from http:// anekaplanta.wordpress.com. Suyatri, N. M. Y. P. (2008). Diversification of consumption of staple food based on local potency in realizing the food safety of household in villages, Sub-district of Semin, Gunungkidul District. Journal of Economic Development, 13 (1), 51–60. Swastika, D. K. S. (2011). Building aself-sufficiency and food sovereignty of farmers to alleviate poverty. Development of Agricultural innovation, 4, (2), 103–117. Short Communication of Oral Presentations

Food Policy to Bridge Political and Investment Barrier Among Countries by Innovative Support System in Asia

Renu Agrawal Department of Food Microbiology, Central Food Technological Research Institute, Mysore, India E-mail: [email protected]

Introduction Over the past three decades, the world has produced more grain per capita. But still, several million people have died of hunger. What and where is it that we are going wrong? We need to work out mechanisms together. Today, we all are here to involve global grain markets, international trade and price control to check the chronic food deficit which is impairing the lives of the people. This is directly related to the global market. Populist schemes are a boon for the country’s economy if they reach out to the needy. We need an “International outlook” to take the country’s progress to the next level. We are at the tipping point. But the question is how do we tip? If, we tip in a wrong way, then we are in a mess. We need to change the way we do things. We need to bring in new technologies, innovation and change the earlier set processes. In 1972, there was a severe “World food crisis”. But it was good weather and strong incentives given to the farmers which improved the conditions in 1978. The world food economy is intimately interdependent. The linkages among different countries and commodities are to be provided through international trade. Trade in agriculture, petroleum, fertilizers and pesticides connect the agricultural and industrial economies of most countries. The foreign exchange transactions and rate directly affect the food policy. Everything is globally interdependent. Interdependence will enhance specialization and promote higher productivity by better understanding and utilizing each other’s potential at the international level. More than half of the world’s population lives in Asia and most of the people are very poor, which creates 2/3 of the world hunger. Solving hunger involves, expanding the available choices like income, food prices, food supplies and foremost the consumer knowledge. The processes for agricultural commodities on farm is by transforming these into food for the marketing sector, and selling it to the consumers for better nutrition. Solving malnutrition is the priority to all concerns in all Asian countries. The processes which make up the food system

379 380 Proceedings ASIAHORCS 2013

can improve the collaboration amongst all of us. This could be from agricultural inputs to nutritional supplementation. A food system that has many hungry people is a failure. Not only that, it is important to produce enough food, the right kind of food to be eat, buy and generate enough income. Proper education should also be given to people about what to eat to combat malnutrition. All of these factors in the policy will contribute to eradicate hunger. The vulnerability is extreme for subsistence due to climate, droughts, floods, pests, failed crops, economic circumstances and so many more. A good food policy can protect this and can improve good food products in the markets giving more economic opportunities among countries for trade. The food policy is a collective effort of the government, inter-governments, food producers, consumers, and marketing agents to ultimately reach the goal. Food policy is a process of research and a great thinking to design and discover the trade identifying government initiatives to the projects, programs and policy arenas which should give inter-country benefits. Each domestic food policy maker must link their country’s food system to the Asian and world commodity markets. Food price policy is an important element both for trade and price. A major role of the food policy should be to bridge the problems among nations which will lead to more rapid growth bridging towards rural development that reach the small producers, using food price effectively and carefully targeting the food subsidies.

Globally, we all have same objectives: • Efficient growth in food and agricultural sectors. • Improved income distribution and employment creation. • Satisfying nutritional status for the entire population. • Adequate food security to ensure against bad harvest, natural disasters, uncertain world food supplies and prices. Therefore, it is very important to strategize minutely a consistent and workable food policy which should include land, income transfers and technical changes. It should be focused on job creation, incentives to enhance food production, investment in agricultural infrastructure, economic efficiency and rising productivity. It is impossible to afford mismanagement, waste or inefficiencies by bad policies. It is very important to keep in mind the intergovernmental trade benefit along with bilateral cooperation. Food security bill. The food security bill makes food our legal right. In India recently, food security bill has been passed. The provision is made for providing food to all. The bill stands to support the bare minimum. The Food and food science policy 381

Agricultural Organization (FAO) defines food security as meeting the dietary diversity requirements in line with the cultural preferences taking millets, proteins and oil to eradicate malnutrition. The nutritional needs, agricultural policy and food programs have to be connected nationally and internationally. The efficacy can be improved by the use of newer technologies, biometric systems, truck tracking systems, painting PDS transport vehicle with identifiable distinct color and SMS to panchayats at the village level when truck leaves the go down. This can be adopted by other Asian countries also. Today, the maximum items of consumption are owned by overseas enterprises. A majority of us have no inkling that every purchase sends value out of the country to the foreign owners. For progress, it is important to align corporate, national and international energies. A successful global brand will ultimately be a badge of honor for the country and a source of wealth creation. What about Food Safety? A very important aspect of food. The changing patterns in food production, processing, distribution, storage and presentations have created new challenges to food safety. The extensive use of pesticides, veterinary drugs, genetic modifications and pollutants in sources of irrigations has enhanced increased production of food products, but the risk of food contaminants has increased. Irradiations, preservatives and additives added for improving shelf life, flavor, taste, and texture pose new risks. Like food security, food safety is a basic human right and the right to healthy and safe environment. Consumers are concerned about the health risks associated with unsafe and unhealthy food. There is awareness about the potential dangers in food by microbial contaminations, heavy metals, hazardous chemicals and toxins. With the outbreaks of food borne diseases, adulterations, changing life styles and food habits along with consumer awareness on nutrition, quality and food safety issues have resulted in demand for new regulations. Therefore, a new law Food Safety and Standards Authority of India (FSSAI) was constituted in 2008 and started in 2011. The mandate of this regulation is that rules, regulations and standards are enforced uniformly in the country. There has to be a connection between the nutritional needs, agricultural policy and the food programs. FSSAI is a legislative authority to take responsibility for national leadership on food safety along with concerned ministries to ensure farm to fork continuum. This includes representatives from food industry, consumer organizations, food technical scientists, union territories, farmers’ organization and retailers organization. The reinforcement includes central licensing authority, state licensing authority and registering by involving panchayat and municipal bodies. FSSAI is a simple reference point for all matters relating to food safety and standards. It is important to establish food safety management system for food businesses 382 Proceedings ASIAHORCS 2013

either by NABL or any other body. The food testing system must be for good management techniques and improvement in test competencies. Bridging nations and policies for mutual benefit. To establish a system to network different organizations and countries for scientific cooperation to coordinate various activities, it is important to exchange information, development, implement joint projects, exchange expertise and use best practices in the field of food safety. Participation needs to be in the training and capacity building, food surveillance and scientific activities of the authority. To ensure safe and wholesome food for human consumption, international methods are required to understand food borne diseases and infections ultimately linking them to food contamination on the basis of risk. Of course, building is a gigantic task. This demands tremendous staying power. It requires insight, continuous nurturing of R & D, brand building capability, cutting edge manufacturing, an extensive trade marketing and distribution network. One has to have a determination to succeed against all odds to become a brand across the world. The journey has just begun and there are miles to go. Each country should take it on a wide range of issues by the research agencies which will provide the grant and the output to be of international standards. NRF and Life Sciences of Korea

Joon Kim Director of Life Science Division, National Research Foundation of Korea, Division of Life Sciences, Korea University, Seoul, Korea

Abstract The National Research Foundation of Korea (NRF) is a specialized research funding agency, established in 2009. This is the biggest governmental funding agency of Korea which is the merge product of 3 formerly independent funding agencies. NRF supports creative academic research, not only in science and technology but also in humanities and social sciences including academic studies and interdisciplinary academic fields. Division of Life Sciences is under the Directorate for Basic Research in Science & Engineering. It has governmental funding programs as follows. First, the ‘General Researcher Program’ is organized for the increase of the research capacity of universities and research institutes. Second, ‘Mid-career Researcher Program’ is organized to enhance basic research capability and promote senior researchers’ activities through creative individual or small-scale collaborative research. Third, ‘Leading Researcher Program’, is organized to discover next-generation scientists and stimulate them to become global leaders and distinguished scientists. Division of Life Sciences of NRF distributes funds to all the basic fields of life sciences including biology, agriculture, veterinary medicine, nutrition and food sciences. Current status of NRF and future in life science with respect to food science fields will be discussed in this session.

*Corresponding Author Anam-dong, Seongbuk-Gu, 136-701 Seoul, South Korea E-mail: [email protected]

Introduction The NRF of Korea is a specialized research funding agency, established in 2009 which is the governmental funding agency of Korea. NRF was the merge product of 3 formerly independent foundations. They were the Korea Science and Engineering Foundation (KOSEF), the Korea Research Foundation (KRF), and the Korea Foundation for International Cooperation of Science and Technology (KICOS). NRF supports creative academic research not only in science and technology, but also in humanities and social sciences including academic studies and interdisciplinary academic fields. Its annual budget is around 3 billion US$. This institution plays six major roles. 1) Supports of academic and R&D activities. 2) Fostering and utilization of researchers in academia and R&D fields. 3) Promotion of international cooperation for academic and R&D activities.

383 384 Proceedings ASIAHORCS 2013

4) Facilitation of the survey, analysis and application of useful resources for research funding as well as development of policies. 5) Assistance in managing research performed by academic and R&D organization. 6) Promotion of cooperative exchange between domestic and overseas institutes and organizations in the fields of academia and R&D. NRF has a total of six areas for academia and administration and two offices. 1) Directorate for Basic Research in Science and Engineering 2) Directorate for the Humanities and Social Science 3) Directorate for National Science and Engineering Programs 4) Directorate for Academic Promotion 5) Directorate for Administrative Management 6) Center for International Affairs • Office of R&D Performance Development • Office of Planning and Coordination.

Directorate for Basic Research Directorate for Basic Research in Science and Engineering has 5 Divisions. They are as follows. A. Division of Natural Sciences B. Division of Life Sciences C. Division of Medical Sciences D. Division of Engineering E. Division of Electrical Engineering, Information Science and Convergence Research. This directorate has governmental funding programs as follows. 1) ‘General Researcher Program’ is organized for the increase of the research capacity of universities and research institutes. It is to broaden the research base by supporting basic research activities in science and engineering fields. By providing research opportunities to young or continuing scientists, the NRF aims to cultivate active researchers to upgrade their research. 2) ‘Mid-career Researcher Program’ is organized to enhance basic research capability and promote senior researchers’ activities through creative individual or small-scale collaborative research. At the same time, this program tries to contribute to the development of Korea’s science and technology capacities and the strengthening of national competitiveness with continuous support for active senior researchers. It has ‘Core Research Program’ and ‘National Research Lab Program’. food science policy 385

3) ‘Leading Researcher Program’ is organized to discover next-generation scientists and stimulate them to become global leaders and distinguished scientists. Eventually, this program expects to produce key players in their specialized fields. It has ‘Creative Research Program’ and ‘National Scientist Program’. 4) ‘Advanced Research Center Program’ is organized to foster a group of about 10 world-class scientists and promote the nation’s knowledge competitiveness by supporting excellent scientist group in their specific fields. It has Science Research Center (SRC), Engineering Research Center (ERC) and Medical Research Center (MRC) programs. 5) Basic Research Laboratory (BRL) Program is organized to foster promising research group of 4 or 5 in the same university by developing professors’ personal laboratories into major/department-level basic research labs. 6) Basic Research Infrastructure Support Program is organized to increase the national competitiveness through the following measures. It is to provide necessary research information for basic research, to create an efficient research environment and to support the creation of infrastructure in order to build research hubs in universities and to foster new researchers.

Division of Life Sciences Division of Life Sciences is under the Directorate for Basic Research in Science & Engineering. It comprises about one fifth of the directorate. Division of Life Sciences has 3 chief research boards (CRB) such as basic life sciences, applied life sciences and agricultural, food and fishery sciences. Each CRB area has several research boards (RB) areas. All together, Division of Life Sciences has 20 RB areas. RB of the food science and biotechnology belongs to the agricultural, food and fishery sciences CRB area.

Food Science and Biotechnology RB of food science and biotechnology is a very active and biggest field among all the RB areas of the Division of Life Sciences. It represents approximately 10% of the Division of Life Sciences in terms of manpower and research funding. The NRF of Korea sincerely hopes our programs will help develop global research further in the field of food science and biotechnology, and eventually improve the quality of our lives in the world. The details of present and future status of food science and biotechnology in the division of life sciences in Korea with respect to the role of NRF will be discussed furtherly in this session. 386 Proceedings ASIAHORCS 2013

References NRF. (2012). NRF Annual Report in the Division of Life Sciences 2012. NRF. (2013). Implementation plan for basic research programs in science and engineering. NRF. (2013). Working for humanity and the future. Posters

The Strategy of Indonesia’s Food Security in the Future Based on Potential Food Localization

Ikha Prasetiyani Faculty of Geography, Gadjah Mada University, Yogyakarta, Indonesia

Abstract Population is great potencial for a country if it could be managed well. The increasing number of population could be a problem if the goverment do not manage it properly. In regards to the food problem, the amound of food needs are associated with population growth. Therefore, strategy is needed to prevent food inadequacy. The aim of this research is to arrange food strategy on based on the spread of food mapping in Indonesia. The method of this research is by localizing the areas that have a food potential. This strategy aims to maximize the potential of food in Indonesia, so we can map out areas of food potential, food safety and food insecurity. Keywords: Mapping, localization, potential food

*Corresponding Author E-mail: [email protected]/[email protected]

Background The increased number of population is a development challenge in the future. The greater the number of population, the more complicated the problem is. One of them is the fulfilment of food demand. In 2050, Kunzig (2011) predicted that the number of world population will be more than 9 billion. The larger the number of population, the greater the need for food. Food supply depends on natural resources that if it does not managed well, the food import will increase, especially in Indonesia. Indonesia’s population number reached more than 237 million in 2010 and their consumption in kal/day/capita was as much as 1,925.61 kal/day/capita (BPS, 2010). Fulfilment of food demand must be balanced by food availability. Food availability in Indonesia is actually enough to fulfil food needs, and even could be more if it is managed in good way, especially in regions that have food potency to be developed. To develop and fulfil food adequacy (food availability and demand) are absolute requirement in reaching good development and national security. Considering the importance of food security in Indonesia’s national security, the right and suitable strategy of food security is needed for Indonesia’s potency food conditions.

389 390 Proceedings ASIAHORCS 2013

The Aim ofR esearch. The aim of this research is to arrange the strategy for food security in Indonesia by using map-based localizations of potential food areas in 2020 and 2040.

Methods of Research The method of this research is by using region typology based on potential food. The analysis of region typology is usually used by the government to make a plan on policy priority, so that district or regional development can use it as their development planning. Policy priority is arranged based on food potency of each province in Indonesia and interpreted by mapping or be called as regions localization. Regions typology is region classification based on their characteristic, and the classification is based on food potency areas. Those classifications have three points, namely food potency or food granary, food safety, and food insecurity. Every category is divided again into two category, the main and the second category. Therefore, regions typologies that are interpreted by map have six categories. Regions localization of food potency is grouped in four food commodities namely rice, starchy, vegetables and fruits, and animal resource food. Division of the category of potential food is showed in Table 1.1.

Table 1.2 Regional typology based on food security characteristic Potential food granary Food safety Food insecurity Major TTC, TSC, TRC SSC, RRC STtC, RTtC, RStC TTtC, TStC, TRtC, Secondary SRC STC, RSC,RTC SStC, SRtC, RRtC

Source: result of research analysis 2012–2013 Explanation: Potential food granary = adequacy, high of food available Food safety = adequacy, food demand and available are balance Food insecurity = inadequacy, food demand higher than food available food science policy 391

Analysis Graphic of food needs, availability, and adequacy in Indonesia

Picture 1.1 Graphic of Indonesian foods developing in 2020 and 2040

Graphic in the Picture 1.1 shows that the predicted condition of Indonesia’s food security in 2020 and 2040 from the view of food adequacy based on exponential and arithmetic calculation will be sufficient enough in each food commodity, assuming the amount of land is consistent. The trend of food security development in the graphic is indeed showing an increase. Rice commodity is a food commodity that mostly consumed by Indonesian. It is because for most Indonesian, consuming rice as a main food commodity has become a culture. Meanwhile, animal resource food commodity such as meat, mil, and egg are the lowest food commodity consumed by Indonesian. Animal resource food like meat for Indonesian is being considered as expensive food; only middle-upper people could eat that every time. This factor is one of the reasons that made the consumption of animal resource food in Indonesia very low. Vegetables/fruits are one of food commodities, with a potential to be an export commodity because of their high production availability. However, the system of storing and packaging on vegetables/fruits product is a burden due to the low technology on post-harvest process. This made local production of vegetables/fruits loses its competitiveness than import product, whereas starchy food commodity is the commodity which has a potential as food alternative for rice commodity as Indonesia’s main food. Food starchy contains almost similar nutrient as rice. The first starchy product is cassava, a main local food in 392 Proceedings ASIAHORCS 2013

several areas such as Java, that was made into geplak or tiwul. If starchy product is produced and developed in a good way, the dependence of rice will decline. Generally, food adequacy in Indonesia is enough. But, if we look each province in more detail, not all is sufficient. It happened for all commodities; especially rice as the main food in Indonesia. Although most regions have food potential and food safety, every region which has an inadequacy is therefore considered as food insecurity area. Regions included in the category of potential food localization such as potential food, food safety and food insecurity is predicted to have it in 2020 and 2040. Then, regions that are not be mentioned as potential food or food insecurity means they have safe food condition. The spreading localization of Indonesia potential food can be showed by the Picture 1.2–1.9.

Picture 1.2 Mapping of potential food granary in Indonesia Rice Commodity at 2020 food science policy 393

Picture 1.3 Mapping of potential food granary in Indonesia Rice Commodity at 2040

The main or the second potential food of rice commodity in 2020 and 2040 is spreading in Eastern Indonesia and several regions in western and middle Indonesia. Food insecurity area is predicted to be spreaded in eastern and middle Indonesia, especially in Java except Banten Province. Java is the area that has mostly full population and becomes the center of economy, social and politic activity. Despite the fact that Java is the granary potential food center in Indonesia, the continuously increasing population and their activities make the food demand increased. Things mentioned before make Java as the food insecurity areas in rice commodity. The potential region of Indonesian food is eastern Indonesia because the rice consumption in there is lower than therice production. Animal resource food is the lowest food consumption by Indonesian people, and its potential region is different rice commodity. Eastern Indonesia is the area that has food insecurity in this commodity. Meanwhile, the predicted regions to be a potential food granary in animal resource commodity are in Middle Territory of Indonesia, except West Sulawesi Province in 2020 and Gorontalo in 2040. Western Indonesia in this commodity has food safety, and several provinces have food potential. However, several provinces have food inadequacy and made it food insecurity areas such as DKI Jakarta in 2020, as well as Banten and Bangka Belitung Province in 2040. 394 Proceedings ASIAHORCS 2013

Picture 1.4 Mapping of potential food granary in Indonesia Animal Resource Commodity at 2020

Picture 1.5 Mapping of potential food granary in Indonesia Animal Resource Commodity at 2040 food science policy 395

Picture 1.6 Mapping of potential food granary in Indonesia Vegetables/Fruits Commodity at 2020

Picture 1.7 Mapping of potential food granary in Indonesia Vegetables/Fruits Commodity 396 Proceedings ASIAHORCS 2013

The spread of food commodities that has a potential for export production such as vegetables/fruits mostly is in the category of food safety and food potential. Both of them are spreading in western and middle Indonesia. In the meantime, food insecurity has been spreading equally in eastern Indonesia, except Papua Province, and several provinces in western Indonesia such as Banten and DKI Jakarta Province. In 2040, regions that are predicted to have food insecurity are Jambi, West Sulawesi and South Sulawesi Province.

Picture 1.8 Mapping of potential food granary in Indonesia Starchy Commodity at 2020 food science policy 397

Picture 1.9 Mapping of potential food granary in Indonesia Starchy Commodity at 2040

The prediction for the last commodity, food starchy, in 2020 and 2040 has the potency of spreading in all of Indonesian territory which covers food potential, food safety and food insecurity. The territory which has a potential as a food granary is western Indonesia such as Bengkulu, Lampung and Java, except Banten and DKI Jakarta Province. In middle Indonesia, potential food granary has spreaded in North Sulawesi, Middle Sulawesi and Middle East Sulawesi Province. In eastern Indonesia, it has spreaded in Maluku and North Maluku. The spreading localization of potential food in Indonesia is showing the predicted areas that have food potential, food safety, and food insecurity in western, middle and eastern Indonesia. However, each region and food commodity has different characteristic. Rice commodity that has a potency as potential food mostly spreaded in eastern Indonesia and several provinces in western Indonesia, and the spread of region that has food insecurity is western and widdle Indonesia. Animal resource food as a potential food mostly spread in middle Indonesia, and the food insecurity potency is in eastern Indonesia. meanwhile, regions that have vegetables/fruits as a potential food commodity spreaded mostly in western Indonesia, and food insecurity is spreading mostly in Eastern Indonesia. Lastly, starchy food commodity has equal spread of food potential; every territory has a region with food potential or food insecurity. 398 Proceedings ASIAHORCS 2013

Conclusions Food strategy based on food potential is the localization of the mapping of potential areas for food security. The localization is divided into 3 categories, namely region with food potential, region with food safety, or region with food insecurity. Region with potential food barn can maximize its role to supply the food to regions that have problem on food insecurity. The region with food safety retains its own potential or continues to to facilitate development planning in Indonesia, particularly in the distribution of food commodities among regions in order to achieve the food security in Indonesia.

References Arifin, B. (1980). Kebijaksanaan Penyediaan Pangan dan Perkiraan Situasi Pangan Menjelang Tahun 2000. Jakarta: Badan Urusan Logistik. Aswatini, et al., (2004). Ketahanan Pangan, Kemiskinan dan Sosial Demografi Rumah Tangga. Jakarta:PPK-LIPI. Badan Pusat Statistik. (1980–2010). Statistik Indonesia. Jakarta: Badan Pusat Statistik. Chrisholm, A. H., & Tyers, R. (1982). Food Security: Theory, Policy, and Perspectives from Asia and the Pacific Rim. Totonto: D.C.Heath and Company. Djamin, Z. (1995). Struktur Perekonomian dan Strategi Pembangunan Indonesia. Jakarta: UI-Press. Kraak, M., & Ormelling, F. (2007). Kartografi: Visualisasi Data Geospasial Edisi Kedua. (Diter- jemahkan oleh Sukendra Matra, Sukwardjono, Mas Sukoco, Noerhadji Raharjo, Hartono, dkk). Yogyakarta: Gadjah Mada Univercity Press. Kunzig, R. (2011). Seri khusus Tujuh Milyar (hal 20–47). Majalah National Geografi Indonesia. Jakarta: Kompas Gramedia. Muta’ali, L. (2012). Daya Dukung Lingkungan Untuk Perencanaan Pengembangan Wilayah. Yogyakarta:Badan Penerbit Fakultas Geografi (BPFG) UGM. Soehoed. (2006). Strategi Sebagai Landasan Kebijakan Pembangunan (Beberapa Tinjauan). Jakarta: Djambatan. Appendix

Committee

Committee of The 7th Asian Heads of Research Councils Meeting And The 5th Joint Symposium

A. STEERING COMMITTEE Chairman: Chairman of Indonesian Institute of Sciences (LIPI) Member: 1. Vice-Chairman of Indonesian Institute of Sciences (LIPI) 2. Executive Secretary of Indonesian Institute of Sciences (LIPI) 3. Deputy Chairman for Life Sciences, Indonesian Institute of Sciences (LIPI) 4. Deputy Chairman for Engineering Sciences, Indonesian Institute of Sciences (LIPI)

B. SCIENTIFIC COMMITTEE Chairman: Dr. Siti Nuramaliati Prijono (Deputy Chairman for Life Sciences, LIPI) Secretary: Dr. Andria Agusta (Research Center for Biology, LIPI) Member: 1. Ir. Agus Triyono, M.Agr. (Development Center for Appropriate Technology, LIPI) 2. Purwanto, S.E., M.Econ.St. (Research Center for Economic, LIPI) 3. Dr. Trina Fizzanty (Research Center for Development of Science and Technology, LIPI) 4. Dr. Yopi (Research Center for Biotechnology, LIPI)

C. ORGANIZING COMMITTEE Chairman: Dr. Ir. Bogie Soedjatmiko Eko Tjahjono, M.Sc. (Bureau for Cooperation and Promotion of Science and Technology, LIPI) Vice-Chairman I: Ir. I Nyoman Lugrayasa, M.Si. (Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation, LIPI) Secretary: 1. Mila Kencana, S.IP., M.A. (Bureau for Cooperation and Promotion of Science and Technology, LIPI) 2. Nur Tri Aries S., S.IP., M.A. (Bureau for Cooperation and Promotion of Science and Technology, LIPI)

403 404 Proceedings ASIAHORCS 2013

Secretariat: 1. Dra. Retno Darwanti (Bureau for Cooperation and Promotion of Science and Technology, LIPI) 2. Mafaza, S.IP. (Bureau for Cooperation and Promotion of Science and Technology, LIPI) 3 Rachmat Hidayat, S.Kom. (Bureau for Cooperation and Promotion of Science and Technology, LIPI) 4. Agung Nugroho, S.IP. (Bureau for Cooperation and Promotion of Science and Technology, LIPI) 5. Dyan Meiningsasi Siswoyo P., S.Si. (Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation, LIPI) Treasurer: 1. Nia Rosmiati, S.E. (Bureau for Cooperation and Promotion of Science and Technology, LIPI) 2. Listianingsih, S.Kom. (Bureau for Cooperation and Promotion of Science and Technology, LIPI) Liason Officer: 1. Dr. Bayu Adjie, M.Sc. (Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation, LIPI) 2. Iwan Ridwan Stiaji, MAP. (Bureau for Cooperation and Promotion of Science and Technology, LIPI) 3. Mila Hanifa, S.H., M.H. (Bureau for Cooperation and Promotion of Science and Technology, LIPI) Public Relation: 1. Nirma Yossa, S.IP., M.A. (Bureau for Cooperation and Promotion of Science and Technology, LIPI) 2. Purwadi, S.Sos. (Bureau for Cooperation and Promotion of Science and Technology, LIPI) 3. Muntadliroh, S.I.Kom. (Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation, LIPI) Exhibition: 1. Kamera Sembiring, M.Si. (Bureau for Cooperation and Promotion of Science and Technology, LIPI) 2. I Gede Wawan Setiadi, S.Sn. (Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation, LIPI) Committee of The 7th Asian Heads 405

Protocoler and Reception: 1. Drs. Edward H. Lumbantoruan, M.M. (Bureau for Public Affairs and Equipment, LIPI) 2. Rr. Tety Andriati (Bureau for Public Affairs and Equipment, LIPI) 3. I Nyoman Sukaja, S.Sos. (Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation, LIPI) 4. Melinda Sinaga, S.Sos. (Bureau for Public Affairs and Equipment, LIPI) Equipment: 1. I Made Patru, S.Sos. (Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation, LIPI) 2. I Gusti Ngurah Putu Wisnu, S.Sos. (Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation, LIPI) Accommodation and Meals: 1. Dra. Retno Darwanti (Bureau for Cooperation and Promotion of Science and Technology, LIPI) 2. Ratu Ema, M.Si. (Bureau for Cooperation and Promotion of Science and Technology, LIPI) 3. Sri Amiati (Bureau for Cooperation and Promotion of Science and Technology, LIPI) 4. Luh Sarini, S.P. (Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation, LIPI) Transportation: 1. Drs. Sancoyo (Bureau for Cooperation and Promotion of Science and Technology, LIPI) 2. I Wayan Armawa, S.IP. (Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation, LIPI) 3. Bukky Suwarno, S.S. (Bureau for Public Affairs and Equipment, LIPI) 406 Proceedings ASIAHORCS 2013

Symposium: 1. Trina Fizzanty (Research Center for Development of Science and Technology, LIPI) 2. Mafaza, S.IP. (Bureau for Cooperation and Promotion of Science and Technology, LIPI) 3. Sharon Marks (Bureau for Cooperation and Promotion of Science and Technology, LIPI) List of participants

List of participants

Agung Nugroho Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Agus Triyono Development Center for Appropriate Technology Indonesian Institute of Sciences (LIPI) Akmadi Abbas Executive Secretary Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Amy Estiati Research Centre for Biotechnology Indonesian Institute of Sciences (LIPI) Jln. Raya Jakarta Bogor KM.46 Cibinong Andria Agusta Research Centre for Biology Indonesian Institute of Sciences (LIPI) Jln. Raya Jakarta Bogor KM.46 Cibinong Arabinda Mitra Ministry of Science and Technology, India Ari Mayadewi Universitas Udayana Ary Prihardhyanto Keim Research Centre for Biology Indonesian Institute of Sciences (LIPI) Jln. Raya Jakarta Bogor KM.46 Cibinong Ayu Rai Rachmasari Denpasar Agency of Drug and Food Control Jalan Tjut Nya Dien No. 5 Denpasar, Bali

409 410 Proceedings ASIAHORCS 2013

Bambang Subiyanto Research Center for Innovation Indonesian Institute of Sciences (LIPI) Jl. Jend. Gatot Subroto No. 10 Jakarta Bayu Adjie Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation Indonesian Institute of Sciences (LIPI) Bambang Budhianto Director of Food Crop Seed Ministry of Agriculture Benyamin Lakitan Ministry of Research and Technology of Indonesia Gedung II BPP Teknologi Lt. 7 Jln. MH Thamrin 8, Jakarta Benjamin Agbayani Gonzales University of the Philippines 7A Juan Luna St. Up Diliman Quezon City, Philippines Bogie Soedjatmiko Eko Tjahjono Head of Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Bramantyo Adi Nugroho East Kalimantan Research and Development Agency Jln. Gajah Mada No.02, Samarinda Kalimantan Timur Bukky Suwarno Bureau of General Affairs and Supplies Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Chan Lee National Research Foundation of Korea School of Food Science& Technology, Chung-Ang University, Anseoung, Korea List of participants 411

Charuwan Pharksuwan National Research Council of Thailand (NRCT) 196 Phaholyothin RD. Chatuchak, Bangkok Dadang Ramdhan Center for Science and Technology Development Studies Indonesian Institute of Sciences Jln. Jend. Gatot Subroto No. 10 Jakarta Djamhuriyah Research Center for Limnology Indonesian Institute of Sciences Jln. Raya Jakarta Bogor KM.46 Cibinong Djusman Sajuti Vice Chairman Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Domingo Plasabas Lodevico College of Home Economics, CMU, Musuan, Bukidnon – Philippines Dwi Astuti Research Centre for Biology Indonesian Institute of Sciences (LIPI) Jln. Raya Jakarta Bogor KM.46 Cibinong Dwi Putra Darmawan Udayana University Dyan Meiningsasi Siswoyo Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation Indonesian Institute of Sciences (LIPI) Edward H. Lumbantoruan Bureau of General Affairs and Supplies Indonesian Institute of Sciences (LIPI) Jl. Jend. Gatot Subroto No. 10 Jakarta 412 Proceedings ASIAHORCS 2013

Ernawati AM East Kalimantan Research and Development Agency Jln. Gajah Mada No.02, Samarinda Kalimantan Timur Feng Feng National Natural Science Foundation of China (NSFC) 3 Shuangqin Road, Haidian, 100085 Beijing Gede Arda Udayana University Gede Sedana Dwijendra University Jalan Kamboja Nomor 17 Denpasar GP Ganda Putra Udayana University Halda Arsyad East Kalimantan Research and Development Agency Jln. Gajah Mada No.02, Samarinda Kalimantan Timur Heddy Julistiono Research Centre for Biology Indonesian Institute of Sciences (LIPI) Jln. Raya Jakarta Bogor KM.46 Cibinong Herry Yogaswara Research Center for Population Indonesian Institute of Sciences Hiroyuki Sakakibara University of Miyazaki 1-1 Gakuen Kibana-dai Nishi, Miyazaki

Hisashi Kato Japan Society for the Promotion of Science (JSPS) 5-3-1 Kojimachi, Chiyoda-ku, Tokyo List of participants 413

Hwang Deok-Soo National Research Foundation of Korea (NRF) Ida Ayu Astarini Udayana University Ida Bagus Wisnuardana Bali Provincial Agriculture Office Jln. WR Supratman No 71 Denpasar Ikha Prasetiyani University of Gadjah Mada, Yogyakarta Iskandar Zulkarnain Deputy of Earth Sciences Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta I Gede Wayan Setiadi Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation Indonesian Institute of Sciences (LIPI) I Gusti Ngr Anom Murdhana Faculty of Medicine and Health Sciences Marwadewa University Jln. Terompong No 24 Tanjung Bungkak Denpasar Bali I Gusti Ngurah Putu Wisnu Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation Indonesian Institute of Sciences (LIPI) I Made Andra S. Wijaya Udayana Univeristy I Made Patru Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation Indonesian Institute of Sciences (LIPI) 414 Proceedings ASIAHORCS 2013

I Nyoman Lugrayasa Head of Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation Indonesian Institute of Sciences (LIPI) I Nyoman Sukaja Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation Indonesian Institute of Sciences (LIPI) Iwan Ridwan Stiaji Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta I Wayan Armawa Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation Indonesian Institute of Sciences (LIPI) I Wayan Arnata Udayana University JIANG Zhengqiang China Agricultural University Jutamas Kumchai Department of Plant Science and Natural Resources, Faculty of Agriculture, Chiang Mai University Kamera Sembiring Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta KANG Dong Hyun Department of Food and Animal Biotechnology, Seoul National University Kazuki Kanazawa Kibi International University 370-1 Sareo, Shichi, Minamiawaji, Hyogo List of participants 415

Ken-Ichiro Minato Meijo University 1-501 Hioamaguchi, Nagoya Ketut Arnawa Mahasaraswati University Jln. Kamboja No.11 A, Denpasar–Bali Khalid Norzulaani Institute of Biological Sciences, Faculty of Science, University of Malaya KIM Joon Division of Life Sciences, Korea University, Seoul, Korea KIM Kyoung Heon Department of Food Bioscience & Technology, Korea University Kuniaki Yamashita Japan Society for the Promotion of Science (JSPS) 10th floor, Sermmit Tower, 159 Sukhumivit Soi 21, Bangkok Kristhawat Nopnakeepongse National Research Council of Thailand (NRCT) 196 Phaholyothin RD. Chatucnak, Bangkok Ladie Anne Gases Palermo Visayas State University PhillRootcrops, Visayas State University, Baybay City, Leyte-Philippines LEE Gulwoo National Research Foundation of Korea (NRF) Lerjun Monilla Peñaflor College of Agriculture, UPLB Blk 10 Lot 1. Villa Ricardo Subd., San Antonio, Sen Pedro, Laguna-Philippines Listianingsih Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta 416 Proceedings ASIAHORCS 2013

Liu Congqiang National Natural Science Foundation of China (NSFC) 3 Shuangqin Road, Haidian, 100085 Beijing Luh Sarini Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation Indonesian Institute of Sciences (LIPI) Lukman Hakim Head of Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Mafaza Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Made Pharmawati Udayana Univeristy Made Dwi Wahyuni Marwadewa University Jln. Terompong No 24 Tanjung Bungkak Denpasar Bali Made Sri Yuliartini Marwadewa University Jln. Terompong No 24 Tanjung Bungkak Denpasar Bali Melinda Sinaga Bureau of General Affairs and Supplies Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Michiko Yasuda University of Shizuoka 52-1 Yada, Suruga-ku, Shizuoka Miftakhussolikhah Gunung Kidul Technical Management Unit for Chemical Process and Technology Development Indonesian Institute of Sciences (LIPI) List of participants 417

Mila Hanifa Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Mila Kencana Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Mohammad Suffian Annuar Institute of Biological Sciences, Faculty of Science, University of Malaya Muntadliroh Eka Karya Bali Botanical Garden Technical Management Unit for Plant Conservation Indonesian Institute of Sciences (LIPI) Ni GA. Eka Martiningsih Mahasaraswati University Jalan Kamboja No.11 A, Denpasar – Bali Nia Rosmiati Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Ni Luh Ari Yusasrini Faculty of Agriculture Technology Udayana University Ni Luh Yulianti Udayana University Ni Made Ayu Suardani Marwadewa University Jln. Terompong No 24 Tanjung Bungkak Denpasar Bali Ni Nyoman Ari Mayadewi Udayana University Ni Pradnyawati Udayana University 418 Proceedings ASIAHORCS 2013

Nirma Yossa Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Noorlidah Abdullah Institute of Biological Sciences, Faculty of Science, University of Malaya Nurhayati Damiri University of Sriwijaya Nur Tri Ares Suestiningtyas Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta PARK Yong-Cheol Department of Bio and Fermentation Convergence Technology, Kookmin University Seoul, 136–702, Korea Pimpun Pongpidjayamaad National Research Council of Thailand (NRCT) 196 Phaholyothin RD. Chatucnak, Bangkok Prasanna Vasu CSIR-Central FoodTechnological Research Institute, Mysore-570020, Karnataka, India Pradnyawathi Udayana University Purwadi Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Rachmat Hidayat Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta List of participants 419

Ratu Ema Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta RH Fitri Faradilla School of Chemical Engineering University of New South Wales Renu Agrawal CSIR-Central Food Technological Research Institute, Mysore-570020, Karnataka, India Retno Darwanti Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Retno G. Wijayanti Indonesian Agency for The Assessment and Aplication of Technology Ministry of Research and Technology of Indonesia Gedung II BPP Teknologi Lt 7, 8,18,19,20,21,22,23 dan 24, Jln. MH Thamrin 8, Jakarta Rini Rachmatika Research Centre for Biology Indonesian Institute of Sciences (LIPI) Jln. Raya Jakarta Bogor KM.46 Cibinong Rr. Tety Andriati Bureau of General Affairs and Supplies Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Sancoyo Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta 420 Proceedings ASIAHORCS 2013

Sharon Marks Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Siswono Yudohusodo Board of Advisor Indonesian Farmers Union Siti Nuramaliati Prijono Deputy of Life Sciences Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Sri Amiati Bureau for Cooperation and Promotion of Science and Technology Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta Subramanian Ramalingam Centre for Biotechnology, Anna University, Chennai, India Sulhadiana Munir Ministry of Agriculture Sukhuman Whankaew Institute of Molecular Biosciences, Mahidol University 999 Phutamanthan Ard, Salaya, Phuttamanthan, Nakhon Pathan, Thailand Sunanta Tongta School of Food Technology, Suranaree University of Technology Amphur Muang, Nakhon Ratchasima–Thailand Supli Effendi Rahim Agriculture Faculty University of Palembang Syahrul Aiman Deputy of Engineering Sciences Indonesian Institute of Sciences (LIPI) Jln. Jend. Gatot Subroto No. 10 Jakarta List of participants 421

Tanapon Chaisan Department of Argonomy, Faculty of Agriculture, Kasetsart University Thangadurai Devarajan Karnatak University, Dharwad, Karnataka Trina Fizzanty Center for Science and Technology Development Studies Indonesian Institute of Sciences Jln. Jend. Gatot Subroto No. 10 Jakarta Triyanto Research Center for Limnology Indonesian Institute of Science Wardah Research Centre for Biology Indonesian Institute of Sciences (LIPI) Jln. Raya Jakarta Bogor KM.46 Cibinong Wayan Arnata Udayana University Yekti Asih Purwestri Biochemistry Laboratory Faculty of Biology, University of Gadjah Mada Yopi Research Centre of Biotechnology Indonesian Institute of Sciences (LIPI) Jln. Raya Jakarta Bogor KM.46 Cibinong Zhang Yongtao National Natural Science Foundation of China (NSFC) 3 Shuangqin Road, Haidian, 100085 Beijing Zainal Arifin Head of Research Centre of Oceanography Indonesian Institute of Sciences Jln. Ancol Putih No 1 Jakarta Zuliana Razali Institute of Biological Sciences, Faculty of Science, University of Malaya

Program

PROGRAM The th5 ASIAHORCs Joint Symposium Bali, 26–28 November 2013

Day 2 : Opening ASIAHORCs Meeting and Symposium Date Time Agenda Venue/notes 08:00–08:30 Registration 27 Nov 13 08:30–08:45 Welcoming Remarks Executive Secretary of LIPI, Dr. Akmadi Abbas 08:45 09:30 Keynote Speech: Food Policy in Indonesia Siligita Large Dr. Siswono Yudo Husodo Room, Board Advisor of Indonesian Farmers Hotel Santika Association Siligita 09:30–10:10 Keynote Speech: Gut epithelium can sele ctively remove the functional food factors from nutrients in our diet Prof. Kazuki Kanazawa, Ph.D. School of Agriculture and Regional Vitalization, Kibi International University Symposium 10:10–10:30 Coffee break continue (Member of ASIAHORCs General Meet- ing move to Courtyard Marriott Hotel) Room 1 Bioresources for Food 10:30–10:45 Genetic Resources of Male Sterility for Chil lies Breeding Jutamas Kumchai and Maneechat Nikorn- pun, Department of Plant Science and Natu- ral Resources, Faculty of Agriculture, Chiang Mai University Parallel Session 10:45–11:00 Conversion of agro-industrial residues Room 1: Siligita to produce high protein mushrooms and Large utilization of mushroom industry waste in agriculture Noorlidah Abdullah, Mushroom Research Centre, Institute of Biological Sciences, Fac- ulty of Science,University of Malaya

425 426 Proceedings ASIAHORCS 2013

Room 1 Bioresources for Food 11:00–11:15 Fine mapping of QTL for cyanogenic potential in cassava storage root Sukhuman Whankaew, Supajit Sraphet, Opas Boonseng and Kanokporn Triwitayakorn, Mahidol University, Thailand. 11:15–11:30 Genetic manipulation and mass production of banana (Musa acuminata var. Berangan) plants using cell suspension culture Norzulaani Khalid, Rofina Yasmin Othman, Suffian Annuar Muhammad, Nadiya Akmal Baharom, Maryam Sulaiman, Siti Nur Akmar Mazlin, Nurain Husin and Wendy Chin Yi Wen, University of Malaya 11:30–12:10 Discussion and summary 12:05–13:00 Poster Session and Lunch break Parallel Session 13:00–13:15 Rice improvement through biotechnology Room 1: Siligita to anticipate global climate change Large Amy Estiaty, Research center for Biotechnol- ogy, Indonesian Institute of Sciences 13:15–13:30 Tetraploid plants from interspecific hybrids between mungbean and rice bean Tanapon Chaisan, Prakit Somta, Peerasak Srinives, Sontichai Chanprame, Rangsarid Kaveeta and Surapong Dumrongkitikule, Kasetsart University, Thailand 13:30–13:45 Resistant starch formation of rice from dif ferent varieties Worawikunya Kiatponglarp, Sunanta Tongta and Alain Buléon, School of Food Technol- ogy, Institute of Agricultural Technology, Suranaree University of Technology 13:45–14:05 Discussion Summary Room 1 Functional Food 14:05–14:20 Mannanase from Isolated Marine Bacteria of Pari Island for Manno-oligosaccharides production Yopi, Apridah Cameliawati Djohan and Parallel Session Laksmi Ambarsari Centre for Biotechnology, , Room 1: Siligita Indonesian Institute of Sciences Large 14:20–14:35 Enzymatic Production of Xylooligosaccha ride from Agricultural Wastes Zhengqiang Jiang, Shaoqing Yang and Qiao- juan Yan, China Agricultural University PROGRAM The th5 ASIAHORCs Joint Symposium 427

Room 1 Functional Food 14:35–15:50 Immunomodulating effects of polysaccha rides from edible mushrooms in Japan Ken-ichiro Minato and Akihiro Ohara, De- partment of Applied Biological Chemistry, Meijo University 15:45–15:10 Discussion and Summary

15:10–16:00 Poster Session and Coffee Break

16:00–16:15 Fermentation of Momordica charantia juice by Lactobacillus plantarum and its anti- diabetic properties Mohammad Suffian Annuar, University of Malaya 16:15–16:30 Protective effects of Lactobacillus plantarum CCFM8661 against lead toxicity in mice Q. X. Zhai, G. Wang, F. W. Tian, H. Zhang and W. Chen, School of Food Science and Parallel Session Technology, Jiangnan University. Room 1: Siligita 16:30–16:45 Effects of consumption timing on gastric Large emptying time and Bioavailability of bil berry anthocyanins H. Sakakibara, Y. Aoshima, S. Yamazaki and K. Shimoi, Faculty of Agriculture, University of Miyazaki 16:45–17:00 Functional Foods: Recent Research and Future Prospects Prasanna Vasu, CSIR-CFTRI, India 17:00–17:15 New Functional Cyclic Depsipeptides Exhib iting Multi-drug Resistance Reverting Activ ity Produced by Fusarium Srain Isolated from Potato in Korea Chan Lee, Review Board, National Research Foundation of Korea 17:15–17:30 Food policy to bridge political and investment barrier among countries by innovative sup portsystem in Asia Renu Agrawal, CFTRI, India 17:30–17:50 Discussion and Summary 17:50–18:00 Closing Mengiat Res- 19:00-20:30 Dinner taurant, Hotel Santika Siligita 428 Proceedings ASIAHORCS 2013

Room 2 Food Science Policy 10:30–10:45 In Search for Ocean-based Food Suatinabil ity: RCO-LIPI Vision Zainal Arifin, Research Centre for Oceanog- raphy (RCO) – LIPI 10:45–11:00 The Red Algae Sugar Platform for the Utili zation of Marine Bioresources Kyoung Heon Kim, Department of Food Bio- science & Technology, Korea University Parallel Session 11:00–11:15 NRF and Life Sciences of Korea Room 2: Siligita Joon Kim, National Research Foundation of Medium Korea 11:15–11:30 Reveal About the Forgotten Potency of Food Germplasm Other Than Rice in Indonesia Supli Effendi Rahim and Nurhayati Damiri, University of Palembang and University of Sriwijaya 11:30–11:45 Integrated Policy for Climate Change’s Trap: Case Study in Bitung’s Marine Fishery Resources Dadang Ramdhan, Indonesian Institute of Science 11:45–12:00 Bioprospecting Wild Relatives of Common Crops for Global Food Security Devarajan Thangadurai, Karnatak University, India 12:00–12:15 Discussion and summary

12:15–13:00 Poster Session and Lunch break

Room 2 Bioprocessing Technology/Food Engineering 13:00-13:15 Characteristic of Arrowroot Maranta( arundinacea) Flour From Martelu, Gedangsari, Gunungkidul Miftakhussolikhah, Dini Ariani, Cici Darsih and Mukhamad Angwar Haryadi, UPT BPPTK LIPI Yogyakarta 13:15-13:30 Characterization and Storage Studies On a Native Layered Rice Cake (Sapin-sapin) Pre- pared Through Retort Heat Treatment Benjamin A. Gonzales, Department of Food Science and Nutrition, College of Home Eco- nomics, University of the Philippines PROGRAM The th5 ASIAHORCs Joint Symposium 429

Room 2 Bioprocessing Technology/Food Engineering 13:30–13:45 Rice Analog from Broken Rice (Oryza sativa L.) And Adlay (Coix lacryma-jobi L.) Lerjun M. Peñaflor, Arnold R. Elepaño and Engelert K. Peralta, Institute of Food Science, College of Agriculture, University of the Philippines 13:45–14:00 Effect of new sanitizing formulations on quality of fresh-cut iceberg lettuce Francisco Lopez-Galvez, Peter Ragaert, Ladie Anne Palermo, Markus Eriksson and Frank Devlieghere, Visayas State University 14:00–14:15 Development of Fermentation Processes in Genetically Engineered Lactic Acid Bacteria for FOOD Applications Subramanian Ramalingam, Anna University, Chennai, India 14:15–14:30 Optimization of Dextrin Production Process Using Response Surface Method Achmat Sarifudin and Alhussein M. Assiry, B2PTTG-LIPI Department of Agricultural Engineering, Col- lege of Food and Agricultural Sciences Parallel Session 14:30–15:10 Disucssion and summary Room 2: Siligita 15:10–16:00 Poster Session and coffee break Medium 16:00–16:15 Effects of ripening on the polyphenolic pro file of Mas and Berangan bananas Zuliana Razali, Dominic George Soloman, Natasha Gideon and Chandran Somasun- dram, University of Malaya 16:15–16:30 Microbial Factory Technology for Produc tion of Food Bio-chemicals Using Renew able Biomass Yong-Cheol Park, Bio and Fermentation Con- vergence Technology, Kookmin University 16:30–16:45 Development of a Dispersive Liquid-liquid Microextraction Method for the Spectro photometric Determination of Nickel in Food Samples Shuo Wang, Jiale Li and Junping Wang Tianjin University of Science & Technology, China 16:45–17:00 Innovative Thermal and Non-Thermal Treatments for Food Safety Dong-Hyun Kang, Department of Food and Animal Biotechnology, Seoul National University 430 Proceedings ASIAHORCS 2013

Room 2 Bioprocessing Technology/Food Engineering Synthesis of Diacylglycerols from Mono 17:00–17:15 glycerols and oleic acid throught lipase SMG1-catalyzed esterfication Weifei Wang, Yang Xu and Yonghua Wang, South China University of Technology, China. Parallel Session 17:15–17:30 Application of Plackett-Burman Design on Room 2: Siligita the Sensory Analysis of Probiotic Wine Medium Domingo P. Lodevico and Roberta D. Lauzon, Department of Food Science, College of Home Economics, Central Mindanao University 17:30–17:50 Discussion and Summary 17:50–18:00 Closing Siligita large Dr. Siti Nuramaliati Prijono, room Deputy Chairman for Life Sciences of LIPI 19:00–20:30 Dinner Mengiat Res- taurant Day 3 : Field Trip to Eka Karya Botanical Garden, Bedugul Date Time Agenda Venue/notes 28 Nov 07:00–07:30 Convene at Hotel Lobby 2013 07:30–10:30 Depart to Eka Karya Botanical Garden Travel to Bedugul (app.3 hours) 10:30–12:00 Arriving at Bedugul: Site tour 12:00–13:00 Lunch break 13:00–16:00 Depart to hotel (Denpasar) Snack box provided 16:00 Arriving at Denpasar Photos

433 434 Proceedings ASIAHORCS 2013 PhotoS 435