US008 785727B2

(12) United States Patent (10) Patent No.: US 8,785,727 B2 Bauer et al. (45) Date of Patent: Jul. 22, 2014

(54) DESATURASE AND METHOD FOR THE WO WO91f13972 9, 1991 PRODUCTION OF POLYUNSATURATED W. W22. E. FATTY ACDS IN TRANSGENIC ORGANISMS WO WO 94,11516 5, 1994 WO WO94, 18337 8, 1994 (75) Inventors: Joerg Bauer, Teltow (DE); Johnathan WO WO95/18222 7, 1995 A. Napier, Preston Hertfordshire (GB); W. W. 9:29, 23: Olga Sayanova, St. Albans Hertfordshire WO WO 97.30582 8, 1997 (GB) WO WO98,46763 10, 1998 WO WO98,46764 10, 1998 (73) Assignee: Rothamsted Research Ltd., W. W. 3:25 9. 3. Hertfordshire (GB) WO WO99,27111 6, 1999 (*) Notice: Subject to any disclaimer, the term of this W. W. 2. 39. patent is extended or adjusted under 35 WO WO 02/081668 A2 10, 2002 U.S.C. 154(b) by 575 days. WO WO 2005,103253 A1 11/2005 WO WO 2007.093776 A2 8, 2007 (21) Appl. No.: 12/990,492 OTHER PUBLICATIONS (22) PCT Filed: Apr. 29, 2009 Torres-Guzman and Dominguez 1997 Molecular and Cellular Biol ogy Nov. p. 6283-6293.* (86). PCT No.: PCT/EP2009/055210 Bell and Pond 1996 Phytochemistry 41:2 p. 465-471.* S371 (c)(1), Domergue et al., “Cloning and Functional Characterization of (2), (4) Date: Feb. 15, 2011 Phaeodactylum tricornutum front-end desaturases involved in eicosapentaenoic acid biosynthesis.” Eur: J. Biochem... vol. 269, pp. (87) PCT Pub. No.: WO2009/133145 4105-41 13 (2002). Horrocks et al., “Health Benefits of Docosahexaenoic Acid (DHA).” PCT Pub. Date: Nov. 5, 2009 Pharmacological Research, vol. 40, No. 3, pp. 211-225 (1999). Huang et al., "Cloning of A12- and A6-Desaturases from Mortierella (65) Prior Publication Data alpine and Recombinant Production of Y-Linolenic Acid in Sac charomyces cerevisiae," Lipids, vol. 34, No. 7, pp. 649-659 (1999). US 2011 FO138490 A1 Jun. 9, 2011 Sakuradani et al., “A6-Fatty acid desaturase from an arachidonic acid-producing Mortierella fungus; Gene cloning and its (30) Foreign Application Priority Data heterologous expression in a fungas, Aspergillus.” gene vol. 238, pp. 445-453 (1999). Apr. 30, 2008 (EP) ...... O8155461 Sprecher, "Metabolism of highly unsatured n-3 and n-6 fatty acids.” Biochimica et Biophysica Acta, vol. 1486, pp. 219-231 (2000). (51) Int. Cl. Stukey et al., “The OLE 1 Gene of Saccharomyces cerevisiae Encodes CI2P 7/64 (2006.01) the A9 Fatty Acid Desaturase and Can Be Functionally Replaced by CI2N 9/02 (2006.01) the Rat Stearoyl-CoA Desaturase Gene.” The Journ. of Biological CI2N IS/00 (2006.01) Chem., vol. 265, No. 33, pp. 20144-20149 (1990). C7H 2L/04 (2006.01) AOIH 5/00 (2006.01) (Continued) CI2N 15/82 (2006.01) CI2N 5/14 (2006.01) Primary Examiner — David T Fox A23K L/65 (2006.01) Assistant Examiner — Matthew Keogh CIIB I/00 (2006.01) (74) Attorney, Agent, or Firm — Foley & Lardner LLP (52) U.S. Cl. USPC ...... 800/281; 435/134: 435/189: 435/320.1; (57) ABSTRACT 435/419,536/23.2:536/23.7; 426/52: 426/417: 800/295 The present invention relates to a polynucleotide from Emili (58) Field of Classification Search ana huxleyi which codes for a desaturase and which can be None employed for the recombinant production of polyunsaturated See application file for complete search history. fatty acids. The invention furthermore relates to vectors, host cells and transgenic nonhuman organisms which comprise (56) References Cited the polynucleotide according to the invention, and to the polypeptides encoded by the polynucleotide. The invention U.S. PATENT DOCUMENTS furthermore relates to antibodies against the polypeptide 5,614,393 A 3, 1997 Thomas et al. according to the invention. Finally, the invention also relates 6,043,411 A 3, 2000 Nishizawa et al. to production methods for the polyunsaturated fatty acids and 2006/0094.091 A1* 5/2006 Macool et al...... 435.134 for oil, lipid and fatty acid compositions and to their use as drugs, cosmetics, foodstuffs, feedstuffs, preferably fish food, FOREIGN PATENT DOCUMENTS or food Supplements. EP O 550 162 A1 7, 1993 EP 0 794. 250 A1 9, 1997 15 Claims, 4 Drawing Sheets US 8,785,727 B2 Page 2

(56) References Cited Sprecher, "Metabolism of highly unsaturated n-3 and n-6 fatty acids.” Biochem et Biophysica Acta, vol. 1486, pp. 219-231 (2000). OTHER PUBLICATIONS Tocher et al., “Recent Advances in the Biochemistry and Molecular Biology of Fatty Acyl Desaturases.” Prog. Lipid Res., vol. 37, No. Tocher et al., “Recent Advances in the Biochemistry and Molecular 2/3, pp. 73-117 (1998). Biology of Fatty Acyl Desaturases.” Prog. Lipid Res., vol. 37, No. Domergue et al., “Cloning and functional characterization of 2/3, pp. 73-117 (1998). Phaeodactylum tricornutum front-end desatures involved in Takeyama et al., “Expression of the eicosapentaenoic acid synthesis eicosapentaenoic acid biosynthesis.” Eur: J. Biochem... vol. 269, pp. gene cluster from Shewanella sp. in a transgenic marine 4105-41 13 (2002). cyanobacterium, Synechococcus sp. Microbiology, vol. 142, pp. Hamazaki. “Beneficial Effects of Eicosapentaenoic Acid on 2725-2731 (1997). Endothelial Vasodilator Functions in Animals and Humans.” Fatty Poulos, “Very Long Chain Fatty Acids in Higher Animals—A Acids and Lipids, vol. 88, pp. 100-108 (2001). Calder, "Dietary modification of inflammation with lipids.” Proceed Review.” Lipids, vol. 30, No. 1, 14 pages (1995). ings of the Nutrition Society, vol. 61, pp. 345-358 (2002). Wada et al., “Enchancement of chilling tolerance of a Clelandet al., “Fish Oil and Rheumatoid Arthritis: Antiinflammatory cyanobacterium by genetic manipulation of fatty acid desaturation.” and Collateral Health Benefits.” The Journ. Of Rheumatology, pp. Nature, vol. 347, pp. 200-203 (1990). 2305-2307 (2000). McKeon et al., “Stearoyl-Acyl Carrier Protein Desatrase from Saf Bell et al., “Lipid Composition During Growth of Motile and Coc flower Seeds.” Methods in Enzymology, vol. 71, pp. 275-281 (1981). colith Forms of Emiliania huxleyi, "Phytochemistry, vol. 41, No. 2, Wang et al., “BioSynthesis and regulation of linolenic acid in higher pp. 465-471 (1996). plants.” Plant Physiol. Biochem, vol. 26, No. 6, pp. 777-792 (1988). Pond et al., “The LIPID Compositions of the Coccolithophore Totani et al., “The Filamentous Fungus Mortierella alpine, High in Emiliania huxleyi and its possible ecophysiological Significance.” Arachidonic Acid.” Lipids, vol. 22, No. 12, pp. 1060-1062 (1987). vol. 76, pp. 579-594 (1996). Akimoto et al., “Carbon Dioxide Fixation and Polyunsaturated Fatty Guschina et al., “Lipids and lipid metabolism in eukaryotic algae.” Acid Production by the Red Alga Porphyridium cruentum.” vol. 73, Progress in Lipid Research, vol. 45, pp. 160-186 (2006). pp. 269-278 (1998). Singh et al., “Metabolic engineering of new fatty acids in plants.” Yu et al., Production of Eicosapentaenoic Acid by a Recombinant Current Opinion in Plant Biology, vol. 8, pp. 197-203 (2005). Marine Cyanobacterium, Synechococcus sp., Lipids, vol. 35, pp. Napier et al., “Progress towards the production of very long-chain 1061-1064 (2000). polyunsaturated fatty acid in transgenic plants: plant metabolic engi Zank et al., "Cloning and functional characterization of an enzyme neering comes of age.” Physiol. Plant... vol. 126, pp. 398-406 (2006). involved in the elongation of A6-polyunsaturated fatty acids from the Zhou et al., “Isolation and characterization of genes from the marine moss Physcomitrella patents.” The Plant Journ., vol. 31, No. 3, pp. microalga Pavlova salina encoding three front-end desaturases 255-268 (2002). involved in docosahexaenoic acid biosynthesis.” Psytochemistry, Sakuradani et al., “A6-Fatty acid desaturase from an arachiodinic vol. 68, pp. 785-796 (2007). acid-producing Mortierella fungas.” Gene, vol. 238, pp. 445-453 (1999). * cited by examiner U.S. Patent Jul. 22, 2014 Sheet 1 of 4 US 8,785,727 B2

Fig. 1

SEQ ID 1 2.5 da-Des Ot) S

8E ID 1 92 d6-Des (Ot) 8

SEQ ID 1 4. da-Des Ot 4.

SEQ 1 d 6-res (Ot

SEQ ID 1 -4 d 6-Des (Ot) 248

SEC ID 1 28 d-Des (Ot 29

SE) D 1. 33. d 6-Des (Ot) 34

SEQ ID 1 384 da-Des Ot 39

SEC ID 1. 434 d 6-Des (Ot a

40 a SEQ l w 45.5 d 6-Des Ot) 453 U.S. Patent Jul. 22, 2014 Sheet 2 of 4 US 8,785,727 B2

Fig 2.

A 16:1 18:1

16:1 18:1

B

16:1 18:1

C

16:1 18:1 20:3

D 16:1

18:1 20:45,8,11,14

16:1 18:1 20:458,11,14

U.S. Patent Jul. 22, 2014 Sheet 4 of 4 US 8,785,727 B2

Fig. 4

18:1 A9 A12-desaturas, A15703-desaturas A9,12,15 A9-elongase / N A6-deSaturase/ N A9-elongase 20:2 A1114 18:3 A69,12 18:4 A6,9,12,15 20:3 A1114, 17 abdosaurs.N / A6-elongase N / A8-deSaturaSe 20:3 A8,11,14 20:4 A8,11,14, 17

A5-deSaturaSe co3-deSaturaSe 20:4 A5,8,11,14. --> 20:5 A5,8,11,14, 17

A5-elongase co-deSaturaSe 22:4 A7,10,13,16 22:5 A7,10,13,16,19

A4-desaturaSe co3-deSaturaSe 225A4,7,10,13,16 22:6 A4,7,10,13,16, 19 US 8,785,727 B2 1. 2 DESATURASE AND METHOD FOR THE or safflower. Conventional natural sources of these fatty acids PRODUCTION OF POLYUNSATURATED are fish Such as herring, salmon, Sardine, redfish, eel, carp, FATTY ACDS IN TRANSGENIC ORGANISMS trout, halibut, mackerel, Zander or tuna, or algae. Depending on the intended use, oils with Saturated or This application is a 371 of PCT/EP09/55210 filed 29 Apr. 5 unsaturated fatty acids are preferred. In human nutrition, for 2009. example, lipids with unsaturated fatty acids, specifically The present invention relates to a polynucleotide from polyunsaturated fatty acids, are preferred. The polyunsatu Emiliana huxleyi which codes for a desaturase and which can rated co3-fatty acids are said to have a positive effect on the be employed for the recombinant production of polyunsatu cholesterol level in the blood and thus on the possibility of rated fatty acids. The invention furthermore relates to vectors, 10 host cells and transgenic nonhuman organisms which com preventing heart disease. The risk of heart disease, a stroke or prise the polynucleotides according to the invention, and to hypertension can be reduced markedly by adding these the polypeptides encoded by the polynucleotides. The inven ()3-fatty acids to food. Also, ()3-fatty acids have a positive tion furthermore relates to antibodies against the polypep effect on inflammatory, specifically on chronically inflamma tides according to the invention. Finally, the invention also 15 tory, methods in association with immunological diseases relates to production methods for the polyunsaturated fatty such as rheumatoid arthritis. They are therefore added to acids and for oil, lipid and fatty acid compositions and to their foodstuffs, specifically to dietetic foodstuffs, or are employed use as drugs, cosmetics, foodstuffs, feedstuffs, preferably fish in medicaments. ()6-Fatty acids such as arachidonic acid tend food, or food Supplements. to have a negative effect on these disorders in connection with Fatty acids and triacylglycerides have a multiplicity of these rheumatic diseases on account of our usual dietary applications in the food industry, in animal nutrition, in cos intake. metics and in the pharmacological sector. Depending on (O3- and (06-fatty acids are precursors of tissue hormones, whether they are free saturated or unsaturated fatty acids or known as eicosanoids. Such as the prostaglandins, which are else triacylglycerides with an elevated content of saturated or derived from dihomo-y-linolenic acid, arachidonic acid and unsaturated fatty acids, they are suitable for very different 25 eicosapentaenoic acid, and of the thromboxanes and leukot applications. Polyunsaturated fatty acids such as linoleic acid rienes, which are derived from arachidonic acid and eicosa and linolenic acid are essential for mammals, since they can pentaenoic acid. Eicosanoids (known as the PG series) not be produced by the latter themselves. Polyunsaturated which are formed from ()6-fatty acids generally promote (D3-fatty acids and (06-fatty acids are therefore an important inflammatory reactions, while eicosanoids (known as the PG constituent in animal and human nutrition. 30 series) from co3-fatty acids have little or no proinflammatory Polyunsaturated long-chain (D3-fatty acids such as eicosa effect. pentaenoic acid (=EPA, C20:5^*'''''') or docosa Owing to the positive characteristics of the polyunsatu hexaenoic acid (=DHA, C22:6-7'''''') are important rated fatty acids, there has been no lack of attempts in the past components in human nutrition owing to their various roles in to make available genes which are involved in the synthesis of health aspects, including the development of the child brain, 35 fatty acids or triglycerides for the production of oils in various the functionality of the eyes, the synthesis of hormones and organisms with a modified content of unsaturated fatty acids. other signal Substances, and the prevention of cardiovascular Thus, WO 91/13972 and its US equivalent describe a A9-de disorders, cancer and diabetes (Poulos, A Lipids 30:1-14, saturase. WO 93/11245 claims a A15-desaturase and WO 1995; Horrocks, LA andYeo Y KPharmacol Res 40:211-225, 94/11516 a A12-desaturase. Further desaturases are 1999). This is why there is a demand for the production of 40 described, for example, in EP-A-0 550 162, WO 94/18337. polyunsaturated long-chain fatty acids. WO 97/30582, WO 97/21340, WO95/18222, EP-A-0 794 Owing to the present-day composition of human food, an 250, Stukey et al., J. Biol. Chem., 265, 1990: 20144-20149, addition of polyunsaturated co3-fatty acids, which are prefer Wada et al., Nature 347, 1990: 200-203 or Huanget al., Lipids entially found in fish oils, to the food is particularly important. 34, 1999: 649-659. However, the biochemical characteriza Thus, for example, polyunsaturated fatty acids such as 45 tion of the various desaturases has been insufficient to date docosahexaenoic acid (=DHA, C22:6'7''''') or since the enzymes, being membrane-bound proteins, present eicosapentaenoic acid (EPA, C20:5^*'''''7) are added to great difficulty in their isolation and characterization infant formula to improve the nutritional value. The unsatur (McKeon et al., Methods in Enzymol. 71, 1981: 12141 ated fatty acid DHA is said to have a positive effect on the 12147, Wang et al., Plant Physiol. Biochem., 26, 1988: 777 development and maintenance of brain functions. 50 792). As a rule, membrane-bound desaturases are character Hereinbelow, polyunsaturated fatty acids are referred to as ized by being introduced into a suitable organism which is PUFA, PUFAs, LCPUFA or LCPUFAs (polyunsaturated Subsequently analyzed for enzyme activity by analyzing the fatty acids, PUFA, long-chain polyunsaturated fatty acids, starting materials and the products. A6-Desaturases are LCPUFA). described in WO 93/06712, U.S. Pat. No. 5,614,393, WO The various fatty acids and triglycerides are mainly 55 96/21022, WO 00/21557 and WO99/27111. Their applica obtained from microorganisms such as Mortierella and tion for production in transgenic organisms is described, for Schizochytrium or from oil-producing plants such as Soybean, example, in WO98/46763, WO 98/46764 and WO 98/46765. oilseed rape, algae Such as Crypthecodinium or Phaeodacty In this context, the expression of various desaturases and the lum and others, where they are obtained, as a rule, in the form formation of polyunsaturated fatty acids is also described and of their triacylglycerides (triglycerides=triglycerols). How 60 claimed; see, for example, WO 99/64616 or WO98/46776. ever, they can also be obtained from animals, such as, for As regards the expression efficacy of desaturases and its example, fish. The free fatty acids are advantageously pre effect on the formation of polyunsaturated fatty acids, it must pared by hydrolysis. Very long-chain polyunsaturated fatty be noted that the expression of a single desaturase as acids such as DHA, EPA, arachidonic acid (=ARA, described to date has only resulted in low contents of unsat C20:4^*'''), dihomo-y-linolenic acid (C20:3^*''') or 65 urated fatty acids/lipids such as, for example, Y-linolenic acid docosapentaenoic acid (DPA, C22:5^''''''') are not syn and stearidonic acid. Moreover, a mixture of c)3- and ()6-fatty thesized in oil crops such as oilseed rape, soybean, Sunflower acids was obtained, as a rule. US 8,785,727 B2 3 4 Especially suitable microorganisms for the production of Higher plants comprise polyunsaturated fatty acids such as PUFAS are microalgae such as Phaeodactylum tricornutum, linoleic acid (C18:2) and linolenic acid (C18:3). ARA, EPA Porphiridium species, Thraustochytrium species, and DHA are not found at all in the seed oil of higher plants, Schizochytrium species or Crypthecodinium species, ciliates or only in miniscule amounts (E. Ucciani: Nouveau Dic Such as Stylonychia or Colpidium, fungae such as Mortier tionnaire des Huiles Végétales New Dictionary of Vegetable ella, Entomophthora or Mucor and/or mosses Such as Phy Oils. Technique & Documentation Lavoisier, 1995. ISBN: Scomitrella, Ceratodon and Marchantia (R. Vazhappilly & F. 2-7430-0009-0). However, the production of LCPUFAs in Chen (1998) Botanica Marina 41: 553-558; K. Totani & K. higher plants (preferably in oil crops such as oilseed rape, Oba (1987) Lipids 22: 1060-1062: M. Akimoto et al. (1998) linseed, Sunflower and Soybeans) would be advantageous Appl. Biochemistry and Biotechnology 73: 269-278). Strain 10 since large amounts of high-quality LCPUFAs for the food selection has resulted in the development of a number of industry, animal nutrition and pharmaceutical purposes might mutant strains of the microorganisms in question which pro be obtained economically. A potential route is via recombi duce a series of desirable compounds including PUFAs. nant methods, where genes which code for enzymes of the However, the mutation and selection of strains with an biosynthesis of LCPUFAs are introduced and expressed. improved production of a particular molecule Such as the 15 These genes code for, for example, A6-desaturases, A6-elon polyunsaturated fatty acids is a time-consuming and difficult gases, A5-desaturases or A4-desaturases. These genes can method. This is why recombinant methods as described above advantageously be isolated from microorganisms and lower are preferred whenever possible. However, only limited plants which produce LCPUFAs and incorporate them in the amounts of the desired polyunsaturated fatty acids Such as membranes or triacylglycerides. Thus, it has already been DPA, EPA or ARA can be produced with the aid of the possible to isolate A6-desaturase genes from the moss Phy abovementioned microorganisms. Moreover, depending on Scomitrella patens and A6-elongase genes from P patens and the microorganism used, these are generally generated as from the nematode C. elegans. (Zank, T.K. etal. Plant Journal fatty acid mixtures of, for example, EPA, DPA and ARA. 31:255-268, 2002, Beaudoin et al. Biochem Soc Trans 28: A variety of synthetic pathways is being discussed for the 661-663, 2000). synthesis of arachidonic acid, eicosapentaenoic acid (EPA) 25 The first transgenic plants which comprise and express and docosahexaenoic acid (DHA). Thus, EPA or DHA are genes coding for LCPUFA biosynthesis enzymes and which produced in marine bacteria Such as Vibrio sp. or Shewanella produce LCPUFAs were described for the first time, for sp. via the polyketide pathway (Yu, R. et al. Lipids 35:1061 example, in DE-A-102 19203 (method for the production of 1064, 2000; Takeyama, H. et al. Microbiology 143:2725 polyunsaturated fatty acids in plants). However, these plants 2731, 1997). 30 produce LCPUFAs in amounts which require further optimi An alternative strategy is the alternating activity of desatu Zation for methoding the oils which are present in the plants. rases and elongases (Zank, T. K. et al. Plant Journal 3 1:255 To make possible the fortification of food and offeed with 268, 2002: Sakuradani, E. et al. Gene 238:445-453, 1999). A these polyunsaturated fatty acids, there is therefore a great modification of this pathway via A6-desaturase, A6-elongase, need for a simple, inexpensive method for the production of A5-desaturase, A5-elongase and A4-desaturase is the Spre 35 these polyunsaturated fatty acids, specifically in eukaryotic cher pathway (Sprecher 2000, Biochim. Biophys. Acta 1486: systems. 219-231) in mammals. Instead of the A4-desaturation, a fur The object on which the present invention is based is the ther elongation step is effected here to give C, followed by provision of Such means and measures. This object is a further A6-desaturation and finally B-oxidation to give the achieved by the embodiments which are described in the C chain length. What is known as the Sprecher pathway is, 40 patent claims and hereinbelow. however, not suitable for the production in plants and micro The present invention thus relates to a polynucleotide com organisms since the regulatory mechanisms are not yet prising a nucleic acid sequence selected from the group con known. sisting of: Depending on their desaturation pattern, the polyunsatu (a) nucleic acid sequence as shown in any of SEQID NO: rated fatty acids can be divided into two large classes, viz. (D6 45 1; or (D3-fatty acids, which differ with regard to their metabolic (b) nucleic acid sequence which codes for a polypeptide and functional activities. The starting material for the having an amino acid sequence as shown in any of SEQ ()6-metabolic pathway is the fatty acid linoleic acid ID NO: 2; (18:2^') while the co3-pathway proceeds via linolenic acid (c) nucleic acid sequence which has at least 70% identity to (18:3^'''). Linolenic acid is formed by the activity of a 50 one of the nucleic acid sequence of (a) or (b), and which A 15-desaturase (Tocher et al. 1998, Prog. Lipid Res. 37, codes for a polypeptide with desaturaase activity; and 73-117: Domergue et al. 2002, Eur. J. Biochem. 269, 4105 (d) nucleic acid sequence for a fragment of a nucleic acid of 4113). (a), (b) or (c), where the fragment codes for a polypep Mammals, and thus also humans, have no corresponding tide with desaturase activity. desaturase activity (A12- and A15-desaturase) and must take 55 According to the invention, the term “polynucleotide' up these fatty acids (essential fatty acids) via food. Starting refers to polynucleotides which comprise nucleic acid with these precursors, the physiologically important polyun sequences which code for polypeptides with desaturase activ saturated fatty acids arachidonic acid (=ARA, 20:4^'''''), ity. The desaturase activities are preferably required for the an (D6-fatty acid and the two ()3-fatty acids eicosapentaenoic biosynthesis of lipids or fatty acids. Especially preferably, acid (=EPA, 20:5^*'''''7) and docosahexaenoic acid 60 they take the form of the following desaturase activity: A5-de (DHA, 22:6'''''''''') are synthesized via the sequence saturase activity. The desaturase is preferably involved in the of desaturase and elongase reactions. The application of synthesis of polyunsaturated fatty acids (PUFAs) and espe ()3-fatty acids shows the therapeutic activity described above cially preferably in the synthesis of long-chain PUFAs in the treatment of cardiovascular diseases (Shimikawa 2001, (LCPUFAs). Suitable detection systems for this desaturase World Rev. Nutr. Diet. 88, 100-108), inflammations (Calder 65 activity are described in the examples or in WO 2005/083053. 2002, Proc. Nutr. Soc. 61,345-358) and arthritis (Cleland and The specific polynucleotides according to the invention, i.e. James 2000, J. Rheumatol. 27, 2305-2307). the polynucleotide with a nucleic acid sequence as shown in US 8,785,727 B2 5 6 SEQID NO: 1 or polynucleotides which code for a polypep mentioned specific nucleic acid sequences and codes for a tide with an amino acid sequence as shown in SEQID NO: 2 polypeptide with the respective biological activity. Equally have been obtained from Emiliana huxleyi. The term also preferably comprised are polynucleotides which comprise comprises variants of the abovementioned specific poly nucleic acid sequences which code for a polypeptide with an nucleotides. These may take the form of homologous, amino acid sequence with at least 70%, at least 75%, at least orthologous or paralogous sequences. Such variants com 80%, at least 81%, at least 82%, at least 83%, at least 84%, at prise nucleic acid sequences which feature at least one base least 85%, at least 86%, at least 87%, at least 88%, at least Substitution, one base addition or one base deletion, it being 89%, at least 90%, at least 91%, at least 92%, at least 93%, at intended that the variants still code for a polypeptide with the least 94%, at least 95%, at least 96%, at least 97%, at least abovementioned biological activity of the respective starting 10 98% or at least 99% (or a different percentage than mentioned sequence. Variants comprise polynucleotides which are herein) identity with one of the abovementioned specific capable of hybridization with the abovementioned polynucle amino acid sequences and where the polypeptide has the otides, preferably under stringent conditions. Especially pre respective biological activity of the starting sequence. ferred stringent conditions are known to the skilled worker The percentage of identical nucleotides or amino acids and can be found in Current Protocols in Molecular Biology, 15 preferably relates to a sequence segment of at least 50% of the John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. A preferred sequences to be compared, and especially preferably over the example of stringent hybridization conditions are hybridiza entire length of the sequences to be compared. A multiplicity tions in 6x sodium chloride/sodium citrate (=SSC) at of programs which implement algorithms for Such compari approximately 45°C., followed by one or more wash steps in Sons are described in the prior art and commercially available. 0.2xSSC, 0.1% SDS at 50 to 65°C. The skilled worker knows In particular, reference may be made to the algorithms of that these hybridization conditions differ as a function of the Needleman and Wunsch or Smith and Waterman, which give type of nucleic acid and, for example when organic solvents particularly reliable results. These algorithms can preferably are present, with regard to the temperature and the buffer be implemented by the following programs: PileUp (J. Mol. concentration. Under “standard hybridization conditions'. Evolution., 25, 351-360, 1987, Higgins 1989, CABIOS, 5: the temperature differs as a function of the type of nucleic 25 151-153), Gap and BestFit (Needleman 1970, J. Mol. Biol. acid between 42° C. and 58° C. in aqueous buffer with a 48; 443-453 and Smith 1981, Adv. Appl. Math. 2; 482-489), concentration of from 0.1 to 5xSSC (pH 7.2). If organic as part of the GCG software (Genetics Computer Group, 575 solvent is present in the abovementioned buffer, for example Science Drive, Madison, Wis., USA 53711, 1991). For the 50% formamide, the temperature under standard conditions purposes of the present invention, it is especially preferred to is approximately 42°C. The hybridization conditions for 30 determine the percentage (%) of the sequence identity with DNA:DNA hybrids are preferably for example 0.1xSSC and the GAP program over the entire sequence, with the following 20° C. to 45° C., preferably between 30° C. and 45° C. The set parameters: Gap Weight: 50, Length Weight: 3, Average hybridization conditions for DNA:RNA hybrids are prefer Match: 10.000 and Average Mismatch: 0.000. ably for example 0.1xSSC and 30° C. to 55° C., preferably A polynucleotide which only comprises a fragment of the between 45° C. and 55° C. The abovementioned hybridiza 35 abovementioned nucleic acid sequences is also a polynucle tion temperatures are determined for example for a nucleic otide according to the invention. Here, it is intended that the acid of approximately 100 by (base pairs) in length and a fragment codes for a polypeptide which features the biologi G+C content of 50% in the absence of formamide. The skilled cal activity of the starting sequence, or of the polypeptide worker knows how to determine the hybridization conditions which the latter codes for. Polypeptides which are encoded by required with the aid of textbooks, such as the one mentioned 40 Such polynucleotides therefore comprise, or consist of hereinabove, or from the following textbooks: Sambrook et domains of the abovementioned specific polypeptides (start al., Molecular Cloning, Cold Spring Harbor Laboratory, ing polypeptides) which confer the biological activity. A frag 1989; Hames and Higgins (eds.) 1985, Nucleic Acids Hybrid ment for the purposes of the invention preferably comprises at ization: A Practical Approach, IRL Press at Oxford Univer least 50, at least 100, at least 250 or at least 500 consecutive sity Press, Oxford; Brown (ed.) 1991, Essential Molecular 45 nucleotides of the abovementioned specific sequences or Biology: A Practical Approach, IRL Press at Oxford Univer codes for an amino acid sequence comprising at least 20, at sity Press, Oxford. As an alternative, variants of the specific least 30, at least 50, at least 80, at least 100 or at least 150 polynucleotides according to the invention may also be pro consecutive amino acids of one of the abovementioned spe vided by polymerase chain reaction (PCR)-based methods. cific amino acid sequences, and confers biological activity, To this end, it is possible first to derive primers from con 50 preferably desaturase activity, as described above. served sequences (for example sequences which code for The term “desaturase activity” as used in the present con functional domains in the polypeptide). Conserved sequences text refers to an enzymatic activity by which a dehydrogena can be determined by sequence comparisons with polynucle tion of fatty acids or fatty acid derivatives as Substrates cata otides which code for polypeptides with a similar activity. lyZes. The desaturase activity according to the invention The template used may be DNA or cDNA from bacteria, 55 preferably takes the form of deta-5 desaturase (also referred fungi, plants or animals. DNA fragments obtained by PCR to as A5-desaturase activity). A5-Desaturases are enzymes can be used for screening suitable genomic libraries or cDNA with the enzymatic function for the dehydrogenation of C20 libraries in order to if required isolate the complete open fatty acids which are dehydrogenated at the Catom 8-9. Here, reading frame of the polynucleotide and to determine it by the C atoms C5 and C6 are dehydrogenated by in each case sequencing. Preferred variants comprise polynucleotides 60 one hydrogen atom, giving rise to a double bond between the which comprise a nucleic acid sequence with at least 70%, at two C atoms. It is especially preferred that enzymes with least 75%, at least 80%, at least 81%, at least 82%, at least desaturase activity—and in particular A5-desaturase activ 83%, at least 84%, at least 85%, at least 86%, at least 87%, at ity—within the meaning of the present invention also convert least 88%, at least 89%, at least 90%, at least 91%, at least acyl-coenzyme A as Substrate. 92%, at least 93%, at least 94%, at least 95%, at least 96%, at 65 The polynucleotide variants according to the invention least 97%, at least 98% or at least 99% (or a different percent preferably feature at least 10%, at least 20%, at least 30%, at age than mentioned herein) identity with one of the above least 40%, at least 50%, at least 60%, at least 70%, at least US 8,785,727 B2 7 8 80% or at least 90% of the respective biological activity of the (such as, for example, those described in Sambrook et al., polypeptide which is encoded by the starting sequence. That Molecular Cloning: A Laboratory Manual. 2" Ed., Cold is to say the polypeptides which are encoded by the poly Spring Harbor Laboratory, Cold Spring Harbor Laboratory nucleotides according to the invention can participate in the Press, Cold Spring Harbor, N.Y., 1989) for isolating further metabolism of compounds required for the synthesis of fatty nucleic acid sequences which are useful in the method. More acids, fatty acid esters such as diacylglycerides and/or tria over, it is possible to isolate polynucleotides or fragments cylglycerides in an organism, preferably in a plant or plant thereof by means of polymerase chain reaction (PCR), where cell, or can participate in the transport of molecules across oligonucleotide primers which are based on this sequence or membranes, which means Cis-, Co- or C-carbon chains in parts thereof are employed (for example, a nucleic acid mol the fatty acid molecule with double bonds at least two, advan 10 ecule comprising the complete sequence or part thereof can tageously three, four, five or six positions. be isolated by polymerase chain reaction using oligonucle The polynucleotides according to the invention either com otide primers which have been generated on the basis of this prise the abovementioned specific nucleic acid sequences or same sequence). For example, it is possible to isolate mRNA consist of them. That is to say, that the polynucleotides from cells (for example by the guanidinium thiocyanate according to the invention may, in principle, also comprise 15 extractive method by Chirgwin et al. (1979) Biochemistry further nucleotides. These may preferably be 3'- or 5'-untrans 18:5294-5299, and cDNA can be generated by means of lated regions of the genomic nucleic acid sequence. They reverse transcriptase (for example Moloney MLV reverse preferably consist of at least 100,200 or 500 nucleotides at the transcriptase, obtainable from Gibco/BRL. Bethesda, Md., or 5' terminus and of at least 20, 50 or 100 nucleotides at the 3' AMV reverse transcriptase, obtainable from Seikagaku terminus of the coding region. Further polynucleotides which America, Inc., St. Petersburg, Fla.). Synthetic oligonucle comprise additional nucleic acid sequences are those which otide primers for the amplification by means of polymerase code for fusion proteins. Such fusion proteins can code for chain reaction can be generated on the basis of the polynucle further polypeptide or polypeptide portions, in addition to the otide and amino acid sequences shown in the SEQID num abovementioned polypeptides. The additional polypeptide or bers. A nucleic acid according to the invention can be ampli polypeptide portion may take the form of further enzymes of 25 fied using cDNA or, alternatively, genomic DNA as the lipid or fatty acid biosynthesis. Others which are feasible are template and Suitable oligonucleotide primers, following polypeptides which may act as expression markers (green, standard PCR amplification techniques. The nucleic acid yellow, red, blue fluorescent proteins, alkaline phosphatase amplified thus can be cloned into a suitable vector and char and others) or so-called “tags' as labels or as an aid for acterized by means of DNA sequence analysis. Oligonucle purification (for example FLAG tags, 6-histidine tags, MYC 30 otides which correspond to a desaturase nucleotide sequence tags and others). can be generated by standard synthetic methods, for example Polynucleotide variants can be isolated from different using an automatic DNA synthesizer. natural or artificial Sources. For example, they can be gener The polynucleotides according to the invention can either ated artificially by in-vitro or in-vivo mutagenesis. Homologs be provided in the form of isolated polynucleotides (i.e. iso or orthologs of the specific sequences can be obtained from a 35 lated from their natural origin, for example the genomic wide range of animals, plants and microorganisms. They are locus) or else in genetically modified form (i.e. the polynucle preferably obtained from algae. Algae Such as Isochrysis, otides may also be present at their natural genetic locus, but, Euglena or Crypthecodinium, algae/diatoms such as Thalas in Such a case, must be genetically modified). An isolated Siosira, Phaeodactylum or Thraustochytrium, Pythium, polynucleotide preferably comprises less than 5 kb, 4 kb, 3 mosses such as Physcomitrella or Ceratodon are preferred, 40 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleic acid sequence which very especially preferred are the algae of the genus Euglena occurs naturally in its environment. The polynucleotide or the diatoms of the class Oomycota Such as the genera according to the invention may be present as a single-stranded Pythium or Phytophtora or fungi from the division Zygomy or double-stranded nucleic acid molecule and may take the wta from the genera Rhizopus. The polynucleotides can also form of genomic DNA, cDNA or RNA. Preferably, the poly be preferably be obtained from higher plants such as Primu 45 nucleotide according to the invention consists of RNA or laceae such as Aleuritia, Calendula Stellata, Osteospermum DNA. The polynucleotides according to the invention com spinescens or Osteospermum hyoseroides, microorganisms prise all orientations of the sequences shown in the SEQID Such as fungi. Such as Aspergillus, Thraustochytrium, Phy numbers, i.e. also complementary Strands and reverse, or tophthora, Entomophthora, Mucor or Mortierella, bacteria reverse-complementary, orientations. The term furthermore Such as Shewanella, yeasts or animals such as nematodes, for 50 also comprises chemically modified nucleic acids, such as the example Caenorhabditis, insects or fish. The polynucleotide naturally occurring methylated DNA molecules, or artificial variants are also preferably derived from an animal from the nucleic acids, for example biotinylated nucleic acids. order vertebrates. Especially preferably, the polynucleotides Owing to the polynucleotides according to the invention, are derived from the class Vertebrata: Euteleostomi, Actinop the substrates 20:4A5,8,11,14 and 20:5A5,8,11,14, 17 can be terygii; Neopterygii; Teleostei: Euteleostei, Protacanthop 55 increased in the recombinant production of long-chain terygii, Salmoniformes; Salmonidae or Oncorhynchus and, PUFAs. The A5-desaturase which is encoded by the poly very especially preferably, from the order Salmoniformes nucleotide according to the invention preferentially catalyzes Such as the family Salmonidae, Such as the genus Salmo, for the final synthesis step of 20:3A8,11,14 and 20:4A8,11,14.17 example from the genera and species Oncorhynchus mykiss, to give the commercially valuable long-chain polyunsatu Trutta trutta or Salmo trutta fario. Here, the polynucleotides 60 rated fatty acids. A variety of approaches for isolating A5-de according to the invention can be isolated by means of stan saturases have been carried out in the past (for example dard techniques of molecular biology and of the sequence Domergue et al. (2002), Eur J. Biochem. 269(16):4105-13, information provided herein. Also, it is possible, with the aid Kajikawa et al. (2004)Plant Mol. Biol. 54:335-52). It has also of comparative algorithms, to identify for example a homolo been possible to demonstrate that all of the previously known gous sequence or homologous, conserved sequence regions at 65 A5-desaturases utilize the same acyl carrier phosphatidylcho the DNA or amino acid level. These can be employed as lin (Domergue et al. (2003) J Biol. Chem. 278(37):35115 hybridization probe and standard hybridization techniques 26). For A6-desaturases, it has been possible to demonstrate US 8,785,727 B2 9 10 that the conversion of acyl-coenzyme A (acyl-carrier coen the A4-desaturase encoded by the polynucleotide sequence Zyme A) is advantageous for the synthesis of long-chain with SEQID NO: 17 (d4Des(Tc)) with the desaturase accord polyunsaturated fatty acids (Domergue et al. (2005) Biochem ing to the invention in order to synthesize long-chain polyun J.389(Pt.2):483-90). However, it has not been possible to date saturated fatty acids. The abovementioned polynucleotides to identify any enzyme for the class of the 45-desaturases are described in WO2006/100241. Alternatively, it was also which is capable of converting acyl-coenzyme A as the Sub possible to employa A9-elongase and a A8-desaturase instead strate. Neither do sequence comparisons make it possible to of the abovementioned A6-desaturase and the A6-elongase as predict the substrate specificity with regard to the acyl carrier. described in WO2004/057001. Depending on the fatty acid Surprisingly, it was possible to isolate, in the context of the which is to be prepared, it is possible to coexpress, in the host present invention, a sequence from the alga Emiliana huxleyi 10 cells or transgenic organisms described hereinbelow, or to use (Eukaryota; Haptophyceae: Isochrysidales; Noelaerhab in the methods according to the invention, a variety of com daceae), which codes for an enzyme with 45-desaturase activ binations of the polynucleotides according to the invention ity and which converts acyl-coenzyme A Substrates. In par with the abovementioned desaturases or elongases. Espe ticular, it has emerged, advantageously, that the cially preferred combinations for the production of arachi polynucleotides according to the invention can be employed 15 donic acid in table 1, for eicosapentaenoic acid in table 2 and particularly efficiently for the recombinant production of for docosahexaenoic acid in table 3 are detailed hereinbelow. polyunsaturated fatty acids in host cells and transgenic organ For example, it is possible to use the A5-desaturase according isms. In particular, the polypeptides with 45-desaturase activ to the invention, alone or in a Suitable combination (for ity which are encoded by the polynucleotide according to the example a A12-desaturase and a A15-desaturase), together invention are capable of Cs—, Co - and C-fatty acids with d6Des(Pir), d6Elo(Pp), d5Des(Tc), co3Des(Pi) for the with two, three, four or five double bonds and preferably production of EPA. Equally, the A5-desaturase according to polyunsaturated Co-fatty acids with three or four double the invention, alone or in a Suitable combination, can be used bonds such as C20:34, or C20:4A.'''''7. The poly together with d6Des(Pir), d6Elo(Pp), d5Des(Tc), co3Des(Pi), nucleotide and amino acid sequences according to the inven d5Elo(Ot), d4Des(Tc) for the production of docosahexaenoic tion especially preferably lead to an increase in the fatty acids 25 acid. 20:4A5,8,11,14 (arachidonic acid) and 20:5A5,8,11,14.17 Preferably, it is the fatty acids in phospholipids or CoA (eicosapentaenoic acid). fatty acid esters which are desaturated, advantageously in the The invention also comprises oligonucleotides of at least CoA fatty acid esters. Thus, a simple, inexpensive production 15bp, preferably at least 20 bp, at least 25 bp, at least 30 bp, of these polyunsaturated fatty acids is possible, specifically in at least 35bp or at least 50 bp, which are capable of specifi 30 eukaryotic systems. The unsaturated fatty acids produced by cally hybridizing under stringent conditions with one of the means of the polynucleotides according to the invention can abovementioned polynucleotides. The oligonucleotides may then be formulated as oil, lipid and fatty acid compositions consist of DNA or RNA or both. Such oligonucleotides can be and can be employed in a suitable manner. employed as primers for the PCR, as expression-inhibitory The present invention furthermore relates to a vector which antisense oligonucleotides, for RNA interference (RNAi) 35 comprises the polynucleotide according to the invention. approaches or for chimeroplastic or genoplastic approaches. The term “vector” refers to a nucleic acid molecule which RNAi methods are described for example in Fire et al., Nature is capable of transporting another nucleic acid molecule. Such (1998)391:806-811; Fire, Trends Genet. 15,358-363 (1999); as the polynucleotides according to the invention, to which it Sharp, RNA interference 2001. Genes Dev. 15, 485-490 is bound. One type of vector is a “plasmid', a circular double (2001); Hammond et al. Nature Rev. Genet. 2, 1110-1119 40 stranded DNA loop into which additional DNA segments can (2001); Tuschl, Chem. Biochem. 2, 239-245 (2001); Hamil be ligated. A further type of vector is a viral vector, it being ton et al., Science 286, 950-952 (1999); Hammond et al., possible for additional DNA segments to be ligated into the Nature 404, 293-296 (2000); Zamore et al., Cell 101, 25-33 viral genome. Certain vectors are capable of autonomous (2000); Bernsteinet al., Nature 409,363-366 (2001); Elbashir replication in a host cell into which they have been introduced et al., Genes Dev. 15, 188-200 (2001); WO 01/29058; WO 45 (for example bacterial vectors with bacterial replication ori 99/32619; or Elbashir et al., 2001 Nature 411: 494-498 and gin). Other vectors are advantageously integrated into the serve for inhibiting gene expression by degrading the mRNA. genome of a host cell when they are introduced into the host Chimeroplastic or genoplastic approaches serve the in-vivo cell, and thus replicate together with the host genome. More modification (for example the introduction of point muta over, certain vectors can govern the expression of genes with tions) into genes at their endogenous loci. Corresponding 50 which they are in operable linkage. These vectors are referred methods are disclosed in U.S. Pat. No. 5,565,350, U.S. Pat. to in the present context as “expression vectors'. Usually, No. 5,756,325, U.S. Pat. No. 5,871,984, U.S. Pat. No. 5,731, expression vectors which are suitable for DNA recombina 181, U.S. Pat. No. 5,795,972, U.S. Pat. No. 6,573,046, U.S. tion techniques take the form of plasmids. In the present Pat. No. 6,211,351, U.S. Pat. No. 6,586,184, U.S. Pat. No. description, "plasmid' and “vector” can be used exchange 6,271,360 and U.S. Pat. No. 6,479,292. 55 ably since the plasmid is the form of vector which is most In this context, it is especially preferred to employ the frequently used. However, the invention is also intended to A6-desaturase encoded by the polynucleotide sequence with comprise other forms of expression vectors, such as viral SEQID NO: 5 (d6Des(Pir)), the A6-elongase encoded by the vectors, which exert similar functions. Furthermore, the term polynucleotide sequence with SEQIDNO: 7 (d6Elo(Pp)), the “vector” is also intended to comprise other vectors with A5-desaturase encoded by the polynucleotide sequence with 60 which the skilled worker is familiar, such as phages, viruses SEQ ID NO: 1 (d5Des(Eh)), the A12-desaturase encoded by such as SV40, CMV. TMV, transposons, IS elements, phas the polynucleotide sequence with SEQ ID NO: 9 (d12Des mids, phagemids, cosmids, linear or circular DNA, artificial (Ps)), the A15-desaturase encoded by the polynucleotide chromosomes. Finally, the term also comprises constructs for sequence with SEQ ID NO: 13 (d15Des(Perf)), the co3-de the targeted, i.e. homologous, recombination, or the heterolo saturase encoded by the polynucleotide sequence with SEQ 65 gous insertion of polynucleotides. ID NO: 11 (o3Des(Pi)), the A5-elongase encoded by the Vectors can be introduced into prokaryotic and eukaryotic polynucleotide sequence with SEQID NO: (d5Elo(Ot)), and cells via conventional transformation or transfection tech US 8,785,727 B2 11 12 niques. The terms “transformation' and “transfection', con expression cassette. The expression control sequence ensures jugation and transduction, as used in the present context, are that, after transformation or transfection into a host cell, the intended to comprise a multiplicity of methods known in the polynucleotide can be expressed. The expression control prior art for the introduction of foreign nucleic acid (for sequence to be used preferably comprises cis-regulatory ele example DNA) into a host cell, including calcium phosphate ments such as promoter and/or enhancer nucleic acid or calcium chloride coprecipitation, DEAE-dextran-medi sequences, which are recognized by the transcription machin ated transfection, lipofection, natural competence, chemi ery of the host cells. The term furthermore comprises other cally mediated transfer, electroporation or particle bombard expression control elements, for example polyadenylation ment. Suitable methods for the transformation or transfection signals and RNA-stabilizing sequences. These regulatory of host cells, including plant cells, can be found in Sambrook 10 sequences are described for example in Goeddel: Gene et al. (Molecular Cloning: A Laboratory Manual., 2nd ed., Expression Technology: Methods in Enzymology 185, Aca Cold Spring Harbor Laboratory, Cold Spring Harbor Labo demic Press, San Diego, Calif. (1990) or see: Gruber and ratory Press, Cold Spring Harbor, N.Y., 1989) and other labo Crosby, in: Methods in Plant Molecular Biology and Biotech ratory textbooks such as Methods in Molecular Biology, nology, CRC Press, Boca Raton, Fla., eds. Glick and Thomp 1995, Vol. 44, Agrobacterium protocols, Ed.: Gartland and 15 son, chapter 7, 89-108, including the literature cited therein. Davey, Humana Press, Totowa, N.J. Expression control sequences comprise those which govern Suitable cloning vectors are generally known to the skilled the constitutive expression of a nucleotide sequence in many worker. In particular, they include vectors which can replicate types of host cells, and those which govern the direct expres in microbial systems, that is mainly vectors which ensure sion of the nucleotide sequence only in certain host cells efficient cloning in yeasts or fungi and which make possible under certain conditions. The skilled worker knows that the the stable transformation of plants. Those which must be design of the expression vector may depend on factors such as mentioned are in particular various binary and cointegrated the choice of the host cell to be transformed, the extent of the vector systems which are suitable for the T-DNA-mediated expression of the desired protein and the like. The polynucle transformation. Such vector systems are, as a rule, character otides according to the invention may be present in one or ized in that they comprise at least the vir genes, which are 25 more copies in the expression cassette or in the expression required for the agrobacterium-mediated transformation, and vector according to the invention (for example in the form of the T-DNA-bordering sequences (T-DNA border). Prefer several expression cassettes). Here, the regulatory sequences ably, these vector systems also comprise further cis-regula or factors can preferably have a positive effect on the gene tory regions such as promoters and terminators and/or selec expression of the introduced genes, as described above, and tion markers, by means of which suitably transformed 30 thereby increase it. Thus, it is possible to enhance the regu organisms can be identified. While in the case of cointegrated latory elements advantageously at the transcription level by vector systems vir genes and T-DNA sequences are arranged using strong transcription signals such as promoters and/or on the same vector, binary systems are based on at least two "enhancers’. Besides, it is also possible to enhance the trans vectors, one of which bears virgenes, but no T-DNA, and the lation, for example by improving the mRNA stability. Further other bears T-DNA, but no vir gene. As a result, the last 35 expression control sequences within the meaning of the mentioned vectors are relatively small, easy to manipulate present invention are translation terminators at the 3' end of and to replicate both in E. coli and in Agrobacterium. These the polynucleotides to be translated. An example which can binary vectors include vectors from the pBIB-HYG series, be used here is the OCS1 terminator. As in the case of the the pPZP series, the pl3ecks series and the pGreen series. promoters, a different terminator sequence should be used for Preferably used according to the invention are Bin19, 40 each polynucleotide to be expressed. pBI101, pBinAR, pGPTV and pCAMBIA. An overview of Preferred expression control sequences or regulatory binary vectors and their use is found in Hellens et al. Trends sequences are present in promoters such as the cos, tac, trp, in Plant Science (2000) 5, 446-451. The vectors with the tet, trp-tet, lpp, lac, lpp-lac, lacIq, T7. T5, T3, gal, trc, ara, inserted polynucleotides according to the invention can be SP6, w-PR or W-PL promoters and are advantageously propagated Stably under selective conditions in microorgan 45 employed in Gram-negative bacteria. Further advantageous isms, in particular Escherichia coli and Agrobacterium tume regulatory sequences are, for example, present in the Gram faciens, and make possible a transfer of heterologous DNA positive promoters amy and SPO2, in the yeast or fungal into plants or microorganisms. The polynucleotides accord promoters ADC1, MFC, AC, P-60, CYC1, GAPDH, TEF, ing to the invention can be introduced into organisms such as rp28, ADH or in the plant promoters CaMV/35S Francket microorganisms or plants by means of the cloning vectors and 50 al., Cell 21 (1980) 285-294, PRP1 Ward et al., Plant. Mol. thus used for transforming plants. Vectors which are suitable Biol. 22 (1993), SSU, OCS, lib4, usp, STLS1, B33, nos or in for this purpose are published in: Plant Molecular Biology the ubiquitin or phaseolin promoter. Advantageous in this and Biotechnology (CRC Press, Boca Raton, Fla.), chapter context are also inducible promoters, such as the promoters 6/7, p.71-119 (1993); F. F. White, Vectors for Gene Transfer described in EP-A-0 388 186 (benzenesulfonamide-induc in Higher Plants; in: Transgenic Plants, Vol. 1, Engineering 55 ible), Plant J. 2, 1992:397-404 (Gatz et al., tetracycline-in and Utilization, eds. Kung and R. Wu, Academic Press, 1993, ducible), EP-A-0 335 528 (abscisic acid-inducible) or WO 15-38; B. Jenes et al., Techniques for Gene Transfer, in: 93/21334 (ethanol- or cyclohexenol-inducible). Further suit Transgenic Plants, Vol. 1, Engineering and Utilization, eds. able plant promoters are the cytosolic FBPase promoter or the Kung and R. Wu, Academic Press (1993), 128-143; Potrykus, ST-LSI promoter of potato (Stockhaus et al., EMBO J. 8, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205 60 1989, 2445), the glycine max’ phosphoribosyl-pyrophosphate 225. amidotransferase promoter (Genbank Accession No. The vector is preferably an expression vector. The poly U87999) or the node-specific promoter described in EP-A-0 nucleotide is present in the expression vector according to the 249 676. Especially advantageous promoters are promoters invention in operative (i.e. functional) linkage with an expres which make possible the expression in tissues which are sion control sequence. The expression control sequence 65 involved in the biosynthesis of fatty acids. Very especially together with the polynucleotide and optionally further advantageous are seed-specific promoters, such as the USP sequence elements of the vector is also referred to as the promoter, but also other promoters such as the LeB4, DC3, US 8,785,727 B2 13 14 phaseolin or napin promoter. Further especially advanta geously, the sequence is repeated up to three times. To express geous promoters are seed-specific promoters which can be the nucleic acid sequences, the latter are inserted behind the used for monocotyledonous or dicotyledonous plants and promoter via a suitable cleavage site, for example in the which are described in U.S. Pat. No. 5,608,152 (oilseed rape polylinker. Advantageously, each nucleic acid sequence has napin promoter), WO 98/45461 (Arobidopsis oleosin pro its own promoter and, if appropriate, its own terminator. Such moter), U.S. Pat. No. 5,504.200 (Phaseolus vulgaris phaseo advantageous constructs are disclosed, for example, in DE lin promoter), WO 91/13980 (Brassica Bce4 promoter), by 101 02337 or DE 101 02338. However, it is also possible to Baeumleinet al., Plant J., 2, 2, 1992:233-239 (LeB4 promoter inserta plurality of nucleic acid sequences behind a promoter from a legume), these promoters being Suitable for dicots. and, if appropriate, in front of a terminator. Here, the insertion Examples of promoters which are suitable for monocots are 10 site, or the sequence, of the inserted nucleic acids in the the barley lpt-2 or lpt-1 promoter (WO95/15389 and WO expression cassette is not of critical importance, that is to say 95/23230), the barley hordein promoter and other suitable a nucleic acid sequence can be inserted at the first or last promoters described in WO99/16890. In principle, it is pos position in the cassette without its expression being Substan sible to use all natural promoters together with their regula tially influenced thereby. Advantageously, different promot tory sequences, such as those mentioned above, as expression 15 ers such as, for example, the USP, LegB4 or DC3 promoters, control sequences. It is also possible to use synthetic promot and different terminators can be used in the expression cas ers, either in addition or alone, in particular when they medi sette. However, it is also possible to use only one type of ate seed-specific expression, as described, for example, in promoter in the cassette. This, however, may lead to undes WO 99/16890. ired recombination events. In order to achieve a particularly high PUFA content, espe The recombinant expression vectors used can be designed cially in transgenic plants, the polynucleotides of the present for the expression in prokaryotic or eukaryotic cells. This is invention should preferably be expressed in oil crops in a advantageous since intermediate steps of the vector construc seed-specific manner. To this end, seed-specific promoters tion are frequently carried out in microorganisms for the sake can be used, or those promoters which are active in the of simplicity. For example, the A12-desaturase. A 15-desatu embryo and/or in the endosperm. In principle, seed-specific 25 rase, A12- and A15-desaturases, (03-desaturase, A6-desatu promoters can be isolated both from dicotyledonous and from rase, A6-elongase, A9-elongase, A8-desaturase, A5-desatu monocotyledonous plants. Advantageous preferred promot rase, A5-elongase and/or A4-desaturase genes can be ers are listed hereinbelow: USP (unknown seed protein) and expressed in bacterial cells, insect cells (using Baculovirus vicilin (Vicia faba) Baumlein et al., Mol. Gen. Genet., 1991, expression vectors), yeast and other fungal cells (see 225(3), napin (oilseed rape) U.S. Pat. No. 5,608,152, acyl 30 Romanos, M. A., et al. (1992) “Foreign gene expression in carrier protein (oilseed rape) U.S. Pat. No. 5,315,001 and yeast: a review'', Yeast 8:423-488; Van den Hondel, C. A. M. WO 92/18634), oleosin (Arabidopsis thaliana) WO J. J., et al. (1991) “Heterologous gene expression in filamen 98/45461 and WO93/20216), phaseolin (Phaseolus vulgaris) tous fungi', in: More Gene Manipulations in Fungi, J. W. U.S. Pat. No. 5,504,200), Bce4 WO91/13980, legumines Bennet & L. L. Lasure, Eds., pp. 396-428: Academic Press: B4 (LegB4 promoter) Baumlein et al., Plant J., 2.2, 1992. 35 San Diego; and van den Hondel, C. A. M. J. J., & Punt, P. J. Lpt2 and Ipt 1 (barley) WO95/15389 and WO95/23230), (1991) “Gene transfer systems and vector development for seed-specific promoters from rice, maize and wheat WO filamentous fungi, in: Applied Molecular Genetics of Fungi, 99/16890, Amy32b, Amy 6-6 and aleurain U.S. Pat. No. Peberdy, J. F., et al., Eds., pp. 1-28, Cambridge University 5,677,474), Bce4 (oilseed rape) U.S. Pat. No. 5,530,149. Press: Cambridge), algae (Falciatore et al., 1999, Marine glycinin (soybean) EP 571 741, phosphoenolpyruvate car 40 Biotechnology. 1, 3:239-251), ciliates of the types: Holotri boxylase (soybean).JP 06/62870, ADR12-2 (soybean)WO chia, Peritrichia, Spirotrichia, Suctoria, Tetrahymena, Para 98/08962), isocitrate lyase (oilseed rape) U.S. Pat. No. mecium, Colpidium, Glaucoma, Platyophrya, Potomacus, 5,689,040 or C-amylase (barley) EP 781849. Desaturaseudocohnilembus, Euplotes, Engelmaniella and Plant gene expression can also be facilitated via a chemi Stylonychia, in particular of the genus Stylonychia lemmae, cally inducible promoter (see a review in Gatz, 1997, Annu. 45 using vectors in a transformation method as described in WO Rev. Plant Physiol. Plant Mol. Biol., 48:89-108). Chemically 98/O1572 and, preferably, in cells of multi-celled plants (see inducible promoters are particularly suitable when it is Schmidt, R. and Willimitzer, L. (1988) “High efficiency Agro desired that gene expression should take place in a time bacterium tumefaciens-mediated transformation of Arabi specific manner. Examples of Such promoters are a salicylic dopsis thaliana leaf and cotyledon explants' Plant Cell Rep.: acid-inducible promoter (WO95/19443), a tetracycline-in 50 583-586: Plant Molecular Biology and Biotechnology, C ducible promoter (Gatz et al. (1992) Plant J. 2, 397-404) and Press, Boca Raton, Fla., Chapter 6/7, pp.71-119 (1993); F. F. an ethanol-inducible promoter. White, B. Jenes et al., Techniques for Gene Transfer, in: To ensure stable integration of the various biosynthesis Transgenic Plants, Vol. 1, Engineering and Utilization, Eds.: genes into the transgenic plant over a plurality of generations, Kung and R. Wu, Academic Press (1993), 128-43; Potrykus, each of the polynucleotides according to the invention should 55 Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205 be expressed under the control of a separate promoter, pref 225 (and references cited therein)). Suitable host cells are erably a promoter which differs from the other promoters, furthermore discussed in Goeddel, Gene Expression Technol since repeating sequence motifs can lead to instability of the ogy: Methods in Enzymology 185, Academic Press, San T-DNA, or to recombination events. In this context, the Diego, Calif. (1990). As an alternative, the recombinant expression cassette is advantageously constructed in Such a 60 expression vector can be transcribed and translated in vitro, way that a promoter is followed by a suitable cleavage site for example using T7-promoter regulatory sequences and (advantageously in a polylinker) for insertion of the nucleic T7-polymerase. acid to be expressed and, if appropriate, a terminator is then In most cases, the expression of proteins in prokaryotes positioned behind the polylinker. This sequence is repeated involves the use of vectors comprising constitutive or induc several times, preferably three, four or five times, so that up to 65 ible promoters which govern the expression of fusion or non five genes can be combined in one construct and introduced fusion proteins. Typical fusion expression vectors are, inter into the transgenic plant in order to be expressed. Advanta alia, pGEX (Pharmacia Biotech Inc.; Smith, D. B., and US 8,785,727 B2 15 16 Johnson, K. S. (1988) Gene 67:31-40), pMAL (New England gene 3 of the Tiplasmid pTiACH5 (Gielen et al., EMBO J.3 Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, (1984) 835 et seq.), which is known as octopine synthase, or N.J.), where glutathione S-transferase (GST), maltose-E- functional equivalents thereof, but all other terminators which binding protein and protein A, respectively, arefused with the are functionally active in plants are also Suitable. Since plant recombinant target protein. Examples of suitable inducible gene expression is very often not limited to transcriptional nonfusion E. coli expression vectors are, inter alia, pTrc levels, a plant expression cassette preferably comprises other (Amannet al. (1988) Gene69:301-315) and pET 11d (Studier sequences which are linked operably, such as translation et al., Gene Expression Technology: Methods in Enzymology enhancers, for example the overdrive sequence, which com 185, Academic Press, San Diego, Calif. (1990) 60-89). The prises the tobacco mosaic virus 5'-untranslated leader target gene expression from the vector pTrc is based on the 10 sequence, which increases the protein/RNA ratio (Gallie et transcription from a hybrid trp-lac fusion promoter by the al., 1987, Nucl. Acids Research 15:8693-8711). As described host RNA polymerase. The target gene expression from the above, plant gene expression must be linked operably with a vectorpET 11d is based on the transcription of a T7-gn 10-lac Suitable promoter which triggers gene expression with the fusion promoter, which is mediated by a viral RNA poly correct timing or in a cell- or tissue-specific manner. Utiliz merase (T7gn1), which is coexpressed. This viral polymerase 15 able promoters are constitutive promoters (Benfey et al., is provided by the hoststrains BL21 (DE3) or HMS174 (DE3) EMBO J. 8 (1989) 2195-2202), such as those which are from a resident Aprophagene which harbors a T7 gn1 gene derived from plant viruses, such as 35SCAMV (Francket al., under the transcriptional control of the lacUV 5 promoter. Cell 21 (1980) 285-294), 19S CaMV (see also U.S. Pat. No. Other vectors which are suitable for prokaryotic organisms 5,352,605 and WO 84/02913), or plant promoters, such as the are known to the skilled worker, these vectors are, for promoter of the small Rubisco subunit, which is described in example in E. coli pl G338, p.ACYC184, the pBR series such U.S. Pat. No. 4,962,028. Other preferred sequences for use in as pBR322, the puC series such as puC18 or puC19, the operable linkage in plant gene expression cassettes are tar M113 mp series, pKC30, pRep4, pHS1, pHS2, pPLc236, geting sequences, which are required for steering the gene pMBL24, pIG200, pluR290, pIN-III113-B1, gt11 or product into its corresponding cell compartment (see a review pBdCI, in Streptomyces plJ101, pIJ364, pIJ702 or plJ361, in 25 in Kermode, Crit. Rev. Plant Sci. 15, 4 (1996) 285-423 and Bacillus puB110, pC194 or pBD214, in Corynebacterium references cited therein), for example into the vacuole, into pSAT7 or pAJ667. the nucleus, all types of plastids, such as amyloplasts, chlo In a further embodiment, the expression vector is a yeast roplasts, chromoplasts, the extracellular space, the mitochon expression vector. Examples of vectors for expression in the dria, the endoplasmic reticulum, oil bodies, peroxisomes and yeast S. cerevisiae comprise pYeldesaturasec 1 (Baldarietal. 30 other compartments of plant cells. As described above, plant (1987) Embo J. 6:229-234), pMFa (Kurjan and Herskowitz gene expression can also be facilitated via a chemically (1982) Cell 30:933-943), p.RY88 (Schultz et al. (1987) Gene inducible promoter (see review in Gatz 1997, Annu. Rev. 54:113-123) and pYES2 (Invitrogen Corporation, San Diego, Plant Physiol. Plant Mol. Biol., 48:89-108). Chemically Calif.). Vectors and methods for the construction of vectors inducible promoters are particularly suitable when it is which are suitable for use in other fungi. Such as the filamen 35 desired that the gene expression takes place in a time-specific tous fungi, comprise those which are described in detail in: manner. Examples of Such promoters are a salicylic-acid van den Hondel, C. A. M. J. J., & Punt, P. J. (1991) “Gene inducible promoter (WO95/19443), a tetracyclin-inducible transfer systems and vector development for filamentous promoter (Gatz et al. (1992) Plant J. 2, 397-404) and an fungi, in: Applied Molecular Genetics of fungi, J. F. Peberdy ethanol-inducible promoter. Promoters which respond to et al., Ed., pp. 1-28, Cambridge University Press: Cambridge, 40 biotic or abiotic stress conditions are also suitable, for or in: More Gene Manipulations in Fungi J. W. Bennet & L. example the pathogen-induced PRP1 gene promoter (Wardet L. Lasure, Eds., pp. 396-428: Academic Press: San Diego. al., Plant. Mol. Biol. 22 (1993) 361-366), the heat-inducible Further suitable yeast vectors are, for example, p AG-1, YEp6, tomato hsp80 promoter (U.S. Pat. No. 5,187.267), the chill YEp13 or pEMBLYe23. inducible potato alpha-amylase promoter (WO 96/12814) or As an alternative, the polynucleotides of the present inven 45 the wound-inducible pin II promoter (EP-A-0375 091). tion can also be expressed in insect cells using Baculovirus Especially preferred are those promoters which bring expression vectors. Baculovirus vectors which are available about the gene expression in tissues and organs in which the for the expression of proteins in cultured insect cells (for biosynthesis offatty acids, lipids and oils takes place, in seed example Sf9 cells) comprise the pac series (Smith et al. cells, such as the cells of the endospermand of the developing (1983) Mol. Cell. Biol. 3:2156-2165) and the pVL series 50 embryo. Suitable promoters are the oilseed rape napin gene (Lucklow and Summers (1989) Virology 170:31-39). promoter (U.S. Pat. No. 5,608,152), the Vicia faba USP pro Preferred plant expression vectors comprise those which moter (Baeumlein et al., Mol Gen Genet, 1991, 225 (3):459 are described in detail in: Becker, D., Kemper, E., Schell, J., 67), the Arabidopsis oleosin promoter (WO 98/45461), the and Masterson, R. (1992) "New plant binary vectors with Phaseolus vulgaris phaseolin promoter (U.S. Pat. No. 5,504, selectable markers located proximal to the left border. Plant 55 200), the Brassica Bce4 promoter (WO 91/13980) or the Mol. Biol. 20:1195-1197: and Bevan, M. W. (1984) “Binary legumine B4 promoter (LeB4: Baeumlein et al., 1992, Plant Agrobacterium vectors for plant transformation’. Nucl. Acids Journal, 2 (2):233-9), and promoters which bring about the Res. 12:8711-8721; Vectors for Gene Transfer in Higher seed-specific expression in monocotyledonous plants such as Plants; in: Transgenic Plants, Vol. 1, Engineering and Utili maize, barley, wheat, rye, rice and the like. Suitable notewor zation, Eds. Kung and R. Wu, Academic Press, 1993, p. 60 thy promoters are the barley Ipt2 or Ipt1 gene promoter (WO 15-38. A plant expression cassette preferably comprises 95/15389 and WO95/23230) or the promoters from the bar expression control sequences which are capable of governing ley hordein gene, the rice glutelin gene, the rice oryzingene, the expression of genes in plant cells and which are linked the rice prolamine gene, the wheat gliadine gene, the wheat operably so that each sequence can fulfill its function, Such as glutelin gene, the maize Zeine gene, the oat glutelin gene, the transcriptional termination, for example polyadenylation sig 65 Sorghum kasirin gene or the rye Secalin gene, which are nals. Preferred polyadenylation signals are those which are described in WO99/16890. Especially suitable promoters are derived from Agrobacterium tumefaciens T-DNA, such as likewise those which bring about the plastid-specific expres US 8,785,727 B2 17 18 Sion, since plastids are the compartment in which the precur nephoraceae. Such as the genera Blakeslea, Choanephora, for sors and some of the end products of lipid biosynthesis are example the genera and species Blakeslea trispora, Choane synthesized. Suitable promoters, such as the viral RNA poly phora cucurbitarum, Choanephora infundibulifera var. merase promoter, are described in WO95/16783 and WO cucurbitarum, Mortierellaceae. Such as the genus Mortier 97/06250, and the clpP promoter from Arabidopsis, ella, for example the genera and species Mortierella isabel described in WO99/46394. lina, Mortierella polycephala, Mortierella ramanniana, Mor tierella vinacea, Mortierella Zonata, the family Mucorales, The abovementioned vectors are only a small overview Such as the genera and species Rhizopus Oryzae, Rhizopus over possible vectors which are suitable. Further plasmids are stolonifer, Fusarium graminearium, Pythiaceae, such as the known to the skilled worker and are described for example in: genera Phytium, Phytophthora, for example the genera and Cloning Vectors (eds. Pouwels, P.H., et al., Elsevier, Amster 10 species Pythium debaryanum, Pythium intermedium, damNew York-Oxford, 1985, ISBN 0444904018). Further Pythium irregulare, Pythium megalacanthum, Pythium paro Suitable expression systems for prokaryotic and eukaryotic ecandrum, Pythium sylvaticum, Pythium ultimum, Phytoph cells, see chapters 16 and 17 of Sambrook, J., Fritsch, E. F., thora cactorum, Phytophthora cinnamoms, Phytophthora and Maniatis, T., Molecular Cloning: A Laboratory Manual, citricola, Phytophthora citrophthora, Phytophthora crypto 2" ed., Cold Spring Harbor Laboratory, Cold Spring Harbor 15 gea, Phytophthora drechsleri, Phytophthora erythroseptica, Laboratory Press, Cold Spring Harbor, N.Y., 1989. Phytophthora lateralis, Phytophthora megasperma, Phy As described above, the expression vector can, in addition tophthora nicotianae, Phytophthora nicotianae var. para to the polynucleotides according to the invention, also com sitica, Phytophthora palmivora, Phytophthora parasitica, prise further genes which are to be introduced into the organ Phytophthora syringae, Saccharomycetaceae, such as the isms. It is possible and preferred to introduce into the host genera Hansenula, Pichia, Saccharomyces, Saccharomy organisms, and express in them, regulatory genes, such as codes, Yarrowia, for example the genera and species genes for inductors, repressors or enzymes which, as a result Hansenula anomala, Hansenula ca?ifonica, Hansenula of their enzymatic activity, engage in the regulation of one or Canadensis, Hansenula capsulata, Hansenula ciferrii, more genes of a biosynthetic pathway. These genes can be of Hansenula glucozyma, Hansenula henricii, Hansenula hol heterologous or homologous origin. Heterologous genes or 25 stfi, Hansenula minuta, Hansenula nonfermentans, polynucleotides are derived from an organism of origin which Hansenula philodendri, Hansenula polymorpha, Hansenula differs from the target organism into which the genes or Saturnus, Hansenula subpelliculosa, Hansenula wicker polynucleotides are to be introduced. In the case of homolo hamii, Hansenula wingei, Pichia alcoholophila, Pichia gous genes or polynucleotides, target organism and organism angusta, Pichia anomala, Pichia bispora, Pichia burtonfi, of origin are identical. The vector therefore preferably com 30 Pichia Canadensis, Pichia capsulata, Pichia carsonii, Pichia prises at least one further polynucleotide which codes for a cellobiosa, Pichia ciferrii, Pichiafarinosa, Pichia fermen further enzyme which is involved in the biosynthesis of lipids tans, Pichia finlandica, Pichia glucozyma, Pichia gufifier or fatty acids. The enzyme is preferably selected from the mondfi, Pichia haplophila, Pichia henricii, Pichia holstfi, group consisting of acyl-CoA dehydrogenase(s), acyl-ACP Pichia jadinii, Pichia findnerfi, Pichia membranaefaciens, -acyl carrier protein desaturase(s), acyl-ACP 35 Pichia methanolica, Pichia minuta var. minuta, Pichia thioesterase(s), fatty acid acyltransferase(s), acyl-CoA:ly So minuta var. nonfermentans, Pichia norvegensis, Pichia Ohm phospholipid acyltransferase(s), fatty acid synthase(s), fatty eri, Pichia pastoris, Pichia philodendri, Pichia pini, Pichia acid hydroxylase(s), acetyl-coenzyme A carboxylase(s), polymorpha, Pichia quercuum, Pichia rhodanensis, Pichia acyl-coenzyme A oxidase(s), fatty acid desaturase(s), fatty Sargentensis, Pichia stipitis, Pichia Strasburgensis, Pichia acid acetylenase(s), lipoxygenase(s), triacylglycerol 40 subpelficulosa, Pichia toletana, Pichia trehalophila, Pichia lipase(s), allene oxide synthase(s), hydroperoxide lyase(s), vini, Pichia xylosa, Saccharomyces aceta, Saccharomyces fatty acid elongase(s), A4-desaturase(s), A5-desaturase(s), bairn, Saccharomyces bavanus, Saccharomyces bisporus, A6-desaturase(s), A8-desaturase(s), A9-desaturase(s), A12 Saccharomyces capensis, Saccharomyces Carlsbergensis, desaturase(s). A 15-desaturase(s), A12- and A15 Saccharomyces cerevisiae, Saccharomyces cerevisiae var. desaturase(s), (03-desaturase, A5-elongase(s). A6 45 elfipsoideus, Saccharomyces chevafieri, Saccharomyces del elongase(s) and A9-elongase(s). Especially preferred gene brueckfi, Saccharomyces diastaticus, Saccharomyces droso combinations are listed in tables 5 and 6 in the examples philarum, Saccharomyces elegans, Saccharomyces elfipsoi which follow. deus, Saccharomyces fermentati, Saccharomyces florentinus, The invention also relates to a host cell which comprises Saccharomyces fragilis, Saccharomyces heterogenicus, Sac the polynucleotide according to the invention or the vector 50 charomyces hienipiensis, Saccharomyces inusitatus, Saccha according to the invention. romyces italicus, Saccharomyces kluyveri, Saccharomyces In principle, host cells for the purposes of the present krusei, Saccharomyces lactis, Saccharomyces marxianus, invention may be all eukaryotic or prokaryotic cells. They Saccharomyces microelflipsoides, Saccharomyces montanus, may be primary cells from animals, plants or multi-celled Saccharomyces norbensis, Saccharomyces Oleaceus, Sac microorganisms, for example from those which are men 55 charomyces paradoxus, Saccharomyces pastorianus, Sac tioned in another place in the description. The term further charomyces pretoriensis, Saccharomyces rosea, Saccharo more also comprises cell lines which can be obtained from myces rouxii, Saccharomyces uvarum, Saccharomycodes these organisms. ludwigii, Yarrowia fipolyfica, Schizosaccharomycetaceae However, host cells for the purposes of the invention may Such as the genera Schizosaccharomyces e.g. the species also be single-celled microorganisms, for example bacteria or 60 Schizosaccharomyces japonicus var. japonicus, Schizosac fungi. Especially preferred microorganisms are fungi charomyces japonicus var. versatilis, Schizosaccharomyces selected from the group of the families Chaetomiaceae, Choa malidevOrans, Schizosaccharomyces octosporus, Schizosac nephoraceae, Cryptococcaceae, Cunninghamellaceae, charomyces pombe var. malidevOrans, Schizosaccharomyces Demetiaceae, Moniliaceae, Mortierellaceae, Mucoraceae, pombe var. pombe, Thraustochytriaceae such as the genera Pythiaceae, Sacharomycetaceae, Saprolegniaceae, Schizosa 65 Althornia, Aplanochytrium, Japonochytrium, charomycetaceae, Sodariaceae or Tuberculariaceae. Further Schizochytrium, Thraustochytrium e.g. the species preferred microorganisms are selected from the group: Choa Schizochytrium aggregatum, Schizochytrium limacinum, US 8,785,727 B2 19 20 Schizochytrium mangrovei, Schizochytrium minutum, tia marcescens Subsp. marcescens, Serratia marinorubra, Schizochytrium Octosporum, Thraustochytrium aggregatum, Serratia Odorifera, Serratia plymouthensis, Serratia Thraustochytrium amoeboideum, Thraustochytrium antacti ply muthica, Serratia proteamaculans, Serratia proteamacu cum, Thraustochytrium arudimentale, Thraustochytrium lans Subsp. quinovora, Serratia quinivorans or Serratia aureum, Thraustochytrium benthicola, Thraustochytrium rubidaea; Rhizobiaceae, such as the genera Agrobacterium, globosum, Thraustochytrium indicum, Thraustochytrium Carbophilus, Chelatobacter, Ensifer, Rhizobium, Sinorhizo kerguelense, Thraustochytrium kinnei, Thraustochytrium bium, for example the genera and species Agrobacterium motivum, Thraustochytrium multirudimentale, Thraus atlanticum, Agrobacterium ferrugineum, Agrobacterium tochytrium pachydermum, Thraustochytrium proliferum, gelatinovorum, Agrobacterium lanymoorei, Agrobacterium Thraustochytrium roseum, Thraustochytrium rossii, Thraus 10 tochytrium striatum or Thraustochytrium visurgense. meteori, Agrobacterium radiobacter; Agrobacterium rhizo Equally preferred as microorganisms are bacteria selected genes, Agrobacterium rubi, Agrobacterium stellulatum, from the group of the families Bacillaceae, Enterobacteriacae Agrobacterium tumefaciens, Agrobacterium vitis, Carbophi or Rhizobiaceae. It is especially preferred to mention the lus carboxidus, Chelatobacter heintzii, Ensifer adhaerens, following bacteria selected from the group: Bacillaceae. Such 15 Ensifer arboris, Ensifer fredii, Ensifer kOstiensis, Ensifer as the genus Bacillus, for example the genera and species Kummerowiae, Ensifer medicae, Ensifer meliloti, Ensifer Bacillus acidocaldarius, Bacillus acidoterrestris, Bacillus Saheli, Ensifer terangae, Ensifer xinjiangensis, Rhizobium alcalophilus, Bacillus amyloliquefaciens, Bacillus amylolyti ciceri, Rhizobium etli, Rhizobium fredii, Rhizobium galegae, cus, Bacillus brevis, Bacillus cereus, Bacillus circulans, Rhizobium gallicum, Rhizobium giardinii, Rhizobium hain Bacillus coagulans, Bacillus sphaericus Subsp. fusiformis, anense, Rhizobium huakui, Rhizobium huautlense, Rhizo Bacillus galactophilus, Bacillus globisporus, Bacillus glo bium indigoferae, Rhizobium japonicum, Rhizobium legumi bisporus Subsp. marinus, Bacillus halophilus, Bacillus lenti nosarum, Rhizobium loessense, Rhizobium loti, Rhizobium morbus, Bacillus lentus, Bacillus licheniformis, Bacillus lupini, Rhizobium mediterraneum, Rhizobium meliloti, megaterium, Bacillus polymyxa, Bacillus psychrosaccharo Rhizobium mongolense, Rhizobium phaseoli, Rhizobium lyticus, Bacillus pumilus, Bacillus sphaericus, Bacillus sub 25 radiobacter, Rhizobium rhizogenes, Rhizobium rubi, Rhizo tilis Subsp. spizizenii, Bacillus subtilis Subsp. subtilis or bium sullae, Rhizobium tianshanense, Rhizobium trifolii, Bacillus thuringiensis; Enterobacteriacae Such as the genera Rhizobium tropici, Rhizobium undicola, Rhizobium vitis, Citrobacter, Edwardsiella, Enterobacter, Erwinia, Escheri Sinorhizobium adhaerens, Sinorhizobium arboris, chia, Klebsiella, Salmonella or Serratia, for example the Sinorhizobium fredii, Sinorhizobium kostiense, Sinorhizo genera and species Citrobacter amalonaticus, Citrobacter 30 bium kummerowiae, Sinorhizobium medicae, Sinorhizobium diversus, Citrobacter freundii, Citrobacter genomospecies, meliloti, Sinorhizobium morelense, Sinorhizobium Saheli or Citrobacter gillenii, Citrobacter intermedium, Citrobacter Sinorhizobium Xinjiangense. Koseri, Citrobacter murliniae, Citrobacter sp., Edwardsiella Further utilizable host cells are detailed in: Goeddel, Gene hoshinae, Edwardsiella ictaluri, Edwardsiella tarda, Erwinia Expression Technology: Methods in Enzymology 185, Aca alni, Erwinia amylovora, Erwinia anamatis, Erwinia aphidi 35 demic Press, San Diego, Calif. (1990). Expression strains cola, Erwinia billingiae, Erwinia cacticida, Erwinia Can which can be used, for example those with a lower protease cerogena, Erwinia Carnegieana, Erwinia carotovora Subsp. activity, are described in: Gottesman, S., Gene Expression atroseptica, Erwinia carotovora Subsp. betavasculorum, Technology: Methods in Enzymology 185, Academic Press, Erwinia carotovora Subsp. odorifera, Erwinia carotovora San Diego, Calif. (1990) 119-128. These include plant cells Subsp. wasabiae, Erwinia chtysanthemi, Erwinia cypripedii, 40 and certain tissues, organs and parts of plants in all their Erwinia dissolvens, Erwinia herbicola, Erwinia mallotivora, phenotypic forms such as anthers, fibers, root hairs, stalks, Erwinia milletiae, Erwinia nigrifluens, Erwinia nimipres embryos, calli, cotely dons, petioles, harvested material, plant suralis, Erwinia persicina, Erwinia psidii, Erwinia pyrifo tissue, reproductive tissue and cell cultures which are derived liae, Erwinia quercina, Erwinia rhapontici, Erwinia rubrifa from the actual transgenic plant and/or can be used for bring ciens, Erwinia Salicis, Erwinia Stewartii, Erwinia 45 ing about the transgenic plant. tracheiphila, Erwinia uredovora, Escherichia adecarboxy Polynucleotides or vectors can be introduced into the host lata, Escherichia anindolica, Escherichia aurescens, cell as described above by means of transformation or trans Escherichia blattae, Escherichia coli, Escherichia coli var. fection methods which are known in the prior art. Conditions communion, Escherichia coli-mutabile, Escherichiaferguso and media for the cultivation of the host cells are also known nii, Escherichia hermannii, Escherichia sp., Escherichia vul 50 to the skilled worker. neris, Klebsiella aerogenes, Klebsiella edwardsii Subsp. The host cell according to the invention preferably addi atlantae, Klebsiella Omithinolytica, Klebsiella Oxytoca, Kleb tionally comprises at least one further enzyme which is siella planticola, Klebsiella pneumoniae, Klebsiella pneumo involved in the biosynthesis of lipids or fatty acids. Preferred niae Subsp. pneumoniae, Klebsiella sp., Klebsiella terrigena, enzymes have already been mentioned in another place in the Klebsiella trevisani, Salmonella abony, Salmonella arizo 55 description. The enzyme can be present in the host cell in nae, Salmonella bongori, Salmonella choleraesuis Subsp. endogenous form, i.e. the host cell already naturally arizonae, Salmonella choleraesuis Subsp. bongori, Salmo expresses a gene which codes for a corresponding enzyme. nella choleraesuis Subsp. cholereasuis, Salmonella cholerae Alternatively, it is also possible to introduce, into the host cell, suis Subsp. diarizonae, Salmonella choleraesuis Subsp. a heterologous polynucleotide which codes for the enzyme. houtenae, Salmonella choleraesuis Subsp. indica, Salmonella 60 Suitable methods and means for the expression of a heterolo choleraesuis Subsp. salamae, Salmonella daressalaam, Sal gous polynucleotide are known in the prior art and are monella enterica Subsp. houtenae, Salmonella enterica described herein in connection with the polynucleotides, vec Subsp. salamae, Salmonella enteritidis, Salmonella galli tors and host cells according to the invention. narum, Salmonella heidelberg, Salmonella panama, Salmo The invention also relates to a method of generating a nella Senftenberg, Salmonella typhimurium, Serratia ento 65 polypeptide with desaturase activity, comprising the steps: mophila, Serratia ficaria, Serratia fonticola, Serratia (a) expressing a polynucleotide according to the invention grimesii, Serratia liquefaciens, Serratia marcescens, Serra as defined above in a host cell; and US 8,785,727 B2 21 22 (b) obtaining, from the host cell, the polypeptide which is nonhuman organism preferably takes the form of an animal, a encoded by the polynucleotide. plant or a multicellular microorganism. In this context, the polypeptide can be obtained or isolated The term “transgenic' is understood as meaning that a by all current protein purification methods. The methods heterologous polynucleotide, that is to say a polynucleotide comprise, for example, affinity chromatography, molecular 5 which does not occur naturally in the respective organism, is sieve chromatography, high-pressure liquid chromatography introduced into the organism. This can be achieved either by or else protein precipitation, if appropriate with specific anti random insertion of the polynucleotide or by homologous bodies. Although this is preferred, the method need not nec recombination. Naturally, it is also possible to introduce the essarily provide a pure polypeptide preparation. vector according to the invention instead of the polynucle 10 otide. Methods of introducing polynucleotides or vectors for The invention therefore also relates to a polypeptide which the purposes of random insertion or homologous recombina is encoded by the polynucleotide according to the invention tion are known in the prior art and also described in greater or which is obtainable by the abovementioned method detail hereinbelow. Host cells which comprise the polynucle according to the invention. otide or the vector can also be introduced into an organism The term “polypeptide' refers both to an essentially pure 15 and thus generate a transgenic organism. In such a case. Such polypeptide, and also to a polypeptide preparation which an organism takes the form of a chimeric organism, where additionally comprises further components or impurities. The only those cells which are derived from the introduced cells term is also used for fusion proteins and protein aggregates are transgenic, i.e. comprise the heterologous polynucleotide. which comprise the polypeptide according to the invention The transgenic nonhuman organisms are preferably oil and additionally further components. The term also refers to producing organisms, which means organisms which are chemically modified polypeptides. In this context, chemical used for the production of oils, for example fungi such as modifications comprise artificial modifications or naturally Rhizopus or Thraustochytrium, algae Such as Euglena, Neph occurring modifications, for example posttranslational modi roselmis, Pseudoscourfielda, Prasinococcus, Scherffelia, Tet fications such as phosphorylation, myristylation, glycosyla raselmis, Mantoniella, Ostreococcus, Crypthecodinium, tion and the like. The terms polypeptide, peptide and protein 25 Phaeodactylum, or diatoms such as Pythium or Phytophthora are interchangeable and are used accordingly in the descrip or plants. tion and in the prior art. The polypeptides according to the Transgenic plants which can be used are, in principle, are invention have the abovementioned biological activities, that all plants, that is to say both dicotyledonous and monocoty is to say desaturase activities, and can influence the biosyn ledonous plants. They preferably take the form of oil crop thesis of polyunsaturated fatty acids (PUFAs), preferably the 30 plants which comprise large amounts of lipid compounds, long-chain PUFAs (LCPUFAs), as herein described. Such as peanut, oilseed rape, canola, Sunflower, safflower The invention also comprises an antibody which specifi (Carthamus tinctoria), poppy, mustard, hemp, castor-oil cally recognizes the polypeptide according to the invention. plant, olive, sesame, Calendula, Punica, evening primrose, Antibodies against the polypeptide according to the inven Verbascum, thistle, wild roses, hazelnut, almond, macad tion can be prepared by means of known methods, where 35 amia, avocado, bay, pumpkin/squash, linseed, soybean, pis purified polypeptide or fragments thereof with suitable tachios, borage, trees (oil palm, coconut or walnut) or arable epitopes are used as the antigen. Suitable epitopes can be crops such as maize, wheat, rye, oats, triticale, rice, barley, determined by means of known algorithms for the antigenic cotton, cassava, pepper, Tagetes, Solanaceae plants such as ity determination, based on the amino acid sequences of the potato, tobacco, eggplant and tomato, Vicia species, pea, polypeptides according to the invention provided herein. The 40 alfalfa or bushy plants (coffee, cacao, tea), Salix species, and relevant polypeptides or fragments can then be synthesized or perennial grasses and fodder crops. Preferred plants accord obtained by recombinant techniques. After animals, prefer ing to the invention are oil crop plants such as peanut, oilseed ably mammals, for example hares, rats or mice, have been rape, canola, Sunflower, safflower, poppy, mustard, hemp, immunized, the antibodies can then be obtained from the castor-oil plant, olive, Calendula, Punica, evening primrose, serum, using known methods. Alternatively, monoclonal 45 pumpkin/squash, linseed, soybean, borage, trees (oil palm, antibodies or antibody fragments can be provided with the coconut). Especially preferred are plants which are high in known methods; see, for example, Harlow and Lane Anti C18:2- and/or C18:3-fatty acids, such as sunflower, safflower, bodies, A Laboratory Manual. CSH Press, Cold Spring Har tobacco, Verbascum, Sesame, cotton, pumpkin/squash, bor, 1988 or Köhler and Milstein, Nature 256 (1975), 495, and poppy, evening primrose, walnut, linseed, hemp, thistle or Galfré, Meth. Enzymol. 73 (1981), 3. 50 safflower. Very especially preferred plants are plants such as The antibodies preferably take the form of monoclonal or safflower, Sunflower, poppy, evening primrose, walnut, lin polyclonal antibodies, single-chain antibodies or chimeric seed or hemp. In principle, however, all plants which are antibodies, and fragments of these such as Fab, Fv or schv. capable of synthesizing fatty acids are Suitable. Such as all Further antibodies within the meaning of the invention are dicotyledonous or monocotyledonous plants, algae or bispecific antibodies, synthetic antibodies or their chemically 55 mosses. Advantageous plants are selected from the group of modified derivatives. the plant families Adelotheciaceae, Anacardiaceae, Aster The antibodies according to the invention specifically rec aceae, Apiaceae, Betulaceae, Boraginaceae, Brassicaceae, ognize the polypeptides according to the invention, that is to Bromeliaceae, Caricaceae, Cannabaceae, Convolvulaceae, say they do not cross-react significantly with other proteins. Chenopodiaceae, Crypthecodiniaceae, Cucurbitaceae, This can be assayed by means of methods known in the prior 60 Ditrichaceae, Elaeagnaceae, Ericaceae, Euphorbiaceae, art. For example, the antibodies can be employed for the Fabaceae, Geraniaceae, Gramineae, Juglandaceae, Lau purposes of detection reactions, immunoprecipitation, immu raceae, Leguminosae, Linaceae, Prasinophyceae or vegetable inhistochemistry or protein purification (for example affinity plants or ornamentals such as Tagetes. chromatography). Examples which may especially preferably be mentioned The invention furthermore relates to a transgenic, nonhu 65 are the following plants selected from the group consisting of man organism which comprises the polynucleotide, the vec Adelotheciaceae such as the genera Physcomitrella, for tor or the host cell of the present invention. The transgenic, example the genus and species Physcomitrella patens, Anac US 8,785,727 B2 23 24 ardiaceae such as the genera Pistacia, Mangifera, Anacar chum Schimperi, Ditrichum tortile, Distichium capillaceum, dium, for example the genus and species Pistacia vera pis Distichium hagenii, Distichium inclinatum, Distichium tachio, Mangifer indica mango or Anacardium occidentale inacounii, Eccremidium floridanum, Eccremidium cashew, Asteraceae. Such as the genera Calendula, Cartha whiteleggei, Lophidion strictus, Pleuridium acuminatum, mus, Centaurea, Cichorium, Cynara, Helianthus, Lactuca, Pleuridium altemifolium, Pleuridium holdridgei, Pleuridium Locusta, Tagetes, Valeriana, for example the genus and spe mexicanum, Pleuridium ravenelii, Pleuridium subulatum, cies Calendula officinalis common marigold, Carthamus Saelania glaucescens, Trichodon borealis, Trichodon cylin tinctorius safflower, Centaurea cyanus cornflower. dricus or Trichodon cylindricus var. Oblongus, Elaeagnaceae, Clchorium intybus chicory, Cynara scolymus artichoke. Such as the genus Elaeagnus, for example the genus and Helianthus annus Sunflower, Lactuca sativa, Lactuca 10 species Olea europaea olive. Ericaceae, such as the genus Crispa, Lactuca esculenta, Lactuca Scariola L. ssp. Sativa, Kalmia, for example the genera and species Kalmia latifolia, Lactuca scariola L. var. integrata, Lactuca scariola L. var. Kalmia angustifolia, Kalmia microphylla, Kalmia polifolia, integrifolia, Lactuca sativa Subsp. romana, Locusta commu Kalmia Occidentalis, Cistus chamaerhodendros or Kalmia nis, Valeriana locusta salad vegetables, Tagetes lucida, Tag lucida Imountain laurell, Euphorbiaceae, such as the genera etes erecta or Tagetes tenuifolia african or french marigold. 15 Manihot, Janipha, Jatropha, Ricinus, for example the genera Apiaceae, Such as the genus Daucus, for example the genus and species Manihot utilissima, Janipha manihot, Jatropha and species Daucus carota carrot. Betulaceae, Such as the manihot, Manihot aipil, Manihot dulcis, Manihot manihot, genus Corylus, for example the genera and species Corylus Manihot melanobasis, Manihot esculenta cassava or Rici avellana or Corylus colurna hazelnut, Boraginaceae. Such nus communis castor-oil plant, Fabaceae, Such as the genera as the genus Borago, for example the genus and species Pisum, Albizia, Cathormion, Feuillea, Inga, Pithecolobium, Borago officinalis borage, Brassicaceae, such as the genera Acacia, Mimosa, Medicajo, Glycine, Dolichos, Phaseolus, Brassica, Camelina, Melanosinapis, Sinapis, Arabadopsis, Soybean, for example the genera and species Pisum sativum, for example the genera and species Brassica napus, Brassica Pisum arvense, Pisum humile pea, Albizia berteriana, Albi rapa ssp. oilseed rape. Sinapis arvensis Brassica iuncea, Zia julibrissin, Albizia lebbeck, Acacia berteriana, Acacia Brassica iuncea var. iuncea, Brassica iuncea var. Crispifolia, 25 littoralis, Albizia berteriana, Albizzia berteriana, Cathor Brassica juncea var. foliosa, Brassica nigra, Brassica Sina mion berteriana, Feuillea berteriana, Inga fragrams, Pith pioides, Camelina sativa, Melanosinapis communis mus ecellobium berterianum, Pithecellobium fragrams, Pith tard, Brassica oleracea fodder beet or Arabadopsis ecolobium berterianum, Pseudalbizzia berteriana, Acacia thaliana, Bromeliaceae, such as the genera Anana, Bromelia julibrissin, Acacia nemu, Albizia nemu, Feuilleea julibrissin, (pineapple), for example the genera and species Anana Como 30 Mimosa julibrissin, Mimosa speciosa, Sericanraa julibrissin, sus, Ananas ananas or Bromelia comosa pineapple, Cari Acacia lebbeck, Acacia macrophylla, Albizia lebbeck, caceae, such as the genus Carica. Such as the genus and Feuilleea lebbeck, Mimosa lebbeck, Mimosa speciosa silk species Carica papaya pawpaw, Cannabaceae, such as the tree. Medicago sativa, Medicago falcata, Medicago varia genus Cannabis, such as the genus and species Cannabis alfalfa Glycine max Dolichos soja, Glycine gracilis, Gly sative hemp, Convolvulaceae, Such as the genera Ipomea, 35 cine hispida, Phaseolus max, Soja hispida or Soia max Soy Convolvulus, for example the genera and species Ipomoea bean. Funariaceae, such as the genera Aphanorrhegma, batatus, Ipomoea pandurata, Convolvulus batatas, Convol Entosthodon, Funaria, Physcomitrella, Physcomitrium, for vulus tiliaceus, Ipomoea fastigiata, Ipomoea tiliacea, Ipo example the genera and species Aphanorrhegma serratum, moea triloba or Convolvulus panduratus Sweet potato, Entosthodon attenuatus, Entosthodon bolanderi, Entosth batate, Chenopodiaceae, such as the genus Beta, such as the 40 Odon bonplandii, Entosthodon Californicus, Entosthodon genera and species Beta vulgaris, Beta vulgaris var.altissima, drummondii, Entosthodon jamesonii, Entosthodon leibergii, Beta vulgaris var. vulgaris, Beta maritima, Beta vulgaris var. Entosthodon neoscoticus, Entosthodon rubrisetus, Entosth perennis, Beta vulgaris var. conditiva or Beta vulgaris var. Odon spathulifolius, Entosthodon tucsoni, Funaria ameri esculenta Sugarbeet, Crypthecodiniaceae, such as the genus cana, Funaria bolanderi, Funaria calcarea, Funaria Califor Crypthecodinium, for example the genus and species Crypte 45 nica, Funaria calvescens, Funaria convoluta, Funaria codinium cohnii, Cucurbitaceae, such as the genus Cucur flavicans, Funaria groutiana, Funaria hygrometrica, bita, for example the genera and species Cucurbita maxima, Funaria hygrometrica var. arctica, Funaria hygrometrica Cucurbita mixta, Cucurbita pepo or Cucurbita moschata var. Calvescens, Funaria hygrometrica var. Convoluta, pumpkin/squash, Cymbellaceae, Such as the genera Funaria hygrometrica var. muralis, Funaria hygrometrica Amphora, Cymbella, Okedenia, Phaeodactylum, Reimeria, 50 var. utahensis, Funaria microstoma, Funaria microstoma var. for example the genus and species Phaeodactylum tricornu obtusifolia, Funaria muhlenbergii, Funaria Orcuttii, Funaria tum, Ditrichaceae, Such as the genera Ditrichaceae, Astomi plano-convexia, Funaria polaris, Funaria ravenelii, Funaria opsis, Ceratodon, Chrysoblastella, Ditrichum, Distichium, rubriseta, Funaria Serrata, Funaria Sonorae, Funaria sub Eccremidium, Lophidion, Philibertiella, Pleuridium, Saela limbatus, Funaria tucsoni, Physcomitrella Californica, Phy nia, Trichodon, Skottsbergia, for example the genera and 55 Scomitrella patens, Physcomitrella readeri, Physcomitrium species Ceratodon antarcticus, Ceratodon columbiae, Cerat australe, Physcomitrium Californicum, Physcomitrium col Odon heterophyllus, Ceratodon purpurascens, Ceratodon lenchymatum, Physcomitrium coloradense, Physcomitrium purpureus, Ceratodon purpureus ssp. convolutus, Ceratodon cupuliferum, Physcomitrium drummondii, Physcomitrium purpureus ssp. Stenocarpus, Ceratodon purpureus var. rotun eurystomum, Physcomitrium flexifolium, Physcomitrium difolius, Ceratodon ratodon, Ceratodon Stenocarpus, 60 hookeri, Physcomitrium hookeri var. Serratum, Physcomi Chrysoblastella chilensis, Ditrichum ambiguum, Ditrichum trium immersum, Physcomitrium kellermanii, Physcomi brevisetum, Ditrichum crispatissimum, Ditrichum difficile, trium megalocarpum, Physcomitrium pyriforme, Physcomi Ditrichum falcifolium, Ditrichum flexicaule, Ditrichum trium pyriforme var. Serratum, Physcomitrium rufipes, giganteum, Ditrichum heteromallum, Ditrichum lineare, Physcomitrium sandbergii, Physcomitrium subsphaericum, Ditrichum montanum, Ditrichum montanum, Ditrichum pal 65 Physcomitrium washingtoniense, Geraniaceae, such as the lidum, Ditrichum punctulatum, Ditrichum pusillum, Ditri genera Pelargonium, Cocos, Oleum, for example the genera chum pusillum var. tortile, Ditrichum rhynchostegium, Ditri and species Cocos nucifera, Pelargonium grossularioides or US 8,785,727 B2 25 26 Oleum cocois coconut, Gramineae, such as the genus Sac dosorus, Vanhoefenia, for example the genus and species charum, for example the genus and species Saccharum offi Porphyridium cruentum, Proteaceae. Such as the genus Mac cinarum, Juglandaceae, such as the genera Juglans, Wallia, adamia, for example the genus and species Macadamia inter for example the genera and species Juglans regia, Juglans grifolia (macadamia, Prasinophyceae, such as the genera ailanthifolia, Juglans sieboldiana, Juglans cinerea, Wallia Nephroselmis, Prasinococcus, Scherffelia, Tetraselmis, Man cinerea, Juglans bixbyi, Juglans Californica, Juglans hindsii, toniella, Ostreococcus, for example the genera and species Juglans intermedia, Juglans jamaicensis, Juglans major; Nephroselmis Olivacea, Prasinococcus capsulatus, Scherife Juglans microcarpa, Juglans nigra or Wallia nigra walnut. lia dubia, Tetraselmis chui, Tetraselmis suecica, Mantoniella Lauraceae, such as the genera Persea, Laurus, for example squamata, Ostreococcus tauri, Rubiaceae, such as the genus the genera and species Laurus nobilis bay, Persea ameri 10 Coffea, for example the genera and species Cofea spp., Coffea cana, Persea gratissima or Persea persea avocado, Legu arabica, Coffea canephora or Coffea liberica coffee, Scro minosae, such as the genus Arachis, for example the genus phulariaceae, such as the genus Verbascum, for example the and species Arachis hypogaea peanut, Linaceae, Such as the genera and species Verbascum blattaria, Verbascum chaixii, genera Linum, Adenolinum, for example the genera and spe Verbascum densiflorum, Verbascum lagurus, Verbascum cies Linum usitatissimum, Linum humile, Linum austriacum, 15 longifolium, Verbascum lychnitis, Verbascum nigrum, Ver Linum bienne, Linum angustifolium, Linum catharticum, bascum Olympicum, Verbascum phlomoides, Verbascum Linum flavum, Linum grandiflorum, Adenolinum grandiflo phoenicum, Verbascum pulverulentum or Verbascum thapsus rum, Linum lewisii, Linum narbonense, Linum perenne, verbascum, Solanaceae, such as the genera Capsicum, Nic Linum perenne var. lewisii, Linum pratense or Linum trigy Otiana, Solanum, Lycopersicon, for example the genera and num linseed, Lythrarieae, such as the genus Punica, for species Capsicum annuum, Capsicum annuum var. glabrius example the genus and species Punica granatum pomegran culum, Capsicum frutescens pepper. Capsicum annuum ate, Malvaceae, such as the genus Gossypium, for example paprika, Nicotiana tabacum, Nicotiana alata, Nicotiana the genera and species Gossypium hirsutum, Gossypium attenuata, Nicotiana glauca, Nicotiana langsdorffii, Nicoti arboreum, Gossypium barbadense, Gossypium herbaceum or ana obtusifolia, Nicotiana quadrivalvis, Nicotiana repanda, Gossypium thurberi cotton, Marchantiaceae, Such as the 25 Nicotiana rustica, Nicotiana Sylvestris tobacco, Solanum genus Marchantia, for example the genera and species tuberosum potato, Solanum melongena eggplant, Lyco Marchantia berteroana, Marchantia foliacea, Marchantia persicon esculentum, Lycopersicon lycopersicum, Lycoper macropora, Musaceae, such as the genus Musa, for example sicon pyriforme, Solanum integrifolium or Solanum lycoper the genera and species Musa nana, Musa acuminata, Musa sicum tomato, Sterculiaceae, such as the genus Theobroma, paradisiaca, Musa spp. banana, Onagraceae, Such as the 30 for example the genus and species Theobroma cacao cacao genera Camissonia, Oenothera, for example the genera and or Theaceae, such as the genus Camelia, for example the species Oenothera biennis or Camissonia brevipes evening genus and species Camelia sinensis tea. primrose, Palmae, such as the genus Elacis, for example the Multicellular microorganisms which can be employed as genus and species Elaeis guineensis oil palm, Papaver transgenic nonhuman organisms are preferably protists or aceae. Such as the genus Papaver, for example the genera and 35 diatoms selected from the group of the families Dinophyceae, species Papaver Orientale, Papaverrhoeas, Papaver dubium Turaniellidae or Oxytrichidae, such as the genera and species: poppy, Pedaliaceae. Such as the genus Sesamum, for Crypthecodinium cohnii, Phaeodactylum tricomutum, Stylo example the genus and species Sesamum indicum sesame. nychia mytilus, Stylonychia pustulata, Stylonychia putrina, Piperaceae. Such as the genera Piper; Artanthe, Peperonia, Stylonychia notophora, Stylonychia sp., Colpidium campy Steffensia, for example the genera and species Piper adun 40 lum or Colpidium sp. cum, Piper amalago, Piper angustifolium, Piper auritum, The invention further relates to a method for the production Piper betel, Piper cubeba, Piper longum, Piper nigrum, of a Substance which has the structure shown in the general Piper retrofactum, Artanthe adunca, Artanthe elongata, formula I hereinbelow Peperonia elongata, Piper elongatum, Steffensia elongata cayenne pepper, Poaceae, such as the genera Hordeum, 45 (I) Secale, Avena, Sorghum, Andropogon, Holcus, Panicum, O Oryza, Zea (maize), Triticum, for example the genera and ..CH species Hordeum vulgare, Hordeum jubatum, Hordeum R1 pi -CH2 murinum, Hordeum secalinum, Hordeum distichon, Hor CHFCH CH3, deum aegiceras, Hordeum hexastichon, Hordeum hexasti 50 iii. CH1.p chum, Hordeum irregulare, Hordeum sativum, Hordeum secalinum barley, Secale cereale rye, Avena sativa, Avena where the variables and substituents are as follows: fatua, Avena byzantina, Avena fatua var. sativa, Avena R'-hydroxyl, coenzyme A (thioester), lysophosphatidyl hybrida oats. Sorghum bicolor, Sorghum halepense, Sor choline, lysophosphatidylethanolamine, lysophosphati ghum saccharatum, Sorghum vulgare, Andropogon drum 55 mondii, Holcus bicolor, Holcus sorghum, Sorghum aethiopi dylglycerol, lysodiphosphatidylglycerol, lysophos cum, Sorghum arundinaceum, Sorghum cafforum, Sorghum phatidylserine, lysophosphatidylinositol, sphingo base Cernuum, Sorghum dochna, Sorghum drummondii, Sorghum or a radical of the formula II durra, Sorghum guineense, Sorghum lanceolatum, Sorghum nervosum, Sorghum saccharatum, Sorghum subglabrescens, 60 II Sorghum verticilliflorum, Sorghum vulgare, Holcus halepen HC-O-R2 (II) sis, Sorghum miliaceum, Panicum militaceum millet, Oryza sativa, Oryza latifolia rice, Zea mays maize Triticum aes tivum, Triticum durum, Triticum turgidium, Triticum hyber num, Triticum macha, Triticum sativum or Triticum vulgare 65 H-O-S- wheat, Porphyridiaceae. Such as the genera Chroothece, Flintiella, Petrovanella, Porphyridium, Rhodella, Rho US 8,785,727 B2 27 28 R-hydrogen, lysophosphatidylcholine, lysophosphati bonyl, C-alkylcarbonyl, C2-alkylcarbonyl, C-alkylcar dylethanolamine, lysophosphatidylglycerol, lyso bonyl, C-alkylcarbonyl, C-alkylcarbonyl, Cs diphosphatidylglycerol, lysophosphatidylserine, lyso alkylcarbonyl, Co-alkylcarbonyl or C2-alkylcarbonyl phosphatidylinositol or saturated or unsaturated C-C- radicals which comprise one or more double bonds. Very alkylcarbonyl, especially preferred are saturated or unsaturated C-C- R-hydrogen, saturated or unsaturated C-C2-alkylcarbo alkylcarbonyl radicals such as C-alkylcarbonyl, Cis-alkyl nyl, or R and R independently of one another are a carbonyl, Co-alkylcarbonyl or C-alkylcarbonyl radicals radical of the formula Ia: which comprise one or more double bonds. These advanta geous radicals can comprise two, three, four, five or six 10 double bonds. The especially advantageous radicals with 20 (Ia) or 22 carbon atoms in the fatty acid chain comprise up to six O double bonds, advantageously three, four, five or six double CH bonds, especially preferably five or six double bonds. All the pi CH2 CHRCH CH abovementioned radicals are derived from the corresponding 15 fatty acids. sur R in the general formula II is hydrogen, Saturated or unsat urated C-C2-alkylcarbonyl. in which Alkyl radicals which may be mentioned are substituted or n=2, 3, 4, 5, 6, 7 or 9, m=2, 3, 4, 5 or 6 and p=0 or 3. unsubstituted, Saturated or unsaturated C-C2-alkylcarbonyl and where the method comprises the cultivation of (i) a host chains such as ethylcarbonyl, n-propylcarbonyl. n-butylcar cell according to the invention or (ii) a transgenic nonhuman bonyl, n-pentylcarbonyl, n-hexylcarbonyl, n-heptylcarbonyl, organism according to the invention under conditions which n-octylcarbonyl, n-nonylcarbonyl, n-decylcarbonyl, n-unde permit the biosynthesis of the substance. Preferably, the cylcarbonyl, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tet abovementioned Substance is provided in an amount of at radecylcarbonyl, n-pentadecylcarbonyl, n-hexadecylcarbo least 1% by weight based on the total lipid content in the host 25 nyl, n-heptadecylcarbonyl, n-octadecylcarbonyl-, cell or the transgenic organism. n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbo R" in the general formula I is hydroxyl, coenzyme A nyl or n-tetracosanylcarbonyl, which comprise one or more (thioester), lysophosphatidylcholine, lysophosphatidyletha double bonds. Saturated or unsaturated Co-C-alkylcarbo nolamine, lysophosphatidylglycerol, lysodiphosphatidylg nyl radicals such as n-decylcarbonyl, n-undecylcarbonyl, lycerol, lysophosphatidylserine, lysophosphatidylinositol, 30 n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecylcarbo sphingo base or a radical of the general formula II nyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-heptade cylcarbonyl, n-octadecylcarbonyl, n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbonyl or n-tetracosanyl II HC-O-R2 (II) carbonyl, which comprise one or more double bonds are 35 preferred. Especially preferred are saturated and/or unsatur ated Co-C-alkylcarbonyl radicals such as Co-alkylcar i-o-; bonyl, C-alkylcarbonyl, C2-alkylcarbonyl, C-alkylcar bonyl, C-alkylcarbonyl, C-alkylcarbonyl, Cis H-O-S- alkylcarbonyl, Co-alkylcarbonyl or C2-alkylcarbonyl 40 radicals which comprise one or more double bonds. Very The abovementioned radicals of R' are always bonded to especially preferred are saturated or unsaturated C-C- the compounds of the general formula I in the form of their alkylcarbonyl radicals such as C-alkylcarbonyl, Cs-alkyl thioesters. carbonyl, Co-alkylcarbonyl or C2-alkylcarbonyl radicals R in the general formula II is hydrogen, lysophosphatidyl which comprise one or more double bonds. These advanta choline, lysophosphatidylethanolamine, lysophosphatidylg 45 geous radicals can comprise two, three, four, five or six lycerol, lysodiphosphatidylglycerol, lysophosphatidylserine, double bonds. The especially advantageous radicals with 20 lysophosphatidylinositol or saturated or unsaturated C-C- or 22 carbon atoms in the fatty acid chain comprise up to six alkylcarbonyl. double bonds, advantageously three, four, five or six double Alkyl radicals which may be mentioned are substituted or bonds, especially preferably five or six double bonds. All the unsubstituted, Saturated or unsaturated C-C2-alkylcarbonyl 50 abovementioned radicals are derived from the corresponding chains such as ethylcarbonyl, n-propylcarbonyl. n-butylcar fatty acids. bonyl, n-pentylcarbonyl, n-hexylcarbonyl, n-heptylcarbonyl, The abovementioned radicals of R, R and R can be n-octylcarbonyl, n-nonylcarbonyl, n-decylcarbonyl, n-unde Substituted by hydroxyland/or epoxy groups and/or can com cylcarbonyl, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tet prise triple bonds. radecylcarbonyl, n-pentadecylcarbonyl, n-hexadecylcarbo 55 The polyunsaturated fatty acids produced in the method nyl, n-heptadecylcarbonyl, n-octadecylcarbonyl, according to the invention advantageously comprise at least n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbo two, advantageously three, four, five or six, double bonds. nyl or n-tetracosanylcarbonyl, which comprise one or more The fatty acids especially advantageously comprise four, five double bonds. Saturated or unsaturated Co-C-alkylcarbo or six double bonds. Fatty acids produced in the method nyl radicals such as n-decylcarbonyl, n-undecylcarbonyl, 60 advantageously have 18, 20 or 22 C atoms in the fatty acid n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecylcarbo chain; the fatty acids preferably comprise 20 or 22 carbon nyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-heptade atoms in the fatty acid chain. Saturated fatty acids are advan cylcarbonyl, n-octadecylcarbonyl, n-nonadecylcarbonyl, tageously reacted to a minor degree, or not at all, with the n-eicosylcarbonyl, n-docosanylcarbonyl or n-tetracosanyl nucleic acids used in the method. To a minor degree is to be carbonyl, which comprise one or more double bonds are 65 understood as meaning that the Saturated fatty acids are preferred. Especially preferred are saturated and/or unsatur reacted with less than 5% of the activity, advantageously less ated Co-C-alkylcarbonyl radicals such as Co-alkylcar than 3%, especially advantageously with less than 2%, very US 8,785,727 B2 29 30 especially preferably with less than 1, 0.5, 0.25 or 0.125% in by weight of phospholipids, the total of the various com comparison with polyunsaturated fatty acids. These fatty pounds amounting to 100% by weight. acids which have been produced can be produced in the The method according to the invention yields the LCPU method as a single product or be present in a fatty acid FAS produced in a content of at least 3% by weight, advanta mixture. geously at least 5% by weight, preferably at least 8% by Advantageously, the substituents R or R in the general weight, especially preferably at least 10% by weight, most formulae I and II are, independently of one another, Saturated preferably at least 15% by weight, based on the total fatty or unsaturated Cs-C-alkylcarbonyl, especially advanta acids in the transgenic organisms, advantageously in a trans geously, they are, independently of one another, unsaturated genic plant. In this context, it is advantageous to convert Cs 10 and/or Co-fatty acids which are present in the host organisms Cs-, Co- or C2-alkylcarbonyl with at least two double to at least 10%, advantageously to at least 20%, especially bonds. advantageously to at least 30%, most advantageously to at The polyunsaturated fatty acids produced in the method are least 40% to give the corresponding products such as DPA or advantageously bound in membrane lipids and/or triacylglyc DHA, to mention just two examples. The fatty acids are erides, but may also occur in the organisms as free fatty acids 15 advantageously produced in bound form. These unsaturated or else bound in the form of other fatty acid esters. In this fatty acids can, with the aid of the nucleic acids used in the context, they may be present as “pure products' or else advan method according to the invention, be positioned at the Sn1. tageously in the form of mixtures of various fatty acids or Sn2 and/or Sn3 position of the advantageously produced trig mixtures of different glycerides. The various fatty acids lycerides. Since a plurality of reaction steps are performed by which are bound in the triacylglycerides can be derived from the starting compounds linoleic acid (C18:2) and linolenic short-chain fatty acids with 4 to 6 C atoms, medium-chain acid (C18:3) in the method according to the invention, the end fatty acids with 8 to 12C atoms or long-chain fatty acids with products of the method such as, for example, arachidonic acid 14 to 24C atoms; preferred are long-chain fatty acids, more (ARA), eicosapentaenoic acid (EPA), ()6-docosapentaenoic preferably long-chain polyunsaturated fatty acids with 18, 20 acid or DHA are not obtained as absolutely pure products: and/or 22 C atoms. 25 minor traces of the precursors are always present in the end The method according to the invention advantageously product. If, for example, both linoleic acid and linolenic acid yields fatty acid esters with polyunsaturated Cis-, Co- and/or are present in the starting organism and the starting plant, the C-fatty acid molecules with at least two double bonds in the end products such as ARA, EPA or DHA are present as fatty acid ester, advantageously with at least three, four, five mixtures. The precursors should advantageously not amount or six double bonds in the fatty acid ester, especially advan 30 to more than 20% by weight, preferably not to more than 15% tageously with at least five or six double bonds in the fatty by weight, especially preferably not to more than 10% by acid ester and advantageously leads to the synthesis of weight, most preferably not to more than 5% by weight, based linoleic acid (=LA, C18:2^''), Y-linolenic acid (=GLA, on the amount of the end product in question. Advanta C18:3a''), stearidonic acid (=SDA, C18:4'''''), geously, only ARA, EPA or only DHA, bound or as free acids, dihomo-y-linolenic acid (=DGLA, 20:3^*'''), (03-eico 35 are produced as end products in a transgenic plant in the satetraenoic acid (=ETA, C20:4'''''), arachidonic acid method according to the invention. If the compounds ARA, (ARA, C20:4^'''''), eicosapentaenoic acid (EPA, C20: EPA and DHA are produced simultaneously, they are advan 5^*'''''7), co6-docosapentaenoic acid (C22:5^*'''''') tageously produced in a ratio of at least 1:1:2 (EPA: ARA: co6-docosatetraenoic acid (C22:4''''''), co3-docosapen DHA), advantageously of at least 1:1:3, preferably 1:1:4, taenoic acid (=DPA, C22:5^''''''), docosahexaenoic 40 especially preferably 1:1:5. acid (=DHA, C22:6'''''''') or mixtures of these, pref Fatty acid esters or fatty acid mixtures produced by the erably ARA, EPA and/or DHA. (03-Fatty acids such as EPA method according to the invention advantageously comprise and/or DHA are very especially preferably produced. 6 to 15% of palmitic acid, 1 to 6% of stearic acid, 7-85% of The fatty acid esters with polyunsaturated Cis-, Co- and/ oleic acid, 0.5 to 8% of vaccenic acid, 0.1 to 1% of arachic or C-fatty acid molecules can be isolated in the form of an 45 acid, 7 to 25% of saturated fatty acids, 8 to 85% of monoun oil or lipid, for example in the form of compounds Such as saturated fatty acids and 60 to 85% of polyunsaturated fatty sphingolipids, phosphoglycerides, lipids, glycolipids Such as acids, in each case based on 100% and on the total fatty acid glycosphingolipids, phospholipids such as phosphatidyletha content of the organisms. Advantageous polyunsaturated nolamine, phosphatidylcholine, phosphatidylserine, phos fatty acids which are present in the fatty acid esters or fatty phatidylglycerol, phosphatidylinositol or diphosphatidylg 50 acid mixtures are preferably at least 0.1, 0.2,0.3, 0.4,0.5,0.6, lycerol, monoacyl-glycerides, diacylglycerides, 0.7, 0.8, 0.9 or 1% of arachidonic acid, based on the total fatty triacylglycerides or other fatty acid esters such as the acetyl acid content. Moreover, the fatty acid esters or fatty acid coenzyme Aesters which comprise the polyunsaturated fatty mixtures which have been produced by the method of the acids with at least two, three, four, five or six, preferably five invention advantageously comprise fatty acids selected from or six double bonds, from the organisms which have been 55 the group of the fatty acids erucic acid (13-docosaenoic acid), used for the preparation of the fatty acid esters; advanta sterculic acid (9,10-methyleneoctadec-9-enoic acid), mal geously, they are isolated in the form of their diacylglycer valic acid (8.9-methyleneheptadec-8-enoic acid), chaulmoo ides, triacylglycerides and/or in the form of phosphatidylcho gric acid (cyclopentenedodecanoic acid), furan fatty acid line, especially preferably in the form of the triacylglycerides. (9,12-epoxyoctadeca-9,11-dienoic acid), vernolic acid (9,10 In addition to these esters, the polyunsaturated fatty acids are 60 epoxyoctadec-12-enoic acid), tarinic acid (6-octadecynoic also present in the organisms, advantageously the plants, as acid), 6-nonadecynoic acid, Santalbic acid (t11-octadecen-9- free fatty acids or bound in other compounds. As a rule, the ynoic acid), 6.9-octadecenynoic acid, pyrulic acid (t10-hep various abovementioned compounds (fatty acid esters and tadecen-8-ynoic acid), crepenynic acid (9-octadecen-12 free fatty acids) are present in the organisms with an approxi ynoic acid), 13, 14-dihydrooropheic acid, octadecen-13-ene mate distribution of 80 to 90% by weight of triglycerides, 2 to 65 9,11-diynoic acid, petroselenic acid (cis-6-octadecenoic 5% by weight of diglycerides, 5 to 10% by weight of acid), 9c. 12t-octadecadienoic acid, calendulic acid monoglycerides, 1 to 5% by weight of free fatty acids, 2 to 8% (8t10t12c-octadecatrienoic acid), catalpic acid (9t11t13c-oc US 8,785,727 B2 31 32 tadecatrienoic acid), eleostearic acid (9c11t13t-octadecatri Advantageously, the desaturases used in the method enoic acid), jacaric acid (8c 10t12c-octadecatrienoic acid), according to the invention convert their respective Substrates punicic acid (9c11t 13c-octadecatrienoic acid), parinaric acid in the form of the CoA-fatty acid esters. If preceded by an (9c11t13t 15c-octadecatetraenoic acid), pinolenic acid (all elongation step, this advantageously results in an increased cis-5,9,12-octadecatrienoic acid), laballenic acid (5,6-octa product yield. The respective desaturation products are decadienallenic acid), ricinoleic acid (12-hydroxyoleic acid) thereby synthesized in greater quantities, since the elongation and/or coriolic acid (B-hydroxy-9c. 11t-octadecadienoic step is usually carried out with the CoA-fatty acid esters, acid). The abovementioned fatty acids are, as a rule, advan while the desaturation step is predominantly carried out with tageously only found in traces in the fatty acid esters or fatty the phospholipids or the triglycerides. Therefore, a substitu acid mixtures produced by the method according to the inven 10 tion reaction between the CoA-fatty acid esters and the phos tion, that is to say that, based on the total fatty acids, they pholipids or triglycerides, which would require a further, occur to less than 30%, preferably to less than 25%, 24%, possibly limiting, enzyme reaction, is not necessary. 23%, 22% or 21%, especially preferably to less than 20%, Owing to the enzymatic activity of the polypeptides used in 15%, 10%, 9%, 8%, 7%, 6% or 5%, very especially prefer the method according to the invention, a wide range of poly ably to less than 4%. 3%, 2% or 1%. The fatty acid esters or 15 unsaturated fatty acids can be produced in the method accord fatty acid mixtures produced by the method according to the ing to the invention. Depending on the choice of the organ invention advantageously comprise less than 0.1%, based on isms, such as the advantageous plants, used for the method the total fatty acids, or no butyric acid, no cholesterol, no according to the invention, mixtures of the various polyun clupanodonic acid (docosapentaenoic acid, saturated fatty acids or individual polyunsaturated fatty acids, C22:5^'''''') and no nisinic acid (tetracosahexaenoic such as EPA or ARA, can be produced in free or bound form. acid, C23:6^*'''''). Owing to the nucleic acid Depending on the prevailing fatty acid composition in the sequences of the invention, or the nucleic acid sequences used starting plant (C18:2- or C18:3-fatty acids), fatty acids which in the method according to the invention, an increase in the are derived from C18:2-fatty acids, such as GLA, DGLA or yield of polyunsaturated fatty acids of at least 50%, advanta ARA, or fatty acids which are derived from C 18:3-fatty acids, geously of at least 80%, especially advantageously of at least 25 such as SDA, ETA or EPA, are thus obtained. If only linoleic 100%, very especially advantageously of at least 150%, in acid (=LA, C18:2^*) is present as unsaturated fatty acid in comparison with the nontransgenic starting organism, for the plant used for the method, the method can only afford example a yeast, an alga, a fungus or a plant Such as Arabi GLA, DGLA and ARA as products, all of which can be dopsis or linseed can be obtained in a comparison by GC present as free fatty acids or in bound form. If only O-lino analysis. 30 lenic acid (ALA, C18:3^''') is present as unsaturated Chemically pure polyunsaturated fatty acids or fatty acid fatty acid in the plant used for the method, the method can compositions can also be prepared by the methods described only afford SDA, ETA, EPA and/or DHA as products, all of above. To this end, the fatty acids or the fatty acid composi which can be present as free fatty acids or in bound form, as tions are isolated from the organism, such as the microorgan described above. Owing to the modification of the activity of isms or the plants or the culture medium in or on which the 35 the enzymes A5-desaturase, A6-desaturase, A4-desaturase, organisms have been grown, or from the organism and the A 12-desaturase. A 15-desaturase, (D3-desaturase, A5-elon culture medium, in a known manner, for example via extrac gase and/or A6-elongase which play a role in the synthesis, it tion, distillation, crystallization, chromatography or combi is possible to produce, in a targeted fashion, only individual nations of these methods. These chemically pure fatty acids products in the abovementioned organisms, advantageously or fatty acid compositions are advantageous for applications 40 in the abovementioned plants. Owing to the activity of A6-de in the food industry sector, the cosmetic industry sector and saturase and A6-elongase, for example, GLA and DGLA, or especially the pharmacological industry sector. SDA and ETA, are formed, depending on the starting plant In principle, all genes of the fatty acid or lipid metabolism and unsaturated fatty acid. DGLA or ETA or mixtures of these can be used in the method for the production of polyunsatu are preferably formed. If A5-desaturase, A5-elongase and rated fatty acids, advantageously in combination with the 45 A4-desaturase are additionally introduced into the organisms, inventive polynucleotide(s) (for the purposes of the present advantageously into the plant, ARA, EPA and/or DHA are application, the plural is understood as encompassing the additionally formed. Advantageously, only ARA, EPA or singular and vice versa). Genes of the fatty acid or lipid DHA or mixtures of these are synthesized, depending on the metabolism which are used are advantageously selected from fatty acids present in the organism, or in the plant, which acts the group consisting of acyl-CoA dehydrogenase(s), acyl 50 as starting Substance for the synthesis. Since biosynthetic ACP =acyl carrier protein desaturase(s), acyl-ACP cascades are involved, the end products in question are not thioesterase(s), fatty acid acyltransferase(s), acyl-CoA:ly So present as pure Substances in the organisms. Small amounts phospholipid acyltransferases, fatty acid synthase(s), fatty of the precursor compounds are always additionally present acid hydroxylase(s), acetyl-coenzyme A carboxylase(s), in the end product. These Small amounts amount to less than acyl-coenzyme A oxidase(s), fatty acid desaturase(s), fatty 55 20% by weight, advantageously less than 15% by weight, acid acetylenases, lipoxygenases, triacylglycerol lipases, especially advantageously less than 10% by weight, most allene oxide synthases, hydroperoxide lyases or fatty acid advantageously less than 5, 4, 3, 2 or 1% by weight, based on elongase(s). Genes selected from the group of the A4-desatu the end product DGLA, ETA or their mixtures, or ARA, EPA, rases, A5-desaturases, A6-desaturases, A8-desaturases, DHA or their mixtures, advantageously EPA or DHA or their A9-desaturases, A12-desaturases, A 15-desaturases, A12- and 60 mixtures. A 15-desaturases, co3-desaturases, A6-elongases, A9-elon In addition to the production, directly in the organism, of gases or A5-elongases in combination with the polynucle the starting fatty acids for the polypeptides used in the method otides according to the invention are preferably used, it being of the invention, the fatty acids can also be fed externally. The possible to use individual genes or a plurality of genes in production in the organism is preferred for reasons of combination. For especially preferred gene combinations, 65 economy. Preferred substrates are linoleic acid (C18:2^'''), reference is made here to tables 5 and 6, which are shown in Y-linolenic acid (C18:3^'''), eicosadienoic acid the examples. (C20:2^'''), dihomo-y-linolenic acid (C20:3^*'''), US 8,785,727 B2 33 34 arachidonic acid (C20:4''''''), docosatetraenoic acid example the genus Mortierella, Thraustochytrium, Saprolleg (C22:4A7,10,13,16) and docosapentaenoic acid nia, Phytophthora or Pythium, bacteria, Such as the genus (C22:5A4,7,10,13,15). Escherichia or Shewanella, yeasts, such as the genus Saccha To increase the yield in the described method for the pro romyces, cyanobacteria, ciliates, algae Such as Mantoniella or duction of oils and/or triglycerides with an advantageously Ostreococcus, or protozoans such as dinoflagellates, such as elevated content of polyunsaturated fatty acids, it is advanta Thalassiosira or Crypthecodinium. Preferred organisms are geous to increase the amount of starting product for the Syn those which are naturally capable of synthesizing Substantial thesis of fatty acids; this can be achieved for example by amounts of oil. Such as fungi. Such as Mortierella alpina, introducing, into the organism, a nucleic acid which codes for Pythium insidiosum, Phytophthora infestans, or plants such a polypeptide with a A5-desaturase activity according to the 10 invention. This is particularly advantageous in oil-producing as Soybean, oilseed rape, coconut, oil palm, safflower, flax, organisms such as those from the family of the Brassicaceae, hemp, castor-oil plant, Calendula, peanut, cacao bean or Sun Such as the genus Brassica, for example oilseed rape; the flower, or yeasts such as Saccharomyces cerevisiae, with family of the Elaeagnaceae, such as the genus Elaeagnus, for Soybean, flax, oilseed rape, Safflower, Sunflower, Calendula, example the genus and species Olea europaea, or the family 15 Mortierella or Saccharomyces cerevisiae being especially Fabaceae, such as the genus Glycine, for example the genus preferred. In principle, Suitable as host organisms are, in and species Glycine max, which are high in oleic acid. Since addition to the abovementioned transgenic organisms, also these organisms are only low inlinoleic acid (Mikoklajczak et transgenic animals, advantageously nonhuman animals, for al., Journal of the American Oil Chemical Society, 38, 1961, example Caenorhabditis elegans. Further suitable host cells 678-681), the use of the A5-desaturases for producing the and organisms have already been described extensively starting arachidonic acid, or eicosapentaenoic acid, or above. docosapentaenoic acid, or docosahexaenoic acid is advanta Transgenic plants which comprise the polyunsaturated geous. fatty acids synthesized in the method according to the inven The method according to the invention advantageously tion can advantageously be marketed directly without there employs the abovementioned nucleic acid sequences or their 25 being any need for the oils, lipids or fatty acids synthesized to derivatives or homologs which code for polypeptides which be isolated. Plants for the method according to the invention retain the enzymatic activity of the proteins encoded by are listed as meaning intact plants and all plant parts, plant nucleic acid sequences. These sequences, individually or in organs or plant parts such as leaf stem, seeds, root, tubers, combination with the polynucleotides according to the inven anthers, fibers, root hairs, stalks, embryos, calli, cotely dons, tion, are cloned into expression constructs and used for the 30 petioles, harvested material, plant tissue, reproductive tissue introduction into, and expression in, organisms. Owing to and cell cultures which are derived from the transgenic plant their construction, these expression constructs make possible and/or can be used for bringing about the transgenic plant. In an advantageous optimal synthesis of the polyunsaturated this context, the seed comprises all parts of the seed Such as fatty acids produced in the method according to the invention. the seed coats, epidermal cells, seed cells, endosperm or In a preferred embodiment, the method furthermore com 35 embryonic tissue. However, the compounds produced in the prises the step of obtaining a cell or an intact organism which method according to the invention can also be isolated from comprises the nucleic acid sequences used in the method, the organisms, advantageously plants, in the form of their where the cell and/or the organism is transformed with a oils, fats, lipids and/or free fatty acids. Polyunsaturated fatty polynucleotide according to the invention, a gene constructor acids produced by this method can be obtained by harvesting a vector as described below, alone or in combination with 40 the organisms, either from the crop in which they grow, or further nucleic acid sequences which code for proteins of the from the field. This can be done via pressing or extraction of fatty acid or lipid metabolism. In a further preferred embodi the plant parts, preferably of the plant seeds. In this context, ment, this method furthermore comprises the step of obtain the oils, fats, lipids and/or free fatty acids can be obtained by ing the oils, lipids or free fatty acids from the organism or pressing by what is known as cold-beating or cold-pressing from the culture. The culture can, for example, take the form 45 without applying heat. To allow for greater ease of disruption of a fermentation culture, for example in the case of the of the plant parts, specifically the seeds, they are previously cultivation of microorganisms, such as, for example, Mortier comminuted, steamed or roasted. The seeds which have been ella, Thalassiosira, Mantoniella, Ostreococcus, Saccharo pretreated in this manner can Subsequently be pressed or myces or Thraustochytrium, or a greenhouse- or field-grown extracted with solvent such as warm hexane. The solvent is culture of a plant. The cell or the organism thus produced is 50 Subsequently removed. In the case of microorganisms, the advantageously a cell of an oil-producing organism, Such as latter are, after harvesting, for example extracted directly an oil crop. Such as, for example, peanut, oilseed rape, canola, without further methoding steps or else, after disruption, linseed, hemp, soybean, Safflower, Sunflowers or borage. extracted via various methods with which the skilled worker In the case of plant cells, plant tissue or plant organs, is familiar. In this manner, more than 96% of the compounds 'growing is understood as meaning, for example, the culti 55 produced in the method can be isolated. Thereafter, the result Vation on or in a nutrient medium, or of the intact plant on or ing products are methoded further, i.e. refined. In this method, in a Substrate, for example in a hydroponic culture, potting for example the plant mucilages and Suspended matter are compost or on arable land. first removed. What is known as desliming can be effected Suitable organisms or host cells for the method according enzymatically or, for example, chemico-physically by addi to the invention are those which are capable of synthesizing 60 tion of acid such as phosphoric acid. Thereafter, the free fatty fatty acids, specifically unsaturated fatty acids, and/or which acids are removed by treatment with a base, for example are Suitable for the expression of recombinant genes. Sodium hydroxide Solution. The resulting product is washed Examples which may be mentioned are plants such as Ara thoroughly with water to remove the alkali remaining in the bidopsis, Asteraceae such as Calendula or crop plants such as product and then dried. To remove the pigments remaining in Soybean, peanut, castor-oil plant, Sunflower, maize, cotton, 65 the product, the products are Subjected to bleaching, for flax, oilseed rape, coconut, oil palm, safflower (Carthamus example using fuller's earth or active charcoal. At the end, the tinctorius) or cacao bean, microorganisms, such as fungi, for product is deodorized, for example using steam. US 8,785,727 B2 35 36 The PUFAs or LCPUFAs produced by this method are 10% of EPA and/or DHA, based on the total fatty acid content preferably Cis-, Co- or C-fatty acid molecules, advanta of the production organism, advantageously of a plant, espe geously Co- or C-fatty acid molecules, with at least two cially advantageously of an oil crop plant Such as Soybean, double bonds in the fatty acid molecule, preferably three, oilseed rape, coconut, oil palm, safflower, flax, hemp, castor four, five or six double bonds. These Cis-, Co- or C-fatty oil plant, Calendula, peanut, cacao bean, Sunflower, or the acid molecules can be isolated from the organism in the form abovementioned further mono- or dicotyledonous oil crop ofan oil, a lipid or a free fatty acid. Suitable organisms are, for plants. example, those mentioned above. Preferred organisms are A further embodiment according to the invention is the use transgenic plants. of the oil, lipid, the fatty acids and/or the fatty acid composi One embodiment of the invention is therefore oils, lipids or 10 tion in feedstuffs, foodstuffs, cosmetics or pharmaceuticals. fatty acids or fractions thereof which have been produced by The oils, lipids, fatty acids or fatty acid mixtures according to the abovedescribed method, especially preferably oil, lipid or the invention can be used in the manner with which the skilled a fatty acid composition comprising PUFAs and being worker is familiar for mixing with other oils, lipids, fatty derived from transgenic plants. acids or fatty acid mixtures of animal origin, Such as, for As described above, these oils, lipids or fatty acids advan 15 example, fish oils. These oils, lipids, fatty acids or fatty acid tageously comprise 6 to 15% of palmitic acid, 1 to 6% of mixtures, which are composed of vegetable and animal con stearic acid, 7-85% of oleic acid, 0.5 to 8% of vaccenic acid, stituents, may also be used for the preparation offeedstuffs, 0.1 to 1% of arachic acid, 7 to 25% of saturated fatty acids, 8 foodstuffs, cosmetics or pharmaceuticals. to 85% of monounsaturated fatty acids and 60 to 85% of The term “oil, “lipid' or “fat is understood as meaning a polyunsaturated fatty acids, in each case based on 100% and fatty acid mixture comprising unsaturated, saturated, prefer on the total fatty acid content of the organisms. Advantageous ably esterified, fatty acid(s). The oil, lipid or fat is preferably polyunsaturated fatty acids which are present in the fatty acid high in polyunsaturated free or, advantageously, esterified esters or fatty acid mixtures are preferably at least 0.1, 0.2, fatty acid(s), in particular linoleic acid, Y-linolenic acid, 0.3, 0.4,0.5,0.6,0.7, 0.8, 0.9 or 1% of arachidonic acid, based dihomo-Y-linolenic acid, arachidonic acid, C-linolenic acid, on the total fatty acid content. Moreover, the fatty acid esters 25 Stearidonic acid, eicosatetraenoic acid, eicosapentaenoic or fatty acid mixtures which have been produced by the acid, docosapentaenoic acid or docosahexaenoic acid. The method of the invention advantageously comprise fatty acids amount of unsaturated esterified fatty acids preferably selected from the group of the fatty acids erucic acid (13 amounts to approximately 30%, a content of 50% is more docosaenoic acid), sterculic acid (9,10-methyleneoctadec-9- preferred, a content of 60%, 70%, 80% or more is even more enoic acid), malvalic acid (8.9-methyleneheptadec-8-enoic 30 preferred. For the analysis, the fatty acid content can, for acid), chaulmoogric acid (cyclopentenedodecanoic acid), example, be determined by gas chromatography after con furan fatty acid (9,12-epoxyoctadeca-9,11-dienoic acid), ver verting the fatty acids into the methyl esters by transesterifi nolic acid (9,10-epoxyoctadec-12-enoic acid), tarinic acid cation. The oil, lipid or fat can comprise various other satu (6-octadecynoic acid), 6-nonadecynoic acid, Santalbic acid rated or unsaturated fatty acids, for example calendulic acid, (t11-octadecen-9-ynoic acid), 6.9-octadecenynoic acid, 35 palmitic acid, palmitoleic acid, Stearic acid, oleic acid and the pyrulic acid (t10-heptadecen-8-ynoic acid), crepenynic acid like. The content of the various fatty acids in the oil or fat can (9-octadecen-12-ynoic acid), 13, 14-dihydrooropheic acid, vary, in particular depending on the starting organism. octadecen-13-ene-9,11-diynoic acid, petroselenic acid (cis The polyunsaturated fatty acids with advantageously at 6-octadecenoic acid), 9c, 12t-octadecadienoic acid, calen least two double bonds which are produced in the method are, dulic acid (8t10t12c-octadecatrienoic acid), catalpic acid 40 as described above, for example sphingolipids, phosphoglyc (9t11t13c-octadecatrienoic acid), eleostearic acid (9c11t13t erides, lipids, glycolipids, phospholipids, monoacylglycerol, octadecatrienoic acid), jacaric acid (8c10t12c-octadecatri diacylglycerol, triacylglycerol or other fatty acid esters. enoic acid), punicic acid (9c11t 13c-octadecatrienoic acid), Starting from the polyunsaturated fatty acids with advan parinaric acid (9c11t13t15c-octadecatetraenoic acid), pino tageously at least five or six double bonds, which acids have lenic acid (all-cis-5,9,12-octadecatrienoic acid), laballenic 45 been prepared in the method according to the invention, the acid (5,6-octadecadienallenic acid), ricinoleic acid (12-hy polyunsaturated fatty acids which are present can be liberated droxyoleic acid) and/or coriolic acid (13-hydroxy-9c. 11t-oc for example via treatment with alkali, for example aqueous tadecadienoic acid). The abovementioned fatty acids are, as a KOH or NaOH, or acid hydrolysis, advantageously in the rule, advantageously only found in traces in the fatty acid presence of an alcohol Such as methanol or ethanol, or via esters or fatty acid mixtures produced by the method accord 50 enzymatic cleavage, and isolated via, for example, phase ing to the invention, that is to say that, based on the total fatty separation and Subsequent acidification via, for example, acids, they occur to less than 30%, preferably to less than HSO. The fatty acids can also be liberated directly without 25%, 24%, 23%, 22% or 21%, especially preferably to less the abovedescribed methoding step. than 20%, 15%, 10%.9%, 8%, 7%,6% or 5%, very especially After their introduction into an organism, advantageously a preferably to less than 4%. 3%, 2% or 1%. The fatty acid 55 plant cell or plant, the nucleic acids used in the method can esters or fatty acid mixtures produced by the method accord either be present on a separate plasmid or, advantageously, ing to the invention advantageously comprise less than 0.1%, integrated into the genome of the host cell. In the case of based on the total fatty acids, or nobutyric acid, no choles integration into the genome, integration can be random or else terol, no clupanodonic acid (docosapentaenoic acid, C22: be effected by recombination such that the native gene is 5^*'''''') and no nisinic acid (tetracosahexaenoic acid, 60 replaced by the copy introduced, whereby the production of C23:6A38,12,15,18:21). the desired compound by the cell is modulated, or by the use The oils, lipids or fatty acids according to the invention of a gene in “trans'. So that the gene is linked operably with a preferably comprise at least 0.5%, 1%, 2%, 3%, 4% or 5%, functional expression unit which comprises at least one advantageously at least 6%, 7%, 8%, 9% or 10%, especially sequence which ensures the expression of a gene and at least advantageously at least 11%, 12%, 13%, 14% or 15% of ARA 65 one sequence which ensures the polyadenylation of a func or at least 0.5%, 1%, 2%. 3%, 4% or 5%, advantageously at tionally transcribed gene. The nucleic acids are advanta least 6% or 7%, especially advantageously at least 8%, 9% or geously introduced into the organisms via multi-expression US 8,785,727 B2 37 38 cassettes or constructs for multiparallel expression, advanta tissue, but can also take place in a tissue-specific manner in all geously into the plants for the multiparallel seed-specific the other parts of the plant for example in epidermal cells or expression of genes. in the tubers. Mosses and algae are the only known plant systems which If microorganism Such as yeasts, such as Saccharomyces or produce Substantial amounts of polyunsaturated fatty acids Schizosaccharomyces, fungi such as Mortierella, Aspergillus, Such as arachidonic acid (ARA) and/or eicosapentaenoic acid Phytophthora, Entomophthora, Mucor or Thraustochytrium, (EPA) and/or docosahexaenoic acid (DHA). Mosses com algae Such as Isochrysis, Mantoniella, Ostreococcus, Phaeo prise PUFAS in membrane lipids, while algae, organisms dactylum or Crypthecodinium are used as organisms in the which are related to algae and a few fungi also accumulate method according to the invention, these organisms are 10 advantageously grown in fermentation cultures. substantial amounts of PUFAs in the triacylglycerol fraction. Owing to the use of the nucleic acids according to the This is why nucleic acid molecules which are isolated from invention which code for a desaturase, the polyunsaturated such strains that also accumulate PUFAs in the triacylglycerol fatty acids produced in the method can be increased by at least fraction are particularly advantageous for the method accord 5%, preferably by at least 10%, especially preferably by at ing to the invention and thus for the modification of the lipid 15 least 20%, very especially preferably by at least 50% in com and PUFA production system in a host, in particular plants parison with the wild type of the organisms which do not Such as oil crops, for example oilseed rape, canola, linseed, comprise the nucleic acids recombinantly. hemp, soybeans, Sunflowers and borage. They can therefore In principle, the polyunsaturated fatty acids produced by be used advantageously in the method according to the inven the method according to the invention in the organisms used tion. in the method can be increased in two different ways. Advan Substrates which are suitable for the polypeptides accord tageously, the pool of free polyunsaturated fatty acids and/or ing to the invention of the fatty acid or lipid metabolism the content of the esterified polyunsaturated fatty acids pro selected from the group acyl-CoA dehydrogenase(s), acyl duced via the method can be enlarged. Advantageously, the ACP =acyl carrier protein desaturase(s), acyl-ACP pool of esterified polyunsaturated fatty acids in the transgenic thioesterase(s), fatty acid acyltransferase(s), acyl-CoA:ly So 25 organisms is enlarged by the method according to the inven phospholipid acyltransferase(s), fatty acid synthase(s), fatty tion. acid hydroxylase(s), acetyl-coenzyme A carboxylase(s), If microorganisms are used as organisms in the method acyl-coenzyme A oxidase(s), fatty acid desaturase(s), fatty according to the invention, they are grown or cultured in a acid acetylenase(s), lipoxygenase(s), triacylglycerol manner with which the skilled worker is familiar, depending lipase(s), allene oxide synthase(s), hydroperoxide lyase(s) or 30 on the host organism. As a rule, microorganisms are grown in fatty acid elongase(s) are advantageously C-, Cis- or Co a liquid medium comprising a carbon Source, usually in the fatty acids. The fatty acids converted as substrates in the form of Sugars, a nitrogen source, usually in the form of method are preferably converted in the form of their acyl organic nitrogen Sources Such as yeast extract or salts such as CoA esters and/or their phospholipid esters. ammonium sulfate, trace elements such as salts of iron, man To produce the long-chain PUFAs according to the inven 35 ganese and magnesium and, if appropriate, vitamins, at tem tion, the polyunsaturated Cis-fatty acids must first be desatu peratures of between 0° C. and 100° C., preferably between rated by the enzymatic activity of a desaturase and Subse 10° C. and 60°C., while introducing oxygen gas. The pH of quently be elongated by at least two carbon atoms via an the nutrient liquid can either be kept constant, that is to say elongase. After one elongation cycle, this enzyme activity regulated during the culturing period, or not. The cultures can gives Co-fatty acids and after two elongation cycles, C 40 be grown batchwise, semi-batchwise or continuously. Nutri fatty acids. The activity of the desaturases and elongases used ents can be provided at the beginning of the fermentation or in the method according to the invention preferably leads to fed in semicontinuously or continuously. The polyunsatu Cs-, Co- and/or C-fatty acids, advantageously with at least rated fatty acids produced can be isolated from the organisms two double bonds in the fatty acid molecule, preferably with as described above by methods known to the skilled worker, three, four, five or six double bonds, especially preferably to 45 for example by extraction, distillation, crystallization, if give Co- and/or C-fatty acids with at least two double appropriate precipitation with salt, and/or chromatography. bonds in the fatty acid molecule, preferably with three, four, To this end, the organisms can advantageously be disrupted five or six double bonds, very especially preferably with five beforehand. or six double bonds in the molecule. After a first desaturation If the host organisms are microorganisms, the methods and the elongation have taken place, further desaturation and 50 according to the invention is advantageously carried out at a elongation steps such as, for example, such a desaturation in temperature of between 0° C. and 95°C., preferably between the 45 and 44 positions may take place. Products of the 10° C. and 85°C., especially preferably between 15° C. and method according to the invention which are especially pre 75°C., very especially preferably between 15° C. and 45° C. ferred are dihomo-y-linolenic acid, arachidonic acid, eicosa In this method, the pH value is advantageously kept pentaenoic acid, docosapentaenoic acid and/or docosa 55 between pH 4 and 12, preferably between pH 6 and 9, espe hexaenoic acid. The Co-fatty acids with at least two double cially preferably between pH 7 and 8. bonds in the fatty acid can be desatured by the enzymatic The method according to the invention can be operated activity according to the invention in the form of the free fatty batchwise, semibatchwise or continuously. An overview over acid or in the form of the esters, such as phospholipids, known cultivation methods can be found in the textbook by glycolipids, sphingolipids, phosphoglycerides, monoacylg 60 Chmiel (Bioprozeftechnik 1. Einführung in die Bioverfahr lycerol, diacylglycerol or triacylglycerol. enstechnik Biomethod technology 1. Introduction to The preferred biosynthesis site offatty acids, oils, lipids or biomethod technology (Gustav Fischer Verlag, Stuttgart, fats in the plants which are advantageously used is, for 1991)) or in the textbook by Storhas (Bioreaktoren and example, in general the seed or cell strata of the seed, so that periphere Einrichtungen Bioreactors and peripheral equip seed-specific expression of the nucleic acids used in the 65 ment (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)). method is sensible. However, it is obvious that the biosynthe The culture medium to be used must suitably meet the sis of fatty acids, oils or lipids need not be limited to the seed requirements of the Strains in question. Descriptions of cul US 8,785,727 B2 39 40 ture media for various microorganisms can be found in the nents may be sterilized either together or, if required, sepa textbook “Manual of Methods for General Bacteriology” of rately. All media components may be present at the start of the the American Society for Bacteriology (Washington D.C., cultivation or added continuously or batchwise, as desired. USA, 1981). The culture temperature is normally between 15° C. and As described above, these media which can be employed in 45° C., preferably at from 25°C. to 40°C., and may be kept accordance with the invention usually comprise one or more constant or altered during the experiment. The pH of the carbon Sources, nitrogen Sources, inorganic salts, vitamins medium should be in the range from 5 to 8.5, preferably and/or trace elements. around 7.0. The pH for cultivation can be controlled during Preferred carbon Sources are Sugars, such as mono-, di- or cultivation by adding basic compounds such as Sodium polysaccharides. Examples of very good carbon Sources are 10 hydroxide, potassium hydroxide, ammonia and aqueous glucose, fructose, mannose, galactose, ribose, Sorbose, ribu ammonia or acidic compounds such as phosphoric acid or lose, lactose, maltose, Sucrose, raffinose, starch or cellulose. Sulfuric acid. Foaming can be controlled by employing anti Sugars can also be added to the media via complex com foams such as, for example, fatty acid polyglycol esters. To pounds Such as molasses or other by-products from Sugar maintain the stability of plasmids it is possible to add to the raffination. The addition of mixtures of a variety of carbon 15 medium Suitable Substances having a selective effect, for Sources may also be advantageous. Other possible carbon example antibiotics. Aerobic conditions are maintained by Sources are oils and fats such as, for example, soya oil, Sun introducing oxygen or oxygen-containing gas mixtures Such flower oil, peanut oil and/or coconut fat, fatty acids such as, as, for example, ambient air, into the culture. The temperature for example, palmitic acid, Stearic acid and/or linoleic acid, of the culture is normally 20° C. to 45° C. and preferably 25° alcohols and/or polyalcohols such as, for example, glycerol, C. to 40°C. The culture is continued until formation of the methanol and/or ethanol, and/or organic acids Such as, for desired product is at a maximum. This aim is normally example, acetic acid and/or lactic acid. achieved within 10 hours to 160 hours. Nitrogen sources are usually organic or inorganic nitrogen The fermentation broths obtained in this way, in particular compounds or materials comprising these compounds. those containing polyunsaturated fatty acids, usually contain Examples of nitrogen sources comprise ammonia in liquid or 25 a dry mass of from 7.5 to 25% by weight. gaseous form or ammonium salts such as ammonium Sulfate, The fermentation broth can then be methoded further. The ammonium chloride, ammonium phosphate, ammonium car biomass may, according to requirement, be removed com bonate or ammonium nitrate, nitrates, urea, amino acids or pletely or partially from the fermentation broth by separation complex nitrogen Sources such as cornsteep liquor, Soya methods such as, for example, centrifugation, filtration, meal, Soya protein, yeast extract, meat extract and others. The 30 decanting or a combination of these methods or be left com nitrogen sources can be used individually or as a mixture. pletely in said broth. It is advantageous to method the biomass Inorganic salt compounds which may be present in the after its separation. media comprise the chloride, phosphorus and Sulfate salts of However, the fermentation broth can also be thickened or calcium, magnesium, Sodium, cobalt, molybdenum, potas concentrated without separating the cells, using known meth sium, manganese, Zinc, copper and iron. 35 ods such as, for example, with the aid of a rotary evaporator, Inorganic Sulfur-containing compounds such as, for thin-film evaporator, falling-film evaporator, by reverse example, Sulfates, Sulfites, dithionites, tetrathionates, thiosul osmosis or by nanofiltration. Finally, this concentrated fer fates, Sulfides, or else organic Sulfur compounds such as mentation broth can be methoded to obtain the fatty acids mercaptains and thiols may be used as sources of sulfur for the present therein. production of Sulfur-containing fine chemicals, in particular 40 The polynucleotides or polypeptides of the present inven of methionine. tion which are involved in the metabolism of lipids and fatty Phosphoric acid, potassium dihydrogen phosphate or dipo acids, PUFA cofactors and enzymes or in the transport of tassium hydrogen phosphate or the corresponding Sodium lipophilic compounds across membranes are used in the containing salts may be used as sources of phosphorus. method according to the invention for the modulation of the Chelating agents may be added to the medium in order to 45 production of PUFAS in transgenic organisms, advanta keep the metal ions in solution. Particularly suitable chelating geously in plants, such as maize, wheat, rye, oats, triticale, agents comprise dihydroxyphenols such as catechol or pro rice, barley, Soybean, peanut, cotton, Linum species such as tocatechuate and organic acids such as citric acid. linseed or flax, Brassica species such as oilseed rape, canola The fermentation media used according to the invention for and turnip rape, pepper, Sunflower, borage, evening primrose cultivating microorganisms usually also comprise other 50 and Tagetes, Solanaceae plants such as potato, tobacco, egg growth factors such as vitamins or growth promoters, which plant and tomato, Vicia species, pea, cassava, alfalfa, bushy include, for example, biotin, riboflavin, thiamine, folic acid, plants (coffee, cacao, tea), Salix species, trees (oil palm, coco nicotinic acid, panthothenate and pyridoxine. Growth factors nut) and perennial grasses and fodder crops, either directly and salts are frequently derived from complex media compo (for example when the overexpression or optimization of a nents such as yeast extract, molasses, cornsteep liquor and the 55 fatty acid biosynthesis protein has a direct effect on the yield, like. It is moreover possible to add suitable precursors to the production and/or production efficiency of the fatty acid from culture medium. The exact composition of the media com modified organisms) and/or can have an indirect effect which pounds depends heavily on the particular experiment and is nevertheless leads to an enhanced yield, production and/or decided upon individually for each specific case. Information production efficiency of the PUFAs or a reduction of undes on the optimization of media can be found in the textbook 60 ired compounds (for example when the modulation of the Applied Microbiol. Physiology, A Practical Approach” (Edi metabolism of lipids and fatty acids, cofactors and enzymes tors P. M. Rhodes, P. F. Stanbury, IRL Press (1997) pp. 53-73, leads to modifications of the yield, production and/or produc ISBN 0 199635773). Growth media can also be obtained tion efficiency or the composition of the desired compounds from commercial suppliers, for example Standard 1 (Merck) within the cells, which, in turn, can affect the production of or BHI (brain heart infusion, DIFCO) and the like. 65 one or more fatty acids). All media components are sterilized, either by heat (20 min The combination of various precursor molecules and bio at 1.5 bar and 121°C.) or by filter sterilization. The compo synthesis enzymes leads to the production of various fatty US 8,785,727 B2 41 42 acid molecules, which has a decisive effect on lipid compo O-linolenic acid, dihomo-y-linolenic acid, eicosatetraenoic sition, since polyunsaturated fatty acids (—PUFAs) are not acid or stearidonic acid. Preferred substrates are linoleic acid, only incorporated into triacylglycerol but also into membrane Y-linolenic acid and/or O-linolenic acid, dihomo-y-linolenic lipids. acid or arachidonic acid, eicosatetraenoic acid or eicosapen Brassicaceae, Boraginaceae, Primulaceae, or Linaceae are 5 taenoic acid. The synthesized Co- or C-fatty acids with at particularly suitable for the production of PUFAs, for least two, three, four, five or six double bonds in the fatty acid example Stearidonic acid, eicosapentaenoic acid and docosa are obtained in the method according to the invention in the hexaenoic acid. Linseed (Linum usitatissimum) is especially form of the free fatty acid or in the form of their esters, for advantageously suitable for the production of PUFAs with the example in the form of their glycerides. nucleic acid sequences according to the invention, advanta 10 The term 'glyceride' is understood as meaning a glycerol geously, as described, in combination with further desatu esterified with one, two or three carboxyl radicals (mono-, di rases and elongases. or triglyceride). "Glyceride' is also understood as meaning a Lipid synthesis can be divided into two sections: the syn mixture of various glycerides. The glyceride or glyceride thesis of fatty acids and their binding to sn-glycerol-3-phos mixture may comprise further additions, for example free phate, and the addition or modification of a polar head group. 15 fatty acids, antioxidants, proteins, carbohydrates, vitamins Usual lipids which are used in membranes comprise phos and/or other Substances. pholipids, glycolipids, sphingolipids and phosphoglycerides. For the purposes of the method according to invention, a Fatty acid synthesis starts with the conversion of acetyl-CoA 'glyceride' is furthermore understood as meaning glycerol into malonyl-CoA by acetyl-CoA carboxylase or into acetyl derivatives. In addition to the abovedescribed fatty acid glyc ACP by acetyl transacylase. After a condensation reaction, erides, these also include glycerophospholipids and glycero these two product molecules together form acetoacetyl-ACP, glycolipids. Preferred examples which may be mentioned in which is converted via a series of condensation, reduction and this context are the glycerophospholipids such as lecithin dehydratation reactions so that a saturated fatty acid molecule (phosphatidylcholine), cardiolipin, phosphatidylglycerol, with the desired chain length is obtained. The production of phosphatidylserine and alkylacylglycerophospholipids. the unsaturated fatty acids from these molecules is catalyzed 25 Furthermore, fatty acids must Subsequently be translocated by specific desaturases, either aerobically by means of to various modification sites and incorporated into the tria molecular oxygen or anaerobically (regarding the fatty acid cylglycerol storage lipid. A further important step in lipid synthesis in microorganisms, see F.C. Neidhardt et al. (1996) synthesis is the transfer offatty acids to the polar head groups, E. coli and Salmonella. ASM Press: Washington, D.C., pp. for example by glycerol fatty acid acyltransferase (see 612-636 and references cited therein; Lengeler et al. (Ed.) 30 Frentzen, 1998, Lipid, 100(4-5):161-166). (1999) Biology of Procaryotes. Thieme: Stuttgart, N.Y., and Publications on plant fatty acid biosynthesis and on the the references therein, and Magnuson, K.,etal. (1993)Micro desaturation, the lipid metabolism and the membrane trans biological Reviews 57:522-542 and the references therein). port of lipidic compounds, on beta-Oxidation, fatty acid modi To undergo the further elongation steps, the resulting phos fication and cofactors, triacylglycerol storage and triacylglyc pholipid-bound fatty acids must be returned to the fatty acid 35 erol assembly, including the references therein, see the CoA esterpool from the phospholipids. This is made possible following papers: Kinney, 1997, Genetic Engineering, Ed.: J by acyl-CoA: lysophospholipid acyltransferases. Moreover, K Setlow, 19:149-166; Ohlrogge and Browse, 1995, Plant these enzymes are capable of transferring the elongated fatty Cell 7:957-970; Shanklin and Cahoon, 1998, Annu. Rev. acids from the CoA esters back to the phospholipids. If appro Plant Physiol. Plant Mol. Biol. 49:611-641; Voelker, 1996, priate, this reaction sequence can be traversed repeatedly. 40 Genetic Engineering, Ed.: J K Setlow, 18:111-13; Gerhardt, Examples of precursors for the biosynthesis of PUFAs are 1992, Prog. Lipid R. 31:397-417: Gühnemann-Schäfer & oleic acid, linoleic acid and linolenic acid. These Cis-carbon Kindl., 1995, Biochim. Biophys Acta 1256:181-186; Kunauet fatty acids must be elongated to Co and C in order to obtain al., 1995, Prog. Lipid Res. 34:267-342; Stymine et al., 1993, fatty acids of the eicosa and docosa chain type. With the aid of in: Biochemistry and Molecular Biology of Membrane and the desaturases used in the method. Such as the A12-. A 15-, 45 Storage Lipids of Plants, Ed.: Murata and Somerville, Rock A12- and A15-, (03-, A4-, A5- and A6-desaturases and/or the ville, American Society of Plant Physiologists, 150-158, A5-, A6-elongases, arachidonic acid, eicosapentaenoic acid, Murphy & Ross 1998, Plant Journal. 13(1):1-16. docosapentaenoic acid or docosahexaenoic acid, advanta The PUFAs produced in the method comprise a group of geously eicosapentaenoic acid and/or docosahexaenoic acid, molecules which higher animals are no longer capable of can be produced and Subsequently employed in various appli 50 synthesizing and must therefore take up, or which higher cations regarding foodstuffs, feedstuffs, cosmetics or phar animals are no longer capable of synthesizing themselves in maceuticals. Co- and/or C-fatty acids with at least two, Sufficient quantities and must therefore take up additional advantageously at least three, four, five or six, double bonds in quantities, although they can be synthesized readily by other the fatty acid molecule, preferably Co- or C-fatty acids organisms such as bacteria; for example, cats are no longer with advantageously four, five or six double bonds in the fatty 55 capable of synthesizing arachidonic acid. acid molecule, can be prepared using the abovementioned Phospholipids for the purposes of the invention are under enzymes. Desaturation may take place before or after elon stood as meaning phosphatidylcholine, phosphatidylethano gation of the fatty acid in question. This is why the products lamine, phosphatidylserine, phosphatidylglycerol and/or of the desaturase activities and of the further desaturation and phosphatidylinositol, advantageously phosphatidylcholine. elongation steps which are possible result in preferred PUFAs 60 The terms “production or productivity” are known in the art with a higher degree of desaturation, including a further elon and encompasses the concentration of the fermentation prod gation from Co- to C-fatty acids, to fatty acids such as uct (compounds of the formula I) which is formed within a Y-linolenic acid, dihomo-y-linolenic acid, arachidonic acid, specific period of time and in a specific fermentation volume Stearidonic acid, eicosatetraenoic acid or eicosapentaenoic (for example kg of product per hour per liter). It also com acid. Substrates of the desaturases and elongases used in the 65 prises the productivity within a plant cell or a plant, that is to method according to the invention are C-, Cs- or Co-fatty say the content of the desired fatty acids produced in the acids such as, for example, linoleic acid, Y-linolenic acid, method relative to the content of all fatty acids in this cell or US 8,785,727 B2 43 44 plant. The term “production efficiency' comprises the time involved in the degradation of these compounds, it may be required for obtaining a specific production quantity (for possible to increase the yield, production and/or production example the time required by the cell to establish a certain efficiency offatty acid and lipid molecules from organisms, in throughput rate of a fine chemical). The term "yield or prod particular from plants. The fatty acids obtained in the method uct/carbon yield' is known in the art and comprises the effi are Suitable as starting materials for the chemical synthesis of ciency of the conversion of the carbon source into the product further products of interest. For example, they can be used for (i.e. the fine chemical). This is usually expressed for example the preparation of pharmaceuticals, foodstuffs, animal feeds as kg of product per kg of carbon Source. By increasing the or cosmetics, either alone or in combination with one another. yield or production of the compound, the amount of the It can be seen from what has been said above that the molecules obtained of this compound, or of the suitable mol 10 invention also relates to a method for the preparation of an oil, ecules of this compound obtained, in a specific culture quan lipid or fatty acid composition, comprising the steps of the tity over a specified period of time is increased. The terms method according to the invention and the further step of “biosynthesis or biosynthetic pathway' are known in the art formulating the Substance as an oil, lipid or fatty acid com and comprise the synthesis of a compound, preferably an position. organic compound, by a cell from intermediates, for example 15 In a preferred embodiment of this method, the oil, lipid or in a multi-step and strongly regulated method. The terms fatty acid composition is formulated further to give a drug, a “catabolism or catabolic pathway' are known in the art and cosmetic product, a foodstuff, a feedstuff, preferably fish comprise the cleavage of a compound, preferably of an food, or a food Supplement. organic compound, by a cell to give catabolites (in more Finally, the invention relates to the principle of using the general terms, Smaller or less complex molecules), for polynucleotide, the vector, the host cell, the polypeptide or example in a multi-step and strongly regulated method. The the transgenic, nonhuman organism of the present invention term “metabolism' is known in the art and comprises the for the production of an oil, lipid or fatty acid composition. totality of the biochemical reactions which take place in an The latter is then preferably to be employed as drug, cosmetic organism. The metabolism of a certain compound (for product, foodstuff, feedstuff, preferably fish food, or food example the metabolism of a fatty acid) thus comprises the 25 Supplement. totality of the biosynthetic pathways, modification pathways The content of all the references, patent applications, pat and catabolic pathways of this compound in the cell which ents and published patent applications cited in the present relate to this compound. patent application is hereby incorporated by reference to the By employing, in the method according to the invention, respective specific disclosure. the polynucleotides according to the invention and optionally 30 further polynucleotides which code for enzymes of the lipid FIGURES or fatty acid metabolism it is possible to achieve various advantageous effects. Thus, it is possible to influence the FIG. 1: Sequence alignment of the O. tauri A6-desaturase yield, production and/or production efficiency of the polyun (SEQ ID NO: 4) with the sequence from Emiliana huxleyi saturated fatty acids in a plant, preferably in an oil crop plant, 35 (SEQID NO: 2). or in a microorganism. The number or activity of the polypep FIG. 2: Gas-chromatographic analysis of the feeding of tides or polynucleotides according to the invention can be yeasts transformed with pYES2.1/V5-His-TOPO (A) and increased, so that larger amounts of the gene products and, pYES-SEQ1(Eh) (B). The substance fed was the fatty acid ultimately, larger amounts of the compounds of the general 20:348,11,14 (C). The A5-activity is demonstrated by the formula I are produced. A de novo synthesis in an organism, 40 appearance of an additional peak with the identity 20:4A5,8. which, before the gene(s) in question was/were introduced, 11,14 (D). had been lacking the activity and ability to biosynthesize the FIG. 3: Plasmid map of the binary construct LJB1589, compounds, is also possible. The same applies analogously to transformed into Brassica napus, for the EPA synthesis in the combination with further desaturases or elongases or fur seeds. ther enzymes of the fatty acid and lipid metabolism. The use 45 FIG. 4: Synthetic pathways for PUFAs. of a variety of divergent sequences, i.e. sequences which differ at the DNA sequence level, may also be advantageous EXAMPLES in this context, or else the use of gene expression promoters which makes possible a different gene expression as far as Example 1 timing is concerned, for example as a function of the degree of 50 maturity of a seed or oil-storing tissue. General Cloning Methods By introducing, into an organism, a polynucleotide accord ing to the invention alone or in combination with other genes The cloning methods such as, for example, restriction into a cell it is possible not only to increase the biosynthetic cleavages, agarose gel electrophoresis, purification of DNA flow towards the end product, but also to increase, or to create 55 fragments, transfer of nucleic acids to nitrocellulose and de novo, the corresponding triacylglycerol composition. nylon membranes, linkage of DNA fragments, transforma Equally, the number or activity of other genes which are tion of Escherichia coli cells, bacterial cultures and the required for the import of nutrients for the biosynthesis of one sequence analysis of recombinant DNA were carried out as or more fatty acids, oils, polar and/or neutral lipids can be described by Sambrook et al. (1989) (Cold Spring Harbor increased, so that the concentration of these precursors, 60 Laboratory Press: ISBN 0-87969-309-6). cofactors or intermediates within the cells or within the stor age compartment is increased, whereby the ability of the cells Example 2 to produce PUFAs is further enhanced. By optimizing the activity, or increasing the number, of one or more polynucle Sequence Analysis of Recombinant DNA otides or polypeptides according to the invention which are 65 involved in the biosynthesis of these compounds, or by Recombinant DNA molecules were sequenced with an destroying the activity of one or more genes which are ABI laser fluorescence DNA sequencer by the method of US 8,785,727 B2 45 46 Sanger (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA74, One example is the analysis of fatty acids (abbreviations: 5463-5467). Fragments obtained by polymerase chain reac FAME, fatty acid methyl ester: GC-MS, gas liquid chroma tion were sequenced and verified to avoid polymerase errors tography/mass spectrometry; TAG, triacylglycerol, TLC, in constructs to be expressed. thin-layer chromatography). Unambiguous proof for the presence offatty acid products Example 3 can be obtained by analyzing recombinant organisms using standard analytical methods: GC, GC-MS or TLC, as Lipid Extraction from Yeasts and Plants described on several occasions by Christie and the references therein (1997, in: Advances on Lipid Methodology, Fourth The effect of the genetic modification in plants, fungi, 10 Edition: Christie, Oily Press, Dundee, 119-169; 1998, algae, ciliates or on the production of a desired compound Gaschromatographie-Massenspektrometrie-Verfahren Gas (such as a fatty acid) can be determined by growing the chromatography/mass spectrometry methods, Lipide modified microorganisms or the modified plant under Suit 33:343-353). able conditions (such as those described above) and analyzing The material to be analyzed can be disrupted by sonication, 15 grinding in a glass mill, liquid nitrogen and grinding or via the medium and/or the cellular components for the elevated other applicable methods. After disruption, the material must production of the desired product (i.e. of lipids or a fatty acid). be centrifuged. The sediment is resuspended in distilled These analytical techniques are known to the skilled worker water, heated for 10 minutes at 100° C., cooled on ice and and comprise spectroscopy, thin-layer chromatography, vari recentrifuged, followed by extraction for one hour at 90°C. in ous types of staining methods, enzymatic and microbiologi 0.5 M sulfuric acid in methanol with 2% dimethoxypropane, cal methods and analytical chromatography Such as high which leads to hydrolyzed oil and lipid compounds, which performance liquid chromatography (see, for example, give transmethylated lipids. These fatty acid methyl esters are Ullman, Encyclopedia of Industrial Chemistry, Vol. A2, p. extracted in petroleum ether and finally subjected to a GC 89-90 and p. 443-613, VCH: Weinheim (1985); Fallon, A., et analysis using a capillary column (Chrompack, WCOT Fused al., (1987) “Applications of HPLC in Biochemistry’ in: Labo 25 Silica, CP-Wax-52 CB, 25 microM, 0.32 mm) at a tempera ratory Techniques in Biochemistry and Molecular Biology, ture gradient of between 170° C. and 240° C. for 20 minutes Vol.17: Rehmetal. (1993) Biotechnology, Vol. 3, Chapter III: and 5 minutes at 240°C. The identity of the resulting fatty “Product recovery and purification', p. 469-714, VCH: Wein acid methyl esters must be defined using standards which are heim; Belter, P.A., et al. (1988) Bioseparations: downstream available from commercial sources (i.e. Sigma). methoding for Biotechnology, John Wiley and Sons: 30 Kennedy, J. F., and Cabral, J. M. S. (1992) Recovery methods Example 4 for biological Materials, John Wiley and Sons: Shaeiwitz, J. A., and Henry, J. D. (1988) Biochemical Separations, in: Cloning a Desaturase Gene from the Alga Emiliana Ullmann's Encyclopedia of Industrial Chemistry, Vol. B3; huxleyi 35 Chapter 11, p. 1-27, VCH: Weinheim; and Dechow, F. J. A sequence database of Emiliana huxleyi was searched (1989) Separation and purification techniques in biotechnol using the known sequence of the Ostreococcus tauri A6-de ogy, Noyes Publications). saturase (Domergue et al. (2005) Biochem J. 389(Pt 2):483 In addition to the abovementioned methods, plant lipids are 90, SEQ ID NO:3). It was possible to identify a sequence extracted from plant material as described by Cahoon et al. 40 with homology to the amino acid sequence of the Ostreococ (1999) Proc. Natl. Acad. Sci. USA 96 (22): 12935-12940 and cus tauri A6-desaturase (SEQID NO: 4). The sequence was Browse et al. (1986) Analytic Biochemistry 152:141-145. elongated in the 5' and 3' direction by means of RACE-PCR The qualitative and quantitative analysis of lipids or fatty (Clontech, USA) following the manufacturer's instructions acids is described in Christie, William W., Advances in Lipid (SEQID NO: 1), and the coding amino acid sequence (SEQ Methodology, Ayr? Scotland: Oily Press (Oily Press Lipid 45 ID NO: 2) checked with the amino acid sequence of the Library; 2); Christie, William W., Gas Chromatography and Ostreococcus tauri A6-desaturase (SEQ ID NO: 4) in a Lipids. A Practical Guide Ayr, Scotland: Oily Press, 1989, sequence alignment (FIG. 1). According to ClustalW, the Repr. 1992, IX, 307 pp. (Oily Press Lipid Library: 1); sequence alignment gives a sequence identity of 41%. Other “Progress in Lipid Research, Oxford: Pergamon Press, 1 amino acid sequences such as, for example, the Mortierella (1952)-16 (1977) under the title: Progress in the Chemistry of 50 alpina d5-desaturase (WO2000/012720) show 22% identity. Fats and Other Lipids CODEN. To characterize the functions of SEQID NO: 1 and of the In addition to measuring the end product of the fermenta corresponding amino acid sequence, the open reading frame tion, it is also possible to analyze other components of the of the DNA was cloned downstream of the galactose-induc metabolic pathways which are used for the production of the ible GAL1 promoter of pYES2.1/V5-His-TOPO (Invitro desired compound, Such as intermediates and by-products, in 55 gen), giving rise to the plasmid pYES-SEQ1 (Eh). This plas order to determine the overall production efficiency of the mid was then transformed into the yeast strain INVSC-1 compound. The analytical methods comprise measuring the (Invitrogen) following the manufacturers instructions and amount of nutrients in the medium (for example Sugars, selected on plates with DOB-U agar on the basis of uracil hydrocarbons, nitrogen Sources, phosphate and other ions), auxotrophism. Positive colonies were identified by PCR. To measuring the biomass composition and the growth, analyZ 60 this end, in each case 1 ul of defrosted cells, 200 uM dNTPs. ing the production of conventional metabolites of biosyn 2.5 UTaq polymerase and 100 umol of each primer were used thetic pathways and measuring gases which are generated to carry out in a total volume of 50 ul. The PCR conditions are during the fermentation. Standard methods for these mea as follows: first denaturation at 95°C. for 5 minutes, followed surements are described in Applied Microbial Physiology: A by 30 cycles of 30 seconds at 94° C., 1 minute at 55° C. and Practical Approach, P. M. Rhodes and P. F. Stanbury, Ed., IRL 65 2 minutes at 72°C., and a last elongation step for 10 minutes Press, p. 103-129; 131-163 and 165-192 (ISBN: at 72° C. In parallel, the empty vector pYES2.1/V5-His 0199635773) and references cited therein. TOPO was transformed in the abovedescribed manner into US 8,785,727 B2 47 48 competent yeast cells of the strain INVSC-1. Yeast cells with Example 7 the plasmids pYES-SEQ1 (Eh) were incubated for 12 h in liquid DOB-U medium at 28°C., 200 rpm, and then for a Production of Transgenic Plants for the Production further 12 h in induction medium (DOB-U+2% (w/v) galac of Long-Chain Polyunsaturated Fatty Acids tose--2% (w/v) raffinose) and 250 uMoffatty acids added to To produce long-chain polyunsaturated fatty acids in the medium. The specificity and activity of the gene to be plants, various genes of the metabolic pathway are combined characterized can be determined with reference to the added on a binary vector. To produce the fatty acid arachidonic acid fatty acids. (20:4A5,8,11,14), genes as described in table 1 were com Yeasts which have been transformed with the plasmids bined. Analogously, genes as described in Table 2 were com pYES2/V5-His-TOPO or pYES-SEQ1(Eh) were analyzed as 10 bined for the production of the fatty acid eicosapentaenoic follows: acid (20:5A5,8,11,14.17). Analogously, the genes as described in Table 3 were combined for producing the fatty The yeast cells from the main cultures were harvested by acid docosahexaenoic acid (22:6A4,7,10,13,16,19). centrifugation (100xg, 5 min, 20°C.) and washed with 100 mM NaHCO, pH 8.0 to remove residual medium and fatty 15 TABLE 1 acids. Starting with the yeast cell sediments, fatty acid methyl esters (FAMEs) were prepared by acid methanolysis. To this Gene combination for the production of arachidonic acid end, the cell sediments were incubated for one hour at 80°C. Genes Activity SEQ ID NO together with 2 ml of 1 N methanolic sulfuric acid and 2% D6Des(Pir) A6-desaturase 5 (v/v) of dimethoxypropane. The FAMEs were extracted twice D6Elo(Pp) A6-elongase 7 with petroleum ether (PE). To remove nonderivatized fatty D5Des(Eh) A5-desaturase 1 acids, the organic phases were washed in each case once with D12Des(Ps) A 12-desaturase 9 2 ml of 100 mMNaHCO, pH 8.0 and 2 ml of distilled water. Thereafter, the PE phases were dried with NaSO, evapo 25 rated under argon and taken up in 100 ul of PE. The samples TABLE 2 were separated on a DB-23 capillary column (30 m, 0.25 mm. 0.25 um, Agilent) in a Hewlett-Packard 6850 gas chromato Gene combination for the production of eicosapentaenoic acid graph equipped with flame ionization detector. The condi Genes Activity SEQ ID NO tions for the GLC analysis were as follows: the oven tempera 30 D6Des(Pir) A6-desaturase 5 ture was programmed from 50° C. to 250° C. with an D6Elo(Pp) A6-elongase 7 increment of 5°C/min and finally 10 min at 250° C. (hold D5Des(Eh) A5-desaturase 1 ing). ()3-Des(Pi) omega 3-desaturase 11 The signals are identified by comparing the retention times D12Des(Ps) A 12-desaturase 9 with corresponding fatty acid standards (Sigma). The meth 35 D15Des(Perf) A15-desaturase 13 odology is described for example in Napier and Michaelson, 2001, Lipids. 36(8):761-766: Sayanova et al., 2001, Journal of Experimental Botany. 52(360): 1581-1585, Sperling et al., TABLE 3 2001, Arch. Biochem. Biophys. 388(2):293–298 and 40 Gene combination for the production of docosahexaenoic acid Michaelson et al., 1998, FEBS Letters. 439(3):215-218. Activity and Substrate Determination of the Desaturases Genes Activity SEQ ID NO Identified D6Des(Pir) A6-desaturase 5 D6Elo(Pp) A6-elongase 7 The substrate specificity of SEQID NO: 1 was determined D5Des(Eh) A5-desaturase 1 after expression and feeding of various fatty acids. Surpris 45 ()3-Des(Pi) omega 3-desaturase 11 D12Des(Ps) A 12-desaturase 9 ingly, only 20:3A8,11,14 and 20:4A8,11,14.17 of the fed sub D15Des(Perf) A15-desaturase 13 strates were converted. Thus, the coding sequence SEQ ID D5Elo(Ot) A5-elongase 15 NO: 1 has 45-desaturase activity and is hereinbelow referred D4Des(Tc) A4-desaturase 17 to as d5Des(Eh). The specific conversion of the fatty acids fed 50 is shown in FIG. 2. After 48 h, 65-70% of the fed fatty acid is Further transformation vectors based on pSUN-USP were converted into the product, the conversion rate being calcu generated for the transformation of plants. To this end, NotI lated using the following formula: cleavage sites were introduced at the 5' and at the 3' end of the coding sequence, using the following primer pairs (see Table Conversion rate in %=product quantity substrate 55 7). quantity-product quantity*100 Composition of the PCR Mix (50 ul): 5.00 ul template cDNA The percentage of the converted fatty acid in the total fatty 5.00 ul 10x buffer (Advantage polymerase)+25 mM MgCl acids is 7-8%. The converted fatty acid is distributed to in 5.00 ul 2 mM dNTP each case 9% to the lipids phosphatidylethanolamine, phos 60 1.25 ul of each primer (10 umol/LL) phatidylinositol and phosphatidylserine. The lipid phosphati 0.50 ul Advantage polymerase dylcholin only accounts for 2%. The remaining fatty acids are The Advantage polymerase from Clontech is employed. found in the neutral lipids. The fact that only little of the PCR Reaction Conditions: product of the d5Des(Eh) is accumulated in phosphatidylcho Annealing temperature: 1 min 55° C. line, in combination with the distribution to a multiplicity of 65 Denaturation temperature: 1 min 94°C. further lipid classes, shows the coenzyme A specificity of Elongation temperature: 2 min 72°C. d5Des(Eh). Number of cycles: 35 US 8,785,727 B2 49 50 TABLE F Primer sequences (for cloning transformation vectors based on pSUN-USP) SEQ ID Gene Primer NO

D6-Des (Pir) Fwd: goggcc.gc.gc.catggtggacct caa.gc.ctgg 18 RVS : gcggcc.gttacatcgctgggaacticgg 19

D5-Des (Eh) Fwd: goggcc.gc.gc.catgtcattggctgctaaagatg 2O Rvs: goggcc.gt caatgacct gtaactictaac 21

O3-Des (Pi) Fwd: goggcc.gc.gc.catgg.cgacgaaggaggcgta 22 RVS : gcggcc.gc.gttacgtggacttggtcttggcc 23

D6-Elo (Pp) Fwd: goggcc.gc.gc.catggaggit cqtggagagattic 24 Rvs: goggcc.gc.gt cact cagttittagct coc 25

D12Des (PS) Fwd: goggcc.gc.catgg.cgatcc tigaacccggag 26 RVS : gcggcc.gcttagagcttgttcttgtagaag 27

D15Des Fwd: goggcc.gc.catgg.ccgtttct tccggtgc 28 (Perf) RVS : gcggcc.gc.ctaaatctttittggaaggaaag 29

D5Elo (Ot) FWC: gcggcc.gc.gc.catgagcgc.ct Coggtgcgctg 3O Rvs: goggcc.gcgittagt caatttitt c 31

D4Des (Tc) FWC: gcggcc.gc.gc.catgacggit cqgctacgacgag 32 RVS : gcggcc.gc.gt caggcagcgc.gctgcCagg 33

The PCR products were incubated with the restriction to the plasmid named pSUN-USP, which can be employed for enzyme NotI for 4 h at 37° C. The plant expression vector transforming plants by means of Agrobacterium tumefaciens. pSUN300-USP is incubated in the same manner. Thereafter, 30 a) Generation of transgenic oilseed rape plants (modified the PCR products and the 7624 bp vector are separated by method of Moloney et al., 1992, Plant Cell Reports, 8:238 agarose gel electrophoresis, and the corresponding DNA 242) fragments are excised. The DNA is purified by means of the To generate transgenic oilseed rape plants, binary vectors Qiagen gel purification kit, following the manufacturers 35 such as the pSUN plasmids described hereinabove or, by way instructions. Thereafter, vector and PCR products are ligated. of example, the derivative LJB1589 (SEQID No. 34, plasmid The Rapid Ligation kit from Roche is used for this purpose. map in FIG. 3) with the relevant gene combinations were The plasmids generated are verified by sequencing. transformed into Agrobacterium tumefaciens C58C1: pSUN300 is a derivative of the plasmid pPZP (Hajduk SHAO01 (Deblaere et al., 1984, Nucl. Acids. Res. 13, 4777 iewicz, P, Svab, Z. Maliga, P., (1994) The small versatile 40 4788). A 1:50 dilution of an overnight culture of a positively pPZP family of Agrobacterium binary vectors for plant trans transformed agrobacterial colony in Murashige-Skoog formation. Plant Mol Biol 25:989-994). pSUN-USP origi medium (Murashige and Skoog 1962 Physiol. Plant. 15, 473) nated from pSUN300, by inserting a USP promoter into supplemented with 3% sucrose (3MS medium) was used for pSUN300 in the form of an EcoRI fragment. The polyadeny transforming oilseed rape plants (cv. Kumily, Swalof Weibul, lation signal is the OCS gene from the A. tumefaciens Ti 45 Sweden). Petioles or hypocotyls of freshly germinated sterile plasmid (ocsTerminator, Genbank Accession VO0088) (De oilseed rape plants (in each case approx. 1 cm) were incu Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Mon bated with a 1:50 agrobacterial dilution for 5-10 minutes in a tagu, M. and Schell, J. Nucleotide sequence and transcript Petridish. This was followed by 3 days of coincubation in the map of the Agrobacterium tumefaciens Tiplasmid-encoded dark at 25° C. on 3MS medium supplemented with 0.8% octopine synthase gene J. Mol. Appl. Genet. 1 (6), 499-511 50 Bacto agar. After 3 days, the cultivation was continued with (1982). The USP promoter corresponds to nucleotides 1 to 16 hours light/8 hours dark and was continued, in a 1-week 684 (Genbank Accession X56240), where part of the noncod rhythm, on MS medium supplemented with 500 mg/l Clafo ing region of the USP gene is present in the promoter. The ran (cefotaxim-sodium), 50 mg/l Kanamycin, 20 microM promoter fragment which is 684 base pairs in size was ampli benzylaminopurine (BAP) and 1.6 g/l glucose. Growing fied by a PCR reaction using standard methods with the aid of 55 shoots were transferred to MS medium supplemented with a synthesized primer and by means of a commercially avail 2% sucrose, 250 mg/l Claforan and 0.8% Bacto agar. If no able T7 standard primer (Stratagene). roots had formed after three weeks, the growth hormone 2-indolebutyric acid was added to the medium to promote (Primer Sequence: rooting. 60 Regenerated shoots were obtained on 2MS medium (Primer sequence: Supplemented with kanamycin and Claforan, transferred into SEQ ID NO. 82 soil once rooted, and after cultivation for two weeks grown in 5 - GTCGACCCGCGGACTAGTGGGCCCTCTAGACCCGGGGGATCC a controlled-environment cabinet or in a greenhouse, flower GGATCTGCTGGCTATGAA-3'). ing was induced, mature seeds were harvested and analyzed 65 for expression of the desaturase or elongase genes by means The PCR fragment was recut with EcoRI/SalI and inserted of lipid analyses as described by way of example in Qiu et al. into the vectorpSUN300 with OCS terminator. This gave rise 2001, J. Biol. Chem. 276, 31561-31566. US 8,785,727 B2 51 52 b) Generation of Transgenic Linseed Plants 35(6):456-465 by means of particle bombardment. Agrobac terial-mediated transformations can be effected for example Transgenic linseed plants can be generated for example by as described by Mlynarova et al. (1994), Plant Cell Report 13: the method of Bellet al., 1999, InVitro Cell. Dev. Biol.-Plant. 282-285.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 35

<21 Os SEQ ID NO 1 &211s LENGTH: 1368 &212s. TYPE: DNA <213> ORGANISM: Emiliana huxleyi <4 OOs SEQUENCE: 1 atgtcattgg ctgctaaaga tigcagcct cq goccact cat cogt cittgga cc ctaagtat 60 cacggagcta caaataagtic aagaactgat gcagcagacc ttacagttag ttctat coac 12O actitcta agg agatgat cat aaggggit cqt gtgt atgatgtc.tctgattt tattaaaagg 18O

cacccgggag galagcattat taaactic toc ttaggttctg atgcaacaga cqcttataac 24 O

aact tccata ttaggtotaa aaaag.cggat aaaatgttga gagctittgcc aagtaggc.ca 3 OO gtagcggatggatticgctag agacgctttgtctgcagact tcgaggcc.ct gaga.gc.ccala 360

Ctcgaggc.cg aaggttactt Caaccgaat ctgtggcatg tagctt atcg agttgcggaa 42O gtcgttgct a tigtactgggc ggg tattaga Cttatctggg C9ggittattg gtttittagga 48O

gcc attgtag caggaat agc tic aggggaga tigcggttggc titcagcatga gggtggtcat 54 O

tatt cqctica caggtaatat taaacttgat coacacatgc aaatgattat citatggatta 6 OO

ggttgcggala titc.cggttgtt attggaga aaccalacata acaa.gcacca togacaccg 660 caaaagttgg gtgcagatcc agacicttcaa acaatgcct C togttgcgtt CCatggactic 72O

atcggtgcta aggct agggg agcaggaaag togtggctag catggcaa.gc. tccacttitt C 78O

tttggaggcg titat cacaac cctdgitatct tittggttggc agttcgtcca acatccaaag 84 O

cacgcattga gagtaggaaa ccaactic gaa ttaggctata toggctttacg atatgctitta 9 OO

tgg tatgcag catt.cggtca tottgggctt ggtggtgctt to agattgta CdCtttitt at 96.O gtggcagtcg gaggtacat a tat ctitcacg aactittgcgg ttct cacac acatalaggat 102O

gttgttccac acgataag.ca tatttcttgg accttgtatt citgcaaacca taccactaat 108O

caatctaa.ca cacct ctagt caattggtgg atggcctatic tdaattitt.ca aattgaacat 114 O

cacct titt.cc ctago atgcc acaatataac catcctaaaa totgcggaag agtgaaacaa 12 OO ttgtttgaaa aa catggcgt agagtacgat gt cagaactt acgcgaagtic aatgcgtgat 1260

acatacgtga at citc.ttggc tigtgggaaat gcatctoatt coctitcatca gagaaacgag 132O ggattaacga ct agggagtic ticggctgtt agagttacag gt cattga 1368

<21 Os SEQ ID NO 2 &211s LENGTH: 45.5 212s. TYPE: PRT <213> ORGANISM: Emiliana huxleyi <4 OOs SEQUENCE: 2 Met Ser Lieu Ala Ala Lys Asp Ala Ala Ser Ala His Ser Ser Val Lieu. 1. 5 1O 15 Asp Pro Llys Tyr His Gly Ala Thr Asn Llys Ser Arg Thir Asp Ala Ala 2O 25 3 O

Asp Lieu. Thr Val Ser Ser Ile Asp Thir Ser Lys Glu Met Ile Ile Arg 35 4 O 45 US 8,785,727 B2 53 54 - Continued

Gly Arg Wall Tyr Asp Wall Ser Asp Phe Ile Lys Arg His Pro Gly Gly SO 55 6 O

Ser Ile Ile Lell Ser Lell Gly Ser Asp Ala Thir Asp Ala Tyr Asn 65 70

Asn Phe His Ile Arg Ser Ala Asp Met Lell Arg Ala Luell 85 90 95

Pro Ser Arg Pro Wall Ala Asp Gly Phe Ala Arg Asp Ala Luell Ser Ala 105 11 O

Asp Phe Glu Ala Lell Arg Ala Glin Luell Glu Ala Glu Gly Tyr Phe Glu 115 12 O 125

Pro Asn Luell Trp His Wall Ala Arg Wall Ala Glu Wall Wall Ala Met 13 O 135 14 O

Tyr Trp Ala Gly Ile Arg Lell Ile Trp Ala Gly Tyr Trp Phe Luell Gly 145 150 155 160

Ala Ile Wall Ala Gly Ile Ala Glin Gly Arg Gly Trp Luell Glin His 1.65 17O 17s

Glu Gly Gly His Tyr Ser Lell Thir Gly Asn Ile Lell Asp Arg His 18O 185 19 O

Met Glin Met Ile Ile Gly Luell Gly Gly Met Ser Gly Tyr 195

Trp Arg Asn Glin His Asn Lys His His Ala Thir Pro Glin Luell Gly 21 O 215 22O

Ala Asp Pro Asp Lell Glin Thir Met Pro Luell Wall Ala Phe His Gly Luell 225 23 O 235 24 O

Ile Gly Ala Ala Arg Gly Ala Gly Lys Ser Trp Lieu Ala Trp Gln 245 250 255

Ala Pro Luell Phe Phe Gly Gly Wall Ile Thir Thir Lell Wall Ser Phe Gly 26 O 265 27 O

Trp Glin Phe Wall Glin His Pro Lys His Ala Luell Arg Wall Gly Asn Glin 27s 285

Lell Glu Luell Gly Tyr Met Ala Luell Arg Tyr Ala Lell Trp Ala Ala 29 O 295 3 OO

Phe Gly His Luell Gly Lell Gly Gly Ala Phe Arg Lell Tyr Ala Phe Tyr 3. OS 310 315

Wall Ala Wall Gly Gly Thir Ile Phe Thir ASn Phe Ala Wall Ser His 3.25 330 335

Thir His Asp Wall Wall Pro His Asp Lys His Ile Ser Trp Thir Luell 34 O 345 35. O

Ser Ala Asn His Thir Thir Asn Glin Ser ASn Thir Pro Luell Wall Asn 355 360 365

Trp Trp Met Ala Tyr Lell Asn Phe Glin Ile Glu His His Luell Phe Pro 37 O 375

Ser Met Pro Glin Tyr Asn His Pro Ile Cys Gly Arg Wall Glin 385 390 395 4 OO

Lell Phe Glu His Gly Wall Glu Tyr Asp Wall Arg Thir Ala Lys 4 OS 41O 415

Ser Met Arg Asp Thir Wall Asn Luell Luell Ala Wall Gly Asn Ala Ser 42O 425 43 O

His Ser Luell His Glin Arg Asn Glu Gly Luell Thir Thir Arg Glu Ser Ala 435 44 O 445

Ala Wall Arg Wall Thir Gly His 450 45.5

US 8,785,727 B2 57 58 - Continued

Ala Luell Ala Ala Lell Pro Ser Arg Pro Ala Lys Thir Ala Lys Wall 105 11 O

Asp Asp Ala Glu Met Lell Glin Asp Phe Ala Lys Trp Arg Lys Glu Luell 115 12 O 125

Glu Arg Asp Gly Phe Phe Lys Pro Ser Pro Ala His Wall Ala 13 O 135 14 O

Phe Ala Glu Luell Ala Ala Met Ala Luell Gly Thir Luell Met Tyr 145 150 155 160

Ala Arg Wall Wall Ser Ser Wall Luell Wall Tyr Ala Phe Phe Gly 1.65 17O 17s

Ala Arg Gly Trp Wall Glin His Glu Gly Gly His Ser Ser Luell Thir 18O 185 19 O

Gly Asn Ile Trp Trp Asp Arg Ile Glin Ala Phe Thir Ala Gly Phe 195

Gly Luell Ala Gly Ser Gly Asp Met Trp Asn Ser Met His Asn His 21 O 215

His Ala Thir Pro Glin Lys Wall Arg His Asp Met Asp Lell Asp Thir Thir 225 23 O 235 24 O

Pro Ala Wall Ala Phe Phe Asn Thir Ala Wall Glu Asp Asn Arg Pro Arg 245 250 255

Gly Phe Ser Lys Tyr Trp Lell Arg Luell Glin Ala Trp Thir Phe Ile Pro 26 O 265 27 O

Wall Thir Ser Gly Lell Wall Lell Luell Phe Trp Met Phe Phe Luell His Pro 27s 28O 285

Ser Lys Ala Lieu Lys Gly Gly Lys Glu Glu Lieu Wall Trp Met Lieu 29 O 295 3 OO

Ala Ala His Wall Ile Arg Thir Trp Thir Ile Lys Ala Wall Thir Gly Phe 3. OS 310 315

Thir Ala Met Glin Ser Gly Luell Phe Luell Ala Thir Ser Trp Wall Ser 3.25 330 335

Gly Luell Phe Ala His Phe Ser Thir Ser His Thir His Luell Asp 34 O 345 35. O

Wall Wall Pro Ala Asp Glu His Luell Ser Trp Wall Arg Tyr Ala Wall Asp 355 360 365

His Thir Ile Asp Ile Asp Pro Ser Glin Gly Trp Wall Asn Trp Luell Met 37 O 375

Gly Luell Asn Glin Wall Ile His His Luell Phe Pro Ser Met Pro 385 390 395 4 OO

Glin Phe Arg Glin Pro Glu Wall Ser Arg Arg Phe Wall Ala Phe Ala Lys 4 OS 415

Trp Asn Luell Asn Wall Met Thir Tyr Ala Gly Ala Trp 425 43 O

Ala Thir Luell Gly Asn Lell Asp Asn Wall Gly Lys His Tyr Wall His 435 44 O 445

Gly Glin His Ser Gly Thir Ala 450 45.5

SEO ID NO 5 LENGTH: 1380 TYPE: DNA ORGANISM: Pythium irregulare

< 4 OOs SEQUENCE: 5 atggtggacc tcaa.gc.ctgg agtgaagcgc ctggtgagct ggaaggagat ccdc.gagcac

US 8,785,727 B2 61 62 - Continued

Lell Ser Met Ala Ile Cys Phe Phe Phe Asn. Ser Phe Ala Met Tyr Met 145 150 155 160

Wall Ala Gly Val Ile Met Gly Lieu Phe Tyr Glin Glin Ser Gly Trp Lieu. 1.65 17O 17s

Ala His Asp Phe Lieu. His ASn Glin Val Cys Glu Asn Arg Thir Lieu. Gly 18O 185 19 O

Asn Luell Ile Gly Cys Lieu Val Gly Asn Ala Trp Glin Gly Phe Ser Met 195

Glin Trp Trp Lys Asn Llys His Asn Lieu. His His Ala Wall Pro Asn Luell 21 O 215

His Ser Ala Lys Asp Glu Gly Phe Ile Gly Asp Pro Asp Ile Asp Thr 225 23 O 235 24 O

Met Pro Lel Lieu Ala Trp Ser Lys Glu Met Ala Arg Ala Phe Glu 245 250 255

Ser Ala His Gly Pro Phe Phe Ile Arg Asn Glin Ala Phe Luell Tyr Phe 26 O 265 27 O

Pro Luell Lel Lieu. Lieu Ala Arg Lieu Ser Trp Lieu. Ala Glin Ser Phe Phe 285

Wall Phe Thr Glu Phe Ser Phe Gly Ile Phe Asp Wall Glu Phe 29 O 295 3 OO

Asp Gly Pro Glu Lys Ala Gly Lieu. Ile Wal His Trp Gln Lieu. 3. OS 310 315 32O

Ala Ile Tyr Phe Cys Asn Met Ser Lieu. Phe Glu Wall Ala Tyr 3.25 330 335

Phe Lieu Met Gly Glin Ala Ser Cys Gly Lieu Lieu Lieu Luell Wall Phe 34 O 345 35. O

Ser Ile Gly His Asn Gly Met Ser Val Tyr Glu Arg Thir Llys Pro 355 360

Asp Phe Trp Gln Leul Glin Wall. Thir Thir Thr Arg Asn Arg Ala Ser 37 O 375

Wall Phe Met Asp Trp Phe Thr Gly Gly Lieu. Asn Tyr Ile Asp His 385 390 395 4 OO

His Luell Phe Pro Leu Val Pro Arg His Asn Lieu. Pro Wall Asn. Wall 4 OS 41O 415

Lell Ile Ser Lieu. Cys Lys Glu Phe Asp Ile Pro Phe His Glu Thir 425 43 O

Gly Phe Trp Glu Gly Ile Tyr Glu Val Val Asp His Lell Ala Asp Ile 435 44 O 445

Ser Lys Glu Phe Ile Thr Glu Phe Pro Ala Met 450 45.5

SEO ID NO 7 LENGTH: 873 TYPE: DNA ORGANISM: Physcomitrella patens

< 4 OOs SEQUENCE: 7 atggaggit cq tagagatt Ctacggtgag ttggatggga aggtotcgca ggg.cgtgaat 6 O gcattgctgg gtagttittgg ggtggagttg acggatacgc CCaCtaccala aggcttgcc C 12 O citcgttgaca gtc.ccacacc catcgt.cctic ggtgtttctg tat acttgac tattgtcatt 18O ggagggctitt tgtggataaa ggcCagggat Ctgaaaccgc gcgc.ctcgga gcc atttittg 24 O citccaa.gctt tggtgcttgt gcaca acctg ttctgttittg cgcticagtict gtatatgtgc 3OO gtgggcatcg cittatcaggc tattacctgg cgg tact citc tctggggcaa. tgcatacaat 360 US 8,785,727 B2 63 64 - Continued

CCtaala Cata aagagatggc gattctggta tacttgttct acatgtctaa gtacgtggaa tt catggata ccgittat cat gat actgaag cgcagcacca ggcaaataag ct tcc to cac gttitat catc att Cttcaat t to cott catt tggtgggcta ttgct catca cgctic ctggc 54 O ggtgaagcat attggtctgc ggctctgaac t caggagtgc atgttct cat gtatgcgitat tact tc.ttgg ctgcctgc ct tcgaagtagc c caaagttaa aaaataagta c ctitttittgg 660 ggcagg tact tgacacaatt c caaatgttc cagtt tatgc tgaact tagt gCaggcttac 72 O tacgacatga aaacgaatgc gcc at atcca Caatggctga t caagattitt gttctactac atgat citcgt. tgctgtttct titt cqgcaat ttttacgitac aaaaataCat caaac Cotct 84 O gacggaaagc aaaagggagc taaaactgag tga 873

<210s, SEQ I D NO 8 &211s LENGT H: 290 212. TYPE : PRT &213s ORGAN ISM: Physcomitrella patens

<4 OOs, SEQUENCE: 8 Met Glu Wall Val Glu Arg Phe Tyr Gly Glu Lieu. Asp Gly Wall Ser 1. 1O 15

Gln Gly Val Asn Ala Lieu. Lieu. Gly Ser Phe Gly Wall Glu Luell Thir Asp 25

Thir Pro Thr Thr Lys Gly Lieu Pro Lieu Val Asp Ser Pro Thir Pro Ile 35 4 O 45

Val Lieu. Gly Val Ser Val Tyr Lieu Thir Ilie Wall Ile Gly Gly Lieu. Luell SO 55 6 O

Trp Ile Llys Ala Arg Asp Lieu Lys Pro Arg Ala Ser Glu Pro Phe Lieu. 65 70 7s 8O

Lieu. Glin Ala Lieu Val Lieu Val His Asn Lieu. Phe Phe Ala Luell Ser 85 90 95

Lieu. Tyr Met Cys Val Gly Ile Ala Tyr Glin Ala Ile Thir Trp Arg Tyr 105 11 O

Ser Lieu. Trp Gly Asn Ala Tyr Asn Pro Llys His Glu Met Ala Ile 115 12 O 125

Lieu Val Tyr Leu Phe Tyr Met Ser Lys Tyr Val Glu Phe Met Asp Thr 13 O 135 14 O

Wall Ile Met Ile Lieu Lys Arg Ser Thr Arg Glin Ile Ser Phe Lieu. His 145 150 155 160

Val Tyr His His Ser Ser Ile Ser Lieu. Ile Trp Trp Ala Ile Ala His 1.65 17O 17s

His Ala Pro Gly Gly Glu Ala Tyr Trp Ser Ala Ala Lell Asn Ser Gly 18O 185 19 O

Wal His Wall Leu Met Tyr Ala Tyr Tyr Phe Leu Ala Ala Lieu. Arg 195

Ser Ser Pro Llys Lieu Lys Asn Lys Tyr Lieu Phe Trp Gly Arg Tyr Lieu. 21 O

Thir Glin Phe Gln Met Phe Glin Phe Met Luell Asn Lell Wall Glin Ala Tyr 225 23 O 235 24 O

Tyr Asp Met Llys Thr Asn Ala Pro Tyr Pro Gln Trp Lell Ile Lys Ile 245 250 255

Lieu. Phe Tyr Tyr Met Ile Ser Leu Lieu. Phe Lieu Phe Gly Asn Phe Tyr 26 O 265 27 O

Val Glin Lys Tyr Ile Llys Pro Ser Asp Gly Lys Glin Gly Ala Lys

US 8,785,727 B2 67 68 - Continued

Wall Luell Trp Pro Val Tyr Trp Phe Phe Glin Gly Ser Tyr Lieu. Thir 105 11 O

Gly Wall Trp Wall Ile Ala His Glu Cys Gly His Glin Ala Tyr Cys Ser 115 12 O 125

Ser Glu Wall Wall Asn. Asn Lieu. Ile Gly Lieu Val Lell His Ser Ala Lieu 13 O 135 14 O

Lell Wall Pro Tyr His Ser Trp Arg Ile Ser His Arg His His Ser 145 150 155 160

Asn Thir Gly Ser Cys Glu Asn Asp Glu Wall Phe Wall Pro Wall Thr Arg 1.65 17O 17s

Ser Wall Luell Ala Ser Ser Trp Asn Glu Thir Lieu. Glu Asp Ser Pro Leu 18O 185 19 O

Glin Luell Tyr Arg Ile Val Tyr Met Lieu. Wall Wall Gly Trp Met Pro 195

Gly Tyr Luell Phe Phe Asn Ala Thr Gly Pro Thr Lys Trp Gly Lys 21 O 215 22O

Ser Arg Ser His Phe Asn Pro Tyr Ser Ala Ile Ala Asp Arg Glu 225 23 O 235 24 O

Arg Trp Met Ile Val Lieu. Ser Asp Ile Phe Lieu. Wall Ala Met Lieu Ala 245 250 255

Wall Luell Ala Ala Lieu. Wal His Thr Phe Ser Phe Asn Thir Met Val Lys 26 O 265 27 O

Phe Wall Val Pro Tyr Phe Ile Wall Asn Ala Lell Wall Lieu. Ile 28O 285

Thr Tyr Lieu Gln His Thr Asp Thr Tyr Ile Pro His Phe Arg Glu Gly 29 O 295 3 OO

Glu Trp Asn Trp Lieu. Arg Gly Ala Lieu. Cys Thr Wall Asp Arg Ser Phe 3. OS 310 315 32O

Gly Pro Phe Lieu. Asp Ser Val Val His Arg Ile Wall Asp Thir His Wall 3.25 330 335

His His Ile Phe Ser Lys Met Pro Phe Tyr His Glu Glu Ala 34 O 345 35. O

Thir Asn Ala Ile Llys Pro Lieu. Lieu. Gly Llys Phe Lell Asp Thr 355 360 365

Thir Pro Wall Pro Val Ala Lieu. Trip Arg Ser Tyr Thir His Llys Phe 37 O 375 38O

Wall Glu Asp Asp Gly Llys Val Val Phe Tyr Lys Asn Luell 385 390 395

SEQ ID NO 11 LENGTH: 1086 TYPE: DNA ORGANISM: Phytophtora infe Stans

< 4 OOs SEQUENCE: 11 atgg.cgacga aggagg.cgta tgttgttcc cc actictgacgg agatcaa.gc.g gtc.gctacct 6 O aaag actgtt tcgaggct tc ggtgcctctg tcqct ctact acaccgtgcg ttgtctggtg 12 O atcgcggtgg c totalacct it cggtc.tcaac tacgctcgcg citctgc.ccga ggtC9agagc 18O ttctgggctic tggacgc.cgc actctgcacg ggcta catct tgctgcaggg catcgtgttc 24 O tggggcttct tCacggtggg ccacgatgcc ggcCacggcg c ctitct cqcg ctaccacctg 3OO citta actt.cg tggtgggcac titt catgcac tcqct catcc t cacgcc citt cgagt C9tgg 360 aagct cacgc acct cacca ccacaagaac acgggcaa.ca ttgaccgtga cgaggtott C US 8,785,727 B2 69 - Continued taccc.gcaac gcaaggc.cga caccaccc.g acctgattct ggcgct cqgg gCag.cgtggc tcgcct attt ggtcgagggc ttocotcc to gta aggt caa CCaCttcaac 54 O cc.gttcgagc Ctctgttcgt gcgtcaggtg t cagctgtgg taatct ct ct t ct cqcc cac ttctitcgtgg ccggactict c catct atctg agcct coagc tgggc Cttaa gacgatggca 660 at Ctactact atggacctgt ttttgttgttc ggcagcatgc tggtcattac Cacct tccta 72 O caccacaatg atgaggagaC cc catggtac agtggacgta cgt caagggc aacct citcgt. cc.gtggaccg atcgtacggc gcgct cattg acaac Ctgag CCaCaaCat C 84 O ggcacgcacc agatccacca ccttitt coct at catt.ccgc act acaaact Caagaaagcc 9 OO actg.cggc ct tccaccaggc titt coctdag Ctcgtgcgca agagcgacga gccaattatc 96.O aaggctitt ct tcc.gggttgg acgt.ctictac gcaaact acg gcgttgttgga cCaggaggcg aagct citt.ca cgctaaagga agc.ca aggcg gcgaccgagg cggcggccala gaccalagtoc 108 O acgtaa 1086

SEQ ID NO 12 LENGTH: 361 TYPE : PRT ORGANISM: Phytophtora infestans

< 4 OOs SEQUENCE: 12

Met Ala Thr Lys Glu Ala Tyr Val Phe Pro Thir Lell Thir Glu Ile Llys 1. 5 15

Arg Ser Luell Pro Llys Asp Cys Phe Glu Ala Ser Wall Pro Luell Ser Luell 2O 25 30

Tyr Thir Val Arg Cys Lieu Val Ile Ala Wall Ala Lell Thir Phe Gly 35 4 O 45

Lell Asn Ala Arg Ala Lieu Pro Glu Wall Glu Ser Phe Trp Ala Lieu SO 55 6 O

Asp Ala Ala Lieu. Cys Thr Gly Tyr Ile Luell Luell Glin Gly Ile Wall Phe 65 70 8O

Trp Gly Phe Phe Thir Val Gly His Asp Ala Gly His Gly Ala Phe Ser 85 90 95

Arg His Lieu. Luell Asn. Phe Wall Wall Gly Thir Phe Met His Ser Luell 1OO 105 11 O

Ile Luell Thir Pro Phe Glu Ser Trp Luell Thir His Arg His His His 115 12 O 125

Asn Thir Gly Asn Ile Asp Arg Asp Glu Wall Phe Pro Glin Arg 13 O 135 14 O

Lys Ala Asp Asp His Pro Leu Ser Arg Asn Luell Ile Lell Ala Lieu. Gly 145 150 155 160

Ala Ala Trp Lieu Ala Tyr Lieu Val Glu Gly Phe Pro Pro Arg Llys Val 1.65 17O 17s

Asn His Phe Asn. Pro Phe Glu Pro Luell Phe Wall Arg Glin Wall Ser Ala 18O 185 19 O

Wall Wall Ile Ser Luell Lieu Ala His Phe Phe Wall Ala Gly Luell Ser Ile 195 2OO

Luell Ser Lieu. Glin Lieu. Gly Lieu. Thir Met Ala Ile 21 O 215

Gly Pro Wall Phe Wall Phe Gly Ser Met Luell Wall Ile Thir Thir Phe Lieu. 225 23 O 235 24 O

His His Asn Asp Glu Glu Thir Pro Trp Tyr Ala Asp Ser Glu Trp Thr 245 250 255 US 8,785,727 B2 71 72 - Continued

Wall Gly Asn Lieu. Ser Ser Val Asp Arg Ser Tyr Gly Ala Lieu 26 O 265 27 O

Ile Asp Asn Lieu. Ser His Asn. Ile Gly Thr His Glin Ile His His Lieu. 27s 285

Phe Pro Ile Ile Pro His Tyr Lys Lieu Lys Llys Ala Thr Ala Ala Phe 29 O 295 3 OO

His Glin Ala Phe Pro Glu Lieu. Wall Arg Llys Ser Asp Glu Pro Ile Ile 3. OS 310 315

Ala Phe Phe Arg Val Gly Arg Lieu. Tyr Ala Asn Tyr Gly Wall Wall 3.25 330 335

Asp Glin Glu Ala Lys Lieu. Phe Thr Lieu Lys Glu Ala Lys Ala Ala Thr 34 O 345 35. O

Glu Ala Ala Ala Lys Thr Lys Ser Thir 355 360

SEQ ID NO 13 LENGTH: 1176 TYPE: DNA ORGANISM: Perilla fruticos a.

< 4 OOs SEQUENCE: 13 atggctgttt Cttctggagc taggctitt ct aagtctggag Ctgatggaga agtttitcgat 6 O ggacagcaac agtacgaggg aattggaaag agagctgctg ataagtttga tcc tigctgct 12 O cotcct cott t caagat.cgc tgatat cagg gctgctatt c ctgct cattg Ctgggittaag 18O alaccCttgga ggagtCtttc ttacgttgttg tgggatgttg ctgctgttitt cgctictt Ctt 24 O

tgtacattaa Ctcttgggct ttctggcctg titt actggat tgcticaggga 3OO actatogttct gggcticttitt cgttcttgga cacgattgttg gacacggat C titt citctgat 360 alacact actic ttaacaacgt. tgtgggacac gttctt cact citt citat cott tgtgccttac cacggatgga gaatct ct ca taggacticac catcagaacc atggacacgt. tgagaaggat gagt Cttggg t to cact tcc. tgaga accitt tacaagaagc ttgatttctic tactaagttc 54 O cittagg taca agatcc ctitt c cc tatgttc gcttaccctic tttacctittg gtacagatct

Cctggaaaga ctggat.ctica Ctt CaacCCt tactctgatc ttittcaa.gc.c taacgagagg 660 ggactitat cq tgacttctac tatgtgttgg gctgctatgg gagtgtttct totttacgct 72 O tctact at cq tgggtc.ctaa catgatgttc aagctttacg gagtgcCtta cott attt to gtgatgttggc ttgatact.gt gacttacctt caccaccacg gatacgataa gaagct tcct 84 O tggtacaggt Calaaggagtg gtc.ttacctt agaggaggac ttact actgt ggat Caggat 9 OO tacggatt ct t caacaagat ccaccacgat attggaactic acgtgat coa t cacottt to 96.O cct cagattic Ctcactacca CCttgttgag gct actagag aggctaagag ggtgttggga alactactaCC gtgagcctag aaagttctgga cctgtgcctic tt cat cit tatt ccctgct citt 108 O ttgaagttctic ttggalaggga t cactacgtg tctgataacg gagatat ct gtactaccag 114 O actgatgatg agcttitt.ccc ttctaagaag atctga 1176

<210s, SEQ ID NO 14 &211s LENGTH: 391 212. TYPE : PRT <213> ORGANISM: Perilla fruticosa

<4 OOs, SEQUENCE: 14 Met Ala Val Ser Ser Gly Ala Arg Lieu. Ser Lys Ser Gly Ala Asp Gly US 8,785,727 B2 73 74 - Continued

15

Glu Wall Phe Asp Gly Glin Glin Glin Tyr Glu Gly Ile Gly Lys Arg Ala 2O 25

Ala Asp Lys Phe Asp Pro Ala Ala Pro Pro Pro Phe Lys Ile Ala Asp 35 4 O 45

Ile Arg Ala Ala Ile Pro Ala His Trp Wall Lys Asn Pro Trp Arg SO 55 6 O

Ser Luell Ser Wall Wall Trp Asp Wall Ala Ala Wall Phe Ala Luell Luell 65 70

Ala Ala Ala Wall Tyr Ile Asn Ser Trp Ala Phe Trp Pro Wall Tyr Trp 85 90 95

Ile Ala Glin Gly Thir Met Phe Trp Ala Luell Phe Wall Lell Gly His Asp 105 11 O

Gly His Gly Ser Phe Ser Asp Asn Thir Thir Lell Asn Asn Wall Wall 115 12 O 125

Gly His Wall Luell His Ser Ser Ile Luell Wall Pro Tyr His Gly Trp Arg 13 O 135 14 O

Ile Ser His Arg Thir His His Glin Asn His Gly His Wall Glu Asp 145 150 155 160

Glu Ser Trp Wall Pro Lell Pro Glu Asn Luell Tyr Luell Asp Phe 1.65 17O 17s

Ser Thir Phe Lell Arg Ile Pro Phe Pro Met Phe Ala Tyr 18O 185 19 O

Pro Luell yr Luell Trp Arg Ser Pro Gly Lys Thir Gly Ser His Phe 95

Asn Pro yr Ser Asp Lell Phe Pro Asn Glu Arg Gly Luell Ile Wall 21 O 215

Thir Ser Met Trp Ala Ala Met Gly Wall Phe Lell Luell Tyr Ala 225 23 O 235 24 O

Ser Thir le Wall Gly Pro Asn Met Met Phe Lell Tyr Gly Wall Pro 245 250 255

Luell le Phe Wall Met Trp Luell Asp Thir Wall Thir Luell His His 26 O 265 27 O

His Gly yr Asp Lell Pro Trp Tyr Arg Ser Lys Glu Trp Ser 27s 28O 285

Luell Arg Gly Gly Lell Thir Thir Wall Asp Glin Asp Gly Phe Phe 29 O 295 3 OO

Asn Ile His His Asp Ile Gly Thir His Wall Ile His His Luell Phe 3. OS 310 315

Pro Glin Ile Pro His His Luell Wall Glu Ala Thir Arg Glu Ala Lys 3.25 330 335

Arg Wall Luell Gly Asn Tyr Arg Glu Pro Arg Ser Gly Pro Wall 34 O 345 35. O

Pro Luell His Luell Ile Pro Ala Luell Luell Ser Lell Gly Arg Asp His 355 360 365

Wall Ser Asp Asn Gly Asp Ile Wall Tyr Glin Thir Asp Asp Glu 37 O 375 38O

Lell Phe Pro Ser Lys Ile 385 390

<210s, SEQ ID NO 15 &211s LENGTH: 903 &212s. TYPE: DNA <213> ORGANISM: Ostreococcus tauri US 8,785,727 B2 75 76 - Continued

<4 OOs, SEQUENCE: 15 atgtctgctt ctdgagctitt gttgcctgct attgctitt.cg ctgcttacgc ttacgct acc 6 O tacgct tatg Ctttcgagtg gtct catgct aacggaatcg atalacgtgga tgctagaga.g 12 O tggattggag citttgttctitt gag acticcict gcaattgcta ccaccatgta cct cittgttc 18O tgccttgttgg gacctagatt gatggctaag agggaggctt ttgat cotaa gggatt catg 24 O citcgcttaca acgcttacca aac cqctitt c aacgttgttgg tgctcggaat gttcgct aga 3OO gagatctotg gattgggaca acctgtttgg ggat.c tacta tgccttggag cgataggaag 360 t cct tcaaga ttttgttggg agtgtggctic Cattacaa.ca ataagtacct cgagttgttg gatact.gtgt t catggtggc taggaaaaag accalagcagc totott tott gcatgtgtac catcatgctt tgttgatttg ggcttggtgg cittgtttgtc atctoratggc taccaacgat 54 O tgcatcgatg cittattitcgg agctgcttgc aactott toa tccacat cqt gatgtacticc tactacct Ca tgtctgctitt gggaattaga tgc ccttgga agagatatat cacccaggct 660

Cagatgttgc aatticgtgat cgtgttcgct catgctgttt tcgtgct cag acaaaag cac 72 O tgcc ctdtta ctittgccttg ggcacaaatg titcgtgatga caaatatgtt ggtgctictt C ggaaacttct acct Caaggc ttact Ctaac aagtctaggg gagatggagc ttcttctgtt 84 O aagcctgctg agactact ag agcaccittct gtgagaagaa cCagg to cag gaagat.cgat 9 OO tga 903

<210 SEQ ID NO 16 &211s LENGTH: 3 OO 212. TYPE : PRT &213s ORGANISM: Ostreococcus tauri

<4 OOs, SEQUENCE: 16 Met Ser Ala Ser Gly Ala Lieu. Lieu. Pro Ala Ile Ala Phe Ala Ala Tyr 1. 5 1O 15

Ala Tyr Ala Thr Tyr Ala Tyr Ala Phe Glu Trp Ser His Ala Asin Gly 25

Ile Asp Asn Val Asp Ala Arg Glu Trp Ile Gly Ala Lell Ser Lieu. Arg 35 4 O 45

Lell Pro Ala Ile Ala Thir Thir Met Tyr Lieu. Lieu. Phe Luell Val Gly SO 55 6 O

Pro Arg Luell Met Ala Lys Arg Glu Ala Phe Asp Pro Gly Phe Met 65 70 7s 8O

Lell Ala Asn Ala Tyr Glin Thr Ala Phe Asn Wall Wall Wall Lieu. Gly 85 90 95

Met Phe Ala Arg Glu Ile Ser Gly Lieu. Gly Glin Pro Wall Trp Gly Ser 105 11 O

Thir Met Pro Trp Ser Asp Arg Llys Ser Phe Lys Ile Lell Luell Gly Val 115 12 O 125

Trp Luell His Tyr Asn. Asn Llys Tyr Lieu. Glu Lieu Lell Asp Thir Wall Phe 13 O 135 14 O

Met Wall Ala Arg Llys Llys Thr Lys Gln Lieu. Ser Phe Lell His Val Tyr 145 150 155 160

His His Ala Lieu. Lieu. Ile Trp Ala Trp Trp Lieu. Wall His Luell Met 1.65 17O 17s

Ala Thir Asn Asp Cys Ile Asp Ala Tyr Phe Gly Ala Ala Cys Asn. Ser 18O 185 19 O

US 8,785,727 B2 79 - Continued gaac atttga gacaattggg aaacgaggag act cacgagt Cttggcaaag agctgcttga 1560

<210s, SEQ ID NO 18 &211s LENGTH: 519 212. TYPE: PRT <213> ORGANISM: Thraustochytrium ssp.

<4 OOs, SEQUENCE: 18 Met Thr Val Gly Tyr Asp Glu Glu Ile Pro Phe Glu Glin Val Arg Ala 1. 5 1O 15 His Asn Llys Pro Asp Asp Ala Trp Cys Ala Ile His Gly His Val Tyr 2O 25 3O Asp Val Thir Lys Phe Ala Ser Val His Pro Gly Gly Asp Ile Ile Lieu 35 4 O 45 Lieu Ala Ala Gly Lys Glu Ala Thr Val Lieu. Tyr Glu Thir Tyr His Val SO 55 6 O Arg Gly Val Ser Asp Ala Val Lieu. Arg Llys Tyr Arg Ile Gly Lys Lieu 65 70 7s 8O Pro Asp Gly Glin Gly Gly Ala Asn. Glu Lys Glu Lys Arg Thir Lieu. Ser 85 90 95 Gly Leu Ser Ser Ala Ser Tyr Tyr Thr Trp Asn Ser Asp Phe Tyr Arg 1OO 105 11 O Val Met Arg Glu Arg Val Val Ala Arg Lieu Lys Glu Arg Gly Lys Ala 115 12 O 125 Arg Arg Gly Gly Tyr Glu Lieu. Trp Ile Lys Ala Phe Lieu. Lieu. Lieu Val 13 O 135 14 O Gly Phe Trp Ser Ser Lieu. Tyr Trp Met Cys Thr Lieu. Asp Pro Ser Phe 145 150 155 160 Gly Ala Ile Lieu Ala Ala Met Ser Lieu. Gly Val Phe Ala Ala Phe Val 1.65 17O 17s Gly. Thir Cys Ile Glin His Asp Gly Asn His Gly Ala Phe Ala Glin Ser 18O 185 19 O Arg Trp Val Asn Llys Val Ala Gly Trp Thir Lieu. Asp Met Ile Gly Ala 195 2OO 2O5 Ser Gly Met Thr Trp Glu Phe Gln His Val Lieu. Gly His His Pro Tyr 21 O 215 22O Thir Asn Lieu. Ile Glu Glu Glu Asin Gly Lieu Gln Llys Val Ser Gly Lys 225 23 O 235 24 O Llys Met Asp Thir Lys Lieu Ala Asp Glin Glu Ser Asp Pro Asp Val Phe 245 250 255 Ser Thr Tyr Pro Met Met Arg Lieu. His Pro Trp His Gln Lys Arg Trp 26 O 265 27 O Tyr His Arg Phe Gln His Ile Tyr Gly Pro Phe Ile Phe Gly Phe Met 27s 28O 285 Thir Ile Asn Llys Val Val Thr Glin Asp Val Gly Val Val Lieu. Arg Llys 29 O 295 3 OO

Arg Lieu. Phe Glin Ile Asp Ala Glu. Cys Arg Tyr Ala Ser Pro Met Tyr 3. OS 310 315 32O

Val Ala Arg Phe Trp Ile Met Lys Ala Lieu. Thr Val Lieu. Tyr Met Val 3.25 330 335 Ala Leu Pro Cys Tyr Met Glin Gly Pro Trp His Gly Lieu Lys Lieu. Phe 34 O 345 35. O Ala Ile Ala His Phe Thr Cys Gly Glu Val Leu Ala Thr Met Phe Ile 355 360 365 US 8,785,727 B2 81 82 - Continued

Val Asn His Ile Ile Glu Gly Val Ser Tyr Ala Ser Lys Asp Ala Wall 37 O 375

Lys Gly Thr Met Ala Pro Pro Llys Thr Met His Gly Wall Thir Pro Met 385 390 395 4 OO

Asn Asn. Thir Arg Lys Glu Val Glu Ala Glu Ala Ser Ser Gly Ala 4 OS 415

Val Val Lys Ser Val Pro Lieu. Asp Asp Trp Ala Ala Wall Glin Glin 42O 425 43 O

Thir Ser Val Asn Trp Ser Val Gly Ser Trp Phe Trp Asn His Phe Ser 435 44 O 445

Gly Gly Lieu. Asn His Glin Ile Glu. His His Luell Phe Pro Gly Luell Ser 450 45.5 460

His Glu Thir Tyr Tyr His Ile Glin Asp Wall Wall Glin Ser Thir Ala 465 470

Glu Tyr Gly Val Pro Tyr Gln His Glu Pro Ser Lell Trp Thir Ala Tyr 485 490 495

Trp Llys Met Lieu. Glu. His Lieu. Arg Glin Luell Gly Asn Glu Glu Thir His SOO 505 51O Glu Ser Trp Glin Arg Ala Ala 515

<210s, SEQ ID NO 19 &211s LENGTH: 31 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223 OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 19 gcggcc.gc.gc catggtggac Ctcaa.gc.ctg g 31

<210s, SEQ ID NO 2 O &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 2O gcggc.cgitta catcgctggg aacticgg 27

<210s, SEQ ID NO 21 &211s LENGTH: 33 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 21 gcggcc.gc.gc catgtcattg gctgctaaag atg 33

<210s, SEQ ID NO 22 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 22 gcc.gc.cgt.ca atgacctgta actictaac 28 US 8,785,727 B2 83 84 - Continued

<210s, SEQ ID NO 23 &211s LENGTH: 31 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 23 gcggcc.gc.gc catggcgacg aaggaggcgt a 31

<210s, SEQ ID NO 24 &211s LENGTH: 31 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 24 gcggcc.gc.gt tacgtggact ttcttggc C 31

<210s, SEQ ID NO 25 &211s LENGTH: 32 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 25 gcggcc.gc.gc catggagg to gtggagagat tic 32

<210 SEQ ID NO 26 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 26 gcggcc.gc.gt cacticagttt tagct coc 28

<210s, SEQ ID NO 27 &211s LENGTH: 30 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 27 gcggcc.gc.ca togatcct galacc.cggag 3 O

<210s, SEQ ID NO 28 &211s LENGTH: 30 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 28 gcggcc.gctt agagcttgtt Cttgtagaag 3 O

<210s, SEQ ID NO 29 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223s OTHER INFORMATION: Primer US 8,785,727 B2 85 - Continued

<4 OOs, SEQUENCE: 29 gcggcc.gc.ca to cqtttic titc.cggtgc 29

<210s, SEQ ID NO 3 O &211s LENGTH: 30 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 30 gcggcc.gc.ct aaatctttitt ggaaggaaag 3 O

<210s, SEQ ID NO 31 &211s LENGTH: 32 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 31 gcggcc.gc.gc catgagcgcc ticcggtgcgc tig 32

<210s, SEQ ID NO 32 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

< 4 OO SEQUENCE: 32 gcggcc.gc.gt tagt caattt titc 23

<210s, SEQ ID NO 33 &211s LENGTH: 32 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 33 gcggcc.gc.gc catgacggtc. g.gctacgacg ag 32

<210s, SEQ ID NO 34 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 34 gcggcc.gc.gt Caggcagcgc gctgcCagg 29

<210s, SEQ ID NO 35 &211s LENGTH: 26755 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: 223s OTHER INFORMATION: Plasmic

<4 OOs, SEQUENCE: 35 ctatacaaag ttgatagott gg.cgtaatcg atgtaccgat at caatttaa attggc.cggc 6 O cgagct coct gcagggggcc cqgcgc.gc.ct ctagattaat taaaggcctt agttactaat 12 O cagtgat cag attgtcgttt cocqcct tca gtttaaacta t cagtgtttg acaggatata 18O

US 8,785,727 B2 93 94 - Continued tcc.ca.gc.ccc atcaacgtact cqcaacagg gatcc cc.gta agctcaacaa acct acc caa 732O ttcatcgcta gaattcaaac aaccaccacc aacatacaac acaggcttct tag acticaga 7380 aatcaaccta acaatctgct c caaatgaga atct tcc.gga gotttaggca toctaga cat 744. O at aaccaggit aatctoratag cct gttcc.ca attaggaatc gcaa.gctgtt gttgaatatic 75OO tittaggaaca toaaccaaaa caggit coagg totaccagaa gtagctaaaa agaaagcttic 756 O citcaataatc ctagggatat cittcaa.catc cat cacaaga tagttatgct tcgtaatcga 762O acgcgttacct caacaatcg gag totcttgaaacgcatct gtaccaatca tacgacgagg 768 O gacttgtc.ct gtgattgcta caagaggaac act at ctaac alacgcatcgg ctaatcc.gct 774. O aacgagattt gtagct Cogg gacctgaagt ggctata cag atacctggitt tacct gagga 78OO tcgagcgitat cct tctgctg cgaatacacic ticcittgttcg tacgaggala ggacgttacg 786 O gattgaggaa gagcgggitta aggcttggtgaat ct coatt gatgtacct C Cagggitaagc 7920 gaatacggitt t ctacgc.ctt gacgttctaa agctt.cgacg aggatat cag cqc ctittgcg 798 O gggttgat ct ggagcgaatc gggagatgaa tottt cqggt ttgg taggitt tttggaga 804 O gggagtggitt gttgacattgg tagttgttgtt gag cacggcg gagatggagg agggaga.gct 81OO ggatttgata CC9C9g.cggc gggaggagga gatgatttgttggggttta giggagaatgg 816 O gagggaga at Ctggagattg gtaatggtga tittggaggag galaggagatg gtttggtgga 822 O gaaggagatc gaagaagatgttgttgttgt tttgttgcc gcc.gc.catgg ttcagctgca 828O catacataac at atcaagat cagaacacac atatacacac acaaatacaa totaagt caac 834 O aact coaaaa agt ccagatc tacatatata catacgtaaa taacaaaatc atgtaaataa 84 OO t cacaatcat gtaatccaga tictatgcaca tatatatata cacaattaat aaaaaaaatg 846 O atataacaga tictatat cita totatgtaac aacacaatca gatgagagaa gtgatgttitt 852O cagatctgta tacatacaaa cacaaacaga tigaacaattig atacgtagat coatatgtat 858 O acgtacaatt agctacacga ttaaatgaaa aaaat caacg attitcggatt gg tacacaca 864 O aacgcaacaa tatgaagaaa titcat atctg attagatata aac at aacca cqtgtagata 87OO cacagt caaa toaacaaatt tatagcttct aaacggatga gatgaacaag ataaagatat 876O t cacataagg catacataag ataag cagat taacaaacta gcaataatac atacctaatt 882O aaaacaagga atalacagaga gagagagaga gagagagatt taccttgaaa atgaagagga 888 O gaagagagga titt cittaaaa ttgggggtag agaaagaaag atgatgaatt gtgagaaagg 894 O agagatagaa gggggggttg tatatatagg Ctgtagaaga t tattitttgt gtttgaggcg 9 OOO gtgaaggaag aggggatctg act atgacac gtttgcggitt acg tatttcg at aggagtict 906 O ttcaacgctt aacgc.cgitta Ctctatatga cc.gtttgggc cqtaacgggg ccgtttgtta 912 O acgctgatgt tdattcttitt ctittctittct ttct tcc titt tittaaagaag caattgtaca 918O atcgttgcta gctgtcaaac ggataatt cq gatacggata togcctatatt catat cogta 924 O atttittggat t cqaattitt c ccctic taggg ataac agggit aatggat.cta tattgtttitt 93 OO gttt cacata aatgtcgttt toggattatt c atgtaatatt ttaaactaaa gtacaattitt 936 O tgac tactitt agtttactag ttaagcttitt atttittittga citaac cattgaatgatgaag 942O agat caacgc at catattta caact tacat agt cittittgg aagtgtaaat togctaatact 948O acctaaaata tat ctata at taactaat at tttitt cqtca attataatag atcaattaaa 954 O aggctatoaa aaggaaaaaa atgaaatcca catcc togcca totata acct c atgctggaaa 96.OO aagaaatgaaaaaatataaa aaatttcttt tdttt attaa atttacaact ttaatac tag 966 O

US 8,785,727 B2 97 98 - Continued catcagaacc taaggagagt ttaataatgc titcct cocqq gtgcc ttitta ataaaat cag 2O6 O agacat cata cacacgaccc ctitatgat catct cottaga agtgtcgata gaactaactg 212 O taaggit ctogc tigcatcagtt Cttgactitat ttgtagcticc gtgat actta gggtccaaga 218O cggatgagtg ggc.cgaggct gcatctittag cagccaatga catggaaggc gcggaggtgt 224 O gaga.gtgagt ttgagttgt gtggtgggitt titgagatt ggggatggtg ggtttatata 23 OO gtggagactg aggaatgggg togtgagtgt taactittgca tdggctacac gtgggttctt 2360 ttgggcttac acgtag tatt att catgcaa atgcago caa tacatatacg g tattittaat 242 O aatgtgtggg aatacaat at gcc.gagtatt ttactaattt toggcaatgac aagtgtacat 248O ttggattatc titacttggcc tict cittgctt taatttggat tatttittatt citc.ttacctt 254 O ggcc.gttcat attcacatcc ctaaaggcaa gacagaattgaatggtggcc aaaaattaaa 26 OO acgatggata tacct acat agtgtaggat caattaacgt Caaggaaaa tactgattct 266 O attaggggtg agagttgatc ggittaatt at C caat acatg ccgttggitta attaggatta 272 O tataaaaaat cqatcatcta ttagaatcga ttacggittaa at aggtataa aaatggaga.g 2780 aattgaatca gttataaatt tdttitt cagt taaaatattt citatgat citt caatcgattit 284 O cgg tattitta tact caa.cat ggaaaaaatt toaaatgitat ttcttctaaa agcaaaagaa 29 OO tctataaaaa citat catttt atccaaaa.ca ccaaaatagt ctitttacaat ctitttacagc 296 O citt cacataa acgaaaacaa aagtgaacaa tittctttitta cagcc tttac accaaaaaga 3O2O citacgatgaa citatgataaa attt cataat ctaaaaa.cat taatgaggta aag actic tot 3O8O caaatgggat attctt.cgaa aattitt cata atcgaacgat at acttgaat ttgcaactica 314 O tgaccgaaat tdtcc.caatic cataatactic tittgacaccc tat cagatcc caacgttgtc 32OO cctggttt cq aaaccaccat ttcaaacatgaacatat cac aaaataaac a tittagacacc 326 O aaat atctgc taatggc.cgg cct aacctgc aggatacaag ticgcacaga Citagcggcc.g 332O ctaatc.ccgg gaattaccgg tag tagg.cgc cittgttt tag actgaatata acacaacgat 3380 tatatago cq ctgtc.tttgt ttgaagagaa tdgactacat gctgaaaaat agtgatacaa 344 O gaatcqttgt tittaatgcta aaatgaccat citcgtgattit aacttittctg gaccalatgat 3500 tgtaaagttt tttittagaga gqtggtgata aacatatatt gatttittgaa atgaatagag 3560 ttagaaagta agaaaaatac aataaaaatgttaaataatgttgtagaaat agaaatggaa 362O gagalagtgta aagaaattta aataaaaatt agatgggaga gtaagttagt ttatattgat 3 680 ttgttttgttg gttagttitat citatgttata cittittaactt ataataatcc titt coat cat 37.4 O taagcaattt ttaaaaatga cataattitta aaattatgaa gtaataattig goatggtgaa 38OO taatagacag togtaaatggt gtaaatatat gagct cocat tittatttatt gct co cattt 386 O tatt tattitt agtttgttgttg acagatgaac attattagga ggaaaggitat aag cagggitt 392 O taactgtcac agggalaggtg gttittgggag tict tagttaa tta at Cagat Ctt Cttagaa 398 O gggaaaagct catcat cagt ctggtag tac acgat at Ctc. c9ttatcaga cacgtagta 404 O t ccct tccaa gagacittcaa aagagcaggg ataagatgaa gaggcac agg to Cagactitt 41OO c taggct cac gigtag tagtt toccaacacic ct cittagcct citctagtagc ct caacaagg 416 O tgg tagtgag gaatctgagg gaaaaggtga tiggat cacgt gagttccaat atcgtggtgg 422 O atcttgttga agaatc.cgta atcct gatco acagtag taa gtcct cotct aaggtaagac 428O

Cact cotttg acctgtacca aggaagct tc ttatcgitatic cqtggtggtg alaggtaagtic 434 O acagtat caa gccacat cac gaaaataagg taaggcactic cqtaaagctt gaa catcatg 44 OO

US 8,785,727 B2 105 106 - Continued ataagatagt aaacgataag gaaagacaat ttattgagaa agc catgcta aaatatagat 2154 O agatatacct tag caggtgt ttattittaca acatalacata acatagtagc tagccagoag 216OO gCaggctaaa acatagtata gtctatctgc agggggtacg gtcgaggcgg cct taattaa 21660 titat caag.cg gtc.ttt coag aatgttgtcc gtgcacgtag tagtgctitt c cca cattat c 2172O gaggtttccc aaagtagcct tccaa.gct co agcataagtic at caccittgt agttgaggitt 21780 c cacttctta gcgaaagcaa cqaatcttct gga cacctica ggttgttctga attgaggcat 2184 O agaagggaag aggtgatgaa toacttggca gttcaagtat cc catcaacc agitta accca 219 OO t ccctgagaa gogatcqatat caatggtgtg atccacagog tacct aaccc aagacaaatg 21960 Ctcatcagca ggaacaac at C caaatgggt gtgagaagta gagaagtgag caacaagta 22O2O gcatc.cggaa acc caagaag tagccaagaa gag to cqtag gattgcatag cqgtgaatcc 2208O agta acagcc ttaatggtco aggttctaat cacatgagca gccaa.catcc acacaagct c 2214 O citcgtactitt cotcc.ctt.ca aagcc.ttaga aggatggagg aagaa catcc agaagagcaa 222 OO Caccaatcca gaagtcacag gaatgaaggt C caagcttgc aatctgagcc agtacttaga 2226 O gaatcc ccta ggtctatt at Cct coacago ggtgttgaag aaa.gcaa.cag caggagtggt 2232O atccaaatcc at atcgtgcc ticactttittg aggagtagca toggtgcttgt tdtgcatgga 2238 O gttccacata t ct coagatc cagccaatcc gaatccagoa gtgaaagctt ggatt ct citt 2244. O atcc caccag atgttt cogg toaaagaaga atgtc.ct coc toatgttgaa cc catccaca 225 OO tctagotc.cg aagaa.gcaag cqtaalaccaa cacagaggac acaacgitatic tag.cgtacat 22560 Caagtaggitt CCC aaag.cgt a Catagcagc Caact Cagcg aatctgtaag Caacatgagc 2262O aggaga aggc titgaagaatc cqtcc ct ct c caact cottt citccact tag cqaaatcctg. 2268O gagcatct ca gcatcatcca ctittagcggit cittagcaggit ctagaaggca aag cago caa 2274. O agcct tcc ta gcc tittctag atctgtggtg gaact cottgaaag.cct cag tag catcagc 228 OO tccagtgtta gagaga.gc.gt agaaaatcac ggttcct coa ggatgtttga aatcggit cac 22860 atcgtactica act coct cqa taaccacgta t cittctagog aaggit cittag ccaaag.cagc 2292 O aggttc catc ttcticagoag acaactitcac gttagcct ca gct ctittctic tict ct coat c 2298 O gaaag.cgatc. tccacagtag ggatt coatic gttgttct cq gtc.tcaacac acatggtggc 23 O4 O gcqgttcago ttgatcgctic tattaattag tt cattgttt tatacgtgaa gaaaaagaaa 231 OO gagacggaat atatggcaaa aaa catgcaa ggggacgtgt gttalacatac gtgtctt atg 2316 O actaattatt cqtagtggca gtttctacca totggaaatg gaattgatat acacaggcca 2322 O gcaaga cact ctagottaccatagagcatt tt catgcaca cittttittaaa agacaaagga 2328O agtatattaa tagatggit ca taattctgaa tdttittatta cctittaa.cat tccaacaagg 2334 O ttaaaaccaa totttcaaga tigt caatgtg to citt cacaa act catatat tdaattact a 234 OO gtttgaccaa gatataaggg tta actictaa alacataagaa aatatgacac aaatataaaa 2346 O taaatat cag atatattgag agat citcaaa attattalaga ataaaatatic taagtattaa 2352O tattgttggt gig tatt citaa aggtgacagg tdataaatta tattattgta aaatttaaaa 2358O taagagaata tttittatatt gttgtaaaat ttaaaataag agaat attitt tdagttacgt 23 64 O tttgtactaa atttctattg atggattittg gactittgaaa taccataatt totatt caat 237OO t cattacaca tttitttitcca gcatacaatt tag cattaca aagtttittat at aggcttga 23760 agaaaagtaa catagaaaac aataattcaa aaatcaagac gaggactatt tdgttitt ct c 2382 O aatc.ttaatg atacaactitt at cataattt taaataagga caataattat aatgtgatga 2388O US 8,785,727 B2 107 108 - Continued ttacaattitt cittataatac titactaaagg tagtggtggit tacaacacat taattittaac 2394 O actic cc cctt aatgtgttgc tictittaactic ccattactitc tictaagttgt taaaatctt c 24 OOO citctttgtag tattittagta aaagtgtctg taagttgctic titatgaact g cagaaaggta 24O6 O actgcacatt toctitctt.ca at cactictitc gaatgaagtg gtgttittatgttaatgtgtc. 24.12 O tagt cogact atgaaaaa.ca ggatt ctittg tdttgtacta caaaatttitt cotct cagt c 2418O ttcaagaatt ttct cataag atct tccatg a catcaagtt togcagcact g atacatcaat 2424 O ttaggtttgg aattggcaca agagcaaaat gigt caattgc acactgaaaa gtcaaactitt 243 OO gacttittgcatcaiacatcaa atttcaagaa toacattt catcaagacatgttagaatatg 24360 aagtttgttt tattaagaaa gttcaaaagtic aagtttgctt toggaaaagtic aaaattictaa 2442O acacttagaa atttittctaa citgttaagaa atatgacaag titcagaact t c toggccagat 2448 O titt cac catg atgcaagttg attctggaag aacttctgac acaagagttg tagatttcaa 24.54 O tgagat citaa gacattgcgg aacagaactt ct cittaaaaa tdatgggatt toaagttata 24 6OO aatctittgaa gacacgt.cca tdaaactgaa gtact caata aattittgggc ctitcc caaga 24 660 cggaatttgg ttagaactitc toggagcagtt ttcacgtagg ttcaatcaga gtttgcaaga 2472 O gtaattcaaa gaaagt ctac aaag.catgtt acaagctittctgaaaagttct tagaact cot 2478O t cagaacatgttggalacaga gagattcaaa gat Cagalagt tatacagt ccgggcc.gt c 2484 O gatggc.cggc cta acctgca ggatacaagt gcgcacagac tagcggcc.gc taatc.ccggg 24900 aattaccggit agtaggcgcc ctdaattaac gocgaattaa titcgggggat citggattitta 2496 O gtactggatt ttggttt tag gaattagaaa titt tattgat agaagtattt tacaaataca 25O2O aatacatact aagggitttct tatatgctica acacatgagc gaaac cctat aggaaccota 2508O attic cc titat citgggalacta ct cacacatt attatggaga aacticgagct tdtcgagata 2514 O tcgggctaga gcgccaccgc ggtggagatc. tcggcctta attaatcaag C9g actt Ctt 252OO Cttctttgga gcc atgtagg attgcacgaa gaactgagcg aagaggaaga aaagggagag 2526 O aatgtacacg aagtacacga tiggtgattct gagggaalacc ttatcgcatc. c9tggaaaac 2532O Caagtagg ta gcttgggaca t catgatggit gaattgcaag agttggaaag C9gtcaaaga 25380 tgact tccac cagattggca aag actitt co ggit cittagaa toctitggtgt gcatgcagat 2544 O gaagtagtag gtgtacatca cigtgtgaat gaatc.cgttg aggaggatgg tdaagaagat 25500 atct coat cq tagagcacgt tagcgttcaa C cagtagaag aggaagatgg togtatgatg 25560 gtacacgtgc aagaaagaga gttgttct c ca cittctitt cog agcacaatga agatggitat c 25 620 ccagaaatcc cacactittgg agatgtagaa gagccagagc aagttagcaa. Ctggtggat c 2568O gttcacgttgaagtggttgc atggcataac gigtgitat cog titcctataag cqaggaatcc 2574 O agcct caa.ca gtcatgitaag cqcagaggaa gatttgagac acgttgtaga ggaacttgat 258OO aggg tatggg to Catagctg ggagagattg cat cacagda gatcc caaga t cacgaaagc 2586 O gatgtagatg agagcaatgg togatagogga tictdaaatcg cacaaccacc aatcc tocct 2592 O atcagotctgaactitt coat ctdgat cact c caatcqatig atago agctic caatctitat c 25.980 catago agcg ttataag.cat coatgg tact ggctatogaag aaattataat cqtgtaaaac 2604 O ttagtgagtg td tatgaatgaaagtattgc aaaatcc toa ttatatagac tacatgcata 261OO actagttgca totaaatttg tagttittctt cattattgca toc to caagt gigatgtcatg 2616 O gttttacaca tdgct tcc at gcaaatcatt to caaaatat ttittaaact t t coacagggc 2622 O US 8,785,727 B2 109 110 - Continued atccatgcat gcacct caaa acttgttgttgt gigtaacattgttgtc.ttgaa aaattactaa 2628O acct tttgtc. cacgtgacgt to atgcacct caaat cittgt gtgg taccat tattatcct c 2634 O aagaattatt gaatgtttgg togtatatgcc atc catgcag cattgcaa.ca attaaatct c 264 OO caaaccttgt gigtaccatat t cact cactt taattct cott at agtagaaa tattagcaaa 2646 O tatttacatt to cagttgat tagtatatgt atttagaaga caaaaataat ttagaat caa 2652O ttaatcaact togcaaattgc taagtgttgg caaacgittag cataaaaggt gttataaatt 2658O tag taccalaa tataaaaatt tat cqcaaat caaatacata acacacatag taaaacaaaa 2664 O acaa attaca agggitttaga C9tttagtgg caatgtgtaa atttgctgca gtggc.cggcc 267OO tagtagattit aaattggcct tagtggccaa gottgg.cgta at catggcaa cittitt 26755

We claim: 1. A vector comprising a polynucleotide comprising a 20 (I) O nucleic acid sequence selected from the group consisting of ..CH (a) a nucleic acid sequence that has at least 95% identity to R1 pi e CH2 the sequence of SEQID NO: 1 and CHRCH CH3, (b) a nucleic acid sequence which codes for a polypeptide iii. CH1. having at least 90% identity to the amino acid sequence 25 of SEQID NO: 2; wherein the nucleic acid sequences of (a) and (b) code for a where the variables and substituents are as follows: polypeptide with desaturase activity. R'-hydroxyl, coenzyme A (thioester), lysophosphatidyl 2. The vector according to claim 1, wherein the polynucle choline, lysophosphatidylethanolamine, lysophosphati otide consists of RNA or DNA. 30 dylglycerol, lysodiphosphatidylglycerol, lysophos 3. The vector according to claim 1, wherein the vector is an phatidylserine, lysophosphatidylinositol, sphingo base expression vector. or a radical of the formula II 4. The vector according to claim 1, wherein the vector comprises at least one further polynucleotide which codes for a further enzyme which is involved in the biosynthesis of 35 II lipids or fatty acids. HC-O-R2 (II) 5. A nonhuman host cell comprising the vector according to claim 1. 6. The host cell according to claim 5, wherein the host cell i-o-; additionally comprises at least one further enzyme which is 40 H-O-S- involved in the biosynthesis of lipids or fatty acids. 7. The host cell according to claim 6, wherein the enzyme is selected from the group consisting of an acyl-CoA dehy R-hydrogen, lysophosphatidylcholine, lysophosphati drogenase, an acyl-ACP (acyl carrier protein) desaturase, an dylethanolamine, lysophosphatidylglycerol, lyso acyl-ACP thioesterase, a fatty acid acyltransferase, an acyl 45 diphosphatidylglycerol, lysophosphatidylserine, lyso CoA:lysophospholipid acyltransferase, a fatty acid synthase, phosphatidylinositol or saturated or unsaturated C-C- a fatty acid hydroxylase, an acetyl-coenzyme A carboxylase, alkylcarbonyl, an acyl-coenzyme A oxidase, a fatty acid desaturase, a fatty R-hydrogen, saturated or unsaturated C-C2-alkylcarbo acid acetylenase, a lipoxygenase, a triacylglycerol lipase, an nyl, or R and R independently of one another are a allene oxide synthase, a hydroperoxide lyase, a fatty acid 50 radical of the formula Ia: elongase, a A4-desaturase, a A5-desaturase, a A6-desaturase, a A8-desaturase, a A9-desaturase, a A12-desaturase, a A5-elongase, a A6-elongase and a A9-elongase. (Ia) O 8. A method of fortifying a food or feed product with a CH polypeptide with desaturase activity, comprising the steps: 55 pi CH2 (a) expressing the vector according to claim 1, in a host CHRCH CH cell; iii. CH1. (b) obtaining, from the host cell, the polypeptide which is p encoded by the polynucleotide according to (a); and (c) adding the polypeptide to the food or feed product. 60 n=2, 3, 4, 5, 6, 7 or 9, m=2, 3, 4, 5 or 6; and p=0 or 3: 9. A transgenic, nonhuman organism comprising the vector according to claim 1. and 10. The transgenic, nonhuman organism according to wherein the method comprises the cultivation of host cell claim 9, wherein the organism is an animal, a plant or a of claim 5, under conditions which permit the biosyn multicellular microorganism. 65 thesis of the substance. 11. A method for the production of a substance which has 12. A method for the production of a substance which has the structure shown in the general formula I hereinbelow the structure shown in the general formula I hereinbelow US 8,785,727 B2 111 112 R-hydrogen, saturated or unsaturated C-C2-alkylcarbo (I) nyl, or R and R independently of one another are a O ..CH radical of the formula Ia: R1 pi -CH2 CHFCH iii. CH3, CH (Ia) 1. O CH where the variables and substituents are as follows: pi CH2 R'-hydroxyl, coenzyme A (thioester), lysophosphatidyl CHRCH CH 10 iii. CH1. choline, lysophosphatidylethanolamine, lysophosphati p dylglycerol, lysodiphosphatidylglycerol, lysophos phatidylserine, lysophosphatidylinositol, sphingo base n=2, 3, 4, 5, 6, 7 or 9, m=2, 3, 4, 5 or 6; and p=0 or 3: or a radical of the formula II and 15 wherein the method comprises the cultivation of a transgenic, II nonhuman organism of claim 9, under conditions which per HC-O-R2 (II) mit the biosynthesis of the substance. 13. A method for the production of an oil, lipid or fatty acid composition, comprising the step of the method according to i-o-; claim 11, and the further step of formulating the substance as H-O-S an oil, lipid or fatty acid composition. 14. The method according to claim 13, wherein the oil, R-hydrogen, lysophosphatidylcholine, lysophosphati lipid or fatty acid composition is formulated further to pro dylethanolamine, lysophosphatidylglycerol, lyso duce a drug, a cosmetic product, a foodstuff, or a feedstuff. diphosphatidylglycerol, lysophosphatidylserine, lyso 25 15. The method according to claim 14, wherein the food phosphatidylinositol or saturated or unsaturated C-C- stuff is fish food or a food supplement. alkylcarbonyl, k k k k k