Original Article Microrna-454 Enhances Proliferation and Migration in Non-Small Cell Lung Cancer Cells

Int J Clin Exp Med 2019;12(6):6932-6945 www.ijcem.com /ISSN:1940-5901/IJCEM0087296

Original Article MicroRNA-454 enhances proliferation and migration in non-small cell lung cancer cells

Yun Li1,2*, Quanmei Chen2*, Chunxue Zhang2, Chanjuan Yang1,3, Youquan Bu2, Yunmei Zhang1

1The Nursing College of Chongqing Medical University, Chongqing 400016, China; 2Department of Biochemistry and Molecular Biology, Chongqing Medical University, Chongqing 400016, China; 3The Nursing Department of Chongqing Traditional Chinese Medicine Hospital, Chongqing 400021, China. *Equal contributors. Received August 12, 2018; Accepted March 6, 2019; Epub June 15, 2019; Published June 30, 2019

Abstract: Growing evidence has shown that microRNA-454 (miR-454) plays important roles in a variety of biologi- cal processes in various human cancer cells. However, the roles of miR-454 in non-small cell lung cancer (NSCLC) are largely unknown. Herein, the expression of miR-454 was manipulated using miR-454 mimics and inhibitors in NSCLC cells. We found that miR-454 expression was markedly upregulated in NSCLC patients according to online published data. Modulation of miR-454 levels significantly promoted NSCLC cell growth and migration. Furthermore, the expression of runt-related transcription factor 3 (Runx3) was negatively regulated by miR-454 in NSCLC cells, suggesting that Runx3 may be a potential target gene of miR-454. Meanwhile, the phosphorylation of Akt was posi- tively correlated with miR-454 in NSCLC cells. What’s more, the expression of Runx3 was markedly depressed in lung adenocarcinoma tissues, and the expression of Akt2 was dramatically elevated in NSCLC tissues. Low Runx3 and high Akt expressions were significantly associated with poor survival in NSCLC patients. These findings reveal that miR-454 functions as an oncogene, and decreased Runx3 expression and the activation of Akt signaling may be partially involved in the process. This study could provide a new insight into the functional involvement of miR- 454 in NSCLC.

Keywords: miR-454, NSCLC, proliferation, migration, Runx3, Akt

Introduction malignancy-related mortality worldwide [9, 10]. Lung cancer can be classified into small cell MicroRNAs (miRNAs) are a class of small endog- lung cancer (SCLC) and non-small cell lung can- enous noncoding RNAs, approximately 21-25 cer (NSCLC), which is further categorized into nucleotides in length, which play important lung adenocarcinoma (LUAD), lung squamous roles in regulating numerous physiological and cell carcinoma (LUSC), large cell carcinoma and pathological processes. Moreover, increasing other subtypes [11]. NSCLC is the most com- studies have shown that aberrant expressions mon type of primary lung cancer, accounting for of miRNAs can contribute to many tumor devel- over 85% of all cases [12]. opment processes, such as proliferation, migration, and invasion [1, 2]. Hence, promis- Our group members have worked for a long ing strategies for human cancer treatment time to explore the molecular mechanisms of include regulating the expressions of endoge- NSCLC development and progression. We have nous miRNAs. Recent studies have demon- found that proline-rich protein 11 (PRR11), and strated that these therapeutic strategies are its adjacent gene, spindle and kinetochore- feasible because miRNAs have the ability to associated 2 (SKA2), play critical roles in NSCLC affect cellular behavior [3-5]. development [13, 14]. Meanwhile, we have noticed that two miRNAs, miR-301a and miR- Recent studies indicate that the dysregulation 454, are located in the first intron of the host of miRNAs significantly contributes to the devel- gene SKA2. And we also have found that miR- opment and progression of lung cancer [6-8]. 301a promotes growth and migration in NSCLC Lung cancer remains the leading cause of [15]. Previous studies have shown that miR- MiR-454 acts as an oncogene

Table 1. Sequences of miRNAs Cell proliferation assays Name Sequences A549 and H1299 cells transfected with various miR-454-3p 5’-UAGUGCAAUAUUGCUUAUAGGGU-’3 miRNAs were respectively seeded at a density CCUAUAAGCAAUAUUGCACUAUU of 2×103 cells per well in 96-well plates at 24 miR-NC 5’-UUCUCCGAACGUGUCACGUTT-’3 hours posttransfection. Cell proliferation was ACGUGACACGUUCGGAGAATT assessed at the indicated time points using a Anti-miR-454-3p 5’-ACCCUAUAAGCAAUAUUGCACUA-’3 Cell Counting Kit-8 (Dojindo, Kyushu, Japan). Anti-miR-NC 5’-UUGUACUACACAAAAGUACUG-’3 The absorbance value was then measured at a wavelength of 450 nm. All the experiments were repeated three times. 454 acts as an oncogene or tumor suppressors in different cancers. However, the roles of miR- Wound-healing assays 454 in NSCLC are largely unknown. The cell migration activity was assessed using In this study, we aimed to explore the roles of wound-healing assays. A549 and H1299 cells miR-454 in NSCLC development. We found that transfected with various miRNAs were respec- miR-454 expression is significantly increased tively cultured in a complete medium to a con- in NSCLC tissues, and increased expression of fluent monolayer and then were scraped with miR-454 promotes the proliferation and migra- 200 μl pipette tips to create an artificial wound, tion of NSCLC cells. Furthermore, the underly- and after that the wound was monitored. ing molecular mechanism was explored. The Floating cells were then washed away with findings revealed that decreased Runx3 expres- phosphate buffer saline (PBS), and a fresh sion and increased activation of Akt signaling medium with 1% fetal bovine serum was added. may be involved in the process. These results Cell migration was observed under a micro- could provide a new insight into the functional scope at the indicated time points. involvement of miR-454 in NSCLC. Colony formation assay Materials and methods At 48 hours posttransfection with various miR- Cell culture NAs, the A549 and H1299 cells were respectively harvested, and then an appropriate num- The lung cancer cell lines A549 and H1299 ber of cells was seeded into 6-well plates to cells were cultured in Dulbecco’s modified produce approximately 50-120 colonies per Eagle’s medium (DMEM, HyClone, Logan, Utah, well. After 14 days of incubation at 37°C in 5% USA) and RPMI-1640 medium supplemented CO2, these cells were washed with PBS gently, with 10% heat-inactivated fetal bovine serum, fixed with 70% ethanol and stained with 0.5% penicillin (100 IU/ml), and streptomycin (100 crystal violet for three minutes at room temper- μg/ml). All the cells were maintained in a ature. Colonies containing more than 50 cells humidified atmosphere of 5% CO2 at 37°C. were counted.

Transfection with miRNA agomir and antagomir Expression analysis of miR-454 and its potential target genes in NSCLC MiR-454 agomir (miR-454), miR-454 antagomir (anti-miR-454), and their corresponding nega- MiR-454 expression was analyzed in LUAD and tive controls (miR-NC and anti-miR-NC) were LUSC tissue samples according to the online designed and chemically synthesized by published data using the starBase v2.0 plat- GenePharma (Shanghai, China). The sequenc- form (http://starbase.sysu.edu.cn/), which was es are shown as in Table 1. A549 and H1299 designed to decipher pan-cancer networks of cells were plated in 6-well plates and cultured noncoding RNAs by mining clinical and expres- for 24 hours. Then, the miRNAs were transfect- sion profiles of 14 cancer types (>6000 sam- ed into the cells at a final concentration of 50 ples) from the cancer genome atlas (TCGA) nmol/L using the lipofectamine RNAiMAX data portal [16]. reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Forty- To explore the potential target genes of miR- eight hours after transfection, the cells were 454, three software tools, including TargetScan, collected and subjected to analysis. miRDB and miRWalk, were used to predict the

6933 Int J Clin Exp Med 2019;12(6):6932-6945 MiR-454 acts as an oncogene

Table 2. Primers for qRT-PCR Rad Laboratories, Shanghai, Gene name Forward (5’-3’) Reverse (5’-3’) China). Runx3 ACCTCGGAACTGAACCCATT AGGTAGGTATGGTGGAAGCG Prognostic analysis of Runx3 SMAD4 TCCAGCCTCCCATTTCCAAT ACCTTGCTCTCTCAATGGCT and Akt2 in NSCLC patients PTEN ACCAGGACCAGAGGAAACCT GCTAGCCTCTGGATTTGACG PIAS3 ATGGTGATGAGTTTCCGGGT GAAGGGAGAGATCAGAGGGC The prognostic values of the NKRF AGCTGCTGAGAAAGATGGGT AAATCTGTGTGGCTCTCGGA Runx3 and Akt2 expressions Bim AGCCCAGCACCCATGAGTTGTGAC CTCTGGGCGCATATCTGCAGG were evaluated using pub- Foxf2 CCCGTTACCAGCATCACTCT TGACGCAGGGCTTAATATCC lished lung cancer microarray GAPDH ACCTGACCTGCCGTCTAGAA TCCACCACCCTGTTGCTGTA data from a Nagoya University lung cancer cohort containing 117 lung cancer patients [17]. potential target genes of miR-454. A Venn dia- Microarray and patient survival data were gram was used to display the overlapping tar- downloaded from the GEO database (GSE get genes from the three prediction tools. 13213). The raw microarray data were routinely These genes that were co-predicted using three processed according to the methods of a previ- tools were screened with a DAVID analysis. ous study [18] and further used for a Kaplan- Meier analysis. A receiver operating character- Quantitative RT-PCR analysis istic curve analysis was performed to identify a rational cut-off point. Patients who lived longer Total RNA was extracted using a TRIzol reagent than 5 years after diagnosis were considered to (Invitrogen) according to the manufacturer’s have good prognoses, and Runx3 and Akt2 instructions. Total RNA (500 ng) was reverse expression values that reached optimal sensi- transcribed to obtain cDNA using a PrimeScript tivity and specificity were chosen. RT Reagent Kit (TaKaRa, Dalian, China) according to the manufacturer’s protocol. Quantitative Statistical analysis RT-PCR was performed using a SYBR Green PCR Mix kit (TaKaRa, Dalian, China). The primer All statistical analyses were carried out using sequences are shown in Table 2. The RT-PCR GraphPad Prism 5 software. Student’s t-test reactions were performed in a 10 μL qPCR was performed to analyze the data from cell reaction under the following conditions: 95°C proliferation and colony formation assays. A nonparametric test (the Mann-Whitney test) for 30 s, then 40 cycles at 95°C for 3 s and was used to analyze the significance between 60°C for 30 s. The housekeeping gene GAPDH the miR-454 treatment groups and their corre- was used as an internal control gene, and the sponding control groups. The data were relative abundance of mRNA was calculated expressed as the mean ± standard error of the according to the 2-ΔΔCt method. Each experi- mean (SEM). Overall survival curves were plot- ment was performed in triplicate. ted using the Kaplan-Meier method and com- Western blot analysis pared with the log-rank (Mantel-Cox) test. Univariate regression analysis was performed Total proteins were isolated from the A549 with the Cox proportional hazards regression cells at 48 hours posttransfection with various model to calculate the hazard ratios and their miRNAs using the RIAP protein extraction 95% confidence intervals for each variable and reagent (Beyotime, Shanghai, China). Then, the to analyze independent factors affecting prognosis. A P-value<0.05 was considered statisti- proteins were separated on 10% sodium cally significant. dodecyl sulfate polyacrylamide gels and trans- ferred to PVDF membranes. The target proteins Results were detected by primary antibodies (anti-Akt, 1:1000; anti-pAkt, 1:1000; anti-PTEN, 1:1000; MiR-454 was significantly upregulated in anti-Smad4, 1:1000; anti-GAPDH, 1:2000) fol- NSCLC tissues lowed by incubation with appropriate HRP- conjugated secondary antibodies (1:8000, To explore whether the expression level of miR- Proteintech, Wuhan, China) in conjunction with 454 was changed in lung cancer, the starBase the Clarity Western ECL substrate (Bio- v2.0 pan-cancer platform was used. The results

6934 Int J Clin Exp Med 2019;12(6):6932-6945 MiR-454 acts as an oncogene

Figure 1. The expression of miR-454 is significantly upregulated in NSCLC tissues. MiR-454 expression was analyzed in LUAD and LUSC tissue samples using the starBase v2.0 platform. LUAD means lung adenocarcinoma, LUSC means lung squamous cell carcinoma. Student’s t-test was performed to analyze the data, P<0.05 was considered statistically significant. showed that the expression of miR-454 was ly than the negative control cells (Figure 2B). In significantly upregulated in the NSCLC tissues addition, colony formation assays showed that compared with the corresponding normal tis- miR-454 was able to significantly promote cell sues (430 LUAD samples and 332 LUSC sam- group-dependent growth and cell proliferation ples). The fold-changes of miR-454 in LUAD vs. in the A549 cells. In contrast, anti-miR-454 the normal tissues and in LUSC vs. the normal caused the opposite effect (Figure 2C). tissues were approximately 2.27 and 1.76, respectively (Figure 1). These findings suggest MiR-454 promotes NSCLC cell migration that the increased miR-454 expression may be To further determine whether miR-454 could involved in NSCLC development. affect the migration of NSCLC cells, wound- healing assays were performed. As shown in MiR-454 promotes NSCLC cell growth Figure 3A, the overexpression of miR-454 significantly enhanced the migration activity of Given that the expression of miR-454 was sig- A549 cells compared with negative control nificantly raised in NSCLC tissues, we further cells, but the inhibition of miR-454 with anti- examined whether miR-454 could affect the miR-454 reduced the cell migration ability. The proliferation of NSCLC cells. We utilized gain-of- same phenomenon was observed in the H1299 function and loss-of-function strategies by cells (Figure 3B). Our results were consistent transfecting cells with miR-454, anti-miR-454, with a recent report that miR-454 promotes miR-NC, and anti-miR-NC, respectively. The NSCLC cell invasion/migration ability [19]. results demonstrated that miR-454 had the capacity to promote cell proliferation in both MiR-454 impeded the expression of Runx3 the A549 and H1299 NSCLC cells (Figure 2A). On the other hand, anti-miR-454 caused the To deeply explore the functions of miR-454, we A549 and H1299 cells to proliferate more slow- first analyzed its potential target genes using

6935 Int J Clin Exp Med 2019;12(6):6932-6945 MiR-454 acts as an oncogene

Figure 2. MiR-454 enhanced NSCLC cell proliferation. A, B. Twenty-four hours after transfection with miR-454 or anti-miR-454 in A549 and H1299, cells were subjected to a CCK-8 proliferation assay at the indicated time points. The overexpression of miR-454 promotes proliferation in A549 and H1299 cells, while the inhibition of miR-454

6936 Int J Clin Exp Med 2019;12(6):6932-6945 MiR-454 acts as an oncogene suppresses proliferation. C. The overexpression of miR-454 in A549 cells promotes colony formation, while the inhibition of miR-454 reduces colony formation. Student’s t-test was performed to analyze the data, n=3, and the data were presented as the means ± SEM, **represents P<0.05, **represents P<0.01 vs. corresponding control groups (miR-NC or anti-miR-NC). P<0.05 was considered statistically significant. three online in silico prediction algorithms The clinical significance of Runx3 and Akt2 (TargetScan, miRDB, and miRWalk). The com- expressions in NSCLC patients mon potential target genes using those three software programs are listed in Table 3. There We evaluated the prognostic values of Runx3 were 121 co-predicted genes among all the and Akt2 expressions using the Nagoya predicted genes (Figure 4A). The DAVID analy- University lung cancer cohort. A survival analysis results showed that most of the shared pre- sis demonstrated that low Runx3 expression dicted genes may be involved in transcription, (n=74) and high Akt2 (n=54) expression were apoptosis, the cell cycle, proliferation and significantly associated with poorer survival, but a high expression of Runx3 (n=43) and a migration processes (Figure 4B). According to low Akt2 expression (n=64) were closely asso- our potential target gene analysis, we chose ciated with better clinical outcomes in the several genes to observe whether the expres- Nagoya University lung cancer cohort (Figure sions were changed in the A549 cells after miR- 5). 454 treatment. As shown in Figure 4C, an increase of miR-454 could downregulate the Discussion mRNA expressions of Runx3, PTEN, Smad4, Bim, NKRF, and PIAS3, while a decrease of miR- In our previous studies, we clearly confirmed 454 could upregulate the expression levels of that SKA2 and PRR11 are functionally corre- Runx3, Smad4, Bim, NKRF, PIAS3, and Foxf2. lated in the regulation of the proliferation, These results suggest that these genes may be migration, and invasion of lung cancer cells, the target genes of miR-454. and two miRNAs, miR-301a and miR-454, are located in the first intron of the host gene SKA2 The expression of Runx3 is indeed inhibited by [13, 14]. Our recent studies have demonstrated miR-454. Combining previous studies, the epi- that miR-301a promotes the proliferation and genetic downregulation of Runx3 induces migration of NSCLC cells by targeting the TGF docetaxel resistance in lung adenocarcinoma signaling pathway [15]. Herein, we explored the cells by activating Akt signaling [20]; the loss of potential role of miR-454 in NSCLC develop- Runx3 can promote the Akt-mediated signaling ment. In the present study, our findings revealed pathway and enhance neoplasia in gastric can- that miR-454 expression is increased in NSCLC cer [21] and colorectal cancer cells [22]. tissues, and miR-454 enhances NSCLC cell Therefore, these findings inspired us to further proliferation and migration, suggesting that measure the phosphorylation level of Akt after miR-454 might promote the development of manipulating the miR-454 levels in NSCLC NSCLC. Recently, Zhu et al. reported that cells. The results showed that overexpression increased miR-454 expression in NSCLC tissues is closely correlated with positive lymph of miR-454 significantly increased the phos- node metastasis, advanced TNM stage, and phorylation level of Akt, and the inhibition of poor overall survival [19]. Thus, these findings miR-454 suppressed the Akt phosphorylation could potentially have diagnostic and/or thera- level (Figure 4D). Unfortunately, we found no peutic value for human NSCLC patients in the obvious changes in the protein levels of PTEN future. and Smad4, and the results were not in agree- ment with previous reports that the expression MiR-454 is a recently identified cancer-related of PTEN was inhibited by miR-454 [19]. miRNA. Thus far, a high expression of miR-454 Moreover, we further found that Runx3 expres- has been observed in several human cancers, sion was significantly decreased in LUAD tis- and the overexpression of miR-454 can pro- sues, and Akt2 expression was dramatically mote cell proliferation, invasion, and migration increased in NSCLC tissues (Figure 4E, 4F) by repressing target genes in colorectal cancer according to the starBase database. [23, 24], hepatocellular carcinoma [25, 26],

6937 Int J Clin Exp Med 2019;12(6):6932-6945 MiR-454 acts as an oncogene

Figure 3. MiR-454 promotes NSCLC cell migration. A, B. A549 and H1299 cells were transiently transfected with miR-454 or anti-miR-454. A scratch was made on the cell monolayer, and the wound was observed under a micro- scope at different time points (0, 6, 24 and 48 hours). The overexpression of miR-454 promotes A549 and H1299 cell migration, while the inhibition of miR-454 reduces migration. breast cancer [27, 28], and uveal melanoma 454 expression has been found to be signifi- [29], suggesting that miR-454 acts as a poten- cantly downregulated in hepatic stellate cells tial oncogene in these cancers. However, miR- [30], osteosarcomas [31], sickle cell disease

6938 Int J Clin Exp Med 2019;12(6):6932-6945 MiR-454 acts as an oncogene

Table 3. The common predicted genes from TargetScan, miRDB and miRWalk Target genes Gene name MIER1 Mesoderm induction early response 1 homolog (Xenopus laevis) FBXO28 F-box protein 28 SHANK2 SH3 and multiple ankyrin repeat domains 2 CHST1 Carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 MYBL1 V-myb myeloblastosis viral oncogene homolog (avian)-like 1 IRF1 Interferon regulatory factor 1 SBF2 SET binding factor 2 PAN3 PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) HCFC2 Host cell factor C2 ZBTB4 Zinc finger and BTB domain containing 4 RRAGD Ras-related GTP binding D ACVR1 Activin A receptor, type I THSD7A Thrombospondin, type I, domain containing 7A TMEM110 Transmembrane protein 110 ADAM12 ADAM metallopeptidase domain 12 KIAA1211 KIAA1211 CSMD1 CUB and Sushi multiple domains 1 STIM2 Stromal interaction molecule 2 ZCCHC14 Zinc finger, CCHC domain containing 14 CCDC126 Coiled-coil domain containing 126 VGLL4 Vestigial like 4 (Drosophila) BAHD1 Bromo adjacent homology domain containing 1 FRZB Frizzled-related protein ACSL1 Acyl-CoA synthetase long-chain family member 1 ULK2 Unc-51-like kinase 2 (C. elegans) PIK3C2A Phosphoinositide-3-kinase, class 2, alpha polypeptide LRP8 Low density lipoprotein receptor-related protein 8, apolipoprotein e receptor POU4F1 POU class 4 homeobox 1 SPG20 Spastic paraplegia 20 (Troyer syndrome) RUNX3 Runt-related transcription factor 3 IGSF3 Immunoglobulin superfamily, member 3 SLAIN1 SLAIN motif family, member 1 TBL1XR1 Transducin (beta)-like 1 X-linked receptor 1 PEX5L Peroxisomal biogenesis factor 5-like VPS13D Vacuolar protein sorting 13 homolog D (S. cerevisiae) ENPP5 Ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) ATG2B ATG2 autophagy related 2 homolog B (S. cerevisiae) FAM73A Family with sequence similarity 73, member A SH3D19 SH3 domain containing 19 NPNT Nephronectin SPHK2 Sphingosine kinase 2 C9orf69 Chromosome 9 open reading frame 69 PSAP Prosaposin C16orf70 Chromosome 16 open reading frame 70 SPATA2 Spermatogenesis associated 2 RAB5A RAB5A, member RAS oncogene family SPOPL Speckle-type POZ protein-like

6939 Int J Clin Exp Med 2019;12(6):6932-6945 MiR-454 acts as an oncogene

MET Met proto-oncogene (hepatocyte growth factor receptor) CLIP1 CAP-GLY domain containing linker protein 1 TGFB2 Transforming growth factor, beta 2 SPEN Spen homolog, transcriptional regulator (Drosophila) SLMAP Sarcolemma associated protein ARHGEF4 Rho guanine nucleotide exchange factor (GEF) 4 WNK1 WNK lysine deficient protein kinase 1 JARID2 Jumonji, AT rich interactive domain 2 MAT2B Methionine adenosyltransferase II, beta DLL1 Delta-like 1 (Drosophila) SMARCD2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 MID1IP1 MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) NPAT Nuclear protein, ataxia-telangiectasia locus ACBD5 Acyl-CoA binding domain containing 5 IMPDH1 LMP (inosine 5’-monophosphate) dehydrogenase 1 SERINC3 Serine incorporator 3 LY75 Lymphocyte antigen 75 SNAP25 Synaptosomal-associated protein, 25 kDa FRMD6 FERM domain containing 6 JMY Junction mediating and regulatory protein, p53 cofactor HS3ST5 Heparan sulfate (glucosamine) 3-O-sulfotransferase 5 UBE3B Ubiquitin protein ligase E3B WNT2B Wingless-type MMTV integration site family, member 2B SNPH Syntaphilin RBM25 RNA binding motif protein 25 PHF20 PHD finger protein 20 ANKIB1 Ankyrin repeat and IBR domain containing 1 PTPRG Protein tyrosine phosphatase, receptor type, G VPS37A Vacuolar protein sorting 37 homolog A (S. cerevisiae) PPARG Peroxisome proliferator-activated receptor gamma PRUNE2 Prune homolog 2 (Drosophila) LRP12 Low density lipoprotein receptor-related protein 12 ST18 Suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein) RAP2C RAP2C, member of RAS oncogene family MTMR10 Myotubularin related protein 10 PRKAA2 Protein kinase, AMP-activated, alpha 2 catalytic subunit PDK1 Pyruvate dehydrogenase kinase, isozyme 1 MPHOSPH9 M-phase phosphoprotein 9 TMEM55A Transmembrane protein 55A BPTF Bromodomain PHD finger transcription factor SLC9A2 Solute carrier family 9 (sodium/hydrogen exchanger), member 2 SLC44A1 Solute carrier family 44, member 1 ST8SIA5 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5 TTYH3 Tweety homolog 3 (Drosophila) ENDOD1 Endonuclease domain containing 1 RASA1 RAS p21 protein activator (GTPase activating protein) 1 TRPC3 Transient receptor potential cation channel, subfamily C, member 3 CBFB Core-binding factor, beta subunit C5orf30 Chromosome 5 open reading frame 30

6940 Int J Clin Exp Med 2019;12(6):6932-6945 MiR-454 acts as an oncogene

GJA1 Gap junction protein, alpha 1, 43 kDa LONRF1 LON peptidase N-terminal domain and ring finger 1 PDIK1L PDLIM1 interacting kinase 1 like SOCS5 Suppressor of cytokine signaling 5 DEPDC1 DEP domain containing 1 BAI3 Brain-specific angiogenesis inhibitor 3 UBE2D2 Ubiquitin-conjugating enzyme E2D 2 SNX2 Sorting nexin 2 STK33 Serine/threonine kinase 33 WHSC1L1 Wolf-Hirschhorn syndrome candidate 1-like 1 NRBF2 Nuclear receptor binding factor 2 HPRT1 Hypoxanthine phosphoribosyltransferase 1 PHF12 PHD finger protein 12 NUP133 Nucleoporin 133 kDa CD69 CD69 molecule ACBD3 Acyl-CoA binding domain containing 3 CYP2U1 Cytochrome P450, family 2, subfamily U, polypeptide 1 FOSL1 FOS-like antigen 1 ZNF800 Zinc finger protein 800 FBXO9 F-box protein 9 THOP1 Thimet oligopeptidase 1 KBTBD8 Kelch repeat and BTB (POZ) domain containing 8 NAP1L3 Nucleosome assembly protein 1-like 3 FAM78A Family with sequence similarity 78, member A PELI1 Pellino homolog 1 (Drosophila)

[32], glioblastoma [33], and pancreatic ductal these findings suggest that Runx3 is a potential adenocarcinoma [34], and a high expression of target gene of miR-454 in NSCLC cells. miR-454 inhibits tumor growth and invasion, suggesting that miR-454 is a candidate tumor Furthermore, studies reported that loss of suppressor. Therefore, miR-454 has dual func- Runx3 could enhance docetaxel resistance and tions in cancer development, and the role of neoplasia in cancers [20-22]. In this study, we miR-454 might be dependent on the regulation found that miR-454 indeed enhanced the phos- of distinct target genes in different cancers. phorylation levels of the Akt. Taken together, we speculated that miR-454 activates Akt sig- MiRNA negatively regulates the expressions of naling via targeting Runx3, thus promoting its target genes by base-pairing with 3’-UTRs NSCLC cell proliferation and migration. [35]. Additionally, some highly expressed miR- NAs can act as oncogenes by repressing tumor The mRNA expressions of other potential func- suppressor genes. Accordingly, our results tional targets of miR-454, such as Smad4, Bim, showed that the expression of Runx3 was sig- NKRF, and PIAS3, were also downregulated in nificantly negatively regulated by miR-454 in NSCLC cells upon the overexpression of miR- NSCLC cells. Previous studies have shown that 454. Thus, these genes may take part in miR- the Runx3 functions as a tumor suppressor in 454-modulated NSCLC pathogenesis. Sm- lung cancer [36], gastric cancer [37, 38] and ad4, an important tumor suppressor involved in bladder tumors [39]. The downregulation of TGF-β signaling, was shown to contain a con- Runx3 is observed both in urethane-induced served putative miR-454 target site. Bim, mouse lung adenomas [40] and lung adenocar- NKRF, and PIAS3 are also reported, potential cinoma [36]. Further study has found that the target genes of miR-301a. MiR-301a promotes inactivation of Runx3 is a crucial early event in pancreatic cancer cell proliferation by directly lung adenocarcinoma [41]. Taken together, inhibiting Bim expression [42]; MiR-301a

6941 Int J Clin Exp Med 2019;12(6):6932-6945 MiR-454 acts as an oncogene

6942 Int J Clin Exp Med 2019;12(6):6932-6945 MiR-454 acts as an oncogene

Figure 4. Identification of miR-454 potential target genes. A. One hundred and twenty-one potential target genes were obtained using three online in silico prediction algorithms. B. A DAVID analysis was performed on the 121 potential target genes. C. Seven potential target genes of miR-454 were selected based on bioinformatic analysis and previous reports. Their mRNA levels were determined in A549 cells after transfection with miR-454 or anti-miR-454 using qRT-PCR. D. The protein levels of p-Akt, Akt, PTEN and Smad4 were measured in A549 cells after transfection with miR-454 or anti-miR-454 using western blotting. E. Runx3 expression was remarkably depressed in the LUAD tissues, but not in the LUSC tissues compared with the corresponding control. F. Akt2 expression was dramatically increased in the LUAD tissues and the LUSC tissues compared with the corresponding control. Student’s t-test was performed to analyze the data, P<0.05 was considered statistically significant.

Figure 5. Univariate and multivariate survival analyses were performed based on Runx3 and Akt2 expressions in NSCLC patients. The Kaplan-Meier method was used to plot the overall survival of the NSCLC patients in the Nagoya University cohort. Patients in the low-Runx3 and high-Akt2 expression groups had significantly poorer prognoses than those in the high-Runx3 and low-Akt2 expression groups. An overall survival curve was compared with the log- rank (Mantel-Cox) test. P<0.05 was considered statistically significant. enhances NF-κB activity by downregulating Disclosure of conflict of interest NKRF [43]; PIAS3, a negative regulator of the STAT3 activation pathway, is suppressed by None. miR-301a [44]. MiR-454 and miR-301a have common sequences to target binding sites in Address correspondence to: Yunmei Zhang, The Nu- the 3’-UTRs of potential target genes. Hence, rsing College of Chongqing Medical University, whether Smad4, Bim, NKRF and PIAS3 are 1# Yixueyuan Road, Yuzhong District, Chongqing also target genes of miR-454, and whether 400016, China. Tel: 023-89011757; E-mail: cyzym@ these pathways are involved in the develop- 126.com ment of NSCLC remain to be determined. References These issues are worthy of further study. [1] Sun W, Julie Li YS, Huang HD, Shyy JY and In conclusion, our findings indicate that miR- Chien S. microRNA: a master regulator of cel- 454 is upregulated in NSCLC tissues and pro- lular processes for bioengineering systems. motes the proliferation and migration of NSCLC Annu Rev Biomed Eng 2010; 12: 1-27. cells. And exploratory research showed that [2] Krol J, Loedige I and Filipowicz W. The wide- the activation of Akt signaling through decr- spread regulation of microRNA biogenesis, eased Runx3 expression may be partially function and decay. Nat Rev Genet 2010; 11: involved in the process. This study is beneficial 597-610. for further exploration of the molecular mecha- [3] Conde J, Oliva N, Atilano M, Song HS and Artzi nisms of NSCLC development and could pro- N. Self-assembled RNA-triple-helix hydrogel vide a new insight into the diagnosis and/or scaffold for microRNA modulation in the tu- mour microenvironment. Nat Mater 2016; 15: therapy of human NSCLC. 353-363. Acknowledgements [4] Jackson A and Linsley PS. The therapeutic potential of microRNA modulation. Discov Med 2010; 9: 311-318. This work was supported by the Chongqing [5] Kota J, Chivukula RR, O’Donnell KA, Wentzel Natural Science Foundation (no. cstc2016- EA, Montgomery CL, Hwang HW, Chang TC, Vi- jcyjA0356). vekanandan P, Torbenson M, Clark KR, Men-

6943 Int J Clin Exp Med 2019;12(6):6932-6945 MiR-454 acts as an oncogene

dell JR and Mendell JT. Therapeutic microRNA [16] Li JH, Liu S, Zhou H, Qu LH and Yang JH. star- delivery suppresses tumorigenesis in a mu- Base v2.0: decoding miRNA-ceRNA, miRNA- rine liver cancer model. Cell 2009; 137: 1005- ncRNA and protein-RNA interaction networks 1017. from large-scale CLIP-Seq data. Nucleic Acids [6] Molina-Pinelo S, Pastor MD, Suarez R, Rome- Res 2014; 42: D92-97. ro-Romero B, Gonzalez De la Pena M, Salinas [17] Takeuchi T, Tomida S, Yatabe Y, Kosaka T, Osa- A, Garcia-Carbonero R, De Miguel MJ, Rodri- da H, Yanagisawa K, Mitsudomi T and Taka- guez-Panadero F, Carnero A and Paz-Ares L. hashi T. Expression profile-defined classifica- MicroRNA clusters: dysregulation in lung ade- tion of lung adenocarcinoma shows close nocarcinoma and COPD. Eur Respir J 2014; relationship with underlying major genetic 43: 1740-1749. changes and clinicopathologic behaviors. J [7] Chen Y, Min L, Ren C, Xu X, Yang J, Sun X, Clin Oncol 2006; 24: 1679-1688. Wang T, Wang F, Sun C and Zhang X. miRNA- [18] Liu Z, Niu Y, Li C, Yang Y and Gao C. Integrating 148a serves as a prognostic factor and sup- multiple microarray datasets on oral squa- presses migration and invasion through Wnt1 mous cell carcinoma to reveal dysregulated in non-small cell lung cancer. PLoS One 2017; networks. Head Neck 2012; 34: 1789-1797. 12: e0171751. [19] Zhu DY, Li XN, Qi Y, Liu DL, Yang Y, Zhao J, [8] Guerriero I, D’Angelo D, Pallante P, Santos M, Zhang CY, Wu K and Zhao S. MiR-454 pro- Scrima M, Malanga D, De MC, Ravo M, Weisz motes the progression of human non-small A and Laudanna C. Analysis of miRNA profiles cell lung cancer and directly targets PTEN. identified miR-196a as a crucial mediator of Biomed Pharmacother 2016; 81: 79-85. aberrant PI3K/AKT signaling in lung cancer [20] Zheng Y, Wang R, Song HZ, Pan BZ, Zhang YW cells. Oncotarget 2017; 8: 19172. and Chen LB. Epigenetic downregulation of [9] Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieu- RUNX3 by DNA methylation induces docetaxel lent J and Jemal A. Global cancer statistics, chemoresistance in human lung adenocarci- 2012. CA Cancer J Clin 2015; 65: 87-108. noma cells by activation of the AKT pathway. [10] Torre LA, Siegel RL and Jemal A. Lung cancer Int J Biochem Cell Biol 2013; 45: 2369-2378. statistics. Adv Exp Med Biol 2016; 893: 1-19. [21] Lin FC, Liu YP, Lai CH, Shan YS, Cheng HC, Hsu [11] Urgard E, Vooder T, Vosa U, Valk K, Liu M, Luo PI, Lee CH, Lee YC, Wang HY, Wang CH, Cheng C, Hoti F, Roosipuu R, Annilo T, Laine J, Frenz JQ, Hsiao M and Lu PJ. RUNX3-mediated tran- CM, Zhang L and Metspalu A. Metagenes as- scriptional inhibition of Akt suppresses tumori- sociated with survival in non-small cell lung genesis of human gastric cancer cells. Onco- cancer. Cancer Inform 2011; 10: 175-183. gene 2012; 31: 4302-4316. [12] Brahmer JR, Govindan R, Anders RA, Antonia [22] Kang KA, Kim KC, Bae SC and Hyun JW. Oxida- SJ, Sagorsky S, Davies MJ, Dubinett SM, Ferris tive stress induces proliferation of colorectal A, Gandhi L, Garon EB, Hellmann MD, Hirsch cancer cells by inhibiting RUNX3 and activating FR, Malik S, Neal JW, Papadimitrakopoulou the Akt signaling pathway. Int J Oncol 2013; VA, Rimm DL, Schwartz LH, Sepesi B, Yeap BY, 43: 1511-1516. Rizvi NA and Herbst RS. The Society for Immu- [23] Liu L, Nie J, Chen L, Dong G, Du X, Wu X, Tang notherapy of Cancer consensus statement on Y and Han W. The oncogenic role of microRNA- immunotherapy for the treatment of non-small 130a/301a/454 in human colorectal cancer cell lung cancer (NSCLC). J Immunother Can- via targeting Smad4 expression. PLoS One cer 2018; 6: 75. 2013; 8: e55532. [13] Ji Y, Xie M, Lan H, Zhang Y, Long Y, Weng H, Li [24] Liang HL, Hu AP, Li SL, Xie JP, Ma QZ and Liu JY. D, Cai W, Zhu H, Niu Y, Yang Z, Zhang C, Song MiR-454 prompts cell proliferation of human F and Bu Y. PRR11 is a novel gene implicated colorectal cancer cells by repressing CYLD ex- in cell cycle progression and lung cancer. Int J pression. Asian Pac J Cancer Prev 2015; 16: Biochem Cell Biol 2013; 45: 645-656. 2397-2402. [14] Wang Y, Zhang Y, Zhang C, Weng H, Li Y, Cai W, [25] Yu L, Gong X, Sun L, Yao H, Lu B and Zhu L. Xie M, Long Y, Ai Q, Liu Z, Du G, Wang S, Niu Y, miR-454 functions as an oncogene by inhibit- Song F, Ozaki T and Bu Y. The gene pair PRR11 ing CHD5 in hepatocellular carcinoma. Onco- and SKA2 shares a NF-Y-regulated bidirection- target 2015; 6: 39225-39234. al promoter and contributes to lung cancer [26] Zhou L, Qu YM, Zhao XM and Yue ZD. Involve- development. Biochim Biophys Acta 2015; ment of miR-454 overexpression in the poor 1849: 1133-1144. prognosis of hepatocellular carcinoma. Eur [15] Chen QM, Li Y, Zhang CX, Wang YT, Zhang L, Rev Med Pharmacol Sci 2016; 20: 825-829. Song FZ and Bu YQ. MicroRNA-301a promotes [27] Munoz-Rodriguez JL, Vrba L, Futscher BW, Hu growth and migration by repressing TGFBR2 in C, Komenaka IK, Meza-Montenegro MM, Guti- non-small cell lung cancer. Int J Clin Exp Pathol errez-Millan LE, Daneri-Navarro A, Thompson 2017; 10: 957-971. PA and Martinez ME. Differentially expressed

6944 Int J Clin Exp Med 2019;12(6):6932-6945 MiR-454 acts as an oncogene

microRNAs in postpartum breast cancer in His- [37] Li QL, Ito K, Sakakura C, Fukamachi H, Inoue K, panic women. PLoS One 2015; 10: e0124340. Chi XZ, Lee KY, Nomura S, Lee CW, Han SB, [28] Cao ZG, Li JJ, Yao L, Huang YN, Liu YR, Hu X, Kim HM, Kim WJ, Yamamoto H, Yamashita N, Song CG and Shao ZM. High expression of mi- Yano T, Ikeda T, Itohara S, Inazawa J, Abe T, croRNA-454 is associated with poor prognosis Hagiwara A, Yamagishi H, Ooe A, Kaneda A, in triple-negative breast cancer. Oncotarget Sugimura T, Ushijima T, Bae SC and Ito Y. Caus- 2016; 7: 64900-64909. al relationship between the loss of RUNX3 ex- [29] Sun L, Wang Q, Gao X, Shi D, Mi S and Han Q. pression and gastric cancer. Cell 2002; 109: MicroRNA-454 functions as an oncogene by 113-124. regulating PTEN in uveal melanoma. FEBS Lett [38] Cheng HC, Liu YP, Shan YS, Huang CY, Lin FC, 2015; 589: 2791-2796. Lin LC, Lee L, Tsai CH, Hsiao M and Lu PJ. Loss [30] Zhu D, He X, Duan Y, Chen J, Wang J, Sun X, of RUNX3 increases osteopontin expression Qian H, Feng J, Sun W, Xu F and Zhang L. Ex- and promotes cell migration in gastric cancer. pression of microRNA-454 in TGF-beta1-stimu- Carcinogenesis 2013; 34: 2452-2459. lated hepatic stellate cells and in mouse livers [39] Kim WJ, Kim EJ, Jeong P, Quan C, Kim J, Li QL, infected with Schistosoma japonicum. Parasit Yang JO, Ito Y and Bae SC. RUNX3 inactivation Vectors 2014; 7: 148. by point mutations and aberrant DNA methyla- [31] Niu G, Li B, Sun J and Sun L. miR-454 is down- tion in bladder tumors. Cancer Res 2005; 65: regulated in osteosarcomas and suppresses 9347-9354. cell proliferation and invasion by directly tar- [40] Licchesi JD, Westra WH, Hooker CM, Machida geting c-Met. Cell Prolif 2015; 48: 348-355. EO, Baylin SB and Herman JG. Epigenetic al- [32] Gonsalves CS, Li C, Malik P, Tahara SM, Kalra teration of Wnt pathway antagonists in pro- VK. Peroxisome proliferator-activated receptor- gressive glandular neoplasia of the lung. Carci- alpha-mediated transcription of miR-301a and nogenesis 2008; 29: 895-904. miR-454 and their host gene SKA2 regulates [41] Lee YS, Lee JW, Jang JW, Chi XZ, Kim JH, Li YH, endothelin-1 and PAI-1 expression in sickle cell Kim MK, Kim DM, Choi BS, Kim EG, Chung JH, disease. Biosci Rep 2015; 35. Lee OJ, Lee YM, Suh JW, Chuang LS, Ito Y and [33] Fang B, Zhu J, Wang Y, Geng F and Li G. MiR- Bae SC. Runx3 inactivation is a crucial early 454 inhibited cell proliferation of human glio- event in the development of lung adenocarci- blastoma cells by suppressing PDK1 expres- noma. Cancer Cell 2013; 24: 603-616. sion. Biomed Pharmacother 2015; 75: [42] Chen Z, Chen LY, Dai HY, Wang P, Gao S and 148-152. Wang K. miR-301a promotes pancreatic can- [34] Fan Y, Xu LL, Shi CY, Wei W, Wang DS and Cai cer cell proliferation by directly inhibiting Bim DF. MicroRNA-454 regulates stromal cell de- expression. J Cell Biochem 2012; 113: 3229- rived factor-1 in the control of the growth of 3235. pancreatic ductal adenocarcinoma. Sci Rep [43] Markopoulos GS, Roupakia E, Tokamani M, 2016; 6: 22793. Chavdoula E, Hatziapostolou M, Polytarchou C, [35] Ma R, Jiang T and Kang X. Circulating microR- Marcu KB, Papavassiliou AG, Sandaltzopoulos NAs in cancer: origin, function and application. R and Kolettas E. A step-by-step microRNA J Exp Clin Cancer Res 2012; 31: 38. guide to cancer development and metastasis. [36] Lee KS, Lee YS, Lee JM, Ito K, Cinghu S, Kim Cell Oncol (Dordr) 2017; 40: 303-339. JH, Jang JW, Li YH, Goh YM, Chi XZ, Wee H, Lee [44] Mycko MP, Cichalewska M, Machlanska A, HW, Hosoya A, Chung JH, Jang JJ, Kundu JK, Cwiklinska H, Mariasiewicz M and Selmaj KW. Surh YJ, Kim WJ, Ito Y, Jung HS and Bae SC. MicroRNA-301a regulation of a T-helper 17 im- Runx3 is required for the differentiation of lung mune response controls autoimmune demye- epithelial cells and suppression of lung cancer. lination. Proc Natl Acad Sci U S A 2012; 109: Oncogene 2010; 29: 3349-3361. E1248-1257.

6945 Int J Clin Exp Med 2019;12(6):6932-6945