Novel Inhibitors of Poly(ADP-Ribose) Polymerase/PARP1 and PARP2 Identified Using a Cell-Based Screen in Yeast

[CANCER RESEARCH 61, 4175–4183, May 15, 2001] Novel Inhibitors of Poly(ADP-ribose) Polymerase/PARP1 and PARP2 Identified Using a Cell-based Screen in Yeast

Ed Perkins, Dongxu Sun, Allen Nguyen, Suzana Tulac, Michelle Francesco, Homa Tavana, Hieu Nguyen, Stuart Tugendreich, Peter Barthmaier, Joe Couto, Elaine Yeh, Silke Thode, Kurt Jarnagin, Ajay Jain, David Morgans, and Teri Melese1 Iconix Pharmaceuticals, Mountain View, California 94043

ABSTRACT region (4). Regulation of automodification of PARP1 is twofold: through PARP1-DNA interactions and PARP1-PARP1 dimerization (5). Multicellular organisms must have means of preserving their genomic PARP1 acts together with the DNA damage repair system to integrity or face catastrophic consequences such as uncontrolled cell regulate DNA base excision repair, apoptosis, and necrosis (4). Stud- proliferation or massive cell death. One response is a modification of nuclear proteins by the addition and removal of polymers of ADP-ribose ies of mouse strains lacking the PARP1 gene have identified two roles that modulate the properties of DNA-binding proteins involved in DNA for this encoded protein, depending on the extent of DNA damage repair and metabolism. These ADP-ribose units are added by poly(ADP- (6–8). Moderate damage elicits a protection response similar to that ribose) polymerase (PARP) and removed by poly(ADP-ribose) glycohy- observed for checkpoint genes, leaving PARP1 knockout mice vul- drolase. Although budding yeast Saccharomyces cerevisiae does not pos- nerable to ␥-irradiation and alkylating reagents (8). In cases of exten- sess proteins with significant sequence similarity to the human PARP sive DNA damage, PARP1 activity depletes cellular energy pools, family of proteins, we identified novel small molecule inhibitors against which eventually leads to cell death (3, 6). two family members, PARP1 and PARP2, using a cell-based assay in PARP1 also has a putative role in signaling DNA damage and in yeast. The assay was based on the reversal of growth inhibition caused by recruiting proteins to sites of double-strand breaks. This hypothesis the heterologous expression of either PARP1 or PARP2. Validation of the was based on the ability of proteins, such as p53 and other repair assay was achieved by showing that the growth inhibition was relieved by a mutation in a single residue in the catalytic site of PARP1 or PARP2 or enzymes, to bind to the poly(ADP) polymers present on PARP1 (4, 9). exposure of yeast to a known PARP1 inhibitor, 6(5H)-phenanthridinone. PARP1 inhibitors exaggerate the cytotoxic effects of DNA damage by In separate experiments, when a putative protein regulator of PARP limiting the ability of cells to regulate DNA base excision repair. In activity, human poly(ADP-ribose) glycohydrolase, was coexpressed with this role, PARP inhibitors are being tested as chemosensitizing agents PARP1 or PARP2, yeast growth was restored. Finally, the inhibitors during cancer chemotherapy (10, 11). identified by screening the yeast assay are active in a mammalian PARP Another response to more extensive DNA damage mediated by biochemical assay and inhibit PARP1 and PARP2 activity in yeast cell PARP1 is the promotion of cell death, as seen in cases of ischemic extracts. Thus, our data reflect the strength of using yeast to identify small injury (12). This process can occur when PARP1 activation is highly molecule inhibitors of therapeutically relevant gene families, including stimulated and thus consumes large amounts of NAD, the source of those that are not found in yeast, such as PARP. The resultant inhibitors have two critical uses (a) as leads for drug development and (b) as tools to ADP-ribose. This condition depletes the cellular energy stores (13). dissect cellular function. PARP1 knockout mice are highly resistant to ischemia during stepto- zocin-induced type I diabetes, myocardial infarction, stroke, and neu- rodegeneration (6, 14). In support of a role for PARP1 in cell death in INTRODUCTION various inflammation processes, several studies have shown protection against cellular injury in numerous target cells by using known Living organisms possess mechanisms to regulate cell cycle progres- PARP1 inhibitors (12). sion and to preserve genomic integrity. Failure of these mechanisms in For many years PARP1 has been the only known PARP. However, multicellular organisms results in disorders ranging from the unregulated modification of cellular proteins with ADP-ribose polymers still oc- cell proliferation associated with cancer to massive cell death after the fall curs in PARP1 knockout mice, suggesting the presence of other of tissue oxygen and glucose levels in cardiac or brain ischemia (1). proteins with PARP activity (15). Indeed, new members of the PARP A key cellular response to genomic damage is the posttranslational family have been identified based on the presence of domains that modification of nuclear proteins in response to DNA strand breaks (2, share considerable sequence similarity with the catalytic domain of 3). One known modification is the addition to specific proteins of up PARP1 (16–20). Although some members of the PARP family do not to 200 residues of ADP-ribose to form branched polymers. These possess a well-defined Zn2ϩ finger DNA-binding motif or an auto- polymers act as binding sites for repair proteins that play a central role modification domain such as that described for PARP1, they still in DNA metabolism (4). The enzyme responsible for the addition of catalyze the formation of ADP-ribose polymers in a DNA-dependent these polymers is PARP1.2 PARP1 associates with DNA and with manner and are capable of automodification (16, 17). chromatin-binding proteins such as histones, transcription factors, and Two additional members of the PARP family are tankyrase and key DNA repair proteins (4). Although a number of nuclear proteins VPARP (18, 20). Tankyrase is associated with the telomerase com- such as histones are substrates for PARP1, a major substrate is PARP1 plex that acts to regulate telomere length at replication, and VPARP itself, via automodification of the BRCA1 COOH-terminal homology is a component of a multisubunit complex referred to as a “vault” (21–23). The name vault is based on its observed structure by electron Received 12/20/00; accepted 3/16/01. The costs of publication of this article were defrayed in part by the payment of page microscopy (22). The cellular location of VPARP is predominantly charges. This article must therefore be hereby marked advertisement in accordance with cytoplasmic; however, there is a small fraction associated with the 18 U.S.C. Section 1734 solely to indicate this fact. mitotic spindle (18). Unlike PARP1, tankyrase and VPARP are not 1 To whom requests for reprints should be addressed, at Iconix Pharmaceuticals, 320 Logue Avenue, Mountain View, CA 94043. Phone: (650) 567-5508; Fax: (650) 567-5545; activated by DNA damage (18, 20). Tankyrase modifies the telomere- E-mail: [email protected]. binding protein TRF1 in vitro (15). TRF1 stabilizes the ends of 2 The abbreviations used are: PARP, poly(ADP-ribose) polymerase; PARG, poly- (ADP-ribose) glycohydrolase; VPARP, vault poly(ADP-ribose) polymerase; ORF, open chromosomes, and it has been proposed that modification of TRF1 reading frame; TCA, trichloroacetic acid. with ADP-ribose polymers serves to regulate its ability to form a loop 4175

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2001 American Association for Cancer Research. NOVEL INHIBITORS OF PARP/PARP2 IDENTIFIED IN YEAST SCREEN structure at chromosome ends (15, 23). In other studies, tankyrase has shown). YAN100 is an EIS20-2B derivative that contains a complete deletion been shown to promote telomere elongation in human cells (24). A of the HIS3 gene. The yeast media protocols and genetic molecular biology substrate of VPARP is the major vault protein, MVP (it is also capable techniques used for these studies are standard protocols (36). of automodification); these complexes are up-regulated in multidrug- The genotype of the strains is as follows: (a) EIS20-2B and YPB63; MATa ⌬ ⌬ resistant cancer cell lines (25, 26). The various cellular locations and ade2-1 his3-1115 leu2-3, 112 trp1-1, ura3-1, can1-100, pdr5 , snq2 ; (b) YAN100, MATa ade2-1 his3⌬ϻKanMx, leu2-3,112 trp1-1, ura3-1, canr1-100, domain structures of the PARP family members strongly suggest that pdr5⌬, snq2⌬; (c) W303␣(-W303-1B), MATa ade2-1 his3-11,15 leu2-3,112 they have distinct cellular roles. Identification of selective inhibitors trp1-1, ura3-1, can1-100, pdr5⌬, snq2⌬; and (d) YM4, MATa ade2-101 might help elucidate the function of these enzymes. his3⌬200 leu2-3,112 trp1-1 ura3-52. Poly(ADP-ribose) polymers can be removed by PARG, a member Cloning and Analysis of PARP1, PARP2, and PARG. The cDNAs of a large family of related enzymes (27–30). This enzyme is thought corresponding to the complete open reading frames of PARP1 and PARP2 to regulate the cellular function of PARP family members by remov- were PCR-amplified from pooled total cDNAs initially synthesized from ing ADP-ribose units, which results in changes in the branching placental, fetal brain, and fetal liver polyadenylated mRNAs (Clontech). First- pattern of the polymers (15, 27). There is some evidence to support and second-strand cDNA synthesis was performed using Superscript II reverse the hypothesis that polymers synthesized by different PARP ortho- transcriptase (Life Technologies, Inc.) as described previously (37). The 5Ј and Ј Ј logues might be hydrolyzed by specific PARGs (27). Although a 3 oligonucleotides for PARP1 PCR amplification were, YS5PRP (5 -GTTA- complete understanding of the physiological activities of PARPs ATATACCTCTATACTTTAACGTCAAGGAGAAAAAACGGGAGGATG- GCGGAGTCTTCGGATAAG) and YS3PRP (5Ј-TGAATGTAAGCGTGA- remains unclear, inhibitors of the activity of PARP1 and related CATAACTAATTACATGATGCGGCCCTCCTCTCCCAATTACCACAGG- proteins could provide new therapeutic approaches to both cancer and GAGGTC), respectively, and the 5Ј and 3Ј oligonucleotides for PARP2 were ischemia caused by reperfusion injury and inflammatory processes (12). 5YSADP2lac (5Ј-GTTAATATACCTCTATACTTTAACGTCAAGGAGAA- Kaiser et al. (31) found that the constitutive expression of PARP1 AAAACGGAATTGTGAGCGGATAACAATGGCTCCAAAGCCGAAGC- in Saccharomyces cerevisiae is only possible with simultaneous in- CCTGGGTAC) and 3YSADP2 (5Ј-TGAATGTAAGCGTGACATAACTA- hibition of ADP-ribosylation activity through the addition of the ATTACATGATGCGGCCCTCGGGCACTCAGAGGTGGACCTCCAGC), known inhibitor 3-methoxybenzamide to the growth media. Induction respectively. The oligonucleotide 5YSADP21ac contains the lacO operator of fully active PARP1 under the conditional galactose promoter led to site. PCR amplification was carried out using either Bio-X-ACT (Bioline USA growth arrest (31, 32). The growth inhibition was relieved by removal Inc., Kenilworth, NJ) or pfuTurbo (Stratagene, La Jolla, CA) high-fidelity of the NH -terminal region of PARP1 that contains the DNA-binding thermostable DNA polymerases according to the manufacturers’ instructions. 2 All oligonucleotides were designed to amplify their target cDNAs and carry domain. Yeast does not possess endogenous PARP1 activity (32), so approximately 40 bp of homology at their 5Ј ends with the yeast expression the cause of the growth arrest is unknown. Antibodies raised against vector pYES2. The pYES2 vector (Invitrogen, Carlsbad, CA) contains the polymers of poly(ADP-ribose) were used to determine that a protein yeast GAL1 promoter, CYC1 transcription terminator, 2␮ replication origin, of approximately 116,000 kDa, the size of PARP1 itself, was ADP- and the URA3 gene. ribosylated in yeast cells expressing PARP1 (31). This led to the After PCR, the amplified target cDNAs were agarose gel-purified. Approx- proposal that growth inhibition in yeast might occur through seques- imately 50 ng of target cDNA were cotransformed with approximately 200 ng tration of chromosomal proteins by the ADP-ribose-decorated PARP1 of EcoRI-digested pYES2 into W303␣, and transformants were selected for protein rather than toxicity due to direct modification of a yeast uracil prototrophy. Homologous recombination of the target cDNAs into protein by PARP (31). pYES2 was confirmed by yeast whole cell PCR. After the synthetic lethal In this work, we demonstrate that PARP2, a protein closely related phenotype of the expressed PARP1 and PARP2 was verified, plasmids from at to PARP1, also causes growth inhibition when conditionally ex- least three independent transformants were subsequently rescued into the Escherichia coli strain XL10-GOLD (Stratagene) via electroporation and pressed in yeast. The reduced growth phenotype was used as an assay further characterized by restriction enzyme analysis and DNA sequencing of to screen for novel inhibitors of these proteins by selecting those the 5Ј and 3Ј cloning junctions. These studies verified the presence of the compounds that can restore growth to yeast expressing PARP1 or desired structures. PARP2. The inhibitors identified in our screen also inhibit recombi- During the course of this work, it was noted that the pYES2-PARP2 plasmid nant PARP1 activity in vitro. Certain inhibitors show selectivity for in E. coli was toxic (data not shown), thus the primer 5YSADP2lac incorpo- PARP1 or PARP2. These compounds are the first to be reported that rated a lacO repressor-binding site: this established the plasmid during its specifically recognize PARP orthologues in cells. Our data demon- propagation in XL10-GOLD (which carries the lacIq gene). This vector con- strate the utility of yeast as a screening system to identify inhibitors of struction still exhibited instability during growth in yeast. Thus the GAL1-lac- human genes and gene families, even when the protein is not highly PARP2-CYC1 terminator cassette was recombinationally cloned into yeast ␮ Ј conserved with any yeast proteins. Thus, our purpose is not to under- URA3 2 vector YEP24 (38) using the oligonucleotides Y24smacyct (5 - TCACAAATTAGAGCTTCAATTTAATTATATCAGTTATTACCCGGGG- stand the interaction of heterologous genes with endogenous yeast GCGCGCCGCAAATTAAAGCCTTCGAGC) and Y24pvu2gal1 (5Ј-GGGC- proteins. Rather, we use the “biochemical activity” of the proteins GAGCCGCCGAAGATTAGGCAAATTTGGTCGACGGAGCGCGCAAAG- expressed in yeast to obtain inhibitors that can then be used as tools CCACTACTGCCACTTTTGGAGACTGT), effectively putting the cassettes to dissect function in a relevant mammalian assay. between the SmaI and PvuII sites of YEP24 and eliminating the tetracycline resistance gene. MATERIALS AND METHODS For compound screening and subsequent genetic testing, the PARP1 and PARP2 expression cassettes were integrated into the indicated strains using the Yeast Strains, Media, and Methods. Isogenic derivatives of the W303 S. pARC series of dual episomal/integrative plasmid constructs. A brief summary cerevisiae background were used in this study (33, 34) and are listed below. will be presented in lieu of a detailed description of the steps used to construct Yeast strains lacking the major efflux pumps PDR5 and SNQ2 were con- the pARC series of vectors. The vectors are derived from the pRS series of structed from strain YM4 (a gift of T. Lila, Microcide Pharmaceuticals) deleted vectors (39, 40). The basic elements of the pARC plasmids include a 713-bp for both via a two-step gene disruption process (35). The pdr5⌬ allele was SphI/BamHI fragment containing the S. cerevisiae GAL1 promoter and a deleted at bp 101 through 4149 of the PDR5 open reading frame, and the 243-bp Bg/II/HindIII fragment containing the GAL4 terminator region. This snq2⌬ allele was deleted for bp 235 through 4105 of SNQ2, resulting in strain region surrounds a 45-bp polylinker that contains unique sites for PstI, SalI, YPB63. To construct strain EIS20-2B, YPB63 was backcrossed to W303-1␣, SpeI, XhoI and AvaI and replaces the pRS polylinker; the base vector and and retention of the pdr5⌬ and snq2⌬ alleles was confirmed by whole cell PCR polylinker of the pRS vectors is pBluescript II. Both CEN- and 2␮-based and increased sensitivity to cyclohexamide, a toxic pump substrate (data not vectors were generated with 44 bp of the 5Ј end of the LYS2 gene (bp 8-52 of 4176

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2001 American Association for Cancer Research. NOVEL INHIBITORS OF PARP/PARP2 IDENTIFIED IN YEAST SCREEN the LYS2 ORF) and 43 bp of the 3Ј end of the LYS2 gene (bp 4133-4176 of the algorithms defining this methodology have been described previously, and LYS2 ORF) flanking the CEN-ARSH4 element or the 2␮ replication origin. In they form the basis of a rapid chemical structural similarity search method addition, SfiI sites flank the CEN-ARSH4 or 2␮ elements, such that digestion (44). The pilot library represents a small but diverse portion of the Iconix with this restriction enzyme liberates the elements and allows the subsequent collection, which is derived from multiple commercial sources. All screening integration into the endogneous LYS2 locus via a ␥ deletion mechanism (40). was done in duplicate at initial compound concentrations of 10 ␮g/ml. Cells For this work, integrants were selected for ␣-aminoadipate resistance and by were grown overnight in synthetic media with 2% glucose (repressed) to late marker prototrophy, e.g., Leuϩ or Uraϩ; integration was confirmed by PCR. logarithmic/early stationary phase. The next day, cells were washed once with

For integration of PARP1, a SpeI/MluI (the MluI site made blunt with synthetic media without a carbon source and diluted to a final A600 nm of 0.04 Klenow) GAL1-PARP1-CYC1 terminator fragment from pYES2-PARP1 was in synthetic media containing 2% galactose (induced). The diluted cells (90 ␮l) ligated into a SpeI/EcoRI-cut pARC35A, a CEN-ARSH4 LEU2 vector con- were added immediately to 96-well plates containing the test compound. The taining the original pBluescript II polylinker; these steps resulted in plasmid final volume in each well was 100 ␮l and contained DMSO at a final pARC35APARP1. Digestion with SfiI allowed integration of the PARP1 concentration of 1%. As a control, cells containing vector (YPB63 with expression cassette into the LYS2 locus. For integration of PARP2, the GAL1- integrated vector plasmid) were similarly grown, washed, and diluted to the PARP2-CYC1 terminator fragment from pYES2-PARP2 was amplified by same absorbance and then inoculated.

PCR using pfuTurbo with primers YSPRC (5Ј-GATGTATAAATGAAA- The plates were incubated at 30°C for 40-42 h, and A600 nm was read with GAAATTGAGATGGTGCACGATGCACAGTTGTGAATGTAAGCGTGA- a microtiter plate reader (Molecular Device, Menlo Park, CA) after shaking. CATAACTAATTAC, a primer containing homology at the 5Ј end to the GAL4 The effect of compounds was measured as a percentage of growth resto- terminator) and GLUAS1 (5Ј-TGAAGTACGGATTAGAAGCCGCCG, a ration using the following equation: percentage of growth restoration ϭ Ϫ Ϫ ϫ primer with homology to the GAL1 UAS element). This fragment was co- (TEST MEDarc)/(MEDvec MEDarc) 100, where TEST is A600 nm of transformed into yeast with XhoI-digested pARC25B (2␮ LEU2 GAL1 pro- the well with test compound, MEDarc is the median value of A600 nm of the moter and GAL4 terminator). As before, the recombinants were verified by cells without compound, and MEDvec is the median value of A600 nm of phenotypic analysis and PCR before rescue into E. coli. The resulting vector-containing cells. Compounds showing Ն10% of growth restoration in pARC25BPARP2 plasmid was digested with SfiI and integrated into the LYS2 duplicate tests were scored as hits. locus. Hit Confirmation. Hit compounds identified from the primary screening Phenotypic expression of the PARP1 and PARP2 clones was confirmed by were confirmed by generating a dose-response curve using YAN100 cells constructing green fluorescent protein fusions to the COOH-terminal end of expressing either PARP1 or PARP2. For the confirmation test, the compounds the proteins using green fluorescent protein-KanMX cassettes (41–43). Ex- were solubilized from powder and serially diluted (usually from 128 ␮M to pression was assessed via fluorescence microscopy and Western blot analysis. 0.125 ␮M). The compounds were tested against a vector control strain All active site mutations were confirmed by sequencing. (YAN100 carrying the integrated vector) and other isogenic strains expressing PARG was isolated and cloned using primers 5YSPARG (5Ј-GTTAATAT- different cDNAs that also elicit synthetic lethal phenotypes but are not related ACCTCTATACTTTAACGTCAAGGAGAAAAAACATGAATGCGGGC- to PARP1. CCCGGCTGTGAACC) and 3YSPARG (5Ј-TGAATGTAAGCGTGACATA- ACTAATTACATGATGCGGCCCTCTCAGGTCCCTGTCCTTTGCCCTG- RESULTS AATGGTC) to amplify the complete ORF from a testes cDNA library (37). The purified PCR product was cotransformed with digested pYES2 plasmid Growth Inhibition of Yeast Cells Expressing the Human Genes into EIS20-2B, and the resulting recombinants were confirmed using whole PARP1 or PARP2 Is Relieved by Mutations in the Active Site. As cell PCR. Transformed isolates were subsequently reisolated and transformed shown in Fig. 1, yeast harboring an expression vector carrying the into E. coli XL10-GOLD and confirmed by restriction enzyme analysis result- cDNA for wild-type PARP1 or PARP2 grew in 2% glucose (unin- ing in plasmid pYES2-PARG. To assess whether expressed PARG could duced), but PARP1 or PARP2 expression caused growth inhibition suppress the synthetic lethality caused by PARP1 and PARP2, plasmid when the cells were grown in 2% galactose (induced). To ascertain pYES2-PARG was transformed into EIS20-2B cells containing an integrated chromosomal copy of PARP1 or PARP2. Purified transformants were subse- whether the inhibitory effect of PARP1 and PARP2 expression on quently inoculated into galactose-containing media, and their growth was yeast cell growth depends on their catalytic activity, a single mutation assayed. was generated in the conserved active site of the two enzymes. For PARP Activity Assays. A PARP Activity Assay Kit (Trevigen, Inc., PARP1, a glutamic acid was changed to an alanine at residue 988 Gaithersburg, MD) was used to measure the functional activity of human (E988A), and the analogous change was engineered at residue 509 PARP1 and PARP2. Human PARP1 (supplied in the PARP Activity Assay Kit (E509A) in PARP2. Yeast expressing the mutant constructs grew from Trevigen, Inc.) or crude cell extracts of yeast expressing a cDNA equally well in 2% glucose or 2% galactose. Thus, the growth inhi- encoding the full-length human PARP1 or PARP2 gene were used in the assay. Activity was measured by determining the level of incorporation of radiolabeled NAD in a TCA-precipitable polymer composed of ADP-ribose units. Crude cell lysates were prepared as described by Collinge and Althaus (32). Protein concentrations were determined using the Bio-Rad Protein Assay Kit (Bio-Rad Inc., Hercules, CA). Quantitative values for PARP activity were determined by scintillation counting of the acid-insoluble counts using 20 ␮g of total protein from crude cell lysates in a reaction containing 1 mM NAD, 1 mg/ml histones, 2 mCi 32P NAD, and 10 ␮g of sheared salmon testes DNA. The timed enzymatic reaction was initiated by the addition of the cell lysates, incubated at room temperature, and stopped by the addition of 20% TCA to precipitate ribosylated proteins. The protein precipitate was suspended in liquid scintillation fluid and analyzed using a scintillation counter. Each reaction was done in triplicate, and the results are shown as the mean counts/min. Compound Screening of PARP1 and PARP2 Inhibitors. Strain YPB63 containing integrated PARP1 was screened against a pilot library of 16,000 low molecular weight organic compounds as well as 22 compounds chosen based Fig. 1. Expression of wild-type PARP1 or PARP2 causes a strong inhibition of on computed three-dimensional structural similarity to the known inhibitor growth in S. cerevisiae that is dependent on the catalytic activity of the two proteins. S. cerevisiae expressing either wild-type PARP1 or PARP2 or a catalytically inactive mutant 6(5H)-phenanthridinone. The 22 computationally selected compounds were was grown in 2% glucose (repressed) or 2% galactose media (induced), and their growth chosen from the Iconix corporate library, based on molecular similarity. The was analyzed. 4177

known chemical inhibitor 6(5H)-phenanthridinone would reverse the growth inhibition (Fig. 3). Yeast carrying a chromosomal copy of PARP1, PARP2, or no human cDNA was exposed to varying concentrations of 6(5H)-phenanthridinone (0–128 ␮M; experiments performed in triplicate). Cell growth was restored when yeast was exposed to increasing concentrations of 6(5H)-phenanthridinone; the ␮ ␮ EC50 value was 10.2 M for PARP1 and 36.3 M for PARP2. Analogues of 6(5H)-Phenanthridinone Do Not Discriminate between PARP1 and PARP2. The ability of computationally chosen analogues of 6(5H)-phenanthridinone to reverse the growth inhibition caused by PARP1 and PARP2 expression was measured. Six of the 22 chosen analogues were active and restored growth of yeast strains expressing PARP1 (three are shown in Fig. 4: ICX56316703, Fig. 2. The expression of PARG in yeast alleviates the growth inhibition caused by ICX56259835, and ICX56274004). Not surprisingly, as in the case of PARP1. Yeast cells carrying integrated copies of PARP1 or PARP2 under control of the inducible GAL1 promoter were grown in glucose or 2% galactose. Their growth was the known PARP1 inhibitor compound 6(5H)-phenanthridinone, the analyzed in the presence of episomally expressed PARG also under control of the GAL1 three active analogues also restored the growth of PARP2-expressing promoter or a vector control. yeast to a similar degree. Sensitivity of Yeast to Analogues of 6(5H)-phenanthridinone Is Increased in Strains Lacking the Two Major Efflux Pumps, PDR5 bition observed in yeast requires the catalytically active form of and SNQ2. To optimize the sensitivity of the yeast strain to the PARP1 or PARP2. Fluorescence microscopy revealed that expressed screening compounds, mutations were made in the two efflux pumps, mammalian PARP1 and PARP2 accumulated in the nucleus (data not PDR5 and SNQ2 (45). Pdr5p and Snq2p are the major efflux pumps shown). in S. cerevisiae that confer resistance to several unrelated fungal Yeast cell growth was severely inhibited when PARP1 and PARP2 growth inhibitors. To examine whether yeast strains lacking these two were expressed episomally or from a chromosomal locus (see Figs. 1 major transporters were more sensitive to the active analogues of and 2). In our initial characterization of the growth phenotype caused 6(5H)-phenanthridinone, the activity of the analogues with respect to by PARP1 or PARP2, the genes were episomally expressed but were their ability to restore growth to yeast expressing PARP1 was evalu- integrated for compound screening. ated in pdr5⌬ and snq2⌬ strains (YPB63, which lacks the two pumps) Expression of Human PARG in Yeast Reverses the Growth or (W303, wild-type for PDR5 and SNQ2; see Fig. 5). Inhibition Caused by PARP1 or PARP2 Expression. To determine Whereas four analogues showed a similar effect on growth resto- whether PARG reverses the growth defect caused by human PARP1 ration regardless of the presence or absence of the two efflux pumps or PARP2 expressed in yeast, we conditionally coexpressed PARG (data not shown), yeast lacking the efflux pumps were more respon- from a high-copy plasmid in yeast cells carrying an integrated copy of sive to 6(5H)-phenanthridinone, ICX56209576, and ICX56242099 PARP1 or PARP2 also under control of the inducible galactose than wild-type yeast (Fig. 5). The results underscore that the use of promoter. Yeast cells were grown in glucose medium (uninduced) and yeast strains lacking efflux pumps for screening compounds is bene- then switched to 2% galactose (induced) for 40 h in synthetic media ficial in some cases. lacking uracil. As a control, yeast carrying an integrated copy of Potential Selectivity Is Observed among the Compounds Iden- PARP1 or PARP2 and harboring a high-copy plasmid with no cDNA tified as Hits in the Yeast Cell-based Screen. To identify new was also tested for growth in glucose and galactose media. Fig. 2 classes of inhibitors, we screened the yeast strain carrying integrated shows the growth of yeast in the presence and absence of PARG expression. Yeast expressing PARP1 or PARP2 alone only grew at approximately 1% of the normal wild-type growth levels. However, when PARG was expressed in the presence of PARP1 and PARP2, growth was restored to approximately 70% of wild-type levels. As shown in Fig. 2, PARG expression alone had little effect on the growth rate of yeast (compare the growth in no integrated cDNA grown in glucose and galactose medium). It is likely that PARG expression reverses the deleterious effects of PARP expression by catabolizing the ADP-ribose polymers created by PARP. The inability of PARG expression to completely counteract the effect of PARP1 expression might be due to the residual ADP-ribose monomer that is removed in mammalian cells by an ADP-ribosyl protein lyase (4). A Known Inhibitor of PARP1, Phenanthridinone, Reversed the Growth Inhibition Caused by the Expression of PARP1 and PARP2, Thereby Validating the Assay. To screen for small molecule inhibitors of PARP1 and PARP2, yeast strains expressing these genes from a chromosomal locus were used. The chromosomal expression of the genes increases the robustness of the screen by not allowing variation of plasmid copy number. To further validate that the phenotype of growth inhibition ob- Fig. 3. A known inhibitor of PARP1, 6(5H)-phenanthridinone, reverses the growth served in the integrated strains was due to the activity of PARP1 and inhibition caused by PARP1 and PARP2 expression in S. cerevisiae. Cells expressing PARP2 and that this phenotype would be amenable to compound PARP1 or PARP2 were exposed to varying concentrations of the inhibitor 6(5H)- phenanthridinone, and the percentage of growth restoration was analyzed. The EC50 is screening (i.e., reversed by compounds), we determined whether the 10.2 ␮M for PARP1-expressing cells and 36.3 ␮M for PARP2-expressing cells. 4178

Fig. 4. 6(5H)-Phenanthridinone, computationally chosen analogues, and most of the screening hits show similar efficacy on PARP1 and PARP2. The growth inhibition caused by PARP1 expression in yeast was used to screen for novel inhibitors of this protein by selecting those compounds that can restore growth to yeast expressing PARP1. Ten hits were identified, and their structures are displayed in the figure, along with that of the known inhibitor 6(5H)-phenanthridinone and a few computationally chosen analogues. The structure of the compounds tested is shown along with the EC50 value for both PARP1- and PARP2-expressing cells. ND (not determined) indicates that the compound was not tested against PARP2-expressing cells. NA (not active) indicates that the compound has no effect on growth restoration of yeast up to the highest concentrations tested (128 ␮M). For some compounds, an accurate EC50 could not be determined because at the highest compound concentrations tested (limited by solubility), the growth restoration was linear, making a curve fit to a four-parameter logistic equation impossible.

Fig. 5. Yeast lacking the two major efflux pumps PDR5 and SNQ2 show increased sensitivity to screening compounds. Normal yeast strains or strains carrying a deletion of the two efflux pumps PDR5 and SNQ2 and expressing PARP1 were grown in galactose medium to induce PARP1 expression. The strains were exposed to increasing concentrations of the known inhibitor 6(5H)- phenanthridinone and two analogues, ICX56242099 and ICX56209576. The level of growth restoration at different concentrations of the compounds is plotted.

4179

PARP1 against a 16,000-member pilot library of small organic “drug- like” compounds for their ability to restore growth while PARP1 was expressed (in the presence of galactose). Ten hits showed dose- dependent growth restoration on cells expressing PARP1 (see Figs. 4 and 7; the computationally chosen analogue ICX56259835 was also identified as a screening hit). We then tested the ability of the confirmed hits to restore growth to yeast expressing PARP2. Those values in Fig. 4 labeled NA were compounds that were found to have no activity against PARP2 at the highest concentration tested (128 ␮M), and ND (not determined) refers to those compounds that were not tested under the specific conditions in Fig. 4. Unlike the results observed for the analogues of 6(5H)-phenanthridinone, some of the 10 compounds identified by screening showed patterns suggestive of selectivity for PARP1 or PARP2 (Fig. 4). One inhibitor class showed modest potency (ICX56225770, ICX56244215, and ICX56280834), whereas one compound in this group, ICX56290675, had a higher potency and showed some selectivity for PARP1. ICX56222404 and ICX56259537 are novel inhibitors with more pronounced selectivity for PARP1. Finally, ICX56258231 showed potential selectivity for PARP2 (Fig. 6). Al- though a difference in the level of growth restoration was observed for PARP1 versus PARP2 in the presence of ICX56258231, an accurate

EC50 value for PARP1 could not be determined. Normally this value is derived from a curve fit to a four-parameter logistic equation, but in this case, at the highest concentration of soluble compound, a plateau in the growth restoration curve was not reached. Compounds That Restored Growth in the Yeast Cell-based Assay Inhibit Purified PARP1 in Vitro. To clarify whether the small molecules identified in screening directly inhibited PARP1 activity, the hits were tested for their ability to inhibit human recombinant PARP1 in a biochemical assay. This assay measures the incorporation of radiolabeled ribose derived from NAD into PARP1. Base- line activity was established by measuring incorporation from the radiolabeled ribose in the absence of the inhibitors. Dose-response curves were constructed for three of the compound hits (ICX56304405, ICX56290675, and ICX56258231) and included 6(5H)-phenanthridinone and its inactive analogue, ICX56225328 (Fig. 7). These results show clearly that the compounds identified in the yeast screen are direct inhibitors of PARP1. Compounds That Restored Growth Activity Also Inhibit the Activity of PARP1 and PARP2 from Yeast Cell Extracts. The activity of PARP1 or PARP2 in extracts from cells grown to log phase Fig. 6. Structures and activities of compounds with potential selectivity for PARP over8hin2%glucose (uninduced) was negligible. However, cells isoforms. Two hits identified by screening showed selectivity for either PARP1 or PARP2, and their dose-response curves are shown in the figure. The EC50 value for yeast grown under similar conditions but in the presence of 2% galactose expressing PARP1 by extrapolation is approximately 60 ␮M, but an exact value could not (induced) showed an increase of 20-fold for PARP1 activity and be calculated, as discussed in “Results.” The PARP1 hits were tested on yeast expressing PARP2, and ICX56258231 (A) showed a higher activity against PARP2 than PARP1, 10-fold for PARP2 activity (Fig. 8). The screening compounds were whereas ICX56259537, (B) showed a higher efficacy for PARP1. then tested for their ability to inhibit the activity of PARP1 and PARP2 observed in the yeast extracts. All the compounds inhibited PARP activity as effectively as the known inhibitor with the exception or PARP2 expression is dependent on their catalytic activity, thereby of the inactive analogue, ICX56225328 (Fig. 9). constituting valid screens for small molecule inhibitors of PARP and its family members. The small molecules that have been identified by DISCUSSION their ability to alleviate the growth interference caused by PARP expression in yeast also inhibit mammalian PARP in a biochemical PARP1 and PARP2 cause an interference in cell growth when assay and PARP1 and PARP2 activity in yeast cell extracts. expressed in yeast that can be alleviated by making a single point The chemical inhibitors found in this study confirm previous re- mutation in a conserved residue within the active site or by exposing ports of small molecule PARP1 inhibitors found using other methods the cells to the known inhibitor 6(5H)-phenanthridinone. The glyco- and demonstrate the possibility of previously unreported selective hydrolase PARG, which removes ADP-ribose units from PARP in inhibition of PARP isoforms. The phenanthridinone analogues se- vivo, also reverses the growth phenotype when coexpressed with lected from our corporate library using a chemoinformatic approach PARP1 or PARP2 in yeast. We have identified a number of small were mainly of the phthalazinone class (Fig. 4). This nonselective molecule inhibitors of the mammalian proteins PARP1 and PARP2 class of inhibitors has been described previously and served to con- using a yeast cell-based assay based on growth interference. Our data firm and validate our screening approach. More interesting com- show that the growth defect observed in yeast as a function of PARP1 pounds were uncovered in the pilot screen (Fig. 6) in terms of both 4180

that occur during normal metabolism, replication, and mitosis stimu- late PARP activation in yeast. In mammalian cells, when DNA damage is severe, high levels of ADP-ribosylation result in a depletion of cellular NAD stores. Low NAD levels result in a failure of cellular metabolism and cell death through apoptosis (3, 4). However, previous investigators have shown that the NAD levels of yeast remain unchanged when PARP is expressed, suggesting that the growth interference is not due to depletion of NAD levels and subsequent effects on cellular metabolism (31, 32). Many researchers have expressed foreign proteins in yeast to identify those that functionally complement a yeast mutation (46–48). This approach requires the metabolic pathway affected by the yeast mutation to overlap with a conserved pathway in metazoans. The ability of a foreign protein to replace a yeast protein allows one to study variants of the human protein in a genetically tractable orga- nism. These variants can be in the form of mutants up-regulated in a specific disease tissue or genes containing nucleotide polymorphisms. However, yeast is not limited to the study of processes that are conserved between metazoans and yeast. Investigators have shown that yeast can be used to identify novel members of the apoptotic pathway, even though no such process exists in unicellular organisms Fig. 7. Activity of inhibitors in a PARP enzymatic activity assay. Recombinant PARP1 was assayed by determining the level of incorporation of radiolabeled NAD in a (49–52). These investigators were able to identify two mammalian TCA-precipitable polymer composed of ADP-ribose units. All compounds identified by genes, using a screen based on growth interference in yeast, that screening the yeast cell-based assay inhibited the activity of PARP1 in vitro. An inactive inhibit the induction of apoptosis in mammalian cells (49, 52). As in analogue of 6(5H)-phenanthridinone did not inhibit the activity of PARP1. the case for BAX and BCL2, the yeast genome does not encode a protein with similarity to PARP. Growth interference phenotypes have not been as widely used as complementation assays for compound screening. A benefit of our screen is the elimination of false positives caused by toxic compounds because toxic compounds do not restore growth in yeast. One criticism is that growth interference phenotypes caused by the expression of a mammalian cDNA might not reflect the normal activity of the encoded protein. Therefore, screening such an assay for compounds that reverse the growth interference phenotype might not be relevant if they do not inhibit the mammalian protein but inhibit a yeast protein instead. We have routinely shown that

Fig. 8. PARP1 and PARP2 activity is detected in yeast cell extracts. PARP1 and PARP2 activity from yeast cell extracts was assayed by determining the level of incorporation of radiolabeled NAD in a TCA-precipitable polymer composed of ADP-ribose units. No significant PARP1 or PARP2 activity was detected in glucose medium (PARP expression repressed), but when cells were grown in galactose medium (expression of PARP1 and PARP2 induced), activity was observed. potential selectivity of inhibition and chemical structure. The known phthalazinone (ICX56225770) and quinazolinone (ICX56244215, ICX56280834, ICX56290675, and ICX56304405) inhibitor classes showed modest potency. For one compound, ICX56290675, some selectivity for PARP1 was observed. The thiochromenone ICX56222404 and the benzothiazinone ICX56259537 are novel inhibitors with what appears to be more pronounced selectivity for PARP1. Finally, the results for the substituted phthalazine ICX56258231 suggest selectivity for PARP2. As discussed above, we have determined that the growth interference caused by PARP1 and PARP2 is due to their poly(ADP)-ribosylation activity. Normally the catalytic activity of PARP1 in mammalian cells is activated by double-strand DNA breaks. What activates PARP1 and PARP2 in yeast Fig. 9. Cell extracts from yeast expressing PARP1 or PARP2 display activity that is and the mechanism of the observed growth inhibition are less clear. inhibited by exposure to the PARP1 inhibitors identified in yeast and to 6(5H)-phenan- Kaiser et al. (31) have shown that truncation of the NH terminus thridinone. The inhibitors of PARP1 and PARP2 identified in screening that inhibit 2 PARP1 activity in vitro also inhibited the activity of PARP1 and PARP2 in yeast cell containing the DNA-binding domain of PARP has no effect on the extracts. An inactive analogue of 6(5H)-phenanthridinone did not inhibit the activity of nuclear localization of PARP1, but can no longer cause growth either PARP1 or PARP2. The names of the different compounds tested are displayed on the X axis of the histogram. Values are calculated as a percentage of the activity of PARP1 interference in yeast. These results imply that the catalytic activity of or PARP2 in wild-type yeast expressing PARP1 or PARP2 (percentage of activity PARP1 requires DNA binding in yeast. Perhaps chromosomal breaks normalized to a DMSO control). The concentration of the inhibitors used is 10 ␮M. 4181

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2001 American Association for Cancer Research. NOVEL INHIBITORS OF PARP/PARP2 IDENTIFIED IN YEAST SCREEN active site mutations eliminate the growth interference in yeast 16. Ame, J. C., Rolli, V., Schreiber, V., Niedergang, C., Apiou, F., Decker, P., Muller, S., caused by a wide variety of mammalian enzyme types; the active Hoger, T., Menissier-de Murcia, J., and de Murcia, G. PARP-2, a novel mammalian DNA damage-dependent poly(ADP-ribose) polymerase. J. Biol. Chem., 274: 17860– site mutation thus directly connects the biochemical activity of the 17868, 1999. introduced mammalian protein to its growth-interfering activity. In 17. Johansson, M. A human poly(ADP-ribose) polymerase gene family (ADPRTL): cDNA cloning of two novel poly(ADP-ribose) polymerase homologues. Genomics, addition, we have tested a number of different families of mam- 57: 442–445, 1999. malian proteins and found many that cause growth interference in 18. Kickhoefer, V. A., Siva, A. C., Kedersha, N. L., Inman, E. M., Ruland, C., Streuli, M., yeast, e.g., kinases, small GTPases, and guanine exchange factors and Rome, L. H. The 193-kD vault protein, VPARP, is a novel poly(ADP-ribose) polymerase. J. Cell Biol., 146: 917–928, 1999. (data not shown). For those proteins for which a biochemical assay 19. Sallmann, F. R., Vodenicharov, M. D., Wang, Z. Q., and Poirier, G. G. Character- is available, we have tested the screening hits and observed that ization of sPARP-1. An alternative product of PARP-1 gene with poly(ADP-ribose) they act directly on the human protein;3 oftentimes the rank order polymerase activity independent of DNA strand breaks. J. Biol. Chem., 275: 15504– 15511, 2000. potency is preserved. 20. Smith, S., Giriat, I., Schmitt, A., and de Lange, T. Tankyrase, a poly(ADP-ribose) Our study demonstrates the usefulness of yeast growth interference polymerase at human telomeres. Science (Wash. DC), 282: 1484–1487, 1998. assays for the identification of chemicals that block the activity of a 21. d’Adda di Fagagna, F., Hande, M. P., Tong, W. M., Lansdorp, P. M., Wang, Z. Q., and Jackson, S. P. Functions of poly(ADP-ribose) polymerase in controlling telomere human protein causing the growth defect. This same approach was length and chromosomal stability. Nat. Genet., 23: 76–80, 1999. used to screen for inhibitors of the influenza M2 ion channel, a viral 22. Kong, L. B., Siva, A. C., Rome, L. H., and Stewart, P. L. Structure of the vault, a protein that results in lethality when expressed in yeast (53). We have ubiquitous cellular component. Structure Fold Des., 7: 371–379, 1999. 23. Pennisi, E. A possible new partner for telomerase. Science (Wash. DC), 282: used cell-based assays to identify compounds that inhibit two mem- 1395–1396, 1999. bers of the PARP family. We have shown that using these assays, we 24. Smith, S., and de Lange, T. Tankyrase promotes telomere elongation in human cells. can identify compounds that specifically inhibit the biochemical ac- Curr. Biol., 10: 1299–1302, 2000. 25. Kickhoefer, V. A., Rajavel, K. S., Scheffer, G. L., Dalton, W. S., Scheper, R. J., and tivity of the mammalian protein in vitro and from yeast cell extracts. Rome, L. H. Vaults are up-regulated in multidrug-resistant cancer cell lines. J. Biol. By using two members of the PARP family, we have also shown that Chem., 273: 8971–8974, 1998. our assays are sensitive enough to detect structural activity differences 26. Schroeijers, A. B., Siva, A. C., Scheffer, G. L., de Jong, M. C., Bolick, S. C., Dukers, D. F., Slootstra, J. W., Meloen, R. H., Wiemer, E., Kickhoefer, V. A., Rome, L. H., between a few compounds. Thus, the yeast cell-based assay is excel- and Scheper, R. J. The Mr 193,000 vault protein is up-regulated in multidrug-resistant lent as a means to assay mammalian proteins, even if there is no cancer cell lines. Cancer Res., 60: 1104–1110, 2000. 27. Ame, J. C., Jacobson, E. L., and Jacobson, M. K. Molecular heterogeneity and counterpart in yeast. These assays potentially allow differentiation of regulation of poly(ADP-ribose) glycohydrolase. Mol. Cell Biochem., 193: 75–81, compound sensitivity of family members and thus define structure- 1999. activity relationships important in the development of specific 28. Lin, W., Ame, J. C., Aboul-Ela, N., Jacobson, E. L., and Jacobson, M. K. Isolation and characterization of the cDNA encoding bovine poly(ADP-ribose) glycohydrolase. inhibitors. J. Biol. Chem., 272: 11895–11901, 1997. 29. Pacheco-Rodriguez, G., and Alvarez-Gonzalez, R. Measurement of poly(ADP-ribose) glycohydrolase activity by high resolution polyacrylamide gel electrophoresis: spe- REFERENCES cific inhibition by histones and nuclear matrix proteins. Mol. Cell. Biochem., 193: 13–18, 1999. 1. Choi, D. W. At the scene of ischemic brain injury: is PARP a perp? Nat. Med. 3: 30. Shimokawa, T., Masutani, M., Nagasawa, S., Nozaki, T., Ikota, N., Aoki, Y., 1073–1074, 1997. Nakagama, H., and Sugimura, T. Isolation and cloning of rat poly(ADP-ribose) 2. Jeggo, P. A. DNA repair: PARP—another guardian angel? Curr. Biol., 8: R49–R51, glycohydrolase: presence of a potential nuclear export signal conserved in mamma- 1998. lian orthologs. J. Biochem. (Tokyo), 126: 748–755, 1999. 3. Pieper, A. A., Verma, A., Zhang, J., and Snyder, S. H. Poly(ADP-ribose) polymerase, 31. Kaiser, P., Auer, B., and Schweiger, M. Inhibition of cell proliferation in Saccharo- nitric oxide and cell death. Trends Pharmacol. Sci., 20: 171–181, 1999. myces cerevisiae by expression of human NADϩ ADP-ribosyltransferase requires the 4. D’Amours, D., Desnoyers, S., D’Silva, I., and Poirier, G. G. Poly(ADP-ribosyl)ation DNA binding domain (“zinc fingers”). Mol. Gen. Genet., 232: 231–239, 1992. reactions in the regulation of nuclear functions. Biochem. J., 342: 249–268, 1999. 32. Collinge, M. A., and Althaus, F. R. Expression of human poly(ADP-ribose) polym- 5. Mendoza-Alvarez, H., and Alvarez-Gonzalez, R. Poly(ADP-ribose) polymerase is a erase in Saccharomyces cerevisiae. Mol. Gen. Genet., 245: 686–693, 1994. catalytic dimer and the automodification reaction is intermolecular. J. Biol. Chem., 33. Thomas, B. J., and Rothstein, R. The genetic control of direct-repeat recombination 268: 22575–22580, 1993. in Saccharomyces; the effect of rad52 and rad1 on mitotic recombination at GAL10, 6. Burkart, V., Wang, Z. Q., Radons, J., Heller, B., Herceg, Z., Stingl, L., Wagner, E. F., a transcriptionally regulated gene. Genetics, 123: 725–738, 1989. and Kolb, H. Mice lacking the poly(ADP-ribose) polymerase gene are resistant to ␤ 34. Thomas, B. J., and Rothstein, R. Elevated recombination rates in transcriptionally pancreatic -cell destruction and diabetes development induced by streptozocin. Nat. active DNA. Cell, 56: 619–630, 1989. Med., 5: 314–319, 1999. 35. Orr-Weaver, T. L., Szostak, J. W., and Rothstein, R. J. Genetic applications of yeast 7. Masutani, M., Nozaki, T., Nakamoto, K., Nakagama, H., Suzuki, H., Kusuoka, O., transformation with linear and gapped plasmids. Methods Enzymol., 101: 228–245, Tsutsumi, M., and Sugimura, T. The response of Parp knockout mice against DNA 1983. damaging agents. Mutat. Res., 462: 159–166, 2000. 36. Sherman, F. Getting started with yeast. Methods Enzymol., 194: 3–21, 1991. 8. Masutani, M., Suzuki, H., Kamada, N., Watanabe, M., Ueda, O., Nozaki, T., Jishage, 37. Perkins, E. L., Sterling, J. F., Hashem, V. I., and Resnick, M. A. Yeast and human K., Watanabe, T., Sugimoto, T., Nakagama, H., Ochiya, T., and Sugimura, T. genes that affect the Escherichia coli SOS response. Proc. Natl. Acad. Sci. USA, 96: Poly(ADP-ribose) polymerase gene disruption conferred mice resistant to streptozo- 2204–2209, 1999. tocin-induced diabetes. Proc. Natl. Acad. Sci. USA, 96: 2301–2304, 1999. 38. Botstein, D., Falco, S. C., Stewart, S. E., Brennan, M., Scherer, S., Stinchcomb, D. T., 9. Lindahl, T., Satoh, M. S., Poirier, G. G., and Klungland, A. Post-translational Struhl, K., and Davis, R. W. Sterile host yeasts (SHY): a eukaryotic system of modification of poly(ADP-ribose) polymerase induced by DNA strand breaks. Trends Biochem. Sci., 20: 405–411, 1995. biological containment for recombinant DNA experiments. Gene (Amst.), 8: 17–24, 10. Decker, P., Miranda, E. A., de Murcia, G., and Muller, S. An improved nonisotopic 1979. test to screen a large series of new inhibitor molecules of poly(ADP-ribose) polym- 39. Christianson, T. W., Sikorski, R. S., Dante, M., Shero, J. H., and Hieter, P. Multi- erase activity for therapeutic applications. Clin. Cancer Res., 5: 1169–1172, 1999. functional yeast high-copy-number shuttle vectors. Gene (Amst.), 110: 119–122, 11. Holl, V., Coelho, D., Weltin, D., Hyun, J. W., Dufour, P., and Bischoff, P. Modulation 1992. of the antiproliferative activity of anticancer drugs in hematopoietic tumor cell lines 40. Sikorski, R. S., and Hieter, P. A system of shuttle vectors and yeast host strains by the poly(ADP-ribose) polymerase inhibitor 6(5H)-phenanthridinone. Anticancer designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics, Res., 20: 3233–3241, 2000. 122: 19–27, 1989. 12. Szabo, C., and Dawson, V. L. Role of poly(ADP-ribose) synthetase in inflammation 41. Longtine, M. S., McKenzie, A., III, Demarini, D. J., Shah, N. G., Wach, A., Brachat, and ischaemia-reperfusion. Trends Pharmacol. Sci., 19: 287–298, 1998. A., Philippsen, P., and Pringle, J. R. Additional modules for versatile and economical 13. Takahashi, K., Pieper, A. A., Croul, S. E., Zhang, J., Snyder, S. H., and Greenberg, PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast, 14: J. H. Post-treatment with an inhibitor of poly(ADP-ribose) polymerase attenuates 953–961, 1998. cerebral damage in focal ischemia. Brain Res., 829: 46–54, 1999. 42. Wach, A., Brachat, A., Alberti-Segui, C., Rebischung, C., and Philippsen, P. Heter- 14. Shall, S., and de Murcia, G. Poly(ADP-ribose) polymerase-1: what have we learned ologous HIS3 marker and GFP reporter modules for PCR-targeting in Saccharomyces from the deficient mouse model? Mutat. Res., 460: 1–15, 2000. cerevisiae. Yeast, 13: 1065–1075, 1997. 15. Jacobson, M. K., and Jacobson, E. L. Discovering new ADP-ribose polymer cycles: 43. Wach, A., Brachat, A., Pohlmann, R., and Philippsen, P. New heterologous modules protecting the genome and more. Trends Biochem. Sci., 24: 415–417, 1999. for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast, 10: 1793–1808, 1994. 44. Jain, A. N. Morphological similarity: a 3D molecular similarity method correlated 3 Unpublished observations. with protein-ligand recognition. J. Comput. Aided Mol. Des., 14: 199–213, 2000. 4182

45. Kolaczkowski, M., Kolaczowska, A., Luczynski, J., Witek, S., and Goffeau, A. In 50. Greenhalf, W., Stephan, C., and Chaudhuri, B. Role of mitochondria and C-terminal vivo characterization of the drug resistance profile of the major ABC transporters and membrane anchor of Bcl-2 in Bax induced growth arrest and mortality in Saccharo- other components of the yeast pleiotropic drug resistance network. Microb. Drug myces cerevisiae. FEBS Lett., 380: 169–175, 1996. Resist., 4: 143–158, 1998. 51. Sato, T., Hanada, M., Bodrug, S., Irie, S., Iwama, N., Boise, L. H., Thompson, C. B., 46. Becker, D. M., Fikes, J. D., and Guarente, L. A cDNA encoding a human CCAAT- Golemis, E., Fong, L., and Wang, H. G. Interactions among members of the Bcl-2 binding protein cloned by functional complementation in yeast. Proc. Natl. Acad. Sci. protein family analyzed with a yeast two-hybrid system (published erratum appears in USA, 88: 1968–1972, 1991. Proc. Natl. Acad. Sci. USA, 92: 2016, 1995). Proc. Natl. Acad. Sci. USA, 91: 47. Jonassen, T., Marbois, B. N., Kim, L., Chin, A., Xia, Y. R., Lusis, A. J., and Clarke, 9238–9242, 1994. C. F. Isolation and sequencing of the rat Coq7 gene and the mapping of mouse Coq7 52. Shaham, S., Shuman, M. A., and Herskowitz, I. Death-defying yeast identify novel to chromosome 7 (published erratum appears in Arch. Biochem. Biophys., 335: 227, apoptosis genes. Cell, 92: 425–427, 1998. 1996). Arch. Biochem. Biophys., 330: 285–289, 1996. 53. Kurtz, S., Luo, G., Hahnenberger, K. M., Brooks, C., Gecha, O., Ingalls, K., 48. Tugendreich, S., Bassett, D. E., Jr., McKusick, V. A., Boguski, M. S., and Hieter, P. Numata, K., and Krystal, M. Growth impairment resulting from expression of Genes conserved in yeast and humans. Hum. Mol. Genet., 3: 1509–1517, 1994. influenza virus M2 protein in Saccharomyces cerevisiae: identification of a novel 49. Greenhalf, W., Lee, J., and Chaudhuri, B. A selection system for human apoptosis inhibitor of influenza virus. Antimicrob. Agents Chemother., 39: 2204–2209, inhibitors using yeast. Yeast, 15: 1307–1321, 1999. 1995.

4183

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2001 American Association for Cancer Research. Novel Inhibitors of Poly(ADP-ribose) Polymerase/PARP1 and PARP2 Identified Using a Cell-based Screen in Yeast

Ed Perkins, Dongxu Sun, Allen Nguyen, et al.

Cancer Res 2001;61:4175-4183.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/61/10/4175

Cited articles This article cites 52 articles, 17 of which you can access for free at: http://cancerres.aacrjournals.org/content/61/10/4175.full#ref-list-1

Citing articles This article has been cited by 8 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/61/10/4175.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/61/10/4175. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.