This is the pre print version of the following article: Pasin F. Biotechnol J. 2021 Jan 7:e2000354, which has been published in final form at https://doi.wiley.com/10.1002/biot.202000354. This article may be used for non-commercial purposes in accordance with Wiley Terms and Conditions for Use of Self-Archived Versions.
Oligonucleotide abundance biases aid design of a type IIS synthetic genomics framework with plant virome capacity
Fabio Pasin 1,2
1School of Science, University of Padova, Padova, Italy 2Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan
Correspondence: Fabio Pasin (e-mail: < [email protected] >; ORCID ID: 0000-0002- 9620-4301)
Keywords: DNA chemical synthesis; Golden Gate cloning; plant virome; type IIS restriction enzyme; viral infectious clone assembly
Summary. Novel methodological concepts for biosystems engineering are necessary to meet the ever - increasing human needs. In this study, compositional biases of biological sequences have been identified and exploited to design SynViP - a synthetic genomics framework with plant virome capacity. SynViP allowed rescue of a genuine virus based on a digital template and it has the potential to greatly accelerate the biological characterization and engineering of plant viruses and derived biotechnologies.
Correspondence: [email protected] 1/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354
ABSTRACT Synthetic genomics-driven dematerialization of genetic resources facilitates flexible hypothesis testing and rapid product development. Biological sequences have compositional biases, which, I reasoned, could be exploited for engineering of enhanced synthetic genomics systems. In proof-of-concept assays reported herein, the abundance of random oligonucleotides in viral genomic components was analyzed and used for the rational design of a synthetic genomics framework with plant virome capacity (SynViP). Type IIS endonucleases with low abundance in the plant virome, as well as Golden Gate and No See’m principles were combined with DNA chemical synthesis for seamless viral clone assembly by one-step digestion-ligation. The framework described does not require subcloning steps, is insensitive to insert terminal sequences, and was used with linear and circular DNA molecules. Based on a digital template, DNA fragments were chemically synthesized and assembled by one-step cloning to yield a scar-free infectious clone of a plant virus suitable for Agrobacterium -mediated delivery. SynViP allowed rescue of a genuine virus without biological material, and has the potential to greatly accelerate biological characterization and engineering of plant viruses as well as derived biotechnological tools. Finally, computational identification of compositional biases in biological sequences might become a common standard to aid scalable biosystems design and engineering.
Correspondence: [email protected] 2/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354
1. INTRODUCTION Viruses are relatively simple biological entities, with genomic components whose size is compatible both in terms of technical feasibility and costs with current advances in de novo DNA synthesis (Schindler et al. 2018; Zhang et al. 2020). Synthetic genomics is becoming commonplace for the study and engineering of animal viruses, especially those with medical interest and human pandemic potential (Coleman et al. 2008; Mueller et al. 2010; Dormitzer et al. 2013; Moratorio et al. 2017; Rourke et al. 2020). In plant virology, synthetic genomics can help to demonstrate correctness of genomic sequences, rescue of viruses that might not be physically available (e.g., ancient or environmental samples), as well as to accelerate virus reverse genetics, host-virus interaction studies, biological characterization of emerging viruses, or engineering of biotechnological devices (Massart et al. 2017; Pasin et al. 2019; Feng et al. 2020; Abrahamian et al. 2020). Adoption of this powerful approach for plant virology has nonetheless lagged and is reported only in a handful of studies (Pasin et al. 2019). The first reports of synthetic genomic approaches in plant virology included the use of oligonucleotides to assemble a synthetic tobamovirus (Cooper 2014), and the reconstitution of a full-length tombusvirus genome from synthetic fragments cloned in an intermediate vector (Lovato et al. 2014). Successful examples of synthesis and assembly of viral and bacterial genomes, whose sizes are orders of magnitude larger than those of plant viruses, suggest that the field of plant virology has additional constraints beyond DNA synthesis technology. Viral clone or vector delivery to plants requires specialized techniques (Abrahamian et al. 2020), one of the most efficient of which is Agrobacterium - mediated delivery (agro-infection). Agro-infection requires assembly of viral genomic sequences into binary vectors, which can pose technical challenges (Pasin et al. 2019). Adoption of synthetic genomic approaches by plant virologists would be greatly facilitated by improved molecular tools and frameworks that enable assembly and plant delivery of chemically-synthesized virus components. Low-cost and large-scale methods for de novo gene synthesis rely on barcode sequences that allow standardized, PCR-mediated assembly of short oligonucleotides (Kosuri and Church 2014; Hughes and Ellington 2017). Gibson assembly and its variants were used successfully for plant virus clone assembly (Blawid and Nagata 2015; Pasin et al. 2018, 2019; Zhao et al. 2020), but their applications are limited to linear fragments with terminal homologies. A cloning system compatible with linear or circular DNA molecules and insensitive to specific terminal sequences such as gene synthesis barcodes would facilitate low-cost, rapid engineering of plant virus clones and vectors without biological material requirements. Restriction enzymes (RE) are robust tools that have been used in molecular cloning for decades. Type IIS REs cleave outside of the recognition sites and can be used to produce cloning junctions with arbitrary sequences; correct junction design allows unidirectional, scar-free assembly (Casini et al. 2015; Young et al. 2020). Type IIS RE-based strategies such as No See’m cloning allowed recovery of infectious clones of large-sized viruses with no cloning scars (Yount et al. 2002; Cockrell et al. 2017; Ma et al. 2020; Xie et al. 2020). Multiple digestion, ligation, purification and/or subcloning steps were nonetheless required.
Correspondence: [email protected] 3/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354
Type IIS REs and DNA ligases can be mixed for one-step digestion-ligation reactions (Kotera and Nagai 2008; Marillonnet and Grützner 2020). Based on this property, unique junction sites, and different antibiotic selection schemes, Golden Gate cloning allows high throughput transfer of desired fragments from donor to recipient vectors (Marillonnet and Grützner 2020). Golden Gate syntaxes of unique cloning junctions have been used extensively for robust, directional assembly in a single reaction of over 30 standard parts, which are then flanked by 4-nt cloning junctions (Patron et al. 2015; Pryor et al. 2020). The plant virome is composed of highly divergent viruses with polyphyletic origins (Lefeuvre et al. 2019). Here I sought to explore compositional biases of viral sequences for rational design of a synthetic genomics framework to rescue Synthetic Viruses of Plants (SynViP). A sequence database was analyzed to measure random oligonucleotide abundance in the plant virome. The computational results were used to determine virome cloning constraints of REs and guide the development of a framework that combines Golden Gate and No See’m principles with low-cost DNA chemical synthesis. A new binary vector was generated to incorporate divergent sites of type IIS REs with low frequencies in the plant virome. Appropriate cloning designs allow one-step, seamless assembly of full-length viral genomic components suitable for agro-infection. The SynViP framework has plant virome capacity, can be used with linear and circular DNA molecules, does not require subcloning steps, is insensitive to fragment terminal sequences, and was used successfully to assemble an infectious clone and rescue a plant RNA virus based on a digital template.
Table 1. The type IIS restriction enzymes considered in the study and their features RE Isoschizomers (a) Recognition site Overhang References (b) Sequence nt %GC nt AarI n.a. CACCTGC 7 71.43 4 (van Dolleweerd et al. 2018; Čermák et al. 2017; Andreou and Nakayama 2018; Hussey et al. 2019) SapI BspQI, LguI, GCTCTTC 7 57.14 3 (Čermák et al. 2017; Pollak et al. PciSI 2019, 2020) BfuAI Acc36I, BspMI, ACCTGC 6 66.67 4 see AarI (c) BveI BsmBI Esp3I CGTCTC 6 66.67 4 (Moore et al. 2016; Martella et al. 2017; Vazquez-Vilar et al. 2020; Dusek et al. 2020) BtgZI n.a. GCGATG 6 66.67 4 (Sarrion-Perdigones et al. 2013) BsaI Bso31I, GGTCTC 6 66.67 4 (Marillonnet and Grützner 2020; BspTNI, Eco31I Vazquez-Vilar et al. 2020; Engler et al. 2008; Agmon et al. 2015) BbsI BpiI, BstV2I GAAGAC 6 50.00 4 (Marillonnet and Grützner 2020; Engler et al. 2014; Vasudevan et al. 2019; Chiasson et al. 2019; Occhialini et al. 2019) EarI Bst6I, CTCTTC 6 50.00 3 see SapI (c) Eam1104I (a) n.a., non-commercially available isoschizomers (source Rebase (Roberts et al. 2015))
Correspondence: [email protected] 4/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354
(b) Representative uses in Golden Gate-based cloning (c) BfuAI recognizes the AarI site; EarI recognizes the SapI site
2. RESULTS 2.1 Abundance of oligonucleotides in a plant virome is non-random and correlates negatively with their GC content For sequence analysis, I selected a reference plant virome dataset that includes 2044 accessions, which were grouped into 34 taxonomic families with 1 to >600 assigned genomic components (Figure 1A; Table S1). The virome had a guanine + cytosine content (%GC) peak at the 42% bin (Figure 1A), and an average %GC aggregate per family ranging from 31.48% to 58.22% (Figure 1B). To establish virus study systems, genomic components are usually cloned individually into suitable plasmid vectors. Multipartite viruses are inoculated by simultaneous plant delivery of multiple vectors that include each of the genomic components. REs recognize short DNA sequences. Complete non-redundant oligonucleotide (n.r. mer) sets were generated by random union of 3 to 8 DNA mononucleotides, and searched in the virome to comprehensively infer RE constraints in plant virus cloning (Figure 1C). Virome sequence analysis showed that n.r. mer counts had strong negative correlation with oligonucleotide GC content; abundance of an oligonucleotide in the plant virome is thus significantly reduced by an increase in its %GC. The result was confirmed for each of the n.r. mer sets, and the Pearson's correlation coefficients ranged between -0.948 < r < -0.997 (Figure 1D). The n.r. mer sets were classified by size and %GC, and the subsets obtained were ordered by their virome average counts. The ordered subsets failed to group uniformly by size (Figure 1E), indicating that a size increase alone is not sufficient to reduce virome oligonucleotide abundance. Abundance of the 6-nt subset with 100% GC was lower than that of the 7-nt subsets with 0%, 14.3%, and 28.6% GC; in turn, abundance of the 7-nt subset with 100% GC was lower than that of the 8-nt subsets with 0%, 12.5% and 25.0% GC (Figure 1F). The results revealed that (i) the virome dataset analyzed has a non-random oligonucleotide composition, (ii) the oligonucleotide abundance in the virome is reduced by a concomitant increase in oligonucleotide size and GC content and, by data interpolation, (iii) a RE that recognizes a long DNA sequence with a high %GC would alleviate unwanted targeting and thus cloning constraints of plant virome components.
2.2 Abundance of type IIS RE sites in a plant virome depends on site size and GC content Type IIS REs are compatible with high-throughput and automated construct design and assembly (Smanski et al. 2014; Casini et al. 2015; Young et al. 2020). A subset of commercially available type IIS REs with ≥6-nt recognition sites and ≥3-nt overhangs was considered (Table 1). Virome average counts for type IIS REs with 6-nt sites ranged from 1.24 to 3.99 (Figure 2A); this variation could not be explained by recognition site size alone. Abundance of the 6-nt type IIS REs was inversely related to their %GC, as counts for EarI or BsbI (50.00% GC) were greater than those for high %GC counterparts BsaI, BfuAI, BtgZI or BsmBI (66.67% GC; Figure 2A). Virome counts for the 7-nt type IIS REs were also inversely
Correspondence: [email protected] 5/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354 related to the site %GC, as SapI frequency was 68% greater than AarI (0.74 vs. 0.44) (Figure 2A), which recognizes a sequence with 71.43% GC (Table 1; Figure 2A).
Figure 1. Biased abundance of nucleotide oligomers in plant virome sequences (A) Number of genomic components and guanine-cytosine content (%GC) distribution of the plant virome dataset used. ( B) Aggregate component numbers and average %GC per taxonomic family ( n = 34). ( C) Numbers of the random, non-redundant nucleotide oligomers (n.r. mer) used in sequence analysis. ( D) The n.r. mers were grouped by size and %GC, and virome average count ( n = 2044) is shown for each subset; linear correlation values are shown (Pearson's r). ( E) Scatter plot shows virome average counts (n = 2044) for the subsets in panel E. ( F) For each subset, the red line indicates the aggregate average count per taxonomic families ( n = 34, each point indicates a family); values for the 6-nt (0.79) or 7-nt subsets (0.22) with 100% GC are indicated by dotted lines.
Correspondence: [email protected] 6/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354
The virome dataset comprises diverse taxonomic families with large variation in the number of genomic components (Figure 1B; Table S1). Aggregate counts per family were considered to control overrepresentation of a specific taxonomic group; results confirmed those of Fig. 2A, as per-family abundance of EarI or BsbI was generally greater than that of BsaI, BfuAI, BtgZI or BsmBI (Figure 2B). The aggregate count difference among the 7-nt type IIS REs was significant ( p <0.01, n = 34), and SapI frequency was 42% greater than AarI (0.75 vs. 0.53) (Figure 2C). Virome counts for type IIS REs thus depend on both size and %GC of the recognition sites. It can be concluded that use of a type IIS RE that targets a 7-nt site with high %GC, i.e. AarI, would be preferable in the design of a cloning strategy with plant virome capacity.
2.3 Design of SynViP, a type IIS synthetic genomics framework with plant virome capacity Despite the low AarI frequency, data inspection identified genomic components with a larger number of AarI instances than SapI (e.g. Genomoviridae , Figure 2B). I asked whether a cloning system compatible with both AarI and SapI would confer a technical advantage. Virome abundance of REs with low %GC sites imposes substantial cloning constraints; EarI and BsbI (50% GC) were not considered further. Sequence analysis showed that a hypothetical cloning system based on BsaI, BsmBI, BtgZI, or BfuAI (6-bp targeting REs with 66.67% GC) would allow recovery of clones with no sequence modification for 30.58-41.93% of the virome; complete virome cloning would nevertheless require targeted insertion of up to 13 or 18 single-nucleotide mutations per component (Figure 2D). SapI- or AarI-based systems would respectively allow recovery of clones with no sequence modification for 56.70% or 69.81% of the virome, and insertion of up to 6 single-nucleotide mutations per component would confer virome capacity. The alternative choice of AarI- or SapI-based designs would allow cloning of faithful sequence copies for >80% of virome components (bottom row, Figure 2D). Similar designs coupled with a targeted insertion of single- or two-nucleotide mutations to remove RE recognition sites would allow recovery of full-length clones of >95% or >99% of virome components, respectively. In silico analysis thus showed that a system compatible with both AarI and SapI is superior to those based on an individual type IIS RE. Guided by these results, I generated pLX-AS, a mini binary vector compatible with Golden Gate and No See’m assembly strategies that employ either AarI or SapI (Figure 2E-G; see Methods, and Table S2- S3). pLX-AS is based on the pLX backbone (Pasin et al. 2017), which has been used for Agrobacterium - mediated delivery to plants of infectious clones of several RNA and DNA viruses (Pasin et al. 2018; Zhao et al. 2020). The T-DNA region of pLX-AS comprises a cloning cassette flanked by sequences of the cauliflower mosaic virus (CaMV) 35S promoter and the nopaline synthase (nos) terminator (Figure 2E) for in planta transcription regulation of cDNA clones from RNA viruses. The cloning cassette designed includes divergent AarI and SapI sites flanking the Escherichia coli lacZ reporter for white-blue screens of recombinant clones (Figure 2F). In RNA virus clone assembly, backbone overhangs generated by AarI or
Correspondence: [email protected] 7/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354
SapI digestion allow seamless fragment insertion downstream of the CaMV 35S promoter, and in planta generation of authentic viral genomic 5’ ends (Figure 2G).
Figure 2 . Differential abundance of type IIS restriction enzyme sites in the plant virome and design of the SynViP framework (A) Left, plot shows site size and %GC of reference type IIS restriction enzymes (RE); right, RE site counts in virome components ( n = 2044; bars, maximum; red lines, mean). ( B) Heatmap shows RE site average counts in each taxonomic family; Orphan, species with unassigned family. ( C) For each RE, the red line and value indicate the aggregate average count per taxonomic families (each point indicates a family, n = 34); p value by Wilcoxon signed-rank test is indicated for the AarI versus SapI comparison ( n =
Correspondence: [email protected] 8/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354
34). ( D) Cumulative component percentages relative to the complete virome are shown for site count numbers; values are shown for each RE, or considering the smallest count number among AarI or SapI, i.e., MIN(AarI,SapI); orange bars indicate 100%. ( E) Diagram of pLX-AS, a 4.5-kb T-DNA binary vector including divergent AarI and SapI recognition sites. Vector components are indicated (right); blue, lacZ reporter gene; npt I, kanamycin resistance gene. ( F) Detail of the T-DNA cloning cassette of pLX-AS. The 3’ sequence of the CaMV 35S promoter is in red; arrow indicates the nucleotide preceding the transcription initiation site; lines mark AarI (purple) and SapI (orange) sites. ( G) Detail of the pLX-AS cloning cassette, after AarI (top) or SapI (bottom) digestions; backbone overhangs are show in black.
2.4 One-step digestion-ligation assembly of a virus clone using a digital template and uncloned synthetic DNA fragments An AarI/SapI-based cloning strategy including pLX-AS would (i) be compatible with linear and/or circular DNA molecules, (ii) be insensitive to specific terminal sequences such as gene synthesis barcodes, and (iii) facilitate rapid engineering of plant virus clones without biological material requirements. The family Solemoviridae includes RNA viruses with an average genome size of 4208 nt, close to the aggregate median size (4154) of plant virome components (Figure 3A). As proof of the utility of the synthetic genomics framework designed, I focused on turnip rosette virus (TuRV; Solemoviridae ). The TuRV genomic sequence and its complex organization have recently been revised (Sõmera and Truve 2013; Ling et al. 2013), giving us a representative, high-confidence control during method validation. The TuRV accession KC778720.1 used as a digital template includes a single SapI and no AarI sites. Three linear DNA fragments ranging from 1.2 to 1.6 kb and spanning the TuRV genome were obtained by chemical synthesis (Table S4). Each synthetic fragment was flanked by convergent AarI sites that would allow removal of synthesis barcodes (Figure 3B), and the generation of orthogonal cloning junctions selected to allow (i) directional fragment assembly in pLX-AS by one-step digestion-ligation, (ii) recovery of a seamless TuRV genomic sequence, and (iii) in planta generation of the correct TuRV 5' end from the CaMV 35S promoter (Figure 3C). A synthetic ribozyme was included in the gene synthesis design for in planta removal of non-viral nucleotides from the TuRV 3' end (Figure 3B, Table S4). The uncloned synthetic fragments and pLX-AS were mixed and subjected to digestion-ligation using AarI and T4 DNA ligase in AarI buffer supplemented with ATP (see Methods); the reaction was transformed into E. coli and white colonies were selected using a chromogenic substrate to recover recombinant clones. Correct fragment assembly into pLX-AS was confirmed by restriction analysis of plasmid DNA (Figure 3D). A plasmid clone with the correct digestion pattern and sequence was designated pLX-TuRV, i.e., an 8.3-kb vector suitable for agro-infection that includes a cDNA copy of the full-length TuRV genome (Figure 3B).
Correspondence: [email protected] 9/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354
Figure 3. Use of SynViP for the one -step digestion -ligation assembly of an infectious clone and the rescue of a genuine virus with no natural template (A) Bar plot shows average component size and %GC of each taxonomic family; the red line indicates the aggregate virome median size (4154 nt; n = 34); Solemoviridae average size is shown (4208 nt; n = 19). (B) Top, genomic representation of turnip rosette virus (TuRV). DNA fragments spanning the TuRV genome were chemically synthesized; fragments were flanked by synthesis barcodes (black boxes) and convergent AarI sites (triangles); diamond, a synthetic ribozyme. Fragments were assembled into pLX-AS by one-step digestion-ligation. pLX-TuRV is a T-DNA binary vector with a seamless cDNA copy of the TuRV genome flanked by the CaMV 35S promoter (red arrow) and nos terminator (T-shaped mark). ( C)
Correspondence: [email protected] 10/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354
Detail of the orthogonal cloning junctions generated during the AarI-based digestion-ligation depicted in panel B; the 3’ end of the CaMV 35S promoter is in red. ( D) Restriction profiles are shown of plasmids purified from selected colonies; left, computed restriction pattern. ( E) A control vector (Mock) or pLX- TuRV were transformed into Agrobacterium and delivered to Arabidopsis thaliana by agro-infection. Images show plants at 30 days post agro-infection. ( F) Viral RNA detection in uninoculated leaf samples of agro-inoculated plants. RT-PCR reactions are shown using virus-specific primers (TuRV) or actin primers (CTRL); DNA size markers are indicated (right); M, mock sample. ( G) Transmission electron micrograph of particles purified from infected plant material; scale bar, 100 nm. ( H) Size mean ± SD and distribution ( n = 100), and micrograph magnification are shown of purified particles; scale bar, 50 nm.
2.5 Delivery of synthetic infectious clone to plants by agro-infection Arabidopsis thaliana is a model plant and TuRV host (Ling et al. 2013). pLX-TuRV was transformed into Agrobacterium , and its infectivity was evaluated in A. thaliana by agro-infection. After 30 days, plants agro-inoculated with pLX-TuRV showed severe symptoms and significant growth reduction compared to the mock condition (p <0.001; Figure 3E). Results are consistent with the stunted growth phenotype reported for TuRV-infected A. thaliana plants (Ling et al. 2013). RNA analysis of upper uninoculated leaves by RT-PCR assays showed TuRV accumulation in pLX-TuRV agro-inoculated plants, but not in the mock condition (Figure 3F). Nanoparticles were purified from infected plant material and analyzed by electron microscopy (Figure 3G); the particles observed had an icosahedral shape and an average size of 30.67 nm (Figure 3H), consistent with those described for TuRV virions (Horne et al. 1977). These results confirm the infectivity of the pLX-TuRV binary vector assembled, and thus the suitability of the SynViP framework and its cloning strategy for the generation of plant virus infectious clones and rescue of a genuine plant virus, with no natural template or biological material requirements.
3. DISCUSSION Gene synthesis has revolutionized the study of bacteriophages and animal viruses, and spurred major advances in prevention and control of human infectious diseases. First studies in synthetic genomics used viruses as simple model systems to prove the feasibility of recovering functional biological entities solely by sequence data and in vitro chemical means (Schindler et al. 2018; Zhang et al. 2020). More recently, synthetic genomic approaches have been used in basic and applied research (Schindler et al. 2018; Zhang et al. 2020), including sequence refactoring to facilitate human understanding and manipulation of individual genetic elements (Chan et al. 2005), to probe the completeness of our knowledge of biological systems (Jaschke et al. 2019), and for rational vaccine design and rapid vaccine manufacturing (Coleman et al. 2008; Mueller et al. 2010; Dormitzer et al. 2013; Moratorio et al. 2017; Rourke et al. 2020). In plant virology, studies have reported the recovery of plant infectious agents in the absence of a physical source of biological materials (Pasin et al. 2019), although they relied on cloning methods with limited scalability. Instructed by sequence analysis of a plant virome dataset, I describe here SynViP, a synthetic genomics framework with plant virome capacity. The SynViP framework described (i) does not
Correspondence: [email protected] 11/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354 require subcloning steps, (ii) is compatible with DNA fragments generated by low-cost and large-scale chemical synthesis methods and thus has no natural template requirements, (iii) complies with Golden Gate principles to allow directional assembly of multiple DNA fragments in one-step digestion-ligation reactions, (iv) allows recovery of scar-free constructs by following No See’m principles, (v) through its simultaneous compatibility with AarI and SapI, considerably reduces type IIS RE constraints in cloning plant virome components, and (vi) relies on the newly designed pLX-AS binary vector for construct assembly. pLX-AS includes elements for stable vector maintenance in E. coli and Agrobacterium cells, and for viral clone delivery to plants by agro-infection. pLX-AS autonomously replicates in E. coli and Agrobacterium , thus overcoming a major limitation of the pSoup-pGreen system (Hellens et al. 2000; Lacomme and Chapman 2008; Wrzesi ńska et al. 2016; Majer et al. 2017; Bouton et al. 2018). To promote stable plasmid propagation in bacteria, pLX-AS includes bacterial terminators up- and downstream of T-DNA, and has a lower copy number than pPZP and derivative vectors (e.g., pCAMBIA, pCass4-Rz) (Annamalai and Rao 2005). The RK2-based pCB301 and its derivatives (e.g., pJL-89, pDIVA) have been used in virus infectious clone assembly (Xiang et al. 1999; Lindbo 2007; Wang et al. 2015; Blawid and Nagata 2015; Laufer et al. 2018; Feng et al. 2020); pLX-AS includes the pBBR1 origin, which outperformed the RK2 replicon in transient expression assays (Pasin et al. 2017). SynViP was successfully applied for one-step, seamless assembly of an infectious clone of a representative plant RNA virus with no natural template requirements. Uncloned synthetic fragments spanning the TuRV genome were assembled by one-step digestion-ligation into pLX-AS to yield pLX- TuRV, a TuRV infectious clone suitable for agro-infection. The pLX-TuRV infectivity and rescue of a genuine plant virus without biological material requirements was confirmed by visual assessment of host symptoms, and by detection of virus genomes and assembled virus particles in agro-inoculated plant samples. pLX-TuRV is a new entry in our previously reported binary vector collection of A. thaliana - infecting viruses (Pasin et al. 2018), which now covers members of families with disparate genome composition (single-stranded RNA, single- and double-stranded DNA) and organization, including Caulimoviridae , Geminiviridae , Potyviridae , Virgaviridae , and Solemoviridae (this study). Very short or repetitive sequences can limit efficiency and accuracy of Gibson assembly, but they do not interfere with type IIS-based methods (Casini et al. 2015). The approach described herein is therefore predicted to be suitable for assembly of tandem genomic repeats needed to rescue viral agents with circular components (Pasin et al. 2019; Marquez-Molins et al. 2019; Krupovic et al. 2020). Collectively, it can be anticipated that the framework described in this study will support spread and further development of synthetic genomic approaches for the biological characterization and engineering of plant viruses and derived biotechnologies. Finally, biological systems are often engineered through ad hoc strategies that can be applied to a limited number of related species (Lv et al. 2020); novel theoretical approaches and methodological concepts for biosystems engineering are necessary to meet the ever-increasing human needs (Nielsen et
Correspondence: [email protected] 12/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354 al. 2016; HamediRad et al. 2019; Radivojevi ć et al. 2020; Bartley et al. 2020; Yang et al. 2020). Non- random compositional tendencies, dinucleotide frequency, and codon usage biases have been reported in genomic sequences, including those of viruses (Burge et al. 1992; Karlin and Burge 1995; Cheng et al. 2013; Kunec and Osterrieder 2016; Di Giallonardo et al. 2017). The proposed computational identification of compositional biases in biological sequences might become a common standard to aid scalable biosystems design and engineering.
Correspondence: [email protected] 13/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354
4. MATERIALS AND METHODS Methods and details of the sequence analysis, digestion-ligation (van Dolleweerd et al. 2018), virus inoculation and purification (Denloye et al. 1978; Pasin et al. 2018, 2020) are provided in the Supporting Information.
5. SUPPORTING INFORMATION The supporting PDF file includes supporting materials and methods, supplementary references and the supporting tables as follows: Table S1. Accession numbers of the plant virome sequences analyzed in the study Table S2. Plasmids used in the study Table S3. Sequences of the primers used Table S4. Sequences of the chemically synthesized DNA fragments
ACKNOWLEDGEMENTS I am grateful to D. Endy, K. Gandall, and the BioBricks Foundation for the supply of materials, to D. San León for bioinformatics advice and scripting, to X.-A. Tseng for technical support, and to C. Mark for editorial assistance. Resources from Y.R. Chen, W. Schmidt, S.-T.D. Hsu, P. Draczkowski, and Academia Sinica Cryo-EM Center (ASCEM) are acknowledged. F.P. was the recipient of a post-doctoral fellowship from Academia Sinica (Taiwan).
CONFLICT OF INTEREST The author declares no financial or commercial conflict of interest.
Correspondence: [email protected] 14/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354
REFERENCES Abrahamian P, Hammond RW, Hammond J (2020) Plant virus-derived vectors: applications in agricultural and medical biotechnology. Annu Rev Virol 7:513–535. https://doi.org/10.1146/annurev-virology- 010720-054958 Agmon N, Mitchell LA, Cai Y, et al (2015) Yeast Golden Gate (yGG) for the efficient assembly of S. cerevisiae transcription units. ACS Synth Biol 4:853–859. https://doi.org/10.1021/sb500372z Andreou AI, Nakayama N (2018) Mobius assembly: a versatile Golden-Gate framework towards universal DNA assembly. PLOS One 13:e0189892. https://doi.org/10.1371/journal.pone.0189892 Annamalai P, Rao ALN (2005) Replication-independent expression of genome components and capsid protein of brome mosaic virus in planta : a functional role for viral replicase in RNA packaging. Virology 338:96–111. https://doi.org/10.1016/j.virol.2005.05.013 Bartley BA, Beal J, Karr JR, Strychalski EA (2020) Organizing genome engineering for the gigabase scale. Nat Commun 11:689. https://doi.org/10.1038/s41467-020-14314-z Blawid R, Nagata T (2015) Construction of an infectious clone of a plant RNA virus in a binary vector using one-step Gibson assembly. J Virol Methods 222:11–15. https://doi.org/10.1016/j.jviromet.2015.05.003 Bouton C, King RC, Chen H, et al (2018) Foxtail mosaic virus : a viral vector for protein expression in cereals. Plant Physiol 177:1352–1367. https://doi.org/10.1104/pp.17.01679 Burge C, Campbell AM, Karlin S (1992) Over- and under-representation of short oligonucleotides in DNA sequences. Proc Natl Acad Sci 89:1358–1362. https://doi.org/10.1073/pnas.89.4.1358 Casini A, Storch M, Baldwin GS, Ellis T (2015) Bricks and blueprints: methods and standards for DNA assembly. Nat Rev Mol Cell Biol 16:568–576. https://doi.org/10.1038/nrm4014 Čermák T, Curtin SJ, Gil-Humanes J, et al (2017) A multipurpose toolkit to enable advanced genome engineering in plants. Plant Cell 29:1196–1217. https://doi.org/10.1105/tpc.16.00922 Chan LY, Kosuri S, Endy D (2005) Refactoring bacteriophage T7. Mol Syst Biol 1:2005.0018. https://doi.org/10.1038/msb4100025 Cheng X, Virk N, Chen W, et al (2013) CpG usage in RNA viruses: data and hypotheses. PLoS ONE 8:e74109. https://doi.org/10.1371/journal.pone.0074109 Chiasson D, Giménez-Oya V, Bircheneder M, et al (2019) A unified multi-kingdom Golden Gate cloning platform. Sci Rep 9:10131. https://doi.org/10.1038/s41598-019-46171-2 Cockrell AS, Beall A, Yount B, Baric R (2017) Efficient reverse genetic systems for rapid genetic manipulation of emergent and preemergent infectious coronaviruses. In: Perez DR (ed) Reverse genetics of RNA viruses. Springer New York, New York, NY, pp 59–81 Coleman JR, Papamichail D, Skiena S, et al (2008) Virus attenuation by genome-scale changes in codon pair bias. Science 320:1784–1787. https://doi.org/10.1126/science.1155761 Cooper B (2014) Proof by synthesis of Tobacco mosaic virus . Genome Biol 15:R67. https://doi.org/10.1186/gb-2014-15-5-r67 Denloye AO, Homer RB, Hull R (1978) Circular dichroism studies on turnip rosette virus. J Gen Virol 41:77–85. https://doi.org/10.1099/0022-1317-41-1-77 Di Giallonardo F, Schlub TE, Shi M, Holmes EC (2017) Dinucleotide composition in animal RNA viruses is shaped more by virus family than by host species. J Virol 91:e02381-16, e02381-16. https://doi.org/10.1128/JVI.02381-16 Dormitzer PR, Suphaphiphat P, Gibson DG, et al (2013) Synthetic generation of influenza vaccine viruses for rapid response to pandemics. Sci Transl Med 5:185ra68. https://doi.org/10.1126/scitranslmed.3006368 Dusek J, Plchova H, Cerovska N, et al (2020) Extended set of GoldenBraid compatible vectors for fast assembly of multigenic constructs and their use to create geminiviral expression vectors. Front Plant Sci 11:522059. https://doi.org/10.3389/fpls.2020.522059 Engler C, Kandzia R, Marillonnet S (2008) A one pot, one step, precision cloning method with high throughput capability. PLOS One 3:e3647. https://doi.org/10.1371/journal.pone.0003647 Engler C, Youles M, Gruetzner R, et al (2014) A Golden Gate modular cloning toolbox for plants. ACS Synth Biol Feng M, Cheng R, Chen M, et al (2020) Rescue of tomato spotted wilt virus entirely from complementary DNA clones. Proc Natl Acad Sci U S A 117:1181–1190. https://doi.org/10.1073/pnas.1910787117
Correspondence: [email protected] 15/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354
HamediRad M, Chao R, Weisberg S, et al (2019) Towards a fully automated algorithm driven platform for biosystems design. Nat Commun 10:5150. https://doi.org/10.1038/s41467-019-13189-z Hellens RP, Edwards EA, Leyland NR, et al (2000) pGreen: a versatile and flexible binary Ti vector for Agrobacterium -mediated plant transformation. Plant Mol Biol 42:819–832. https://doi.org/10.1023/A:1006496308160 Horne RW, Harnden JM, Hull R (1977) The in vitro crystalline formations of turnip rosette virus I. Electron microscopy of two- and three-dimensional arrays. Virology 82:150–162. https://doi.org/10.1016/0042-6822(77)90039-3 Hughes RA, Ellington AD (2017) Synthetic DNA synthesis and assembly: putting the synthetic in synthetic biology. Cold Spring Harb Perspect Biol 9:. https://doi.org/10.1101/cshperspect.a023812 Hussey SG, Grima-Pettenati J, Myburg AA, et al (2019) A standardized synthetic Eucalyptus transcription factor and promoter panel for re-engineering secondary cell wall regulation in biomass and bioenergy crops. ACS Synth Biol 8:463–465. https://doi.org/10.1021/acssynbio.8b00440 Jaschke PR, Dotson GA, Hung KS, et al (2019) Definitive demonstration by synthesis of genome annotation completeness. Proc Natl Acad Sci U S A 116:24206–24213. https://doi.org/10.1073/pnas.1905990116 Karlin S, Burge C (1995) Dinucleotide relative abundance extremes: a genomic signature. Trends Genet 11:283–290. https://doi.org/10.1016/s0168-9525(00)89076-9 Kosuri S, Church GM (2014) Large-scale de novo DNA synthesis: technologies and applications. Nat Methods 11:499–507. https://doi.org/10.1038/nmeth.2918 Kotera I, Nagai T (2008) A high-throughput and single-tube recombination of crude PCR products using a DNA polymerase inhibitor and type IIS restriction enzyme. J Biotechnol 137:1–7. https://doi.org/10.1016/j.jbiotec.2008.07.1816 Krupovic M, Varsani A, Kazlauskas D, et al (2020) Cressdnaviricota : a virus phylum unifying seven families of rep-encoding viruses with single-stranded, circular DNA genomes. J Virol 94:e00582- 20. https://doi.org/10.1128/JVI.00582-20 Kunec D, Osterrieder N (2016) Codon pair bias is a direct consequence of dinucleotide bias. Cell Rep 14:55–67. https://doi.org/10.1016/j.celrep.2015.12.011 Lacomme C, Chapman S (2008) Use of potato virus X (PVX)-based vectors for gene expression and virus-induced gene silencing (VIGS). Curr Protoc Microbiol Chapter 16:Unit 16I.1. https://doi.org/10.1002/9780471729259.mc16i01s8 Laufer M, Mohammad H, Maiss E, et al (2018) Biological properties of Beet soil-borne mosaic virus and Beet necrotic yellow vein virus cDNA clones produced by isothermal in vitro recombination: insights for reassortant appearance. Virology 518:25–33. https://doi.org/10.1016/j.virol.2018.01.029 Lefeuvre P, Martin DP, Elena SF, et al (2019) Evolution and ecology of plant viruses. Nat Rev Microbiol 17:632–644. https://doi.org/10.1038/s41579-019-0232-3 Lindbo JA (2007) TRBO: a high-efficiency tobacco mosaic virus RNA-based overexpression vector. Plant Physiol 145:1232–1240. https://doi.org/10.1104/pp.107.106377 Ling R, Pate AE, Carr JP, Firth AE (2013) An essential fifth coding ORF in the sobemoviruses. Virology 446:397–408. https://doi.org/10.1016/j.virol.2013.05.033 Lovato A, Faoro F, Gambino G, et al (2014) Construction of a synthetic infectious cDNA clone of Grapevine Algerian latent virus (GALV-Nf) and its biological activity in Nicotiana benthamiana and grapevine plants. Virol J 11:186. https://doi.org/10.1186/1743-422X-11-186 Lv J, Yu K, Wei J, et al (2020) Generation of paternal haploids in wheat by genome editing of the centromeric histone CENH3. Nat Biotechnol. https://doi.org/10.1038/s41587-020-0728-4 Ma Z, Li Z, Dong L, et al (2020) Reverse genetic systems: rational design of coronavirus live attenuated vaccines with immune sequelae. Adv Virus Res 107:383–416. https://doi.org/10.1016/bs.aivir.2020.06.003 Majer E, Llorente B, Rodríguez-Concepción M, Daròs J-A (2017) Rewiring carotenoid biosynthesis in plants using a viral vector. Sci Rep 7:41645. https://doi.org/10.1038/srep41645 Marillonnet S, Grützner R (2020) Synthetic DNA assembly using Golden Gate cloning and the hierarchical Modular Cloning pipeline. Curr Protoc Mol Biol 130:e115. https://doi.org/10.1002/cpmb.115
Correspondence: [email protected] 16/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354
Marquez-Molins J, Navarro JA, Pallas V, Gomez G (2019) Highly efficient construction of infectious viroid- derived clones. Plant Methods 15:87. https://doi.org/10.1186/s13007-019-0470-4 Martella A, Matjusaitis M, Auxillos J, et al (2017) EMMA: an Extensible Mammalian Modular Assembly toolkit for the rapid design and production of diverse expression vectors. ACS Synth Biol 6:1380– 1392. https://doi.org/10.1021/acssynbio.7b00016 Massart S, Candresse T, Gil J, et al (2017) A framework for the evaluation of biosecurity, commercial, regulatory, and scientific impacts of plant viruses and viroids identified by NGS technologies. Front Microbiol 8:45. https://doi.org/10.3389/fmicb.2017.00045 Moore SJ, Lai H-E, Kelwick RJR, et al (2016) EcoFlex: a multifunctional MoClo kit for E. coli synthetic biology. ACS Synth Biol 5:1059–1069. https://doi.org/10.1021/acssynbio.6b00031 Moratorio G, Henningsson R, Barbezange C, et al (2017) Attenuation of RNA viruses by redirecting their evolution in sequence space. Nat Microbiol 2:17088. https://doi.org/10.1038/nmicrobiol.2017.88 Mueller S, Coleman JR, Papamichail D, et al (2010) Live attenuated influenza virus vaccines by computer-aided rational design. Nat Biotechnol 28:723–726. https://doi.org/10.1038/nbt.1636 Nielsen AAK, Der BS, Shin J, et al (2016) Genetic circuit design automation. Science 352:aac7341. https://doi.org/10.1126/science.aac7341 Occhialini A, Piatek AA, Pfotenhauer AC, et al (2019) MoChlo: a versatile, modular cloning toolbox for chloroplast biotechnology. Plant Physiol 179:943–957. https://doi.org/10.1104/pp.18.01220 Pasin F, Bedoya LC, Bernabé-Orts JM, et al (2017) Multiple T-DNA delivery to plants using novel mini binary vectors with compatible replication origins. ACS Synth Biol 6:1962–1968. https://doi.org/10.1021/acssynbio.6b00354 Pasin F, Menzel W, Daròs J-A (2019) Harnessed viruses in the age of metagenomics and synthetic biology: an update on infectious clone assembly and biotechnologies of plant viruses. Plant Biotechnol J 17:1010–1026. https://doi.org/10.1111/pbi.13084 Pasin F, Shan H, García B, et al (2020) Abscisic acid connects phytohormone signaling with RNA metabolic pathways and promotes an antiviral response that is evaded by a self-controlled RNA virus. Plant Commun 1:100099. https://doi.org/10.1016/j.xplc.2020.100099 Pasin F, Tseng X-A, Bedoya LC, et al (2018) Streamlined generation of plant virus infectious clones using the pLX mini binary vectors. J Virol Methods 262:48–55. https://doi.org/10.1016/j.jviromet.2018.09.007 Patron NJ, Orzaez D, Marillonnet S, et al (2015) Standards for plant synthetic biology: a common syntax for exchange of DNA parts. New Phytol 208:13–19. https://doi.org/10.1111/nph.13532 Pollak B, Cerda A, Delmans M, et al (2019) Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytol 222:628–640. https://doi.org/10.1111/nph.15625 Pollak B, Matute T, Nuñez I, et al (2020) Universal loop assembly: open, efficient and cross-kingdom DNA fabrication. Synth Biol 5:ysaa001. https://doi.org/10.1093/synbio/ysaa001 Pryor JM, Potapov V, Kucera RB, et al (2020) Enabling one-pot Golden Gate assemblies of unprecedented complexity using data-optimized assembly design. PloS One 15:e0238592. https://doi.org/10.1371/journal.pone.0238592 Radivojevi ć T, Costello Z, Workman K, Garcia Martin H (2020) A machine learning Automated Recommendation Tool for synthetic biology. Nat Commun 11:4879. https://doi.org/10.1038/s41467-020-18008-4 Roberts RJ, Vincze T, Posfai J, Macelis D (2015) REBASE--a database for DNA restriction and modification: enzymes, genes and genomes. Nucleic Acids Res 43:D298-299. https://doi.org/10.1093/nar/gku1046 Rourke MF, Phelan A, Lawson C (2020) Access and benefit-sharing following the synthesis of horsepox virus. Nat Biotechnol 38:537–539. https://doi.org/10.1038/s41587-020-0518-z Sarrion-Perdigones A, Vazquez-Vilar M, Palací J, et al (2013) GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Plant Physiol 162:1618–1631 Schindler D, Dai J, Cai Y (2018) Synthetic genomics: a new venture to dissect genome fundamentals and engineer new functions. Curr Opin Chem Biol 46:56–62. https://doi.org/10.1016/j.cbpa.2018.04.002 Smanski MJ, Bhatia S, Zhao D, et al (2014) Functional optimization of gene clusters by combinatorial design and assembly. Nat Biotechnol 32:1241–1249. https://doi.org/10.1038/nbt.3063
Correspondence: [email protected] 17/18
Pasin F. Biotechnol J. 2021 Jan 7:e2000354. http://doi.wiley.com/10.1002/biot.202000354
Sõmera M, Truve E (2013) The genome organization of lucerne transient streak and turnip rosette sobemoviruses revisited. Arch Virol 158:673–678. https://doi.org/10.1007/s00705-012-1519-0 van Dolleweerd CJ, Kessans SA, Van de Bittner KC, et al (2018) MIDAS: a modular DNA assembly system for synthetic biology. ACS Synth Biol 7:1018–1029. https://doi.org/10.1021/acssynbio.7b00363 Vasudevan R, Gale GAR, Schiavon AA, et al (2019) CyanoGate: a modular cloning suite for engineering cyanobacteria based on the plant MoClo syntax. Plant Physiol 180:39–55. https://doi.org/10.1104/pp.18.01401 Vazquez-Vilar M, Gandía M, García-Carpintero V, et al (2020) Multigene engineering by GoldenBraid cloning: from plants to filamentous fungi and beyond. Curr Protoc Mol Biol 130:e116. https://doi.org/10.1002/cpmb.116 Wang Q, Ma X, Qian S, et al (2015) Rescue of a plant negative-strand RNA virus from cloned cDNA: Insights into enveloped plant virus movement and morphogenesis. PLOS Pathog 11:e1005223. https://doi.org/10.1371/journal.ppat.1005223 Wrzesi ńska B, Wieczorek P, Obr ępalska-St ęplowska A (2016) Recombination-based generation of the agroinfectious clones of Peanut stunt virus . J Virol Methods 237:179–186. https://doi.org/10.1016/j.jviromet.2016.09.011 Xiang C, Han P, Lutziger I, et al (1999) A mini binary vector series for plant transformation. Plant Mol Biol 40:711–717. https://doi.org/10.1023/A:1006201910593 Xie X, Muruato A, Lokugamage KG, et al (2020) An infectious cDNA clone of SARS-CoV-2. Cell Host Microbe 27:841–848.e3. https://doi.org/10.1016/j.chom.2020.04.004 Yang X, Medford JI, Markel K, et al (2020) Plant biosystems design research roadmap 1.0. BioDesign Res 2020:8051764. https://doi.org/10.34133/2020/8051764 Young R, Haines M, Storch M, Freemont PS (2020) Combinatorial metabolic pathway assembly approaches and toolkits for modular assembly. Metab Eng. https://doi.org/10.1016/j.ymben.2020.12.001 Yount B, Denison MR, Weiss SR, Baric RS (2002) Systematic assembly of a full-length infectious cDNA of mouse hepatitis virus strain A59. J Virol 76:11065–11078 Zhang W, Mitchell LA, Bader JS, Boeke JD (2020) Synthetic genomes. Annu Rev Biochem 89:77–101. https://doi.org/10.1146/annurev-biochem-013118-110704 Zhao M, García B, Gallo A, et al (2020) Home-made enzymatic premix and Illumina sequencing allow for one-step Gibson assembly and verification of virus infectious clones. Phytopathol Res 2:36. https://doi.org/10.1186/s42483-020-00077-4
Correspondence: [email protected] 18/18
Pasin, F. (2021). Biotechnol. J, e2000354 https://doi.org/10.1002/biot.202000354
SUPPORTING INFORMATION
Oligonucleotide abundance biases aid design of a type IIS synthetic genomics framework with plant virome capacity
Fabio Pasin 1,2
1School of Science, University of Padova, Padova, Italy 2Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan
Correspondence Fabio Pasin E-mail: [email protected] ORCID ID: 0000-0002-9620-4301
Correspondence: [email protected] 1/15
Pasin, F. (2021). Biotechnol. J, e2000354 https://doi.org/10.1002/biot.202000354
SUPPORTING MATERIALS AND METHODS Plant virome sequence analysis Accessions of virus genomic and subgenomic components were obtained from a Virus Metadata Resource file (VMR version June 1, 2019) of the International Committee on Taxonomy of Viruses [1] . Accession sequences were downloaded from the National Center for Biotechnology Information (Table S1). Metaviridae accessions including host sequences were not considered in the analysis. Sets of random DNA sequences of 3 to 8 nucleotides were generated by combining A, T, C, and G in all the possible mononucleotide associations; sense and reverse-complement sequences were filtered to generate random, non-redundant oligonucleotide (n.r. mer) sets using an in-house written script (Python). Virome sequences were assumed to be linear, double-stranded DNA molecules (i.e. as those used in cloning procedures) and counts of each n.r. mer were obtained by RSAT [2] including the -2str -subst 0 options. DNA plasmids To generate pLX-AS, a mini binary vector based on the pLX series [3] , the following fragments were obtained by PCR: (i) backbone, amplified from pLX-B2-TagRFP-T using W144_F19/W145_R19 primers; (ii) the lacZ cassette, from pLX-B3 using W146_F19/W147_R (Tables S2, S3). PCR reactions for pLX-AS assembly were performed with the Q5 High-Fidelity 2× master mix (New England BioLabs) and treated with DpnI; the gel-purified amplicons were joined using a one-step isothermal assembly kit (NEBuilder HiFi DNA assembly Master Mix, New England BioLabs). Blue colonies were selected on medium plates supplemented with kanamycin and X-Gal. AarI-based digestion-ligation assembly DNA fragments spanning the turnip rosette virus (TuRV) genome sequence [4] (GenBank: KC778720.1) were chemically synthesized (Twist Bioscience; Table S4). AarI sites were included to each DNA fragment end. Overhangs produced after AarI digestion were designed as follows: (i) the outermost 5' and 3' overhangs were GAGG and CCCA, respectively, to be compatible with the AarI-linearized pLX-AS vector and initiate CaMV 35S promoter-driven transcription at the correct TuRV 5' end, and (ii) internal overhangs were selected from the TuRV genome sequence to recover the intact wild-type sequence after ligation. In the selection of internal overhangs, palindromic sequences were avoided, and reported design rules [5] were considered to enhance assembly efficiency and fidelity. Fragments were PCR-amplified using primers W158_F/W159_R, gel purified, and assembled into pLX-AS by AarI-based, one-step
Correspondence: [email protected] 2/15
Pasin, F. (2021). Biotechnol. J, e2000354 https://doi.org/10.1002/biot.202000354 digestion-ligation [6] reactions including 1.5 µL ATP (10 mM), 0.8 µL T4 DNA ligase (400 U/ μL; both from New England BioLabs), 1.5 µL AarI buffer (10×), 0.3 µL AarI primer (50×), and 0.5 µL AarI (2 U/ μL: all three from Thermo Fisher Scientific) in a final volume of 15 µL. Reaction mixtures were subjected to a 15 min step at 37°C, 45 cycles of 7 min each (2 min at 37°C and 5 min at 16°C), followed by 5 min at 37°C, and put on hold at 16°C. Reactions were transformed in E. coli DH10B competent cells, spread onto medium plates supplemented with kanamycin and 40 µL X-Gal (40 mg/mL), and incubated (28°C, ~36 h). White colonies were selected. Virus inoculation Plants of Arabidopsis thaliana Columbia-0 (Col-0) ecotype were maintained in a growth chamber at ~22°C, with a 16 h light/8 h dark photoperiod. For agro-infections, the binary vectors were transformed in Agrobacterium AGL1 cells by the freeze-thaw method and delivered to plants as described [7] . The pLX-B3-TagRFP-T vector [3] was used in the mock condition, and pLX-TuRV for TuRV delivery. Virus detection by RT-PCR assays Upper uninoculated leaves of A. thaliana plants were collected at one month post-agro- inoculation, and total RNA was purified using the plant total RNA mini kit (Geneaid). The RT- PCR assays were done as described previously with minor modifications [7] . The Q9_F/Q10_R primer pair for the plant actin transcript was used as a template control, and W154_F/ W155_R for TuRV genome detection. TuRV purification Aerial parts of infected A. thaliana plants were collected at one month post-agro-inoculation, and TuRV was purified as described [8,9] with minor modifications. Briefly, plant material was ground in liquid nitrogen and viral particles were extracted by mixing 1 mL ice-cold 0.2 M sodium acetate, pH 5.0, 0.5 mL chloroform, and 0.5 mL n-butanol per gram of plant material. The sample was shaken at room temperature (5 min), and cleared by centrifugation (20 min, 2’330 g, 4°C); the supernatant was collected and centrifuged (20 min, 10’000 g, 4°C). The supernatant was collected, adjusted to 0.2 M NaCl and 10% w/v polyethylene glycol 6000, stirred (1 h, 4°C) and centrifuged (20 min, 10’000 g, 4°C). The pellet obtained was resuspended (~16 h, 4°C) in ice-cold 0.1 M sodium acetate, pH 5.0, and then centrifuged (10 min, 10’000 g, 4°C). The supernatant was collected and ultracentrifuged (2 h, 35’000 rpm, 4°C) in a Beckman Optima L-90K with the SW 41 swinging-bucket rotor. The pellet obtained was resuspended (1 h, 4°C) in ice-cold 0.1 M sodium acetate, pH 5.0, and then centrifuged (6 min, 8000 g, 4°C); the supernatant collected was used for viral particle imaging.
Correspondence: [email protected] 3/15
Pasin, F. (2021). Biotechnol. J, e2000354 https://doi.org/10.1002/biot.202000354
TuRV particle imaging Viral particles (see above) in 0.1 M sodium acetate, pH 5.0 were incubated with collodion- coated carbon-stabilized copper grids that were negative-stained with 2% uranyl formate and observed in a transmission electron microscope (JEM 1400, Jeol). Images were taken with a CCD camera (Gatan) and processed with ImageJ [10] . Statistics For two-group comparisons, a two-tailed Student’s t test was used; the Wilcoxon signed-rank test was used in paired comparisons of non-normal datasets The virus agro-inoculation assay was repeated three times with similar results.
Correspondence: [email protected] 4/15
Pasin, F. (2021). Biotechnol. J, e2000354 https://doi.org/10.1002/biot.202000354
SUPPORTING TABLES Table S1. Accession numbers of the plant virome sequences analyzed in the study Family GenBank accessions Components Alphaflexiviridae X06728.1 D13747.1 D13957.1 D00344.1 D12517.1 M97264.1 Z21647.1 M62730.1 D29630.1 D26017.1 51 S73580.1 U23414.1 U89243.1 U62963.1 AB010300.1 AB010302.1 AF406744.1 AJ292230.1 AF484251.1 AB066288.1 AF308158.2 AY366208.1 AY366209.1 AY707100.1 AY789138.1 AJ620114.1 AY863024.1 AJ633822.2 AB206396.1 AB219105.1 DQ660333.1 AB353071.1 AB304848.1 EU489641.1 AM745758.1 AY366207.2 JN053266.1 FJ670570.2 JN389521.1 JF930327.1 KC923234.1 KF555653.1 KJ711908.1 KM379144.1 KP313240.1 KR872420.1 KX058345.1 KY288487.1 KY696659.1 MF150239.1 MF150240.1 Alphasatellitidae M29963.1 L32167.1 U16731.1 U16735.1 X80879.1 AJ005966.1 AB009047.1 AB000920.1 AB000922.1 63 AJ132344.1 AJ238493.1 AJ416153.1 AF416471.1 AJ579359.1 AJ512960.1 DQ641718.1 AM236765.1 EU589450.1 EU384623.1 EU384656.1 AM749493.1 FN658711.1 FN658716.1 FN436007.1 FN436008.1 HM163578.1 HQ407396.1 FN675285.1 FN675296.1 FN675297.1 FN675299.1 HQ343234.2 HQ616080.1 FR772086.1 FR772088.1 JX183090.1 HE984148.1 JX458742.1 JX570736.1 JX913532.1 JX569789.1 HF546575.1 HE806451.1 KC959931.1 KF435148.1 KC978990.1 KC979051.1 KC979052.1 KF785752.1 HG530543.1 KF471043.1 KJ939346.1 KT099170.1 KT099172.1 KT099173.1 KX759649.1 KX168428.1 KX348228.1 KX534398.1 KX534399.1 KX534400.1 KX534408.1 KX534409.1 Amalgaviridae EF442780.1 HQ128706.1 HM029246.1 3 Aspiviridae AF525933.1 AF525934.1 AF525935.1 AF525936.1 AY535016.1 AY535017.1 AY535018.1 AY535019.1 14 AY654892.1 AY654893.1 AY654894.1 KJ704366.1 KJ704367.1 KJ704368.1 Avsunviroidae J02020.1 M83545.1 Y14700.1 AJ536613.1 4 Benyviridae D63936.1 D84410.1 D84412.1 D84413.1 D84411.1 EU410955.1 EU099844.3 EU099845.3 FJ424610.2 13 JF513082.1 JF513083.1 AB818898.1 AB818899.1 Betaflexiviridae M58152.1 L25658.1 X82547.1 X75448.1 AF017780.1 AF057136.1 AF237816.1 AF170028.1 AB032469.1 90 AF314662.1 AB051848.1 AJ318061.1 AF315308.1 AJ292226.1 AJ516059.1 AY505475.1 AY461421.1 AY713379.1 D14995.2 AJ620300.1 DQ098905.1 D14449.2 AJ863509.1 DQ117579.1 X75433.2 DQ455582.1 AM158439.1 AM182569.2 EF492068.1 EU020009.1 AM493895.2 EF527260.1 EF693898.1 EU162589.1 EU074853.1 EU527979.1 EU835937.1 AB432910.1 EU433397.2 FJ531634.1 FJ196835.1 FJ685618.1 AY072921.2 EU754720.2 FJ824737.1 AB517596.1 HQ184471.1 HQ339956.1 D88448.2 HQ241409.1 JN039374.1 JN427015.1 JF320810.1 JQ245696.1 JQ904630.1 JX212747.1 JX105428.1 JX277553.1 JX173276.1 JX173277.1 D21829.2 KC218926.1 KF533710.1 KF533711.1 HG008921.2 KF700263.1 KJ415259.1 KF958838.1 KJ789130.1 KP784454.2 KM507061.1 KR349343.1 KT763043.1 KT893294.1 KJ572562.2 KJ572563.2 KJ572564.2 KX000914.1 KY392781.1 KY363796.1 LC224308.1 MF095096.1 MF521889.1 MF405923.1 MF927925.1 MF440375.1 MG637048.1 MG783575.1 MG254193.1 FR877530.2 Botourmiaviridae EU770620.1 EU770621.1 EU770622.1 EU770623.1 EU770624.1 EU770625.1 FJ157981.1 FJ157982.1 9 FJ157983.1 Bromoviridae X01572.1 X02380.1 X01678.1 X00435.1 M60291.1 M65138.1 M64713.1 D10538.1 D00356.1 D00355.1 105
Correspondence: [email protected] 5/15
Pasin, F. (2021). Biotechnol. J, e2000354 https://doi.org/10.1002/biot.202000354
D10663.1 D10044.1 L00163.1 K02703.1 J02042.1 M65139.1 M28817.1 M28818.1 L28145.1 U15608.1 U17726.1 U17389.1 U17390.1 U15729.1 U15730.1 X86352.1 U15728.1 U23715.1 U34050.1 U35145.1 U57046.1 U57047.1 U57648.1 U75538.1 U80934.1 U85399.1 U93192.1 U93193.1 U93194.1 X76993.1 X94346.1 X94347.1 AF174584.1 AF174585.1 AJ277268.1 AJ272327.1 AJ272329.1 AF226160.1 AF226161.1 AF226162.1 AF235033.1 AF235165.1 AF235166.1 AF277662.1 AF278534.1 AF278535.1 AJ272328.2 AB080598.1 AB080599.1 AB080600.1 AY496068.1 AY496069.1 AY500236.1 AY500237.1 AY500238.1 AY707771.1 AY707772.1 AY682102.1 AB194808.1 DQ091193.1 AY363228.2 AY743591.2 EF584664.1 EF584665.1 DQ318818.3 DQ091194.2 EU919666.1 EU919667.1 FM881899.1 FM881900.1 FM881901.1 DQ091195.2 AB444583.1 AB444584.1 AB444585.1 FN669168.1 FN669169.1 HE572565.1 AB724113.1 AB724114.1 AB724115.1 JX463340.1 JX463341.1 JX463342.1 AB194806.2 AB194807.2 KF031037.1 KF031038.1 KF031039.1 KT290039.1 KT290040.1 KT290041.1 KT779204.1 KT779205.1 KT779206.1 Caulimoviridae X06166.1 V00141.1 X04658.1 X52938.1 X57924.1 M89923.1 L14546.1 U13988.1 X97304.1 U59751.1 76 AJ002234.1 AF190123.1 X15828.2 U95208.2 AJ277091.1 AF347695.1 AF404509.2 AF454635.1 AF357836.1 AY180137.1 AF364175.3 AY493509.1 AY750155.1 AY805074.1 DQ822073.1 EU034539.1 EU554423.1 FJ493469.1 FJ439817.1 FJ824813.1 GU985153.1 GU121676.1 HQ694979.1 HQ694978.1 HQ593107.1 HQ593108.1 HQ593109.1 HQ593110.1 HQ593112.1 JF411989.1 FJ560943.2 JF301669.2 JN606110.1 JQ316114.1 JX028536.1 JQ926983.1 JX272320.1 JX429923.1 KC808712.1 KJ013302.1 KM078034.1 KM229702.1 KP710178.1 HG940503.2 KJ413252.1 KR080327.1 LN651258.2 KU508800.1 KX066020.1 KX008573.1 KX008574.1 KX008577.1 KX430257.1 KU168312.1 KX276640.1 KX276641.1 KX168422.1 KY827394.1 KY827395.1 KX852476.1 MF642719.1 MF642724.1 MF642725.1 MF642728.1 MF642736.1 MG686421.1 Closteroviridae X73476.1 U15440.1 U15441.1 U16304.1 Y10237.1 AJ428554.1 AJ428555.1 AF037268.2 AJ508757.2 52 AY242077.1 AY242078.1 AF531505.1 AJ557128.1 AJ557129.1 AY792620.1 AY881628.1 AY903447.1 AY903448.1 DQ860839.1 DQ357218.1 EF546442.1 AF414119.3 EU191904.1 EU191905.1 FJ380118.1 FJ380119.1 FJ467503.1 FJ815440.1 FJ815441.1 FJ869862.1 AY330918.2 AY330919.2 AY488137.2 AY488138.2 AY776334.2 AY776335.2 HM588723.1 GQ376201.2 GQ225585.2 HE588185.1 JQ023131.1 AB733585.1 KC904540.1 KJ748003.1 AB923924.1 KR349464.1 KT203917.1 KR002686.1 KR002687.1 LC052212.1 KX857665.1 MH206615.1 Endornaviridae D32136.1 AJ000929.1 AB014344.1 JN880414.1 AB844264.1 KF562072.1 KJ634409.1 KR080326.1 14 KT456287.1 KT456288.1 KT721705.1 KT727022.1 LC144945.1 KX977569.1 Fimoviridae AY563040.2 AY563041.2 DQ831828.1 DQ831831.1 FM991954.1 FM992851.1 FM864225.2 AM941711.6 49 HQ871942.1 HQ871943.1 HQ871944.1 HQ871945.1 FR823299.1 FR823300.1 FR823301.1 FR823302.1 FR823303.1 HE803827.1 HE803826.2 HF568803.1 HF568804.1 HF568801.1 HF568802.3 HF945448.2 KJ939623.1 KJ939624.1 KJ939626.1 KJ939627.1 KJ939628.1 KJ939629.1 KJ939630.1 KJ939631.1 KM007081.1 KM007082.1 KM007083.1 HF912246.1 HG939489.1 HG939490.1 HF912243.1 HF912244.1 HF912245.3 KP970121.1 KP970122.1 KP970123.1 KT861481.1 KT861482.1 KT861483.1 KT861484.1 KT861485.1 Geminiviridae Y00514.1 X70418.1 X70419.1 M88179.1 M88180.1 D01030.1 D00940.1 D00941.1 S53251.1 L14460.1 617
Correspondence: [email protected] 6/15
Pasin, F. (2021). Biotechnol. J, e2000354 https://doi.org/10.1002/biot.202000354
M20021.1 J02057.1 J02058.1 M23022.1 M88686.1 M88687.1 L01635.1 L01636.1 K02029.1 K02030.1 M38182.1 M38183.1 M82918.1 M81103.1 Z24759.1 Z24758.1 D14703.1 D14704.1 L39638.1 Z48182.1 L14461.1 U49907.1 U57457.1 X84735.1 X99550.1 X99551.1 U38239.1 Y11100.1 Y11099.1 U88692.1 AF012300.1 AF012301.1 Y15033.1 Y15034.1 AF029217.1 AF039841.1 AJ223191.1 AF037752.1 Y15934.1 AF049336.1 AJ002449.1 AJ002455.1 Y14874.1 Y14875.1 AJ006460.1 X61153.1 U77964.1 AF101476.1 AF101478.1 AF126406.1 AF110189.1 AF110190.1 AF142440.1 AF141922.1 AF141897.1 AF112354.1 AF112355.1 AF104036.1 AF072672.1 AF134484.2 AF195782.1 AF188481.1 AF139168.1 AF170101.1 AF155806.1 AF126806.1 AF126807.1 AF241479.1 AF155807.2 AF274349.1 AB007990.1 AF260241.1 AF291705.1 AF291706.1 AF224760.2 AF224761.2 AF311734.1 AJ012081.1 AJ012082.1 AF314531.1 AF327436.1 AF264063.1 AF336806.1 AF350330.1 AF314144.1 U65529.2 U65530.2 AF440790.1 AY064391.1 AF271234.1 AJ314737.1 AJ314738.1 AJ420319.1 AF422174.1 AF326775.1 AF421552.1 AF421553.1 AJ437618.1 AF490004.1 AF491306.1 AY090558.1 AF499442.1 AJ457986.1 AJ457824.1 AJ489258.1 AF130415.2 AF261885.2 AJ495813.1 AJ495814.1 AY044133.1 AY044134.1 AY044135.1 AY044136.1 AY044137.1 AJ507777.1 AJ512761.1 AB050597.1 AF511528.1 AF511529.1 AJ438937.1 AB085793.1 AB085794.1 AB100304.1 AY190290.1 AY190291.1 AJ542540.1 AF480940.1 AF480941.1 U15015.2 U15017.2 AJ549960.1 AF422175.2 AF509739.1 AF509740.1 AF509742.1 AF509743.1 AY297924.1 AY271891.1 AY339618.1 X15983.2 X15984.3 Y11023.2 AJ558121.1 AJ557450.1 AJ557451.1 AJ557453.1 AJ557454.1 AJ558118.1 AJ558122.1 AJ558124.1 AY502935.1 AY502936.1 AJ627904.1 AJ627905.1 AY602165.1 AY602166.1 AY727903.1 AY727904.1 AJ508783.1 AJ851005.1 AJ608286.1 AY705380.1 AJ786711.1 AJ783960.1 AJ876550.1 AY754814.1 AJ865338.1 AJ865340.1 AY927277.1 AF068636.2 DQ022611.1 AY965899.1 AM048837.1 AJ965540.1 DQ127170.1 DQ178608.1 DQ178609.1 DQ207749.1 AJ965539.2 AM050730.1 DQ318937.1 DQ318938.1 DQ336350.1 DQ336351.1 AJ971263.1 DQ339117.1 DQ347950.1 DQ356428.1 DQ406672.1 DQ406673.1 AJ717572.1 DQ406674.1 AJ704971.1 DQ519575.1 DQ520943.1 DQ520944.1 DQ512731.1 DQ641688.1 DQ641690.1 DQ641692.1 DQ641694.1 DQ641695.1 DQ641696.1 DQ641697.1 DQ641698.1 DQ641699.1 DQ641701.1 DQ641689.1 DQ641691.1 DQ641693.1 AM183224.1 AF189018.4 AB267834.1 AB267835.1 DQ875879.1 AM238692.1 AM236784.1 DQ866132.1 DQ875868.1 DQ875869.1 DQ875870.1 DQ875871.1 DQ875872.1 DQ875873.1 EF016486.1 AM236755.1 DQ871221.1 EF165536.1 AM411424.1 EF121755.1 EF194760.1 AM491778.1 EF373060.1 EF417915.1 EF417916.1 EF197941.1 AB236323.1 EF450316.1 EF175733.1 EF408037.1 EF534708.1 EF547938.1 DQ395343.2 AM296025.1 EF602306.1 AM701758.1 AM701760.1 AM701763.1 AM701764.1 AM701765.1 AM701768.1 EF585290.1 EF585291.1 EU158095.1 EU158096.1 EU158097.1 AM886131.1 EU350585.1 EU339937.1 EU377539.1 EU244915.1 EU273818.1 EU360303.1 EU487042.1 EU487046.1 EU365613.1 EU585781.1 EU445699.1 EU596959.1 EU596960.1 FM160943.1 AJ488768.2 EU710749.1 EU710750.1 EU710751.1 EU710752.1 EU710753.1 EU710754.1 EU710755.1 EU710756.1 EU710757.1 AM992534.1 AM884015.2 EU734831.1 EU910141.1 EU798996.1 EU914817.1 EU914818.1 FJ011668.1 FJ011669.1 FJ174698.1 FJ213931.1 EU862323.1 FJ515747.1 AM712436.1 FJ589571.1 FJ455449.1 FJ685621.1 FJ619507.1 FJ237617.1 FJ665631.1 FJ600483.1 FJ600484.1 FJ972767.1 FJ972768.1 FN396966.1 FJ999999.1 FJ529203.1 FJ601917.2 FJ561298.1 FN552749.1 AM999981.1 AM999982.1 FN543425.1 FN543426.1 GQ273988.1 FJ969831.1 AM182232.2 FJ944019.1 FJ944020.1 FJ944021.1
Correspondence: [email protected] 7/15
Pasin, F. (2021). Biotechnol. J, e2000354 https://doi.org/10.1002/biot.202000354
FJ944022.1 FJ944023.1 FM877858.1 M24597.2 GU972604.1 GU997691.1 GU997692.1 GQ472984.1 GQ472985.1 GQ472986.1 FN436001.1 GU456685.1 HM163576.1 HM163577.1 HM003779.1 HM003778.1 HM230683.1 GU734126.2 HM236368.1 HM236369.1 HM236370.1 HM236371.1 GQ334472.2 HM122238.1 HQ180391.1 GU111998.1 HM992939.1 HM140367.1 GU256530.1 GU256532.1 HQ008338.1 HQ009518.1 HM991146.1 HQ113104.1 HM777508.1 HM777510.1 HM585435.1 HM585441.1 HM585443.1 HM585445.1 HM585436.1 HM585442.1 HM585444.1 HM585446.1 FJ619508.2 HQ443515.1 HM357458.2 HM357461.3 HQ162270.1 HQ201952.1 HQ201953.1 HQ393477.1 HQ333144.1 JF265670.1 HQ896204.1 HM007106.1 HM007121.1 HQ396465.1 JF508490.1 HM626515.1 JF694461.1 JF694462.1 JF694471.1 JF694473.1 JF694479.1 JF694480.1 JF694484.1 JF694485.1 JF694486.1 JF905486.1 FJ177030.2 JF803252.1 JF803254.1 JF803264.1 JF803265.1 JN411687.1 JN411688.1 JN564749.1 JN564750.1 JN809819.1 FR772082.1 JN555601.1 HE616777.1 HE617299.1 HE617300.1 JN419002.1 JN419013.1 JN419021.1 JN381814.1 JN381819.1 JN989422.1 JN989439.1 HM357456.2 JQ911766.1 JQ361910.1 JQ897969.1 JQ624879.1 JQ429791.1 JQ821386.1 JQ821387.1 JQ793786.1 JQ866297.1 JQ920490.1 JQ948088.1 JQ948061.1 JQ948051.1 JQ948052.1 JX025358.1 JX094280.1 JX162595.1 JX183732.1 JN848771.1 JN848774.1 JN848776.1 JN848770.1 JN848772.1 JN848773.1 JN848775.1 JQ283246.1 AY508993.2 AY508994.2 JX827487.1 JX827488.1 JX458740.1 JX857691.1 JX857693.1 KC176780.1 KC176781.1 HE862273.1 JN135234.2 JX871376.1 JX871380.1 JX871383.1 JX871385.1 KC149938.1 KC488316.1 KC223600.1 KC706615.1 KC430935.1 KC430936.1 KC202818.1 KC426927.1 KC426928.1 KC577540.1 KC686705.1 KC791690.1 KC791691.1 KC626021.1 KC907406.1 HF921459.1 KF414123.1 KF429251.1 KC898543.1 KC769819.1 KF358470.1 KF358471.1 KF150142.1 KF156759.1 KF446659.1 KF551578.1 KF551585.1 KF551592.1 KF660223.1 HF912280.1 KF723258.1 KF723261.1 JQ901105.2 KJ437671.1 KJ210622.1 KF661331.1 KF661332.1 KF927128.2 LK054801.1 KJ739692.1 JQ714138.2 JQ714137.2 KJ476510.2 KM244718.1 KM244719.1 JN698954.3 KJ957157.1 KF806701.1 KM377674.1 LK028570.1 KM887907.1 KM926624.1 KP663484.1 KP663485.1 KP303687.1 KP195260.1 KP195267.1 KP188831.1 KM411359.1 LM651400.1 KM880103.1 KP732474.1 KR263172.1 KR263181.1 KM359406.2 KT390456.1 KR150789.1 KR612272.1 KT099124.1 KT099125.1 KT099127.1 KT099128.1 KT099139.1 KT099156.1 KT201151.1 KT201152.1 KT201153.1 KT201154.1 KT899302.1 KT899303.1 KT454832.1 KT159766.1 KT444609.1 KT388076.1 KT948785.1 KT948786.1 KT948787.1 KT948788.1 KT582302.1 KT582303.1 LC080677.1 KT809345.1 KT878828.1 KT878829.1 KT966771.1 KT966772.1 KT948069.1 KU131588.1 KU131589.1 KT992056.1 KT962229.1 LC091538.1 KT214389.1 KU323597.1 KU683748.1 KU683750.1 KU522485.1 KU569583.1 KU852742.1 KX691396.1 KX691400.1 KX691402.1 KX691407.1 KX691411.1 KX691412.1 KX691413.1 KX691415.1 KU058856.1 KU058860.1 KX011473.1 KX011474.1 KX011477.1 KX011471.1 KX011472.1 KX363443.1 KX787914.1 KX831132.1 KX096982.1 KY001635.1 KX943290.1 KX943291.1 KX853168.1 KY294725.1 KY294727.1 KX348183.1 KX348184.1 KX348185.1 KX348225.1 KY617094.1 KY565231.1 KX857725.1 KY962377.1 KY962381.1 KY449275.1 KY373213.1 MF185002.1 MF167297.1 KY196216.1 MF402918.1 MG001960.1 MF510408.1 MG969497.1 Genomoviridae JQ412056.1 KF413620.1 KT253577.1 KT598248.3 4 Kitaviridae DQ352194.1 DQ352195.1 JN651148.1 JN651149.1 JN651150.1 JN651151.1 HQ852052.1 HQ852053.1 11 HQ852054.1 JX000024.1 JX000025.1
Correspondence: [email protected] 8/15
Pasin, F. (2021). Biotechnol. J, e2000354 https://doi.org/10.1002/biot.202000354
Luteoviridae X07653.1 X13063.1 D11028.1 D00530.1 L25299.1 X76931.1 X83110.1 AF157029.1 AF352024.1 36 AB038147.1 AF441393.1 AF473561.1 AF235168.2 AF218798.2 AY695933.1 AY956384.1 EF529624.1 EU000534.1 EU024678.1 GU167940.1 HM439775.1 AB594828.1 HM439608.2 KC921392.1 KC571999.1 HF679486.1 JQ700308.2 KP326573.1 KT273409.1 KU999109.1 KU297983.1 KU315177.1 KU248489.1 KX159470.1 KY523072.1 LT559483.1 Metaviridae (a ) X13886.1 1 Nanoviridae S56276.1 U16730.1 U16732.1 U16733.1 U16734.1 U16736.1 L41574.1 L41575.1 L41577.1 L41578.1 75 L41576.1 AB009046.1 AB000923.1 AB000924.1 AB000925.1 AB000926.1 AB000927.1 AJ132179.1 AJ132180.1 AJ132181.1 AJ132182.1 AJ132183.1 AJ132184.1 AJ132186.1 AB027511.1 AJ290434.1 AJ749902.1 AB255373.1 EF546808.1 EF546809.1 EF546810.1 EF546811.1 EF546812.1 EF546813.1 GQ150778.1 GQ150779.1 GQ150780.1 GQ150781.1 GQ150782.1 GQ150783.1 GQ150784.1 GQ150785.1 GU553134.1 JN133279.1 JN133280.1 JN133281.1 JN133282.1 JN133283.1 JN133284.1 JN133285.1 JX569847.1 JX867540.1 JX867546.1 JX867548.1 JX867550.1 KF435143.1 KF435145.1 KF435146.1 KF435147.1 KC978958.1 KC978959.1 KC978960.1 KC978961.1 KC978962.1 KC978963.1 KC978964.1 KC978965.1 KC979054.1 KC979055.1 KC979056.1 KC979057.1 KC979058.1 KC979059.1 KC979061.1 KC979062.1 Orphan V01468.1 S55890.1 S51557.1 M17182.1 M55012.1 M64479.1 AJ000898.1 LT221868.1 LT221869.1 11 KX960111.1 KX960112.1 Partitiviridae AY705784.1 AY705785.1 AY751737.1 AY751738.1 EU195326.1 EU195327.1 EU489061.1 EU489062.1 31 FJ550604.1 FJ550605.1 HM560702.1 HM560703.1 HM560704.1 FR687854.1 FR687855.1 JN117276.1 JN117277.1 JN117278.1 JN117279.1 JN196536.1 JN196537.1 JX971976.1 JX971977.1 JX971978.1 JX971979.1 JX971980.1 JX971981.1 JX971982.1 JX971983.1 JX971984.1 JX971985.1 Phenuiviridae X53563.1 D10979.1 D13176.1 D31879.1 AB000403.1 AB000404.1 AB009656.1 AB010376.1 AB010377.1 14 AB010378.1 MG566074.1 MG566075.1 MG566076.1 MG566077.1 Pospiviroidae X17101.1 X17696.1 X52960.1 X15663.1 X14638.1 X07397.1 X06719.1 V01107.1 V01465.1 J02049.1 28 J02053.1 M20731.1 J04348.1 K00818.1 K00817.1 U21125.1 X99487.1 X95290.1 X95365.1 X95734.1 D12823.1 AF059712.1 AF162131.1 AB019508.1 AF447788.1 EF617306.1 FJ409044.1 JX263426.1 Potyviridae X67673.1 M96425.1 M11458.1 X90904.1 D83749.1 U42596.1 U09509.1 Y09854.1 D86371.1 X04083.1 139 Y10973.1 AF023848.1 AF057533.1 AJ001691.1 D86634.1 D86635.1 AJ132268.1 AJ132269.1 AJ243957.1 AB027007.1 AJ296311.1 D00507.2 AJ298033.1 AF127929.2 AJ306718.1 AJ306719.1 AJ312437.1 AJ297628.1 AJ316084.1 AF499738.1 AJ437279.1 BD171712.1 AJ437280.1 AJ237843.3 AY377938.1 AY206394.2 AY437609.1 AY623626.1 AY623627.1 AY642590.1 AY656816.1 AF169561.2 AY578085.1 AJ851866.1 AJ865076.1 DQ299908.1 AB246773.1 AM039800.1 AB219545.1 DQ645484.1 DQ821938.1 DQ851493.1 DQ851495.1 DQ851496.1 AM181350.1 AY994084.1 AM182028.1 EF219408.1 AY626825.4 EF579955.1 EF608612.1 EU259611.1 EU564817.1 EU410442.1 FJ263671.1 FJ185044.1 GQ421689.2 FM206346.1 GQ388116.1 GU181199.1 GQ916624.1 AF538686.2 AB541985.1 AB551370.1 GU207957.1 GU563327.1 HM363516.1 EU847625.2 HQ676607.1 HQ161081.1 HE600072.1 JF838187.1 JN190431.1 JQ314463.1 JN613807.1 JQ395040.1 JQ723475.1 JQ824374.1 DQ925486.2 AB710145.1 JX156425.1 JQ692088.1 JQ350738.1 JQ807997.1 JQ807999.1 JX470965.1 JQ801448.1 JX867236.1 HQ122652.2
Correspondence: [email protected] 9/15
Pasin, F. (2021). Biotechnol. J, e2000354 https://doi.org/10.1002/biot.202000354
JX156434.1 KC443039.1 AB818538.1 KC345607.1 KF260962.1 KF649336.1 KC691259.1 KF906523.1 KF984546.1 KJ830760.1 KM523548.1 KP405232.1 KP343681.1 KP769852.1 LC055681.1 LC060925.1 KT222674.1 KT692938.1 KT834407.1 KU053507.1 KT724961.1 KU556609.1 KU981084.1 KT633868.1 KX013584.1 KU685505.1 KU935732.1 KY612317.1 KX856009.1 KY491536.1 KY649478.1 KY657266.1 KY623505.1 KY623506.1 MF622947.1 MF997470.1 MF509898.1 MF953305.1 KY562565.1 KY828925.2 Pseudoviridae X53558.1 X13291.1 X13777.1 X52387.1 X63184.1 Z17327.1 U12626.1 D83003.1 U41000.1 U68408.1 21 Y08010.1 U96748.1 U68072.1 D85597.1 Y12321.1 AJ000893.1 AF039373.1 AJ005762.1 AB021265.1 AY016208.1 AH005614.2 Reoviridae D13410.1 D13411.1 D01047.1 D13774.1 U36402.1 L38899.1 U36562.1 U36563.1 U36564.1 U36565.1 84 U36566.1 U36567.1 U36568.1 U36569.1 U33633.1 U72757.1 U73201.1 U73202.1 L46682.1 U66712.1 U66713.1 D86439.1 AF020334.1 AF020335.1 AF020336.1 AF020337.1 U66714.1 AF050086.1 AF049704.1 AF049705.1 AB030009.1 AJ297427.1 AJ297430.1 AJ297431.1 AJ297433.1 AJ293984.1 AJ294757.1 AJ409145.1 AJ409146.1 AJ409147.1 AJ409148.1 AF356083.1 AF359556.1 AY029520.1 AY029521.1 AF395872.1 AF395873.1 AF499925.1 AF499926.1 AF499927.1 AF499928.1 AY297693.1 AY297694.1 AY607586.1 AY607587.1 AY789927.1 AY923115.1 DQ023312.1 D76429.1 AB254451.1 AB254452.1 AB254453.1 AB254454.1 AB254455.1 EU523359.1 EU523360.1 FN563989.1 FN563990.1 FN563991.1 FN563992.1 FN563993.1 FN563994.1 FN563995.1 FN563996.1 KU984966.1 KU984967.1 KU984968.1 KU984969.1 KU984970.1 KU984971.1 KU984972.1 KU984973.1 KU984974.1 KU984975.1 Rhabdoviridae L32603.1 AB011257.1 AB030277.1 AY618417.1 AY674964.1 AJ867584.2 AB244417.1 AB244418.1 21 EF687738.1 GU734660.1 KF812525.1 KF812526.1 KM213865.1 KT381973.1 KY700685.1 KY700686.1 KY751404.1 KY751405.1 KP205452.2 MG938506.1 MG938507.1 Secoviridae X00206.1 X00729.1 X15346.1 X15163.1 X16907.1 X04062.1 X64886.1 M62738.1 D00915.1 M83830.1 106 M83309.1 M14913.1 M95497.1 D00322.1 L19655.1 U50869.1 U67839.1 U70866.1 AB030941.1 AB030940.1 AF020051.3 AF225953.1 AF225954.1 AY017339.1 AB054688.1 AB054689.1 AF368272.1 AJ311875.1 AJ311876.1 AY157993.1 AY157994.1 AY291207.1 AY291208.1 AY363727.1 AY303787.1 AY303788.1 AB084450.1 AB084451.1 AY303786.1 AJ621357.1 AJ621358.1 AB009958.2 AB009959.2 AY860978.1 AY860979.1 AB084452.1 AB084453.1 D12477.2 DQ344639.1 DQ344640.1 DQ388879.1 DQ388880.1 AB295643.1 AB295644.1 EF681764.1 EF681765.1 EU980442.1 GU810903.1 GU810904.1 AB518485.1 AB518486.1 FN691934.1 FN691935.1 FR851461.1 FR851462.1 AB649296.1 AB649297.1 EU881937.2 EU881936.2 JQ670669.1 JQ437415.1 HE613269.1 HE774604.1 JX304792.1 JQ581051.1 KC855266.1 KC855267.1 KC832887.1 KC832892.1 KC595304.1 KC595305.1 KC904083.1 KC904084.1 KM229700.1 KM229701.1 KP404602.1 KP404603.1 KT238881.1 KT692952.1 KT692953.1 KU052530.1 KU052531.1 KX269865.1 KX269871.1 KU215538.1 KU215539.1 KX656670.1 KX656671.1 KX424571.1 KX424572.1 KF533719.2 KF533720.2 KY646466.1 KJ572573.2 LT608395.1 LT608396.1 Solemoviridae L20893.1 M23021.1 Z48630.1 U31286.1 AF055887.1 AB040446.1 AF208001.1 AJ867490.1 AY004291.2 19 AM940437.1 AM990928.1 JF495127.1 HM754263.2 JN620802.1 JX123318.1 AY177608.2 KC577469.1 LC019764.1 LC081344.1 Tolecusatellitidae U74627.1 AJ252072.1 AJ308425.1 AJ298903.1 AJ438938.1 AJ420313.1 AJ421484.1 AY244706.1 72 AJ557441.1 AJ566746.1 AJ316026.1 AJ316032.1 AJ316036.1 AJ316040.1 AY428768.1 AY438558.1
Correspondence: [email protected] 10/15
Pasin, F. (2021). Biotechnol. J, e2000354 https://doi.org/10.1002/biot.202000354
AJ542498.1 AJ542489.1 AJ542491.1 AJ542492.1 AJ542493.1 AJ704609.1 AB182263.1 AJ968684.1 AM072289.1 AJ966244.1 DQ641714.1 DQ641716.1 DQ644564.1 AM410551.1 AB236324.1 AB307732.1 AB308071.1 AM933578.1 AB300464.1 EU862324.1 AM260465.1 FM164737.1 FN435836.1 FJ914390.1 GQ478344.1 HQ180394.1 HM143906.1 FR717140.1 HM007103.1 JF733779.1 JN638445.1 JN819490.1 JN819495.1 JN819498.1 JN986808.1 JF919717.1 JQ866298.1 JX443646.1 KC282642.1 KF433066.1 KC952006.1 KF499590.1 KF640694.1 KF641186.1 KF912951.1 KF716173.1 KF267444.1 KJ642219.2 LK054803.1 KP322555.1 KC967282.2 KP752092.1 KM051528.1 KT099179.1 KT454829.1 KU232893.1 Tombusviridae X62493.1 X15511.1 X08021.1 X02986.1 S46028.1 L07884.1 M25270.1 M29671.1 J04357.1 M21958.1 65 L16015.1 U03563.1 U20976.1 X83964.1 X87115.1 X94560.1 X85989.1 Z69910.1 U57305.1 U72332.1 U55002.1 Y13463.1 U62546.1 M88589.2 L18870.2 X14736.2 D86123.1 X86448.2 AF402620.2 AY163842.1 AB086951.1 AJ514833.1 AJ557804.1 AJ607402.1 AF452884.3 AY038069.2 AY616760.1 AY830918.1 AF266518.2 EF207438.1 EF589670.1 EU127904.1 EU081018.1 FJ188473.1 FJ457015.1 GQ244431.1 FJ768020.1 X85215.3 HQ677625.1 HM640935.2 JX197071.1 JQ864181.1 KC166238.1 JX848617.1 KF482072.1 AY613852.2 AY038066.2 AY038068.2 M22445.3 KJ918748.1 EU151723.4 KP901095.1 KU187189.1 KX712140.1 DQ219415.2 Tospoviridae X66972.1 D10066.1 D00645.1 S48091.1 M74904.1 U27809.1 X93218.1 U42555.1 U78734.1 U75379.1 45 AF001387.1 AF025538.1 AB038343.1 AF133128.1 AF214014.1 AB061774.1 AB061773.1 AY867502.1 DQ256123.1 DQ256124.1 DQ256125.1 FJ623474.1 FJ822961.1 FJ822962.1 GU584184.1 GU584185.1 GU735408.1 HQ728385.1 HQ728386.1 HQ728387.1 JF417980.1 JN587268.1 JN587269.1 KJ541744.1 KJ541745.1 KJ541746.1 KM114546.1 KM114547.1 KM114548.1 KU641378.1 KU641379.1 KU641380.1 KX698422.1 KX698423.1 KX698424.1 Tymoviridae X07441.1 D00637.1 J04374.1 J04375.1 U87832.1 Y16104.1 AF098523.1 AJ271595.1 AF195000.2 26 AJ309022.1 AY789137.1 AY884005.1 AY751777.1 AY751778.1 AY751779.1 AY751780.1 EF554577.1 FJ436028.1 FJ444852.2 FN563123.1 JX508290.1 JX508291.1 KC840043.1 KX354202.1 KY084481.1 AF265566.2 Virgaviridae X03854.1 X14006.1 X03241.1 X51828.1 V01408.1 L07937.1 L07938.1 J04342.1 M16576.1 M81413.1 75 M34077.1 L23972.1 D13438.1 L07269.1 X82130.1 X78602.1 U30944.1 X99149.1 U64512.1 D12505.1 Z97873.1 U03387.1 AJ223596.1 AJ223597.1 AJ223598.1 D86636.1 D86637.1 D86638.1 AJ012005.1 AJ012006.2 AF166084.1 Z36974.2 AJ132576.1 AJ132577.1 AJ132578.1 AJ132579.1 AJ238607.1 AJ243719.1 AB033689.1 AB033690.1 AB033691.1 AB033692.1 AJ277556.1 Z66493.2 AF321057.1 AF332868.1 AJ295948.1 AJ295949.1 AB017503.1 AB089381.1 AF447397.1 DQ355023.1 DQ356949.1 AM040955.1 AM398436.1 AB261167.1 EF375551.1 EU043335.1 HM026454.1 HQ389540.1 HQ667979.1 JF729471.1 JN566124.1 KF477193.1 KF495564.1 AF395898.3 KJ395757.1 AB976029.1 AB976030.1 AB917427.1 KT383474.1 KT225271.2 KT225272.2 KT225273.2 KU659022.1 (a) The Metaviridae accessions AB005247.2 and AC007209.6 were not considered in the analysis since they include host sequences.
Correspondence: [email protected] 11/15
Pasin, F. (2021). Biotechnol. J, e2000354 https://doi.org/10.1002/biot.202000354
Table S2. Plasmids used in the study Plasmid name GenBank Usage Reference pLX-B3 KY825144 Cloning purpose [3] pLX-B2-TagRFP-T KY825142 Cloning purpose [3] pLX-B3-TagRFP-T KY825147 Transient expression [3] pLX-AS MW281334 Cloning purpose This study pLX-TuRV MW281335 Virus inoculation This study
Correspondence: [email protected] 12/15
Pasin, F. (2021). Biotechnol. J, e2000354 https://doi.org/10.1002/biot.202000354
Table S 3. Sequences of the primers used ID Sequence (a ) Use W144_F19 CTCTCGCTGTCACCTGCTCTTCCCAGCCTGCGGATCGTTCAAACATT Cloning W145_R19 CCTCTCCTGACACCTGCTCTTCCTCTCCAAATGAAATGAACTTCCT Cloning W146_F19 GAGGAAGAGCAGGTGTCAGGAGAGGGACCAAAAGCAA Cloning W147_R GGAAGAGCAGGTGACAGCGAGAGAACTCACTCATTAGG Cloning W158_F GCCATTCCGCCTGACCTTTC Cloning W159_R ACTGAGCCTCCACCTAGCCTAACA Cloning Q9_F GACCGTATGAGCAAAGAAATCACAGC RT-PCR Q10_R AATGTACTGAGGGAAGCAAGAATGGA RT -PCR W154_F GGAGTTAGCCGCTCGAAATAGAT RT-PCR W155_R GTTTTCCGCCTCTGGTTCTTTG RT-PCR (a) Sequences are in the 5’ to 3’ orientation
Correspondence: [email protected] 13/15
Pasin, F. (2021). Biotechnol. J, e2000354 https://doi.org/10.1002/biot.202000354
Table S 4. Sequences of the chemically synthesized DNA fragments ID Length Sequence (a ) (bp) BB.TuRV_1 1647 GAAGTGCCATTCCGCCTGACCT TTCACCTGCTTATGAGGCAAAATAAATACAAGAAAGAAAGATTTTCTCCCACAGCTTGTATTATCTCTACGACATTAATGATTAATGAG TAGAGTTGCCACAATCGAAATATACAACGAGAACGGAATAATCGTAGCTCGGAAGAAGACGTCGGGACCGCACGCGCTCCTAGAACTCTTCAACGGAAAGCAGAAATACGA TCAGGTGTCCGAACTCTTTGTAATTTGGGTTTGTGAAGAGTGTGGGAAAACCGTGTACTCTACGTGCGAATTTAAAGGAATCGTATTTGTTAGAGAGGACGGGAAAGAGAC AACTGAATTCGAAACAGAAGCAGTTGTAGACTCCGACGATTGTGGGTGTGCTTACGAGTATCATTCCGAGACCGAGAGTGAAGCTTGCCTTTGCCCCGGATACGCGATAGA AGGAATCTGCGATTGCGATTGGTACGAAGACAGACCCGAAACCAGCGACAGCTCTGAGCTTTTCACCCAGTGGGAAAGGCTCGAACTCTTTTCTGACTAAAATCCACAAGA CATTTACTTTCTTAGTAATAGGTAAGTTTAAACTGTGGAATCATGTTGTCATTAAGGAGTATAGTGAAGCTGATCGTAGCTGCGTTGAACGTAATGTTTGTCGTGACGATA GGAGTGTGTGCTCGAGTGTTAGCCCCAGAGAGGCCAGTGAACTGGAACTTTGTGGCGCTACTGCTGACCCCAGTGCTAGCATTGATAGCATTCGAGCTGCTTACCGAGCTA AGAAAATGGATGGTGTACACCGTAAAGGAAGAAGACCTTCCAGCACCTCTTAGCTTGGATTCAACTCCGAGGTTCGACCCCATTCACGGAATAACGTCAACAGTCACCGTG GACGGCAAGGTTTACCAGGTCGTAATACAACCTGAATACTGGCACCTAGTTTCCCCGAATCGATCTCAGGATGGAAACAAGGAAACCGTATGTATAGACCGCATGTCCACT GTCACCCCGGCAGGAAAGGAACCACCATCTCTCGTGACCCTCAAAGTGGGAGATAGAGTTGTGGGTATGGGTTCCCGAGTCTCATGGGGAGGCAATACGTACCTGTTGACT GCAGCCCACGTTTGTGCCCTACACAAGGACATCTACATCTATAAGAATGCCATAGGCACTCCACTAGGTGCTGGATGGACTAGGCGGTATGGAGCTACTCACAAGACAGCA GACTTTACTCTTATCGAAGTCCCACCGACGGTGTGGGCTAAGCTTGGAGTTAAGGCTGCGAGTCTACAACCGTTGAACAAACTTAGCGTAGTCACTGTTTATTCGGCAAAT AGCTCCACGGTAATAACTTCTAGCAGCTCTCGGGCTGTTACACAAGAATTCCGCCATGTGATAATCCACTCGTGCAATACAACGGCCGGAACCAGCGGTTCTCCACTTTAC AGTGGGGATAATGTGGTAGGAGTCCATTTGGGAACTGAGGTTACCATGCACTCCAACAGAGCTTGTAATGTCGGGTTGGTCTTAGGGGCTTTCCACGAATCTATAATCTCC CAAGGAACTCTTAGTGAGATCTCAGCTGATGAGGCTGCGGATAGAGATTATGATTTTGTATTTGCAGGTGTT AGGCTAGGTGGAGGCTCAGTG BB.TuRV_2 1453 GAAGTGCCATTCCGCCTGACCT TTCACCTGCTTATTTGTGGATTTCAGCGTGGAAGGATTAGGGAGGTTGTCAATGGGAAAAGGCGAATTTTATTTGCGAAATGACCGAGG AATTACAATTGAAGAGATCCGGAAGAAAGGAAGGAAAATATGGACAGAAGACTTTGATGAGGAGTCTGATGACGGAATTTTCGAAACTCTACCAGTGAGCTCTTTAAACTG CCAGCGGGCGAGCGACGAGATTGTCTGCTCGCCCTCCTCGAGTTTGGAAATTACCAATGGAAACAAGGCCACGTCACAGAAGACGGAATCGGCCTCAAAGAAGTTGGGAAG TCCGGGGTTACTTTCTCGGAACCAAAGAAGAAAGGAACGAAAGCGATTACAGAAGCTTTCTCAAGAGAAATCCCCGAAGTCGCAAACTACGCCTGGCCCCAAAGAGGATCA AAGGCCGAAAGGAAGTCCCTCTACCTCCAAGCGAGTAGGTTCCGAAGAACCGAAGAGCCAAATGGAATCGGAGAGGTTGTTGAGAGACTTGTCAAAGAGTATCCAACAACT AACTGTCCTCCTGAATTCAAGGGAAGGTGGGATTACCAAGACATCTTCGAGTACGTCACAGACGTGGCGCGCTCGTCAGACATAAACGGCAAGGCGTCCCCCGGTGTGCCG CTCTCCTCAATAGCGGCCAAGAATGAGGTGTTAGTGACCAGACATCTCGATTTTCTTGTTCATGCTGTGGTCCAAAGATTGTTCCATCTTTCCGATGAGATTCTCCCAGAA AAGCCCTCGCCAGAGTGGTTGGTGTCCCAAGGTTATTGTGATCCAGTGAGAGTCTTTGTTAAACAAGAACCCCACCCGTTGAGGAAGCTTGATGAAGGCAGAGTGAGATTA ATCAGCTCGGTGTCTCTAGTAGACCAGTTAGTTGAAAGGGTCTTGTTCGGCCGCCAAAACCGGAAAGAAATCACACAATGGAAGAGTATCCCGTCGAAACCCGGAATGGGC CTGTCGCTGACTGAACAAATGAAGTCAGTGTTTGAACAGGTGAGTAAATTAGCAGCTAGCCGTGAGGCAGCTGAAGCTGATATTTCCGGTTTCGATTGGTCTGTGCAAGAG TGGGAATTGGAAATGGACTTGGAGGTTCGCCTCCGGTTAGGAAACTTTCCCCCTAAGTTGGAGTTAGCCGCTCGAAATAGATTTAAATGTTTCATGAACTCGGTTTTCCAG CTTAGTAACGGTGAACTGATCTCTCAGGTTAGTCCTGGCCTGATGAAATCTGGATCCTATTGCACATCTTCTACCAACTCAAGAATCAGGGTAGCAATGGCGTATTTAATA GGCTCCCCGTGGTGTATTGCCATGGGTGATGACTCTGTCGAAGGTTACGTTACCAACGCCAGAGAGAAGTATGAATCCCTCGGACACATTTGCAGGTGTT AGGCTAGGTGG AGGCTCAGTG BB.TuRV_3 1263 GAAGTGCCATTCCGCCTGACCT TTCACCTGCTTATACACATCTGTAAGGATTACCTGGTTTGCCAAAAGAAGAAAGGCGAGCTAGATGGGTTCAACTTCTGCTCCCATTGG ATATCCCGTTCACATTCTTACCTTGACTCAGTAGGCAAGACACTCTACAGATTTCTGGAATCATCTAATGAAGAACTAGAGATACTTGAGGCTGAGTTAGGGACCCACCCC AGATGGAGGGAAATTGTTTCCAAACTAGAGCTCGTTGGAAGAATCCGAGCAAAACATAATGGAGAAAGGAAACAAGAAGCTCACAAAGAACCAGAGGCGGAAAACCCGCAA GAAGAATTCCCAATCTGGGAGGACCAATTCAGTGGTTACACCCTTATGGGCCCCAGTTTCGACTGGGACCGTAATGCAGGGTGGAGCACTGTCAATTAGTTCGCTGAATAA CAAAGGTGACATACGAGTGTGTGGAAGGGAAGTAGTCACCGAAATCTCAGTTTCGAACACGCCAACTCCTTCCGTGTTGCAAGTCATACCAGAAACCTTTCCTTCTAGGTT AAAGGGTCTGGCTACCAGTTGGTCGAAGTTCAAGTGGCAGGCTATTAAATTCGTTTACATGCCTATCTGCCCCACAACTGAGAGAGGATCTGTTCACTTCGGATTTCTTTA CGACACCGTGGATAACCTCCCGGGAACTGTCGGCGAGATATCCACTTTACAAGGTTACACTACTGGATCTGTCTGGGCCGGAACCTCGGGAAACGAGCTACTCGAAGATGG TGTTTACGCCAAAACCCCGAAGGATGCCGTCGTAGCCAGAATGGACGCTAGGAGAGCTGATAAGAAATATTATCCGATCGTGAGTACCACTCAATTGACTAAGTCTCTAAA CGTTGACGCTTCGCTGGGAAACACGTACGTGCCGGCTCGCCTGGCGATACTGACCGCTGATGGAACAACGGCAGCAGACAAGCCCCAAATCGTAGGGCGTCTCTACGCCGT GTTCTGCGTTGACCTGATTGACACGATCGCCTCGTCCTTAAACGTATAGAATGGCCCACTTTACGGGCACTCTTCCCTCACTACCCAGGTGAGGGATGTAGAATTCATTTG GGAACCCCACATGGTAGTTAGGACTACTCCGCGTCAAAGACAGGCGGTTATCTGTCTTTG GTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTGAGGACGAAAC CAAAG ACAGCCCAATTTGCAGGTGTT AGGCTAGGTGGAGGCTCAGTG (a) Sequences are in the 5’ to 3’ orientation; chemical synthesis barcodes are shown in red; AarI recognition sites are underlined; the 46-nt ribozyme sequence from tobacco ringspot virus satellite RNA (GenBank: M14879) is in purple
Correspondence: [email protected] 14/15
Pasin, F. (2021). Biotechnol. J, e2000354 https://doi.org/10.1002/biot.202000354
SUPPLEMENTARY REFERENCES
[1] E. J. Lefkowitz, D. M. Dempsey, R. C. Hendrickson, R. J. Orton, S. G. Siddell, D. B. Smith, Nucleic Acids Res. 2018 , 46 , D708. [2] N. T. T. Nguyen, B. Contreras-Moreira, J. A. Castro-Mondragon, W. Santana-Garcia, R. Ossio, C. D. Robles-Espinoza, M. Bahin, S. Collombet, P. Vincens, D. Thieffry, J. van Helden, A. Medina-Rivera, M. Thomas-Chollier, Nucleic Acids Res. 2018 , 46 , W209. [3] F. Pasin, L. C. Bedoya, J. M. Bernabé-Orts, A. Gallo, C. Simón-Mateo, D. Orzaez, J. A. García, ACS Synth. Biol. 2017 , 6, 1962. [4] R. Ling, A. E. Pate, J. P. Carr, A. E. Firth, Virology 2013 , 446 , 397. [5] V. Potapov, J. L. Ong, R. B. Kucera, B. W. Langhorst, K. Bilotti, J. M. Pryor, E. J. Cantor, B. Canton, T. F. Knight, T. C. Evans, G. J. S. Lohman, ACS Synth. Biol. 2018 , 7, 2665. [6] C. J. van Dolleweerd, S. A. Kessans, K. C. Van de Bittner, L. Y. Bustamante, R. Bundela, B. Scott, M. J. Nicholson, E. J. Parker, ACS Synth. Biol. 2018 , 7, 1018. [7] F. Pasin, X.-A. Tseng, L. C. Bedoya, J. Heydarnejad, T.-C. Deng, J. A. García, Y.-R. Chen, J. Virol. Methods 2018 , 262 , 48. [8] R. Hull, Virology 1977 , 79 , 50. [9] A. O. Denloye, R. B. Homer, R. Hull, J. Gen. Virol. 1978 , 41 , 77. [10] C. A. Schneider, W. S. Rasband, K. W. Eliceiri, Nat. Methods 2012 , 9, 671.
Correspondence: [email protected] 15/15