G Model

TTBDIS-692; No. of Pages 7 ARTICLE IN PRESS

Ticks and -borne Diseases xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Ticks and Tick-borne Diseases

journal homepage: www.elsevier.com/locate/ttbdis

Surveillance of ticks and associated pathogens in free-ranging

Formosan pangolins (Manis pentadactyla pentadactyla)

a b c b

Rupak Khatri-Chhetri , Hsi-Chieh Wang , Chen-Chih Chen , Han-Chun Shih ,

b d a a,∗∗,1

Hsien-Chun Liao , Ching-Min Sun , Nabin Khatri-Chhetri , Hung-Yi Wu ,

c,e,∗,1

Kurtis Jai-Chyi Pei

a

Department of Veterinary Medicine, College of Veterinary Medicine, National Pingtung University of Science and Technology, Taiwan

b

Diagnostic and Vaccine Development, Centers for Disease Control, Taiwan

c

Institute of Wildlife Conservation, College of Veterinary Medicine, National Pingtung University of Science and Technology, Taiwan

d

Institute of Bioresources, College of Agriculture, National Pingtung University of Science and Technology, Taiwan

e

Pingtung Rescue Center for Endangered Wild , National Pingtung University of Science and Technology, Taiwan

a r t i c l e i n f o a b s t r a c t

Article history: Chinese pangolins are critically endangered insectivorous mammals distributed in several South and

Received 25 January 2016

Southeast Asian countries. In recent years, there has been an increase in spread of tick-borne diseases

Received in revised form 9 July 2016

in both humans and animals worldwide. Currently, limited information is available on ticks and associ-

Accepted 9 July 2016

ated pathogens infesting pangolins. The objective of the present study was to survey ticks and associated

Available online xxx

pathogens in the Formosan pangolin population in Southeastern Taiwan. Free-ranging Formosan pan-

golins captured during ecological survey were examined for the presence of ticks. DNA extracted from

Keywords:

these ticks was used to identify the tick species and also to detect the tick-borne pathogens, by molecular

Chinese pangolins

Ticks methods. In the present study, we found 25% (13/52) of pangolins captured during 2012–2014 infested

with ixodid ticks. A total of 21 ticks were collected and 3 species were identified: Haemaphysalis hys-

Tick-borne pathogens

Taiwan tricis (14/21), Haemaphysalis formosensis (2/21) and testudinarium (5/21). We detected four

different tick-borne pathogens, where one was identical to Anaplasma sp. strain An.H1446 while others

showed close resemblance to conorii subsp. caspia A-167, Ehrlichia sp. TC251-2 and Cytauxzoon

spp., respectively. The present study is the first survey of ticks infesting the free-ranging Chinese pan-

golins and pathogens harboured by these ticks. This information is important to know the diversity of ticks

and tick-borne pathogens, and its conservation significance to pangolins and other sympatric wildlife.

Important future step should be regular surveillance of ticks and tick-borne diseases at human-domestic

animals-wildlife interface, which can provide a useful insight into the dynamics of these pathogens and

can help control and prevent outbreak of zoonoses.

© 2016 Elsevier GmbH. All rights reserved.

1. Introduction borne pathogens of both medical and veterinary significance, and

there has been an increase in spectrum of these diseases globally

Ticks are obligate blood-sucking ectoparasites with worldwide in recent years (Dantas-Torres et al., 2012; Madder et al., 2013;

distribution and infest wide-range of land vertebrates including Randolph et al., 2001). Information on the epidemiology of tick-

humans (Domingos et al., 2013; Hassan et al., 2013; Madder et al., borne pathogens can be applied to both domestic and wildlife

2013). Moreover, ticks and wildlife are known to harbour tick- health management (Nijhof et al., 2005; Tonetti et al., 2009; Xu

et al., 2015).

Chinese pangolins (Manis pentadactyla) are one of the eight

extant pangolin species and are found only in Asia, its sub-species

∗

Corresponding author at: Institute of Wildlife Conservation, College of Veteri-

M. p. pentadactyla (the Formosan pangolin) distributes only in

nary Medicine, National Pingtung University of Science and Technology, Taiwan.

∗∗ Taiwan. All pangolin species are highly threatened as a result of

Corresponding author at: Department of Veterinary Medicine, College of Veteri-

heavy exploitation for illegal trade. Currently, the M. pentadactyla

nary Medicine, National Pingtung University of Science and Technology, Taiwan.

E-mail addresses: [email protected] (H.-Y. Wu), is listed as Critically Endangered A2d + 3d + 4d in the IUCN (Inter-

[email protected] (K.J.-C. Pei).

national Union for Conservation of Nature) Red List of Threatened

1

These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.ttbdis.2016.07.007

1877-959X/© 2016 Elsevier GmbH. All rights reserved.

Please cite this article in press as: Khatri-Chhetri, R., et al., Surveillance of ticks and associated pathogens in free-ranging Formosan

pangolins (Manis pentadactyla pentadactyla). Ticks Tick-borne Dis. (2016), http://dx.doi.org/10.1016/j.ttbdis.2016.07.007

G Model

TTBDIS-692; No. of Pages 7 ARTICLE IN PRESS

2 R. Khatri-Chhetri et al. / Ticks and Tick-borne Diseases xxx (2016) xxx–xxx

Fig. 1. Map of Taiwan showing the sample collection sites located in Taitung county where Formosan pangolins infested with ticks were captured.

Species and the population trend has been estimated to be declining and other ectoparasites (Fig. 1). All ticks collected were stored in

◦

rapidly (Challender et al., 2014). 70% ethanol at 4 C until further analysis.

There are only few studies available on ticks and tick-borne DNA extraction was done from the tick specimens by using

diseases infecting pangolin species. Amblyomma javanese has the QIAmp DNA Mini Kit (QIAGEN, Hilden, Germany) by follow-

been reported in Malayan pangolins (M. javanica) from Malaysia ing the manufacturers’ instructions and the eluted DNA was stored

◦

(Hafiz et al., 2012; Hassan et al., 2013), (Kollars and at −20 C until use. This DNA template was used for both molec-

Sithiprasasna, 2000; Parola et al., 2003) and also from Southern ular identification of the tick species and also for the detection of

China (Li et al., 2010), whereas A. compressum was reported from select tick-borne pathogens. The final reaction volume for the PCR

the African giant pangolin (M. gigantea), which was found to har- was 25 ␮l, which comprised of 5 ␮l of 5× PCR buffer (Promega),

bour Rickettsia africae, the causal agent of tick fever in humans and 1 ␮l of 5 mM dNTPs (Promega), 1.75 ␮l of 25 mM MgCl2 (Promega),

animals (Mediannikov et al., 2012). Parola et al. (2003) also detected 0.1 ␮l Taq (Promega) (5 U/␮l), 0.5 ␮l of 5 ␮M forward and reverse

Anaplasma spp. in the A. javanese collected from the Malayan pan- primers, 2.5 ␮l of the extracted tick DNA as template, and 13.65 ␮l

golin in Thailand. Another study identified Trypanosoma brucei of deionized water.

gambiense in long tailed pangolins (M. tetradactyla) and tree pan- We first identified ticks to the genus level based on the morpho-

golins (M. tricuspis) in Cameroon (Njiokou et al., 2006). logical characteristics (Baker, 1999; Hoogstraal et al., 1965; Teng

The present study was conducted to investigate the prevalence and Jiang, 1991; Yamaguti et al., 1971). To identify the tick species,

of ticks infesting Formosan pangolins and also detected tick-borne we amplified mitochondrial 16S rDNA and 12S rDNA using previ-

pathogens harboured by these ticks. This information is important ously reported primers (Table 1). The cycling conditions used for the

◦ ◦

to know the diversity of ticks and tick-borne pathogens, and its PCR were: initial pre-heating at 94 C for 5 min, 5 cycles of 94 C for

◦ ◦ ◦

conservation significance to pangolins and other sympatric wildlife. 15 s, 51 C for 30 s and 68 C for 30 s, followed by 25 cycles of 94 C

◦ ◦

for 15 s, 53 C for 30 s and 70 C for 30 s, with a final elongation step

◦

of 5 min at 70 C.

The extracted tick DNA was subjected to SYBR Green real-time

2. Materials and methods

PCR using thermal cycler (Mx3005P, Stratagene, La Jolla, CA, USA)

for detection of Anaplasma spp. and Ehrlichia spp., and nested PCR

The present study was done as a part of a “Pangolin biol-

for detection of apicomplexans and Rickettsia spp. We selected

ogy and ecology project” in Taitung County, Southeastern Taiwan

only one tick collected from each pangolin to detect the tick-borne

with the approval from Taiwan Forestry Bureau. The pangolin

pathogens. Ehrlichia and Anaplasma were detected by Ehrlichia-

habitat consisted of secondary forests, tree plantation, bamboo

specific primers (Table 1), and the PCR conditions included one

◦ ◦ ◦

forests, grasslands, and orchards (Li et al., 2011), and was mod-

cycle of 15 min at 95 C, 45 cycles of 30 s at 94 C, 30 s at 55 C, 90 s

◦ ◦ ◦

erately fragmented with human settlements, farmlands, and trails

at 72 C, one cycle of 1 min at 95 C and 45 cycles of 30 s at 65 C.

(Khatri-Chhetri et al., 2015). Between 2012 and 2014, pangolins

Apicomplexa-specific primers (Table 1) were used for the detection

live-trapped for the project were examined for the presence of ticks

Please cite this article in press as: Khatri-Chhetri, R., et al., Surveillance of ticks and associated pathogens in free-ranging Formosan

pangolins (Manis pentadactyla pentadactyla). Ticks Tick-borne Dis. (2016), http://dx.doi.org/10.1016/j.ttbdis.2016.07.007

G Model

TTBDIS-692; No. of Pages 7 ARTICLE IN PRESS

R. Khatri-Chhetri et al. / Ticks and Tick-borne Diseases xxx (2016) xxx–xxx 3

Table 1

Primers used for the molecular identification of ticks and tick-borne pathogens in the present study.

  a

Target group Target gene Primer name Primer sequence (5 -3 ) Product size (bp) References Positive Control

Tick 16S rDNA 16S+1 CTGCTCAATGATTTTTTAAATTGCTGTGG 460 Black and Piesman, 1994 –

16S−1 CCGGTCTGAACTCAGATCAAGTA

12S rDNA T1B AAACTAGGATTAGATACCCT 360 Beati and Keirans, 2001 –

T2A AATGAGAGCGACGGGCGATGT

Ehrlichia and Anaplasma 16S rDNA EHR16SD GGTACCYACAGAAGAAGTCC 345 Parola et al., 2000 E. chaffeensis and

A. phagocytophilum

EHR16SR TAGCACTCATCGTTTACAGC

Apicomplexa 18S rDNA BmF1 GCGATGTATCATTCAAGTTTCTG 700 Simpson et al., 2005 Babesia microti

BmR1 TGTTATTGCCTTACACTTCCTTGC

BmF2 ACGGCTACCACATCTAAGGAAGGC

BmR2 TCTCTCAAGGTGCTGAAGGA

Rickettsia spp. ompB ompB OF GTAACCGGAAGTAATCGTTTCGTAA 250–426 Kuo et al., 2015a R. conorii, R. typhi

ompB OR GCTTTATAACCAGCTAAACCACC

ompB SFG IF GTTTAATACGTGCTGCTAACCAA

OmpB SFG/TG IR GGTTTGGCCCATATACCATAAG

ompB TG IF AAGATC CTTCTGATGTTGCAACA

a

Extracted from the antigen slides (Focus Technology, Cypress, CA, USA).

of apicomplexans by using nested PCR, and the cycling conditions In the present study, 3 tick species were identified (Table 3).

◦

used were: initial pre-heating at 95 C for 5 mins followed by 39 Haemaphysalis hystricis (14/21) was the most common tick species

◦ ◦ ◦

cycles of 96 C for 20 s, 55 C for 20 s and 72 C for 50 s, with a final found in the Formosan pangolin, of which 4 were males, 6 were

◦

elongation step of 10 min at 72 C. Targeting ompB gene (Table 1) females, and 4 were nymphs. Haemaphysalis formosensis (one male

with nested PCR identified the presence of Rickettsia spp. infection and one female) was identified from only one pangolin. Amblyomma

in ticks (Kuo et al., 2015a). testudinarium (5/21) were identified from two pangolins and all

The PCR products were run on 2% agarose gel (Promega, USA) were nymphs.

and visualized under UV light after staining with ethidium bromide, The most common tick-borne pathogen we identified was

and the positive bands were excised and purified with QIAquick Gel closely related to Rickettsia conorii, which was detected in 3 H.

Extraction Kit, QIAGEN. These PCR products were sequenced twice hystricis ticks (2 females and 1 male) collected from 3 pangolins

in both direction and resulting DNA nucleotide sequences were (Table 4). By PCR, 372 bp of the ompB gene was amplified from

aligned with other known sequences by using the BLAST (Basic the DNA extracted from these ticks and the sequences showed

Local Alignment Search Tool) (www.ncbi.nlm.nih.gov) for compar- 96% (357/372 bp) similarity to the R. conorii subsp. caspia A-167

isons. [AF123708.1]. Only one H. hystricis (P1020529) was found to har-

bour a pathogen belonging to Apicomplexa and the sequence

analysis showed 96% (603/629 bp) similarity to the uncultured

3. Results

Cytauxzoon spp. [KM025200.1]. Likewise, DNA sequences obtained

from only one H. hystricis (P1020307) showed high similarity (99%,

A total of 52 Formosan pangolins (25 males and 27 females) were

303/305 bp) to the Ehrlichia sp. TC251-2 [KJ410253.1] detected in

live-trapped during the study period (Table 2). We collected 21 ticks

Dermacentor nuttalli (Kang et al., 2014). The nucleotide sequences

(7 females, 5 males and 9 nymphs) from 13 individual pangolins.

obtained from the PCR product of another H. hystricis (P1030827)

The prevalence of tick infestation in Formosan pangolins was 25%

showed 100% (305/305 bp) similarity to the Anaplasma sp. strain

with 95% confidence interval (C.I.) of 14.9–38.3%, whereas the mean

An.H1446 [AF497579.1] detected in H. lagrangei (Parola et al., 2003).

intensity was 1.62 (95% C.I. = 1.2–2). Most of ticks were found in the

ventral thoracic region and around the face (Fig. 2), while few ticks

were also found beneath scales. Both adult and sub-adult pangolins

4. Discussion

were found infested with ticks, but we didn’t detect any ticks in the

juvenile individuals.

We found 25% tick infestation rate in Formosan pangolins, which

was much lower than in Malayan pangolins. In a parasitological

survey of 16 Malayan pangolins, 68.8% of them were found to be

infested with A. javanese (Hassan et al., 2013). Many biotic and

abiotic factor such as biodiversity (Ostfeld and Keesing, 2000), cli-

matic conditions (Estrada-Pena˜ and Salman, 2013), host preference

(Mihalca et al., 2012), and seasonal variation (Hornok, 2009) could

contribute to the difference in the tick infestation rate between

Malayan and Formosan pangolins.

In Taiwan, 39 tick species have been reported, which include 2

Argas spp., 3 Carios spp., 8 Ixodes spp., 5 Amblyomma spp., 16 Haema-

physalis spp., 2 Dermacentor spp., and 3 Rhipicephalus spp. (Chen

et al., 2010). However, we identified only 3 tick species of this list

that were infesting the population studied. Haemaphysalis hystricis

is a forest inhabiting species, and is reportedly distributed in sub-

tropical and temperate zones of Asia (Chen et al., 2010; Grassman

Jr. et al., 2004; Hoogstraal et al., 1965). It has a wide host range,

which includes humans, domestic dogs and buffalo, and at least

9 species of wild carnivores and 4 species of ungulates (Akuzawa

Fig. 2. Formosan Pangolin (Manis pentadactyla pentadactyla) infested with a tick on

the left upper eyelid. et al., 1987; Aroon et al., 2009; Cao et al., 2000; Grassman Jr. et al.,

Please cite this article in press as: Khatri-Chhetri, R., et al., Surveillance of ticks and associated pathogens in free-ranging Formosan

pangolins (Manis pentadactyla pentadactyla). Ticks Tick-borne Dis. (2016), http://dx.doi.org/10.1016/j.ttbdis.2016.07.007

G Model

TTBDIS-692; No. of Pages 7 ARTICLE IN PRESS

4 R. Khatri-Chhetri et al. / Ticks and Tick-borne Diseases xxx (2016) xxx–xxx

Table 2

Prevalence and mean intensity of tick infestation in Formosan pangolins.

No. Captured No. Infested Prevalence% (95% C.I.) Mean Intensity (95% C.I.)

Total 52 13 25 (14.9–38.3) 1.62 (1.2–2)

Sex

Male 27 6 22.2 (10.1–41.5) 1.7 (1–2.17)

Female 25 7 28 (13.4–48) 1.57 (1–2.1)

Age-group

Adult 36 10 27.8 (14.8–44.4) 1.5 (1.1–1.9)

Sub-adult 14 3 21.4 (6.1–50) 2 (1–2.67)

Juvenile 2 0 0 (0–0) 0 (0–0)

Seasons

Dry 12 5 41.7 (18.1–70.6) 1.4 (1–1.6)

Wet 40 8 20 (9.4–39.6) 1.75 (1.1–2.4)

Dry season (December-March) and wet season (April–November).

C.I. (Confidence Interval).

Prevalence and mean intensity with 95% C.I. were calculated using Quantitative Parasitology 3.0 (Rózsa et al., 2000).

Table 3

Identification of the tick species collected from Formosan pangolins based on morphological and molecular findings.

Sample Tick Tick species Identification based on Identification based on

mitochondrial 16S rDNA gene mitochondrial 12S rDNA

[Accession no.] [Accession no.]

P1030222 1♀ H. hystricis Haemaphysalis hystricis H. hystricis mitochondrion, partial

mitochondrial gene for 16S genome 238/238(100%)

ribosomal RNA, partial sequence, [JX573137.1]

isolates: HH-B 401/401(100%)

[AB819197.1]

P1020529 1♂ H. hystricis H. hystricis mitochondrial gene for H. hystricis mitochondrion, partial

16S ribosomal RNA, partial genome 238/238(100%)

sequence, isolate: HH-B [JX573137.1]

401/401(100%) [AB819197.1]

♂

P1010227 1 H. hystricis H. hystricis mitochondrial gene for H. hystricis mitochondrion, partial

16S ribosomal RNA, partial genome 238/238(100%)

sequence, isolate: HH-B [JX573137.1]

401/408(98%) [AB819197.1]

P1020220 1♀ H. hystricis H. hystricis mitochondrial gene for H. hystricis mitochondrion, partial

16S ribosomal RNA, partial genome 238/238(100%)

sequence, isolate: HH-B [JX573137.1]

400/401(99%) [AB819197.1]

P1020319 1♂, 1♀ H. formosensis H. formosensis mitochondrion, H. formosensis mitochondrion,

complete genome 403/404(99%) complete genome 338/338(100%)

[JX573137.1] [JX573137.1]

P1020307 1♀ H. hystricis H. hystricis mitochondrial gene for H. hystricis mitochondrion, partial

16S ribosomal RNA, partial genome 238/238(100%)

sequence, isolate: HH-B [JX573137.1]

401/401(100%) [AB819197.1]

P1030606 1♂ H. hystricis H. hystricis mitochondrial gene for H. hystricis mitochondrion, partial

16S ribosomal RNA, partial genome 238/238(100%)

sequence, isolate: HH-C [JX573137.1]

400/403(99%) [AB819197.1]

P1030607 3 nymphs A. testudinarium A. testudinarium mitochondrial A. variegatum isolate AVMA11 12 S

gene for 16S ribosomal RNA, ribosomal RNA gene, partial

partial sequence 403/403(100%) sequence; mitochondrial

[AB602350.1] 307/350(88%) [HQ856475.1]

P1021209 2 nymphs H. hystricis Unable to match Haemaphysalis hystricis

mitochondrion, partial genome

238/238(100%) [JX573137.1]

P1031112 1♂ H. hystricis H. hystricis mitochondrial gene for Haemaphysalis hystricis

16S ribosomal RNA, partial mitochondrion, partial genome

sequence, isolate: HH-A 238/238(100%) [JX573137.1]

401/401(100%) [AB819197.1]

P1031104 2 nymphs A. testudinarium A. testudinarium mitochondrial A. variegatum isolate AVMA11 12 S

gene for 16S ribosomal RNA, ribosomal RNA gene, partial

partial sequence 403/403(100%) sequence; mitochondrial

[AB602350.1] 307/350(88%) [HQ856475.1]

P1030703 2♀ H. hystricis H. hystricis mitochondrial gene for H. hystricis mitochondrion, partial

16S ribosomal RNA, partial genome 238/238(100%)

sequence, isolate: HH-B [JX573137.1]

401/401(100%) [AB819197.1]

P1030827 1♀, 2 nymphs H. hystricis H. hystricis mitochondrial gene for H. hystricis mitochondrion, partial

16S ribosomal RNA, partial genome 238/238(100%)

sequence, isolate: HH-B [JX573137.1]

401/401(100%) [AB819197.1]

♂

(Male), ♀ (Female).

Please cite this article in press as: Khatri-Chhetri, R., et al., Surveillance of ticks and associated pathogens in free-ranging Formosan

pangolins (Manis pentadactyla pentadactyla). Ticks Tick-borne Dis. (2016), http://dx.doi.org/10.1016/j.ttbdis.2016.07.007

G Model

TTBDIS-692; No. of Pages 7 ARTICLE IN PRESS

R. Khatri-Chhetri et al. / Ticks and Tick-borne Diseases xxx (2016) xxx–xxx 5

Table 4

Tick-borne pathogens detected by PCR in ticks collected from Formosan pangolins.

Sample Tick species Anaplasma & Apicomplexa 18S Rickettsia (ompB)

Ehrlichia

P1030222 H. hystricis ♀ – – Rickettsia conorii

subsp. A-167

357/372(96%)

P1020529 H. hystricis ♂ – – –

P1010227 H. hystricis ♂ – Uncultured – Cytauxzoon

603/629(96%)

P1020220 H. hystricis ♀ – – –

P1020319 H. formosensis ♀ – – –

P1020307 H. hystricis ♀ Ehrlichia sp. – – TC251-2

303/305(99%)

♂

P1040606 H. hystricis – – –

P1030607 A. testudinarium – – –

nymph

P1021209 H. hystricis nymph – – –

♂

P1031112 H. hystricis – – Rickettsia conorii

subsp. A-167

357/372(96%)

P1031104 A. testudinarium – – –

nymph

P1030703 H. hystricis ♀ – – –

P1030827 H. hystricis ♀ Anaplasma sp. – Rickettsia conorii

AnHl446 subsp. A-167

305/305(100%) 357/372(96%)

2004; Hoogstraal et al., 1965; Ma et al., 2001; Parola et al., 2003; eases that infect humans, domestic and wild animals worldwide

Shimada et al., 2003; Yamauchi et al., 2009). This suggests that it (Dumler, 2005; Parola et al., 2003; Rikihisa, 1991). The Anaplasma

could also be infesting other sympatric mammals that share the sp. strain AnH1446 identified in the present study has been previ-

pangolin habitat. ously detected in H. lagrangei from a Malayan sun bear (Helarctos

The earliest record of H. formosensis in Taiwan was reported from malayanus) in Thailand (Parola et al., 2003). Regarding ehrlichiosis,

dogs, but elsewhere it has also been identified from wild boar (Sus E. canis is the most common species in Taiwan, and is known to

cristatus), Ryukyu black rabbit, sika deer (Cervus nippon) (Yamaguti infect both dogs and cats (Hsieh et al., 2010; Huang et al., 2010; Wu

et al., 1971; Yamauchi et al., 2009) and Iriomote cat (Prionailurus et al., 2009; Yin et al., 2003). Ehrlichia sp. TC251-2, the most likely

iriomotensis) (Akuzawa et al., 1987) in Japan, and also from dogs in species we found in the Formosan pangolin, has been previously

Southern China (Ma et al., 2001). In a recent survey, it was identified detected in D. nuttalli from China along with other Ehrlichia species

on Jeju Island, Korea for the first time from migratory birds (Choi (Kang et al., 2014).

et al., 2014), which suggests that this tick also has a wide host range. We also detected a pathogen related to Cytauxzoon spp., a causal

The third tick species identified in the present study was A. testu- agent of cytauxzoonosis, which is known to cause fatal disease

dinarium, which is a common tick species in Southern Asia (Voltzit in domestic cats, and infect several wild felids such as ocelot

and Keirans, 2002). This species also has a wide host range includ- (Leopardus pardalis), bobcats (Lynx rufus), puma (Puma concolor),

ing birds (Akuzawa et al., 1987; Cao et al., 2000; Ghosh et al., 2007; jaguar (Panthera onca) and lion (Panthera leo) (André et al., 2009;

Grassman Jr. et al., 2004; Hoogstraal et al., 1968; Inokuma et al., Birkenheuer et al., 2006; Peixoto et al., 2007). Amblyomma ameri-

2002; Miranpuri, 1988; Shimada et al., 2003; Wen et al., 2003; canum, A. maculatum, I. scapularis and I. affinis have been reported to

Yamauchi et al., 2009). harbour Cytauxzoon spp. naturally (Wehinger et al., 1995), while D.

Most of the tick-borne pathogens identified in the present variabilis has been experimentally demonstrated to transmit infec-

study belonged to rickettsiae, which are a diverse group of obliga- tion. Serological survey of the Cytauxzoon spp. in pangolins can

tory intracellular gram-negative bacteria, and include the genera be useful to know if it infects pangolins, a non-felid species. Fur-

Rickettsia, Anaplasma, Ehrlichia, Orientia, and Coxiella (Hackstadt, ther molecular characterization is necessary for identification of

1996) that infect ectoparasites as well as wide-range of vertebrates the Rickettsia and Cytauxzoon species detected in the present study

including domestic animals and humans (Nicholson et al., 2010 due to the low (96%) similarity observed in the DNA sequences.

Walker, 1996). In Taiwan, 9 Rickettsia species or closely related The effect of ticks and tick-borne diseases in mortality and

pathogens have been identified, including the R. conorii from small morbidity of domestic animals are well documented (Domingos

mammals such as losea rat (Rattus losea), house shrew (Suncus mur- et al., 2013; Jongejan and Uilenberg, 1994; Jongejan and Uilenberg,

inus), Ryuku mouse (Mus caroli) (Kuo et al., 2015a). The bandicoot 2004). However, such information is limited in wildlife, partic-

rat (Bandicota indica) was also found to harbour various rickettsial ularly endangered species with declining population. Tick-borne

species (Kuo et al., 2015b). Rickettsia conorii is one of the etiologi- diseases can have conservation implications to wildlife, as there

cal agents of the tick-borne spotted fever group (SFG) rickettsioses are reports of possible associations of tick-borne infections with

(Nicholson et al., 2010; Parola, 2004). The most common tick-borne mortality of endangered species such as in lion (Fyumagwa et al.,

pathogen found in ticks infesting Formosan pangolins showed close 2007) and black rhinoceros (Nijhof et al., 2003). However, further

resemblance to R. conorii subsp. A-167, which is the causal agent of studies are necessary to gather enough evidence of morbidity and

Astrakhan fever (Sentausa et al., 2012). mortality in pangolins to evaluate the extent of the threat. Clini-

Other tick-borne rickettsial pathogens detected from the H. hys- cal and laboratory findings associated with the tick infestation and

tricis in the present study were Anaplasma spp. and Ehrlichia spp., infections with tick-borne pathogens in pangolins can be invaluable

both of which are agent of important and potentially fatal dis- for understanding the pathogenesis of their tick-borne diseases.

Please cite this article in press as: Khatri-Chhetri, R., et al., Surveillance of ticks and associated pathogens in free-ranging Formosan

pangolins (Manis pentadactyla pentadactyla). Ticks Tick-borne Dis. (2016), http://dx.doi.org/10.1016/j.ttbdis.2016.07.007

G Model

TTBDIS-692; No. of Pages 7 ARTICLE IN PRESS

6 R. Khatri-Chhetri et al. / Ticks and Tick-borne Diseases xxx (2016) xxx–xxx

It should be noted that the pangolin habitat in the present study Black, W.C., Piesman, J., 1994. Phylogeny of hard- and soft-tick taxa (: Ixodida)

based on mitochondrial 16S rDNA sequences. Proc. Natl. Acad. Sci. U. S. A. 91,

is in close proximity to human settlements, and therefore there is

10034–10038.

a possibility of transmission of ticks between the domestic animals

Cao, W.C., Gao, Y.M., Zhang, P.H., Zhang, X.T., Dai, Q.H., Dumler, J.S., Fang, L.Q., Yang,

and wildlife. Wildlife can play an important role in the transmis- H., 2000. Identification of Ehrlichia chaffeensis by nested PCR in ticks from

southern China. J. Clin. Microbiol. 38, 2778–2780.

sion of diseases to both humans and domestic animals (Daszak

Challender, D., Baillie, J., Ades, G., Kaspal, P., Chan, B., Khatiwada, A., Xu, L., Chin, S.,

et al., 2000; King, 2004). Haemaphysalis formosensis has not been

KC, R., Nash, H., Hsieh, H., 2014. Manis pentadactyla. The IUCN Red List of

observed to bite humans but the other two species are reported to Threatened Species (Version 2014.3), http://www.iucnredlist.org/details/

12764/0 (accessed 05.12.15).

do so (Guglielmone et al., 2014). However, the former still can have

Chen, Z., Yang, X., Bu, F., Yang, X., Yang, X., Liu, J., 2010. Ticks (acari: ixodoidea:

an important epidemiological role as a vector within the endophilic

, ) of China. Exp. Appl. Acarol. 51, 393–404.

pathogenic cycle that can indirectly affect humans via an exophilic Choi, C.Y., Kang, C.W., Kim, E.M., Lee, S., Moon, K.H., Oh, M.R., Yamauchi, T., Yun,

pathogen cycle with a human biting tick species. Several similar Y.M., 2014. Ticks collected from migratory birds including a new record of

Haemaphysalis formosensis, on Jeju Island, Korea. Exp. Appl. Acarol. 62,

eco-epidemiological settings exist, e.g. that of Borrelia afzelii and I.

557–566.

acuminatus in rodents (Szekeres et al., 2015). Disease can also trans-

Dantas-Torres, F., Chomel, B.B., Otranto, D., 2012. Ticks and tick-borne diseases: a

mit from the reservoir population (often domestic animals) one health perspective. Trends Parasitol. 28, 437–446.

Daszak, P., Cunningham, A.A., Hyatt, A.D., 2000. Emerging infectious diseases of

to the sympatric wildlife via “spill over” mechanism and can be a

wildlife-threats to biodiversity and human health. Science 287, 443–449.

threat to endangered species (Daszak et al., 2000). Therefore, reg-

Domingos, A., Antunes, S., Borges, L., Rosario, V.E., 2013. Approaches towards tick

ular surveillance of zoonotic diseases such as ticks and tick-borne and tick-borne diseases control. Rev. Soc. Bras. Med. Trop 46, 265–269.

Dumler, J.S., 2005. Anaplasma and Ehrlichia infection. Ann. N. Y. Acad. Sci. 1063,

diseases using cross-disciplinary approach should be conducted at

361–373.

the human-domestic animals-wildlife interface, which can provide

Estrada-Pena,˜ A., Salman, M., 2013. Current limitations in the control and spread of

a useful insight into the dynamics of these pathogens, and can help ticks that affect livestock: a review. Agriculture 3, 221–235.

Fyumagwa, R.D., Runyoro, V., Horak, I.G., Hoare, R., 2007. Ecology and control of

control and prevent future outbreak of such diseases.

ticks as disease vectors in wildlife of the Ngorongoro Crater, Tanzania. S. Afr. J.

Wildl. Res. 37, 79–90.

Ghosh, S., Bansal, G.C., Gupta, S.C., Ray, D., Khan, M.Q., Irshad, H., Shahiduzzaman,

5. Conclusion

M., Seitzer, U., Ahmed, J.S., 2007. Status of tick distribution in Bangladesh,

and Pakistan. Parasitol. Res. 101, 207–216.

In conclusion, the present study, for the first time surveyed Grassman Jr., L., Sarataphan, N., Tewes, M., Silvy, N., Nakanakrat, T., 2004. Ticks

(Acari: Ixodidae) parasitizing wild carnivores in Phu Khieo wildlife sanctuary,

ticks infesting free-ranging Formosan pangolins in Taiwan and also

Thailand. J. Parasitol. 90, 657–659.

identified the tick-borne pathogens harboured by these ticks. The

Guglielmone, A.A., Robbins, R.G., Apanaskevich, D.A., Petney, T.N., Estrada-Pena,˜ A.,

findings of the present study represent an important epidemiolog- Horak, I., 2014. The Hard Ticks of the World. Springer, Dordrecht.

Hackstadt, T., 1996. The biology of rickettsiae. Infect. Agents Dis. 5, 127–143.

ical and epizootiological data for this region, and are valuable for

Hafiz, M., Marina, H., Afzan, A.W., Chong, J., 2012. Ectoparasite from confiscated

the conservation of pangolins.

Malayan pangolin (Manis javanica Desmarest) in peninsular Malaysia. In: UMT

11th International Annual Symposium on Sustainability Science and

Management, Terengganu, Malaysia, pp. 09–11.

Conflict of interest

Hassan, M., Sulaiman, M.H., Lian, C.J., 2013. The prevalence and intensity of

Amblyomma javanense infestation on Malayan pangolins (Manis javanica

The authors declare that there is no conflict of interest in this Desmarest) from Peninsular Malaysia. Acta. Trop. 126, 142–145.

study. Hoogstraal, H., Trapido, H., Kohls, G.M., 1965. Studies on southeast Asian

Haemaphysalis ticks (Ixodoidea, Ixodidae). The identity, distribution, and hosts

of H. (Kaiseriana) hystricis Supino. J. Parasitol. 51, 467–480.

Acknowledgements Hoogstraal, H., Santana, F.J., Van Peenen, P.D., 1968. Ticks (Ixodoidea) of Mt. Sontra,

Danang, Republic of . Ann. Entomol. Soc. Am. 61, 722–729.

Hornok, S., 2009. Allochronic seasonal peak activities of Dermacentor and

The authors would like to thank the assistants from the Bunnun Haemaphysalis spp. under continental climate in Hungary. Vet. Parasitol. 163,

366–369.

tribe of Taitung County (A-Yun and A-May) as well as the staffs and

Hsieh, Y.C., Lee, C.C., Tsang, C.L., Chung, Y.T., 2010. Detection and characterization

veterinarians of the PTRC who provided assistance during the study

of four novel genotypes of Ehrlichia canis from dogs. Vet. Microbiol. 146, 70–75.

period. Ministry of Science and Technology of Taiwan, formerly Huang, C.C., Hsieh, Y.C., Tsang, C.L., Chung, Y.T., 2010. Sequence and phylogenetic

analysis of the gp200 protein of Ehrlichia canis from dogs in Taiwan. J. Vet. Sci.

National Science Council (Grant numbers: NSC 101-2621-M-020-

11, 333–340.

006 and NSC 102-2621-M-020-004) and Taiwan Forestry Bureau

Inokuma, H., Fujimoto, T., Hosoi, E., Tanaka, S., Fujisaki, K., Okuda, M., Onishi, T.,

[Grant number: 102 Forest Management-1.1-Conservation-11 (5)] 2002. Tick infestation of sika deer (Cervus nippon) in the western part of

Yamaguchi Prefecture, Japan. J. Vet. Med. Sci. 64, 615–617.

provided fund for the “Pangolin Biology and Ecology Project”. The

Jongejan, F., Uilenberg, G., 1994. Ticks and control methods. Rev. Sci. Tech. OIE 13,

permit numbers from Taiwan Forestry Bureau for this research are: 1201–1226.

0980129850, 0991616024, 1011701139, and 1031700176. Jongejan, F., Uilenberg, G., 2004. The global importance of ticks. Parasitology 129,

S3–S14.

Kang, Y.J., Diao, X.N., Zhao, G.Y., Chen, M.H., Xiong, Y., Shi, M., Fu, W.M., Guo, Y.J.,

References Pan, B., Chen, X.P., 2014. Extensive diversity of Rickettsiales bacteria in two

species of ticks from China and the evolution of the Rickettsiales. BMC Evol.

Biol. 14, 167.

Akuzawa, M., Mochizuki, M., Yasuda, N., 1987. Hematological and parasitological

Khatri-Chhetri, R., Sun, C.-M., Wu, H.-Y., Pei, K.J.-C., 2015. Reference intervals for

study of the Iriomote cat (Prionailurus iriomotensis). Can. J. Zool. 65, 946–949.

hematology, serum biochemistry, and basic clinical findings in free-ranging

André, M.R., Adania, C.H., Machado, R.Z., Allegretti, S.M., Felippe, P.A., Silva, K.F.,

Chinese Pangolin (Manis pentadactyla) from Taiwan. Vet. Clin. Pathol. 44,

Nakaghi, A.C., Dagnone, A.S., 2009. Molecular detection of Cytauxzoon spp. in

380–390.

asymptomatic Brazilian wild captive felids. J. Wildl. Dis. 45, 234–237.

King, L., 2004. Emerging and re-emerging zoonotic diseases: challenges and

Aroon, S., Artchawachom, T., Hill, J.G., Kupittayanant, S., Thanee, N., 2009.

opportunities. Compendium of technical items presented to the International

Ectoparasites of the common palm civet (Paradoxurus hermaphroditus) at

Committees or to Regional Commissions of the OIE, pp. 21–29.

Sakaerat Environmental Research Station, Thailand. Suranaree J. Sci. Technol.

Kollars, T.M., Sithiprasasna, R., 2000. New host and distribution record of

16, 277–281.

Amblyomma javanense (Acari: Ixodidae) in Thailand. J. Med. Entomol. 37, 640.

Baker, A.S., 1999. and Ticks of Domestic Animals. The Stationery Office,

London. Kuo, C.C., Shu, P.Y., Mu, J.J., Wang, H.C., 2015a. High prevalence of Rickettsia spp:

infections in small mammals in Taiwan. Vector-Borne Zoonotic Dis. 15, 13–20.

Beati, L., Keirans, J.E., 2001. Analysis of the systemic relationships among ticks of

Kuo, C.C., Shu, P.Y., Mu, J.J., Lee, P.L., Wu, Y.W., Chung, C.K., Wang, H.C., 2015b.

the genera Rhipicephalus and Boophilus (Acari: Ixodidae) based on

Widespread Rickettsia spp. infections in Ticks (Acari: Ixodoidea) in Taiwan. J.

mitochondrial 12S ribosomal DNA gene sequences and morphological

Med. Entomol. 52, 1096–1102.

characters. J. Parasitol. 87, 32–48.

Li, Y., Chao, S., Fu-Hua, Z., Shi-Bao, W., Guang-Zhi, M., 2010. Age structure and

Birkenheuer, A.J., Marr, H., Alleman, A.R., Levy, M.G., Breitschwerdt, E.B., 2006.

parasites of Malayan pangolin (Manis javanica). J. Econ. Anim. 14, 22–25.

Development and evaluation of a PCR assay for the detection of Cytauxzoon

felis DNA in feline blood samples. Vet. Parasitol. 137, 144–149.

Please cite this article in press as: Khatri-Chhetri, R., et al., Surveillance of ticks and associated pathogens in free-ranging Formosan

pangolins (Manis pentadactyla pentadactyla). Ticks Tick-borne Dis. (2016), http://dx.doi.org/10.1016/j.ttbdis.2016.07.007

G Model

TTBDIS-692; No. of Pages 7 ARTICLE IN PRESS

R. Khatri-Chhetri et al. / Ticks and Tick-borne Diseases xxx (2016) xxx–xxx 7

Li, H.F., Lin, J.S., Lan, Y.C., Pei, K.J.C., Su, N.Y., 2011. Survey of the termites (Isoptera Randolph, S.E., Chemini, C., Furlanello, C., Genchi, C., Hails, R.S., Hudson, P.J., Jones,

Kalotermitidae, Rhinotermitidae, Termitidae) in a Formosan pangolin habitat. L.D., Medley, G., Norman, R.A., Rizzoli, A.P., Smith, G., Woolhouse, M.E.J., 2001.

Fla. Entomol. 94, 534–538. The ecology of tick-borne infections in wildlife reservoirs. In: Hudson, P.J.,

Ma, Y.H., Pan, H., Du, W.D., 2001. Investigation and control of Ectoparasitic ticks on Rizzoli, A., Grenfell, B.T., Heesterbeek, H., Dobson, A.P. (Eds.), The Ecology of

dogs in south China. Chin. J. Pest Control 11, 11. Wildlife Diseases. Oxford University Press Inc., New York, pp. 119–138.

Madder, M., Horak, I., Stoltsz, H., 2013. Tick Importance and Disease Transmission, Rikihisa, Y., 1991. The tribe Ehrlichieae and ehrlichial diseases. Clin. Microbiol. Rev.

http://www.afrivip.org/sites/default/files/importance complete.pdf (accessed 4, 286.

08.12.15). Sentausa, E., El Karkouri, K., Robert, C., Raoult, D., Fournier, P.-E., 2012. Genome

Mediannikov, O., Davoust, B., Socolovschi, C., Tshilolo, L., Raoult, D., Parola, P., 2012. sequence of Rickettsia conorii subsp. caspia, the agent of Astrakhan Fever. J.

Spotted fever group rickettsiae in ticks and fleas from the Democratic Republic Bacteriol. 194, 4763–4764.

of the Congo. Ticks. Tick Borne Dis. 3, 371–373. Shimada, Y., Beppu, T., Inokuma, H., Okuda, M., Onishi, T., 2003. Ixodid tick species

Mihalca, A., Dumitrache, M., Sandor, A., Magdas, C., Oltean, M., Gyorke, A., Matei, I., recovered from domestic dogs in Japan. Med. Vet. Entomol. 17, 38–45.

Ionica, A., D’Amico, G., Cozma, V., Gherman, C., 2012. Tick parasites of rodents Simpson, V.R., Panciera, R.J., Hargreaves, J., McGrarry, J.W., Scholes, S.F.E., Bown,

in Romania: host preferences, community structure and geographical K.J., Birtles, R.J., 2005. Myocarditis and myositis due to infection with

distribution. Parasites Vectors 5, 266. Hepatozoon species in pine martens (Martes martes) in Scotland. Vet. Rec. 156,

Miranpuri, G., 1988. Ticks parasitising the Indian buffalo (Bubalus bubalis) and their 442–446.

possible role in disease transmission. Vet. Parasitol. 27, 357–362. Szekeres, S., Coipan, E.C., Rigó, K., Majoros, G., Jahfari, S., Sprong, H., Földvári, G.,

Nicholson, W.L., Allen, K.E., McQuiston, J.H., Breitschwerdt, E.B., Little, S.E., 2010. 2015. Eco-epidemiology of Borrelia miyamotoi and Lyme borreliosis

The increasing recognition of rickettsial pathogens in dogs and people. Trends spirochetes in a popular hunting and recreational forest area in Hungary.

Parasitol. 26, 205–212. Parasites Vectors 8, 1–8.

Nijhof, A.M., Penzhorn, B.L., Lynen, G., Mollel, J.O., Morkel, P., Bekker, C.P., Jongejan, Teng, K., Jiang, Z., 1991. Economic insect fauna of China Fasc 39 Acari: Ixodidae.

F., 2003. Babesia bicornis sp. nov. and Theileria bicornis sp. nov.: tick-borne Science, 52–349, Beijing.

parasites associated with mortality in the black rhinoceros (Diceros bicornis). J. Tonetti, N., Berggoetz, M., Rühle, C., Pretorius, A., Gern, L., 2009. Ticks and

Clin. Microbiol. 41, 2249–2254. tick-borne pathogens from wildlife in the Free State Province, South Africa. J.

Nijhof, A.M., Pillay, V., Steyl, J., Prozesky, L., Stoltsz, W.H., Lawrence, J.A., Penzhorn, Wildl. Dis. 45, 437–446.

B.L., Jongejan, F., 2005. Molecular characterization of Theileria species Voltzit, O., Keirans, J., 2002. A review of Asian Amblyomma species (Acari, Ixodida,

associated with mortality in four species of African antelopes. J. Clin. Microbiol. Ixodidae). Acarina 10, 95–136.

43, 5907–5911. Walker, D., 1996. Rickettsiae. In: Baron, S. (Ed.), Medical Microbiology. University

Njiokou, F., Laveissière, C., Simo, G., Nkinin, S., Grébaut, P., Cuny, G., Herder, S., of Texas Medical Branch, Galveston, Texas.

2006. Wild fauna as a probable animal reservoir for Trypanosoma brucei Wehinger, K.A., Roelke, M.E., Greiner, E.C., 1995. Ixodid ticks from panthers and

gambiense in Cameroon. Infect. Genet. Evol. 6, 147–153. bobcats in Florida. J. Wildl. Dis. 31, 480–485.

Ostfeld, R.S., Keesing, F., 2000. Biodiversity and disease risk: the case of Lyme Wen, B., Cao, W., Pan, H., 2003. Ehrlichiae and ehrlichial diseases in China. Ann. N.

disease. Conserv. Biol. 14, 722–728. Y. Acad. Sci. 990, 45–53.

Parola, P., Roux, V., Camicas, J.L., Baradji, I., Brouqui, P., Raoult, D., 2000. Detection Wu, T.J., Sun, H.J., Wu, Y.C., Huang, H.P., 2009. Prevalence and risk factors of canine

of ehrlichiae in African ticks by polymerase chain reaction. Trans. R. Soc. Trop. ticks and tick-borne diseases in Taipei, Taiwan. J. Vet. Clin. Sci. 2, 75–78.

Med. Hyg. 94, 707–708. Xu, D., Zhang, J., Shi, Z., Song, C., Zheng, X., Zhang, Y., Hao, Y., Dong, H., Wei, L.,

Parola, P., Cornet, J.-P., Sanogo, Y.O., Miller, R.S., Van Thien, H., Gonzalez, J.-P., El-Mahallawy, H.S., Kelly, P., Xiong, W., Wang, H., Li, J., Zhang, X., Gu, J., Wang,

Raoult, D., Telford, S.R., Wongsrichanalai, C., 2003. Detection of Ehrlichia spp., C., 2015. Molecular detection of vector-borne agents in dogs from ten

Anaplasma spp., Rickettsia spp., and other eubacteria in ticks from the provinces of China. Parasites Vectors 8, 501.

Thai-Myanmar border and Vietnam. J. Clin. Microbiol. 41, 1600–1608. Yamaguti, N., Tipton, V., Keegan, H., Toshioka, S., 1971. Ticks of Japan, Korea, and

Parola, P., 2004. Tick-borne rickettsial diseases: emerging risks in Europe. Comp. the Ryukyu Islands, Brigham Young University Science Bulletin-Biological

Immunol. Microbiol. Infect. Dis. 27, 297–304. Series, vol. XV. Brigham Young University Library, Provo, Utah.

Peixoto, P., Soares, C., Scofield, A., Santiago, C., Franca, T., Barros, S., 2007. Fatal Yamauchi, T., Tabara, K., Kanamori, H., Kawabata, H., Arai, S., Katayama, T., Fujita,

cytauxzoonosis in captive-reared lions in Brazil. Vet. Parasitol. 145, H., Yano, Y., Takada, N., Itagaki, A., 2009. Tick fauna associated with sika deer

383–387. density in the Shimane Peninsula, Honshu, Japan. Med. Entomol. Zool. 60.

Rózsa, L., Reiczigel, J., Majoros, G., 2000. Quantifying parasites in samples of hosts. Yin, C.C., Liu, H.J., Lin, S.C., Liao, M.H., Wu, Y.H., 2003. Identification of Ehrlichia

J. Parasitol. 86, 228–232. canis in cats by nested polimerase chain reaction and nucleotide sequence

analysis. T. V. J. 29, 122–128.

Please cite this article in press as: Khatri-Chhetri, R., et al., Surveillance of ticks and associated pathogens in free-ranging Formosan

pangolins (Manis pentadactyla pentadactyla). Ticks Tick-borne Dis. (2016), http://dx.doi.org/10.1016/j.ttbdis.2016.07.007