1 Rnaseq Profiling of Leukocyte Populations in Zebrafish Larvae Reveals a Cxcl11 Chemokine Gene As A

1 RNAseq profiling of leukocyte populations in zebrafish larvae reveals a cxcl11 chemokine gene as a

2 marker of macrophage polarization during mycobacterial infection.

4 Authors: Julien Rougeot1, Vincenzo Torraca1, Ania Zakrzewska1, Zakia Kanwal1, Hans J. Jansen2,

5 Herman P. Spaink1, Annemarie H. Meijer1*

7 Affiliations: 1Institute of Biology Leiden, Leiden University, 2333 BE, Leiden, The Netherlands, 2ZF-

8 screens B.V., Leiden, The Netherlands.

9 *Corresponding author

10 CORRESPONDENCE:

11 Prof. Annemarie H. Meijer

12 [email protected]

14 Keywords: Innate immunity, zebrafish, RNAseq, macrophage, mycobacteria, neutrophil, lymphoid

15 progenitor cells

17 Word count: 6521

18 Figures: 6

20 Abstract

21 Macrophages are phagocytic cells from the innate immune system, which forms the first line of host

22 defense against invading pathogens. These highly dynamic immune cells can adopt specific functional

23 phenotypes, with the pro-inflammatory M1 and anti-inflammatory M2 polarization states as the two

24 extremes. Recently, the process of macrophage polarization during inflammation has been visualized

25 by real time imaging in larvae of the zebrafish. This model organism has also become widely used to

26 study macrophage responses to microbial pathogens. To support the increasing use of zebrafish in

27 macrophage biology, we set out to determine the complete transcriptome of zebrafish larval

28 macrophages. We studied the specificity of the macrophage signature compared with other larval

29 immune cells and the macrophage-specific expression changes upon infection. We made use of the

30 well-established mpeg1, mpx, and lck fluorescent reporter lines to sort and sequence the

31 transcriptome of larval macrophages, neutrophils, and lymphoid progenitor cells, respectively. Our

32 results provide a complete dataset of genes expressed in these different immune cell types and

33 highlight their similarities and differences. Major differences between the macrophage and

34 neutrophil signatures were found within the families of proteinases. Furthermore, expression of

35 genes involved in antigen presentation and processing was specifically detected in macrophages,

36 while lymphoid progenitors showed expression of genes involved in macrophage activation.

37 Comparison with datasets of in vitro polarized human macrophages revealed that zebrafish

38 macrophages express a strongly homologous gene set, comprising both M1 and M2 markers.

39 Furthermore, transcriptome analysis of low numbers of macrophages infected by the intracellular

40 pathogen Mycobacterium marinum revealed that infected macrophages change their transcriptomic

41 response by downregulation of M2-associated genes and overexpression of specific M1-associated

42 genes. Among the infection-induced genes, a homolog of the human CXCL11 chemokine gene,

43 cxcl11aa, stood out as the most strongly overexpressed M1 marker. Upregulation of cxcl11aa in

44 Mycobacterium-infected macrophages was found to require the function of Myd88, a critical adaptor

45 molecule in the Toll-like and interleukin 1 receptor pathways that are central to pathogen

46 recognition and activation of the innate immune response. Altogether, our data provide a valuable

47 data mining resource to support infection and inflammation research in the zebrafish model.

49 Introduction

50 Macrophages are phagocytic innate immune cells that, together with neutrophils, form the cellular

51 arm of the first line of host defense against invading pathogens. The activation of macrophages is

52 initiated by the recognition of microbial and danger signals by Pattern Recognition Receptors (PRRs),

53 such as the Toll-like receptors (TLRs), which recruit MYD88 and related adaptor molecules for signal

54 transduction to MAP kinases and Nuclear Factor κB (NFκB) (1). The signaling pathways downstream

55 of TLRs and other PRRs regulate the transcription of a large number of genes that are involved in

56 signaling between immune cells (cytokine and chemokine genes) and in host defense (1; 2). To exert

57 their anti-microbial function, macrophages employ several mechanisms, such as the production of

58 reactive oxygen and nitrogen species, the production of antimicrobial peptides, and the degradation

59 of microbes through the phagosomal-lysosomal and autophagy pathways (3). Following successful

60 elimination of microbial invaders, macrophages mediate the resolution of inflammation by clearing

61 cellular debris and eliminating the surplus immune cells that are undergoing cell death at the

62 infection site (4). In addition to these primary functions in infection and inflammation, macrophages

63 orchestrate a range of developmental processes. For example, macrophages interact with

64 endothelial cells to support angiogenesis (5; 6) , help control definitive hematopoiesis (7), and

65 facilitate electrical conduction in the heart (8). Thus, macrophages are highly versatile cells, not only

66 functioning as central players in the immune system, but also contributing to organismal

67 development and maintenance of homeostasis.

68 Macrophages can adopt different states of activation, which are classically divided into a pro-

69 inflammatory M1 state and an anti-inflammatory M2 state (9). These states are characterized by

70 distinct cytokine and chemokine expression patterns as well as different metabolic profiles. However,

71 it is clear that many intermediate phenotypes exist and that the distinction between M1 and M2

72 states is a simplification of how macrophage polarization occurs in different organs and tissues and in

73 response to different stress signals (9). Macrophage polarization plays a major role in the context of

74 disease. Tumor-associated macrophages can acquire anti-tumor or tumor-promoting phenotypes

75 (10), macrophage metabolism is critical in development of atherosclerosis and other cardiovascular

76 diseases (11; 12), and certain pathogens are known to manipulate the macrophage phenotype to

77 their advantage (13; 14; 15). Therefore, a better understanding of macrophage polarization and

78 function could open novel therapeutic avenues for diseases related to dysfunction or hyperactivation

79 of this cell type.

80 The majority of studies on differentiation of macrophage subtypes have been performed in vitro, but

81 recently it has been achieved to image the process of macrophage polarization during inflammation

82 in a living organism (16). To this end, the optically transparent early life stages of the zebrafish were

83 used (embryos and larvae), expressing different fluorescent markers for the macrophage cell type

84 and for a classical M1 marker, tumor necrosis factor alpha (tnfa). Expression of the tnfa reporter was

85 observed in macrophages recruited to sites of injury or sites of Escherichia coli infection.

86 Furthermore, the tnfa-positive macrophages were shown to express other M1 markers (il1b, il6),

87 while tnfa-negative macrophages expressed M2 markers (tgfb1, ccr2, cxcr4b). Dynamic tracing of

88 reporter expression showed that tnfa-positive cells at inflammation sites reverted to a tnfa-negative

89 phenotype during the resolution phase (16). In a follow-up study, a tail fin amputation model was

90 used to show that early recruitment of a tnfa-expressing macrophage subpopulation is required for

91 blastema formation and subsequent fin regeneration (17). Zebrafish models for a wide variety of

92 human diseases have been developed in the recent years (18). Therefore, the tnfa-reporter together

93 with other M1 and M2 lines that are still to be developed, will find many applications to elucidate the

94 functions of polarized macrophage subsets during disease processes.

95 The most frequently used promoter for driving macrophage-specific expression of fluorescent

96 reporters in zebrafish is that of the macrophage expressed 1 gene (mpeg1.1, hereafter called mpeg1)

97 (19; 20). The mpeg1 gene codes for a perforin-like protein with anti-bacterial function (21).

98 Fluorescent mpeg1 reporter lines have been used to study a diverse range of processes. These

99 include for example, macrophage-endothelial interactions (22), long-distance communication

100 between macrophages and pigment cells (23), the function of tumor-associated macrophages (24),

101 and the role of macrophages in host defense against infections (25). Fluorescent mpeg1 reporter

102 expression in zebrafish embryos and larvae marks the monocytic precursors of macrophages in the

103 blood as well as tissue-resident macrophages, including microglia in the developing brain (20; 26).

104 The expression of mpeg1 reporters is non-overlapping with that of a neutrophil-specific BAC reporter

105 line driven by the myeloperoxidase (mpx) promoter (27), or with a reporter for immature

106 lymphocytes controlled by the promoter of the LCK proto-oncogene, Src family tyrosine kinase (lck)

107 gene (28).

108 The generation of macrophage and neutrophil reporter lines has gone together with the

109 development of zebrafish models for a variety of human infectious diseases, providing new

110 possibilities to visualize host-pathogen interactions in real time (25; 29). It has been shown that

111 zebrafish embryos rely on macrophages for an effective host defense against different pathogens,

112 such as Staphylococcus aureus (30) and Salmonella enterica servovar Typhimurium (31). In contrast,

113 the ablation of macrophages was found to protect zebrafish embryos against infection with

114 Burkholderia cenocepacia, revealing that macrophages are critical for the proliferation of this

115 pathogen and for the development of a fatal inflammatory response (32). Macrophages play a dual

116 role during infection with Mycobacterium marinum, a pathogen widely used to model human

117 tuberculosis in zebrafish, since it provides access to the early stages of tuberculous granuloma

118 formation that is initiated by the aggregation of infected macrophages (33; 34; 35). On the one hand,

119 abundant extracellular growth is observed in macrophage-deficient hosts, indicating that

120 proliferation of M. marinum is restricted when phagocytosed by macrophages (36). On the other

121 hand, infected macrophages, driven by bacterial virulence mechanisms, can migrate into tissues and

122 recruit new macrophages, which promotes the cell-to-cell spreading of M. marinum and the

123 expansion of granulomas (37; 38). Consequently, a mutation in the macrophage-specific chemokine

124 receptor cxcr3.2, which restricts macrophage motility, has a positive outcome on the ability of

125 zebrafish embryos to control M. marinum infection (39).

126 Despite extensive use of the zebrafish mpeg1 reporter lines for studying macrophage biology, the

127 expression signature of these cells has remained uncharacterized. Here, we isolated mpeg1

128 expressing cells from transgenic zebrafish larvae by fluorescence activated cell sorting (FACS) and

129 performed RNAseq to investigate what distinguishes the mpeg1-driven expression profile from the

130 signatures of neutrophil and lymphocyte populations isolated from mpx and lck reporter lines. In

131 addition, we determined a core expression set of 744 zebrafish macrophage markers, based on

132 enriched expression in mpeg1-positive cells. We compared this gene set with published RNAseq

133 profiles of human macrophages differentiated in vitro towards M1 or M2 phenotype (40), which

134 showed that zebrafish macrophages express a mixed profile of M1 and M2 markers under

135 unchallenged conditions. We then studied how the expression profile is changed upon M. marinum

136 infection and identified a homolog of the human M1 marker CXCL11 as a robust and specific marker

137 of Mycobacterium-infected macrophages that is induced by myd88-dependent signaling.

138

139 Materials and Methods

140 Zebrafish husbandry and infection experiments

141 Zebrafish lines in this study were handled in compliance with local animal welfare regulations as

142 overseen by the Animal Welfare Body of Leiden University (License number: 10612) and maintained

143 according to standard protocols (zfin.org). All protocols adhered to the international guidelines

144 specified by the EU Animal Protection Directive 2010/63/EU. All experiments with these zebrafish

145 lines were done on larvae before the free-feeding stage. Zebrafish lines included AB/TL, Tg

146 (mpx:eGFP)i114 (27), Tg (mpeg1:Gal4-VP16)gl24/ (UAS-E1b:Kaede)s1999t (20), Tg (mpeg1:mCherry-F)ump2

147 (19), Tg (lck:eGFP)cz2 (28), cxcr3.2-/-hu6044 and their cxcr3.2+/+ siblings (39) , myd88-/- hu3568 and their

148 myd88+/+ siblings (41). Embryos were grown at 28.5°C in egg water (60 µg/ml Instant Ocean sea

149 salts). Mycobacterium marinum M or its RD1-deficient (ΔRD1) isogenic strain (42) containing pSMT3-

150 mCherry (43) was grown and prepared for injections as described (44) and microinjected into the

151 caudal vein of embryos at 28 hours post fertilization (hpf) using, where not differently specified, a

152 dose of 100-125 colony-forming units (cfu) per embryo. After injection, embryos were transferred

153 into fresh egg water and incubated at 28°C for 4 or 5 days before collection. Proper infection was

154 controlled by fluorescent imaging before embryo dissociation.

155 Embryo dissociation and Fluorescent Activated Cell Sorting (FACS)

156 Immune cells from 5-6 dpf larvae were isolated by FACS as described previously (45). Briefly, live

157 embryos were rinsed in calcium free Ringer solution for 15 min and then digested with 0.25% trypsin

158 for 60-90 min at 28°C. Digestion was stopped with 1 mM CaCl2 and 10% fetal calf serum and the cell

159 suspension was centrifuged and washed in PBS. The cell pellet was resuspended in 1 to 2 ml in

160 Leibovitz medium L15 without phenol-red with 1% fetal calf serum, 0.8 mM CaCl2,50 units/ml

161 penicillin and 0.05mg/ml streptomycin and filtered through a 40 µm cell strainer. FACS was

162 performed at 4°C using a FACS AriaIII (BD Biosciences) with the BD FACSDiva software (version 6.1.3).

163 For collecting mCherry-positive cells a Coherent Sapphire solid-state 561 nm yellow green laser with

164 36 mW power was used. Laser settings applied were 600LP, 615/20 BP. For sorting eGFP and Kaede

165 positive cells a Coherent Sapphire solid-state 488 nm laser with 15.4 mW power was used. Laser

166 settings applied were 505LP, 530/30 BP. mCherry and eGFP/Kaede gates were set-up with non-

167 fluorescent samples and allowed to collect an average of respectively 33.8 +/- 16.4 mCherry and 11.6

168 +/- 4.4 eGFP/Kaede false-positive cells per million of sorted cells. An average of 526 mpeg1:Kaede,

169 195 mpx:eGFP and 983 lck:eGFP positive cells in 5 dpf embryos and 1826 mpeg1:Kaede and 5482

170 mpeg1:mCherry positive cells at 6 dpf were collected per million of sorted cells. For background

171 expression assessment 500,000 non-fluorescent cells were sorted for each sample. Cell fractions

172 were separately collected in supplemented L15 medium and RNA isolation was performed directly

173 after sample collection.

174 RNA isolation, Illumina sequencing, and real time PCRs

175 RNA extraction was done using the RNAqueous-Micro Kit (Ambion) or RNeasy mini kit (Qiagen).

176 Quality of RNA used for Illumina sequencing was checked on an Agilent Bioanalyzer 2100 using the

177 RNA 6000 Pico kit (Agilent). RNA samples with RIN above 8 were selected. When RNA quantity was

178 low, RNA integrity was judged by the presence of ribosomal peaks. cDNA synthesis and amplification

179 was performed using the SMARTer Ultra Low RNA Kit for Illumina sequencing (Clontech) according to

180 the manufacturer’s protocol. Illumina TruSeq DNA Sample Preparation Kit v2 (Illumina) was used on

181 shared cDNA to prepare libraries. Three changes were made to manufacturer’s protocol: the

182 adapters were diluted 20 times in the adapter ligation step, library size selection was achieved by

183 double Ampure XP purification with a 0.7x beads to library ratio and library amplification was made

184 with 15 cycles. The resulting libraries were sequenced using an Illumina HiSeq2000 with 50 bp

185 paired-end reads for all samples and single-end reads for 6 dpf samples. RNA collected for real time

186 PCR experiments was further purified using column DNA digestion (RNase-Free DNase set, Qiagen).

187 cDNA was prepared using iScript cDNA-synthesis kit (Invitrogen, Life Technologies) and was used as a

188 template for qRT-PCR reaction with iQ SYBR Green Supermix according to the manufacturer’s

189 instructions (Bio-Rad Laboratories). Expression of cxcl11aa was analysed using the ΔΔCt method and

190 was normalized against ppiab for whole-mount analyses and to eif5 for FACS sorted cells. Primers for

191 these genes were: cxcl11aaFw: ACTCAACATGGTGAAGCCAGTGCT; cxcl11aaRv:

192 CTTCAGCGTGGCTATGACTTCCAT; ppiabFw: ACACTGAAACACGGAGGCAAAG; ppiabRv:

193 CATCCACAACCTTCCCGAACAC; eif5Fw: CAAGTTTGTGCTGTGTCCCG; eif5Rv:

194 AGCCTTGCAGGAGTTTCCAA.

195 RNA-sequencing on 20 sorted cells

196 Dissociation and cell sorting of infected embryos were performed as mentioned previously. 20 cells

197 were sorted directly in cDNA synthesis buffer from the SMARTer Ultra Low RNA Kit for Illumina

198 sequencing (Clontech) and used directly for cDNA synthesis. The resulting cDNA were amplified for

199 20 cycles and used for library preparation and single-end Illumina sequencing as mentioned above.

200 RNA-seq data analysis

201 Image analysis and base calling were done using the Illumina HCS version 1.15.1. Quality trimmed

202 reads were aligned to the Ensembl zebrafish genome (Zv9) using Bowtie and reads were mapped to

203 zebrafish transcripts using TopHat and a modified version of the Ensembl Zv9_79 annotation with

204 additional manually annotated genes (Table S1). Differential expression analyses between non-

205 fluorescent cells and fluorescent positive cells were performed using DEseq package in R and DEseq2

206 for the 20 cell samples. PCA plots and Pearson correlation HeatMaps were generated with DEseq

207 package build in functions. Networks based on GO-enrichment analysis (GOEA) were produced using

208 BiNGO and EnrichmentMap in Cytoscape (46). Gene Set Enrichment Analyses were performed with

209 the GSEA software from the Broad Institute (47; 48) version 3.0.

210

211 Results

212

213 The macrophage-specific transcriptome of zebrafish larvae

214 To determine the gene expression signature of macrophages, we used mpeg1-driven reporters

215 expressing Kaede or mCherry fluorescent proteins (19; 20; 25). RNA was extracted from positive and

216 negative fluorescent cell fractions obtained by FACS sorting of single cell suspensions obtained by

217 dissociating 5 or 6 dpf transgenic larvae. Illumina sequencing (RNAseq) of RNA samples from Kaede-

218 labelled macrophages at 5 dpf and 6 dpf and mCherry-labelled macrophages at 6 dpf, each in

219 duplicate, resulted in a total of 6 replicates. Reproducibility between these replicates after alignment

220 and mapping of the reads was high, as shown by calculation of the Pearson correlation coefficient

221 (Figure S1). Principal component analysis (PCA) showed that all macrophage samples segregated

222 clearly from the samples of negative fluorescent cell fractions. Furthermore, PCA indicated minor

223 differences between samples from macrophages with Kaede and mCherry markers and between the

224 Kaede-labelled macrophages at 5 and 6 dpf (Figure S2A). Between 12110 and 16280 genes were

225 expressed (FPKM ≥ 0.3) in the macrophage populations (Table S2, Table S3) and a total of 13185

226 genes were shared in at least two of the three conditions. Together, these results indicate that our

227 protocol of RNAseq on FACS sorted cells from zebrafish larvae produces high quality results.

228 We performed differential expression (DE) analysis on the duplicates from the three different

229 conditions by comparing results from fluorescence positive cell fractions with the related fluorescent

230 negative cell fractions. By selecting an adjusted p-value threshold of 0.05, we detected a similar

231 number of genes expressed specifically in Kaede-labelled macrophages at 5 and 6 dpf (715 and 703

232 genes respectively), whereas more genes were detected in the 6dpf mCherry-labelled macrophages

233 (1953 genes). Comparison between the different conditions showed a high overlap between the

234 enriched gene sets (Figure 1A). To produce a complete and accurate description of the macrophage

235 transcriptome in the larvae, we selected the genes that met the significance threshold in at least two

236 out of the three conditions. This dataset, hereafter named zebrafish macrophage (zfM) core

237 expression set, contains 744 genes (Figure 1A, Table S4).

238 The zfM core dataset includes the main genes that are known to be specific for macrophages and

239 myeloid cells in zebrafish larvae (Figure 1B). For example, in addition to mpeg1 itself, the

240 macrophage-specific genes csf1ra, mhc2dab, the myeloid genes spi1a and b, and the pan-leukocyte

241 markers coro1a, ptprc and ptpn6 were detected (25; 49). Network visualization of Gene Ontology

242 (GO) terms revealed enrichment of biological processes linked to innate immune response and

243 inflammation, antigen processing and presentation, signal transduction, peptidase activity,

244 chemotaxis and actin filament organization and polymerization (Figure 1C). Similarly, GO terms for

245 molecular function were clearly linked to immune cell function and defense mechanisms (Figure S3).

246 Among the genes from the zfM dataset, 34% (254 out of 754) corresponded to uncharacterized

247 proteins or non-coding RNAs. Manual annotation showed that many of these uncharacterized

248 sequences belong to large immune-related protein families, including the immunoglobulins (36), the

249 C-type lectins (13) and NACHT/LRR proteins (8) (Table S4). Other uncharacterized genes were also

250 related to immunity, such as genes coding for proteins with chemokine/interleukin-like domains,

251 chemokine receptor like domains, interleukin receptor-like domains, complement domains,

252 leukotriene receptor like domains or MHC class II alpha and beta chains. In addition, 38 genes

253 correspond to non-coding RNAs, long-intronic-non-coding RNAs or processed transcripts, of which

254 the possible role in immunity is of interest for further study.

255

256 Comparison of zebrafish macrophage and neutrophil expression

257 For comparison with the macrophage transcriptome, we studied the neutrophil transcriptome by

258 sequencing the fluorescent cell population extracted from 5dpf mpx:gfp larvae (two replicates). A

259 total of 14241 genes were found expressed in neutrophils (FPKM ≥ 0.3, Table S2, Table S3). Selection

260 of differentially expressed genes revealed a data set composed of 503 neutrophil-enriched genes (P-

261 adj < 0.05) (Table S5). 240 (47.71%) of these genes are shared with the zfM core expression dataset

262 (Figure 2A). The neutrophil markers lyz and mpx were detected enriched at a high level in neutrophil

263 population, although a low level of these transcripts could be detected in zebrafish macrophages

264 (Figure 2A), as well as in human macrophages (40). Similarly, several macrophage markers could be

265 detected in neutrophils, but also at a low expression level (Figure 2A).

266 GO analysis identified different biological processes specific for neutrophils such as carbohydrate

267 catabolic process related terms and behavior, described as the internally coordinated responses of

268 whole living organisms to internal or external stimuli and containing the genes wasb, rlbp1b,

269 mmp13a and cxcr4b (Figure 2B). GO terms associated to regulation of peptidase activity, signal

270 transduction and antigen processing and presentation are enriched in macrophages but not in

271 neutrophils, confirming the functional differences between the two myeloid lineages (Figure 1B).

272 Many GO terms are shared between the two cell populations. However, their contents often are

273 composed of different protein families (Figure 3). For example, proteolysis appears to be a major

274 group in both cellular lineages, but macrophages express cathepsin coding genes (ctsba, ctsc, ctsh,

275 ctsk) whereas neutrophils express proteinases from the carboxypeptidase (cpa1, 4, 5), the elastase

276 (ela2, ela2l and ela3l), the chymase families as well as trypsin.

277

278 Comparison of zebrafish myeloid and progenitor lymphoid expression

279 We then used the lck:GFP transgenic line to study the lymphoid cell transcriptome. At 5dpf, the

280 adaptive immune system is not yet mature. However, lymphoid cell progenitors are already present

281 in the thymus (50). RNAseq analysis showed that 13153 genes are expressed in this cell population

282 (FPKM ≥ 0.3, TableS2, Table S3) and 1934 genes were enriched in the lymphoid cell progenitor

283 compared to non-fluorescent cell background (Table S6). Comparison of genes enriched in lymphoid

284 cells with genes specific for myeloid cells (i.e. genes enriched in either macrophages or neutrophils)

285 showed a small overlap between the two populations (Figure 2C). None of the macrophage or

286 neutrophil markers was detected in the lymphoid cell transcriptome, except for il12bb, although it is

287 less expressed. On the opposite, several known lymphocyte markers were detected only in this cell

288 population (Figure 2C). GO analysis showed also little overlap with processes detected in myeloid

289 cells (Figure 2D). Surprisingly, very few terms were associated to immune function, except for

290 chemotaxis, regulation of peptidase activity and actin filament organization, also shared with the

291 myeloid lineage. However, these groups are composed of different genes. For example, the

292 proteases expressed by lymphoid cells mainly belong to the proteasome (Figure 3). A closer look to

293 immunity-related genes showed the presence of chemokines and chemokine receptors as well as

294 MHC class II genes, but expressed at a low level compared to myeloid cells (Figure 3). Two perforin

295 genes were also highly expressed in lymphoid cells only. The main enriched GO terms in the

296 lymphoid cells were found to be associated with metabolic processes, cell cycle, and ribosome

297 biogenesis (Figure 2D), which might reflect the immature status of this cell population in developing

298 zebrafish larvae.

299

300 Similarity between the zebrafish macrophage transcriptome and human polarized macrophage

301 transcriptomes

302 By real time imaging of macrophages in a dual fluorescent mpeg1 and tnfa reporter line evidence has

303 been obtained that zebrafish larvae differentiate M1 and M2 like polarized macrophages in response

304 to wounding and infection (16). We found that the known M1 (il1b, tnfa/tnfb, il6) and M2 (cxcr4b,

305 il10, ccr2) markers were expressed in the zfM core expression set. Additionally, the zebrafish

306 homologs of human M1-markers CXCL11 (cxcl11aa), IDO1 (ido1), MMP9 (mmp9) and TNFRSF1B

307 (tnfrsf1b) and the M2-markers ALOX5AP (alox5ap), CLEC4A (si:ch211-170d8.8), MARCO (marco) and

308 TGFB1 (tgfb1b) were also detected in our zfM core dataset (Table S4).

309 To investigate further the similarities with human macrophages, we compared our transcriptomic

310 data with RNA sequencing data published by Beyer et al. (2012) (40), in which transcriptomes of in

311 vitro polarized M1 and M2 macrophages were analysed.

312 By using Biomart (http://www.ensembl.org/biomart/) combined with custom annotations, we

313 retrieved the human homologs of the total of 13185 genes expressed in mpeg1-positive

314 macrophages and identified 9780 human genes with a HGNC symbol. Approximately three quarters

315 of this human homolog set were also found among the set of 12327 genes expressed in human M1

316 cells (73,1%) and among the 12488 genes expressed in M2 cells (73,6%) (RPKM > 0,3) (Figure 4A).

317 Similar proportions of the human homologs from the zfM core expression set (for which 524 human

318 homologs were identified, see Table S7) were found in human M1 (75,8%) and M2 (76,2%)

319 macrophages (Figure 4A). Among those genes, only 11 were expressed exclusively in human M1

320 macrophages and 13 exclusively in M2 macrophages. These observations suggest that zebrafish

321 macrophages are composed by a mixed population of M1 and M2 type macrophages.

322

323 A total of 114 homologs from the zfM core expression dataset were not present in the M1 or M2

324 polarized human macrophage datasets (Figure 4A). Among these were the known M1 marker

325 Interleukin 12B and the M2 marker mannose receptor C type 1 (MRC1). Other genes detected

326 exclusively in the zfM expression set were associated to the molecular function carbohydrate

327 binding, serine-type endopeptidase inhibitor activity and NAD(P)+ protein arginine ADP-

328 ribosyltransferase activity, and involved in peptidoglycan catabolic processes (Figure 4B). Genes

329 coding for several members of the SerpinB serine protease inhibitor family, the peptidoglycan

330 recognition protein Pglyrp family, metalloproteases (Mmp13a), as well as cytokines (Tnfs11, Il21) and

331 cytokine receptors (Ccr9a, Cxcr3.2, Cxcr3.3, Il22ra2) are present in these categories. The absence of

332 these genes in the human M1 and M2 sets might be due to low expression levels in in vitro cultured

333 cells.

334 Finally, we computed the differential expression between human M1 and M2 polarized macrophages

335 and searched whether the genes from the zfM core expression set were preferentially associated to

336 either M1 (log2FC > 1) or M2 (log2FC < -1) signal. The results show that 67 genes from the zfM core

337 dataset were associated to M1-enriched genes and 67 were associated to M2-enriched genes (Figure

338 4C).

339 We also used Gene Set Enrichment Analysis (GSEA) to compare the set of genes expressed (RPKM >

340 0.3) in zebrafish macrophages with the differential expression between human M1 and M2 polarized

341 macrophages. The analysis showed a preference for M2-enriched genes, although this enrichment

342 was not significant (Figure 4D top panel). Focusing on the zfM core gene set also showed no clear

343 enrichment for either M1- or M2-enriched genes (Figure 4D lower panel).

344 Altogether, our results indicate no clear polarization of the zebrafish macrophages, suggesting the

345 presence of both M1 and M2-typed macrophages in unchallenged larvae.

346

347 Effect of M. marinum infection on the zebrafish macrophage transcriptome profile

348 As zebrafish larval macrophages display mixed M1 and M2 characteristics, we tried to induce a shift

349 in activation phenotype by infecting mpeg1:mCherry embryos at 1dpf with GFP-labelled

350 Mycobacterium marinum (Mm), an intracellular pathogen of macrophages. Transcriptomes of

351 infected and uninfected macrophages were profiled 5 day post infection (6 dpf).

352

353 When retrieving samples from infected larvae, only a small number of double positive cells were

354 collected over a long sorting period, inducing variation between replicates. To minimize the

355 differences, we reduced the sorting time and the number of steps in the protocol by collecting 20

356 infected and uninfected cells from Mm-infected larvae directly in cDNA synthesis buffer and by

357 proceeding immediately to cDNA synthesis and amplification without RNA extraction. These

358 modifications of the protocol led to reproducible results (Figure S2, Figure S3). Differential expression

359 analysis between infected and uninfected macrophages identified 330 upregulated and 139

360 downregulated genes (P-adj < 0.05) (Figure 5A, Table S8). GO analysis identified two terms enriched

361 in the downregulated genes only: cell cycle and blood vessel morphogenesis. This group, often

362 related to immune cell migration, included the genes flt1/VEGFR1, known to be expressed in mouse

363 M2 macrophages in vitro (51; 52), and ptprja/CD148, expressed by human macrophages under

364 exposure to LPS and other TLR-ligands but repressed under CSF-1 treatment (53). Performing GO

365 analysis on the human homologs of this set of genes identified the terms transcription coactivator

366 activity, NADP or NADPH binding and serine hydrolase activity associated to upregulated genes

367 (Figure 5B) and protein localization to downregulated genes.

368 Our analysis revealed several Mm-induced genes that could play important roles in host defense.

369 These include for example CIITA, the master transactivator of MHC class II gene expression, which

370 has previously been described to be important for limiting M. tuberculosis infection in mice (54).

371 Another Mm-induced gene is the mpeg1-family gene mpeg1.2, which we have previously shown also

372 to be inducible by Salmonella infection (21). The mpeg1 genes encode proteins of the perforin family

373 with proposed anti-bacterial functions in macrophages that require further mechanistic dissection

374 (21). On the other hand, other overexpressed genes could be more beneficial for the survival of the

375 bacteria. The gene nsfb, the zebrafish homolog of the human N-ethylmaleimide sensitive factor, has

376 been proposed to promote the fusion of phagosomes containing live Salmonella with the early

377 endosome and repress their transport to lysosomes (55), whereas the acap1 gene promotes

378 Salmonella invasion (56).

379

380 To explore the possible polarization of the Mm-infected zebrafish macrophages, we compared the

381 differentially expressed gene set with the transcriptomes of M1 and M2 in vitro polarized

382 macrophages reported by Beyer et al. (2012) (40). We found that 18 M1-enriched genes (log2FC > 1)

383 were overexpressed in infected macrophages and 2 were downregulated whereas 26 M2-enriched

384 genes (log2FC < -1) were upregulated and 6 were downregulated (Figure 5C). Although GSEA showed

385 no significant association of the upregulated genes with either M1- or M2-enriched genes (Figure 5D,

386 top panel), the genes downregulated in Mm-infected macrophages were clearly associated to M2-

387 polarized human macrophages (Figure 5D, lower panel).

388 One of the most highly induced gene in infected macrophages was cxcl11aa, a zebrafish homolog of

389 the gene for human CXCL11 (Figure 5A), a proinflammatory chemokine that is a typical M1 marker

390 (57). We recently showed that this chemokine is important during Mm infection in zebrafish for the

391 recruitment of macrophages and dissemination of the bacteria(39). Furthermore, expression of tnfa

392 appeared to be highly upregulated in infected macrophages. Tnfa is one of the main markers of M1

393 activated macrophages in human and has been used as a marker for M1-like activated macrophages

394 in zebrafish larvae (16). Other known zebrafish M1-like activated macrophage markers are non-

395 significantly overexpressed (il1b, tnfb), or barely expressed (il6). On the other hand, the known

396 zebrafish M2-like markers are either expressed at a low level (tgfb1a, il10) or not significantly

397 downregulated (cxcr4b, ccr2) (Figure 5A,E).

398 We can conclude that the strong induction of two important proinflammatory markers, cxcl11aa and

399 tnfa, and the downregulation of genes associated to M2 polarization as detected by GSEA indicate

400 that Mm-infected macrophages display M1 rather than M2 characteristics.

401

402 The cxcl11aa gene expression as a robust marker of Mycobacterium-infected macrophages

403 Among the chemokine and cytokine genes expressed in Mm-infected macrophages, cxcl11aa

404 emerged as the most reproducible infection marker from the RNAseq analysis, showing significantly

405 higher induction (average log2 (fold change) = 8.6, P-adj < 0.001) than tnfa (average log2 (FC) = 5.6, P-

406 adj = 0.03) in all replicates. In order to confirm the Mm-inducible expression of cxcl11aa in

407 macrophages, we FACS-sorted mpeg1:mCherry positive cells from Mm-infected and mock-injected

408 larvae and quantified the level of cxcl11aa expression by real time PCR. In uninfected conditions, the

409 expression of cxcl11aa was significantly enriched in the mCherry-positive macrophage cell fraction

410 compared with the unlabeled cell fraction (Figure 6A). During infection, the expression levels of

411 cxcl11aa were strongly upregulated in macrophages but not in the unlabeled cell fraction. We found

412 that the level of this infection-induced and macrophage-specific expression of cxcl11aa is high

413 enough to be detectable in total RNA samples from whole larvae and that cxcl11aa induction did not

414 require the bacterial locus RD1 (Region of Difference 1), a pathogenicity locus encompassing the

415 secretion system of ESAT-6 (Early Secreted Antigenic Target 6 kDa), which is associated with

416 mycobacterial virulence and formation of tubercular granulomas (Figure 6B) (58). The induction of

417 cxcl11aa was also independent from the host cxcr3.2 gene, which encodes the receptor for Cxcl11aa

418 (Fig.6B) (39). Next, we asked whether cxcl11aa induction requires the central immune mediator

419 Myd88, which links pathogen recognition by Toll-like receptors and Il1β-mediated inflammation to

420 activation of the transcription factor Nfκb (59). Therefore, we quantified the expression levels of

421 cxcl11aa in myd88 mutant larvae. Since myd88 mutants display an increased infection level when

422 infected with the same initial infection load as wild type siblings, we compensated this with a

423 reduced inoculum to obtain a similar infection level at 4 dpi. Both with the reduced and the regular

424 inoculum, myd88 mutants displayed a marked incapability to upregulate cxcl11aa (Figure 6C-E),

425 indicating that Myd88-dependent signaling is key to upregulate macrophage expression of cxcl11aa

426 during Mm infection.

427

428

429

430 Discussion

431 Zebrafish larvae provide unique possibilities for real time visualization of macrophage responses

432 during developmental and disease processes. However, it has remained unknown how the

433 expression profile of larval macrophages compares to the profiles of human M1 and M2 in vitro

434 polarized macrophage subsets, which are commonly considered as a reference for pro-inflammatory

435 or anti-inflammatory activation states. Here we used RNAseq analysis of FACS-sorted cell fractions to

436 determine the expression profile of macrophages isolated from mpeg1 reporter lines, which are

437 widely used for imaging studies in zebrafish due to the highly specific labeling of the macrophage

438 lineage. We demonstrate the unique signature of the mpeg1 reporter cells by comparison with the

439 RNAseq profiles of neutrophils, marked by the mpx reporter, and progenitor lymphocytes, marked by

440 the lck reporter. We detected expression of homologs of human M1 as well as M2 markers in the

441 mpeg1 reporter cells, indicating that zebrafish larval macrophages have the potential to differentiate

442 into both directions. Finally, to demonstrate polarization of macrophages under challenged

443 conditions, we achieved an RNAseq analysis of low numbers of mpeg1-positive macrophages

444 infected with a mycobacterial pathogen. The profiling of these infected macrophages revealed

445 downregulation of M2 markers, while M1 markers were upregulated, with strongest induction of a

446 homolog of the human M1 marker CXCL11.

447 Adult mpeg1 reporter fish have previously been used to determine the transcriptome of microglia,

448 the brain-resident macrophage population (60). Other fluorescent reporter lines for different

449 immune cell types from the myeloid and lymphoid lineages have recently been used to determine

450 single-cell transcriptomes of cells sorted from hematopoietic organs (spleen and kidney marrow) of

451 adult fish (61; 62; 63). Our study is the first to report on the transcriptome of larval macrophages. We

452 could detect reproducible expression of a total of 13185 genes in mpeg1-positive macrophages,

453 among which 744 showed significantly enriched expression compared to the background tissue.

454 These genes were linked to biological processes that are important for macrophage function, such as

455 innate immunity, inflammation, antigen processing and presentation, signal transduction, peptidase

456 activity, chemotaxis, and actin filament organization and polymerization. This RNAseq dataset

457 provides a useful new data mining resource that will facilitate genetic analyses of macrophage-

458 specific genes in zebrafish larval models for development and disease.

459 A dual-fluorescent reporter line with mpeg1-labelled macrophages and tnfa as a marker for M1

460 phenotype has been used to demonstrate that injury and infection can induce M1 polarization of

461 macrophages in zebrafish larvae (16). While the tnfa reporter does not show detectable fluorescent

462 gene expression in the absence of wounding or infection stimuli, we could detect a basal level of tnfa

463 expression in our RNAseq data of macrophages from unchallenged zebrafish larvae. Furthermore,

464 our RNAseq data set of 744 enriched macrophage markers contains other M1 markers that were

465 reported to be induced by injury in tnfa-positive macrophages (il1, il6), but also contains M2 markers

466 that are expressed at higher levels in tnfa-negative macrophages (tgfb1, ccr2, cxcr4b). Single cell

467 sequencing would be required to determine if all macrophages express these M1 and M2 markers at

468 low levels or that distinct macrophage subsets exist already under unchallenged conditions. A

469 comparison with RNAseq profiles of in vitro differentiated human M1 and M2 macrophages provided

470 further evidence that the transcriptome of zebrafish larval macrophages displays a mixed M1 and M2

471 signature (40). Whereas our results do not allow to conclude if two distinct populations of

472 macrophages similar to human M1 and M2 polarized macrophages exist in zebrafish larvae, we

473 identified several specific genes that suggest the presence of these different populations and that

474 could be used to expand the repertoire of zebrafish transgenic reporter lines for investigating

475 macrophage polarization in vivo during immune challenge in the zebrafish model.

476

477 Fluorescent reporters driven by the mpeg1 and mpx promoters distinguish specifically between

478 macrophages and neutrophils (20; 27). In agreement, we did not detect mpeg1 gene expression in

479 neutrophils from mpx reporter fish. However, we detected low levels of expression of mpx and other

480 common neutrophil markers in macrophages from mpeg1 reporter fish. This indicates that the

481 RNAseq procedure is highly sensitive and suggests that post-translational mechanisms contribute to

482 regulating the specificity of innate immune cell types. We found that approximately half of the genes

483 that show enriched expression in neutrophils also show enriched expression in macrophages.

484 However, an obvious difference between the two innate immune cell types is that genes involved in

485 antigen presentation and processing were detected only in macrophages. Other notable differences

486 were found within the families of proteinases, with macrophages expressing several members of the

487 cathepsin family, while neutrophils express genes from the carboxypeptidase, elastase, and chymase

488 families. The neutrophil RNAseq data reported here have been data mined to investigate the

489 expression of the major classes of drug transporters in zebrafish larvae, providing useful information

490 for optimizing screening approaches for anti-inflammatory drugs (64).

491 The enriched gene sets of larval macrophages and neutrophils consist for more than 75% of

492 transcripts that are not detected in progenitor lymphocytes isolated from lck reporter fish. Similarly,

493 the enriched gene set of lck-labelled lymphocytes consists for 85% of transcripts that are not

494 expressed in the myeloid lineage. It is well known that the adaptive immune system in zebrafish

495 larvae is not yet mature and that full immunocompetence, including antibody production, is achieved

496 only by 3-6 weeks of development (65; 66). However, it is not known at which stage of larval

497 development the first interactions between antigen-presenting cells and T-lymphocytes take place.

498 We found that mpeg1-labelled macrophages from 5 day old larvae express the major

499 histocompatibility class II gene mhc2dab, which is even earlier than the observed expression of a

500 fluorescent mhc2dab reporter that labels putative dendritic cells scattered throughout the skin of

501 larvae from 9 days onwards (67). The presence of mhc2dab and transcripts of other genes involved in

502 antigen presentation and processing in larval macrophages suggest that communication with T-

503 lymphocytes could take place already at stages where zebrafish larvae are generally believed to rely

504 exclusively on innate immunity. In support of this hypothesis, we found that larval lymphocytes

505 express the Cd4 marker for helper T-cells and the co-stimulatory receptor Cd28, which are required

506 for macrophage activation. Furthermore, the expression of perforin genes is indicative of the

507 development of cytotoxic T-cells. However, since there was no detectable expression of Cd8, it is

508 unlikely that cytotoxic T-cells are already functional in 5 day old larvae.

509 To investigate how larval macrophages respond to an intracellular infection with mycobacteria, we

510 determined the expression profile of Mm-infected mpeg1 reporter cells. This RNAseq analysis was

511 challenging due to the low numbers of infected cells that could be obtained by FACS sorting. Infected

512 macrophages have a lifespan of less than 5 hours (68), which likely is an important contributing

513 factor to the difficulty of isolating Mm-infected cells. To deal with the complication of low cell

514 numbers, we adapted the RNAseq protocol and determined the transcriptomes of triplicate pools of

515 20 infected or non-infected cells from M. marinum infected larvae. By limiting the number of cells

516 per sample to 20 we could avoid interference of DNA reads in the RNAseq data, while still keeping

517 sufficient biological variation to answer the question if Mm infection causes a general shift in

518 macrophage polarization. While different types of macrophage polarization have been reported for

519 in vitro cultured macrophages infected with mycobacteria (15), it is not understood how these

520 pathogens affect macrophage polarization during different stages of tuberculosis disease in vivo. Our

521 RNAseq analysis was performed at a stage where infected macrophages have aggregated into

522 inflammatory infection foci, which are regarded as the earliest developmental stages of tuberculous

523 granulomas (69). We observed that homologs of M2-enriched transcripts of human cells were

524 preferentially down-regulated in M. marinum-infected zebrafish macrophages, whereas several M1-

525 enriched transcripts were highly upregulated. Therefore, although no clear polarization was

526 observed, our analysis suggests that macrophages shift towards M1 phenotype in Mm-infected

527 zebrafish, which are used to model tuberculosis. Our results show an important modification of the

528 macrophage transcriptome upon mycobacterial infection and unravel several targets that can be

529 studied to better understand the molecular mechanisms involved in the host-pathogen interaction.

530 An important question is whether part of the observed expression changes in Mm-infected

531 macrophages might be triggered by bacterial virulence factors or that all changes represent a general

532 host defense response that is mounted against pathogenic as well as non-pathogenic mycobacteria.

533 Irrespective of the answer to this question, it can be argued that some of the induced genes benefit

534 the pathogen rather than the host. For example, we detected induced expression in Mm-infected

535 macrophages of genes (nsfb, acap1) that promote the survival of bacteria in phagosomes (55; 56). A

536 gene that is induced strongly and reproducibly among all replicates, cxcl11aa, could have both host-

537 beneficial and host-detrimental effects. This gene, which is a homolog of the human M1 marker

538 CXCL11, encodes a chemokine that mediates macrophage recruitment to infection foci through

539 interaction with chemokine receptor Cxcr3.2, the zebrafish counterpart of human CXCR3 (39). While

540 a certain level of macrophage recruitment during Mm infection is necessary to restrict infection (70),

541 Mm bacteria also take advantage of the arrival of new macrophages at infection foci as this promotes

542 spreading of the infection (37). In line with these considerations, we have previously found that

543 deficiency in the receptor for Cxcl11aa, Cxcr3.2, limits the expansion of Mm in granulomas (39). A

544 similar phenotype has been found upon depletion of Mmp9, another host factor required for

545 macrophage recruitment (38). Therefore, high and sustained induction of cxcl11aa is likely to have an

546 adverse effect on the control of Mm infection by the zebrafish host. On the other hand, the robust

547 induction of this M1 polarization marker makes the cxcl11aa gene a prime candidate to expand the

548 collection of zebrafish reporter lines for studying macrophage activation.

549 In conclusion, the transcriptome analyses reported here present a unique and detailed genetic

550 profile of zebrafish larval immune cells, thereby providing a valuable resource that can be data mined

551 to verify the expression of specific genes in the profiled cell types or to identify novel genes of

552 interest and potential cell-specific markers. In future work single cell RNA sequencing technology will

553 be useful to interrogate the heterogeneity in expression profiles of resting and activated

554 macrophages.

555 Data Availability Statement

556 The sequencing data for infected samples have been submitted to the NCBI Gene Expression

557 Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE68920. The

558 sequencing data for uninfected samples were made previously available under accession number

559 GSE78954.

560

561 Acknowledgements

562 The authors thank Michiel van der Vaart for critical reading of the manuscript, Graham Lieschke

563 (Monash University), Georges Lutfalla (University of Montpellier), Steve Renshaw (University of

564 Sheffield) and David Langenau (Harvard Stem Cell Institute) for zebrafish reporter lines, Guido de Roo

565 and Sabrina Veld for support with FACS sorting, and the fish facility team members for zebrafish care.

566 This work was supported by the Marie Curie Initial Training Network FishForPharma (PITN-GA-2011-

567 289209) and the project ZF-HEALTH (HEALTH-F4-2010-242048) funded by the European Commission

568 7th Framework Programme, and by the SmartMix programme of the Netherlands Ministry of

569 Economic Affairs and the Ministry of Education, Culture, and Science. Additionally, Z.K. was

570 supported by the Higher Education Commission of Pakistan and A.Z. was supported by a Horizon

571 grant of the Netherlands Genomics Initiative.

572

573

574 Author Contributions

575 JR contributed to conception and design of the study, performed and analyzed experiments, and

576 wrote and edited the manuscript. VT contributed to conception and design of the study, performed

577 and analyzed experiments, and wrote and edited a section of the manuscript. AZ contributed to

578 conception and design of the study and performed experiments. ZK contributed to conception and

579 design of the study and performed experiments. HJJ performed and analyzed experiments. AHM

580 contributed to conception and design of the study, wrote and edited the manuscript, and acquired

581 funding. All authors contributed to manuscript revision, read and approved the submitted version.

582

583 Conflict of Interest Statement

584 Author HJJ was employed by company ZF-screens B.V. (Leiden, The Netherlands). All other authors

585 declare no competing interests.

586

587 References

588 [1] K.R. Balka, and D. De Nardo, Understanding early TLR signaling through the Myddosome. J Leukoc 589 Biol (2018). 590 [2] T. Kawai, and S. Akira, Toll-like receptors and their crosstalk with other innate receptors in 591 infection and immunity. Immunity 34 (2011) 637-50. 592 [3] R.S. Flannagan, G. Cosio, and S. Grinstein, Antimicrobial mechanisms of phagocytes and bacterial 593 evasion strategies. Nat Rev Microbiol 7 (2009) 355-66. 594 [4] M.C. Greenlee-Wacker, Clearance of apoptotic neutrophils and resolution of inflammation. 595 Immunol Rev 273 (2016) 357-70. 596 [5] A. Fantin, J.M. Vieira, G. Gestri, L. Denti, Q. Schwarz, S. Prykhozhij, F. Peri, S.W. Wilson, and C. 597 Ruhrberg, Tissue macrophages act as cellular chaperones for vascular anastomosis 598 downstream of VEGF-mediated endothelial tip cell induction. Blood 116 (2010) 829-40. 599 [6] S.J. Leibovich, P.J. Polverini, H.M. Shepard, D.M. Wiseman, V. Shively, and N. Nuseir, Macrophage- 600 induced angiogenesis is mediated by tumour necrosis factor-alpha. Nature 329 (1987) 630-2. 601 [7] J. Travnickova, V. Tran Chau, E. Julien, J. Mateos-Langerak, C. Gonzalez, E. Lelievre, G. Lutfalla, M. 602 Tavian, and K. Kissa, Primitive macrophages control HSPC mobilization and definitive 603 haematopoiesis. Nat Commun 6 (2015) 6227. 604 [8] M. Hulsmans, S. Clauss, L. Xiao, A.D. Aguirre, K.R. King, A. Hanley, W.J. Hucker, E.M. Wulfers, G. 605 Seemann, G. Courties, Y. Iwamoto, Y. Sun, A.J. Savol, H.B. Sager, K.J. Lavine, G.A. Fishbein, 606 D.E. Capen, N. Da Silva, L. Miquerol, H. Wakimoto, C.E. Seidman, J.G. Seidman, R.I. Sadreyev, 607 K. Naxerova, R.N. Mitchell, D. Brown, P. Libby, R. Weissleder, F.K. Swirski, P. Kohl, C. 608 Vinegoni, D.J. Milan, P.T. Ellinor, and M. Nahrendorf, Macrophages Facilitate Electrical 609 Conduction in the Heart. Cell 169 (2017) 510-522 e20. 610 [9] P.J. Murray, J.E. Allen, S.K. Biswas, E.A. Fisher, D.W. Gilroy, S. Goerdt, S. Gordon, J.A. Hamilton, 611 L.B. Ivashkiv, T. Lawrence, M. Locati, A. Mantovani, F.O. Martinez, J.L. Mege, D.M. Mosser, G. 612 Natoli, J.P. Saeij, J.L. Schultze, K.A. Shirey, A. Sica, J. Suttles, I. Udalova, J.A. van Ginderachter, 613 S.N. Vogel, and T.A. Wynn, Macrophage activation and polarization: nomenclature and 614 experimental guidelines. Immunity 41 (2014) 14-20.

615 [10] M. Yang, D. McKay, J.W. Pollard, and C.E. Lewis, Diverse Functions of Macrophages in Different 616 Tumor Microenvironments. Cancer Res 78 (2018) 5492-5503. 617 [11] G.J. Koelwyn, E.M. Corr, E. Erbay, and K.J. Moore, Regulation of macrophage 618 immunometabolism in atherosclerosis. Nat Immunol 19 (2018) 526-537. 619 [12] M. Nahrendorf, Myeloid cell contributions to cardiovascular health and disease. Nat Med 24 620 (2018) 711-720. 621 [13] G. Lugo-Villarino, C. Verollet, I. Maridonneau-Parini, and O. Neyrolles, Macrophage polarization: 622 convergence point targeted by mycobacterium tuberculosis and HIV. Front Immunol 2 (2011) 623 43. 624 [14] E.T. Richardson, S. Shukla, D.R. Sweet, P.A. Wearsch, P.N. Tsichlis, W.H. Boom, and C.V. Harding, 625 Toll-like receptor 2-dependent extracellular signal-regulated kinase signaling in 626 Mycobacterium tuberculosis-infected macrophages drives anti-inflammatory responses and 627 inhibits Th1 polarization of responding T cells. Infect Immun 83 (2015) 2242-54. 628 [15] N.H. Trivedi, J.J. Yu, C.Y. Hung, R.P. Doelger, C.S. Navara, L.Y. Armitige, J. Seshu, A.P. Sinai, J.P. 629 Chambers, M.N. Guentzel, and B.P. Arulanandam, Microbial co-infection alters macrophage 630 polarization, phagosomal escape, and microbial killing. Innate Immun 24 (2018) 152-162. 631 [16] M. Nguyen-Chi, B. Laplace-Builhe, J. Travnickova, P. Luz-Crawford, G. Tejedor, Q.T. Phan, I. 632 Duroux-Richard, J.P. Levraud, K. Kissa, G. Lutfalla, C. Jorgensen, and F. Djouad, Identification 633 of polarized macrophage subsets in zebrafish. Elife 4 (2015) e07288. 634 [17] M. Nguyen-Chi, B. Laplace-Builhe, J. Travnickova, P. Luz-Crawford, G. Tejedor, G. Lutfalla, K. 635 Kissa, C. Jorgensen, and F. Djouad, TNF signaling and macrophages govern fin regeneration in 636 zebrafish larvae. Cell Death Dis 8 (2017) e2979. 637 [18] G.J. Lieschke, and P.D. Currie, Animal models of human disease: zebrafish swim into view. Nat 638 Rev Genet 8 (2007) 353-67. 639 [19] A. Bernut, J.L. Herrmann, K. Kissa, J.F. Dubremetz, J.L. Gaillard, G. Lutfalla, and L. Kremer, 640 Mycobacterium abscessus cording prevents phagocytosis and promotes abscess formation. 641 Proc Natl Acad Sci U S A 111 (2014) E943-52. 642 [20] F. Ellett, L. Pase, J.W. Hayman, A. Andrianopoulos, and G.J. Lieschke, mpeg1 promoter 643 transgenes direct macrophage-lineage expression in zebrafish. Blood 117 (2011) e49-56. 644 [21] E.L. Benard, P.I. Racz, J. Rougeot, A.E. Nezhinsky, F.J. Verbeek, H.P. Spaink, and A.H. Meijer, 645 Macrophage-expressed perforins mpeg1 and mpeg1.2 have an anti-bacterial function in 646 zebrafish. J Innate Immun 7 (2015) 136-52. 647 [22] C. Gerri, R. Marin-Juez, M. Marass, A. Marks, H.M. Maischein, and D.Y.R. Stainier, Hif-1alpha 648 regulates macrophage-endothelial interactions during blood vessel development in zebrafish. 649 Nat Commun 8 (2017) 15492. 650 [23] D.S. Eom, and D.M. Parichy, A macrophage relay for long-distance signaling during 651 postembryonic tissue remodeling. Science 355 (2017) 1317-1320. 652 [24] K. Chia, J. Mazzolini, M. Mione, and D. Sieger, Tumor initiating cells induce Cxcr4-mediated 653 infiltration of pro-tumoral macrophages into the brain. Elife 7 (2018). 654 [25] V. Torraca, S. Masud, H.P. Spaink, and A.H. Meijer, Macrophage-pathogen interactions in 655 infectious diseases: new therapeutic insights from the zebrafish host model. Dis Model Mech 656 7 (2014) 785-97. 657 [26] A.J. Svahn, M.B. Graeber, F. Ellett, G.J. Lieschke, S. Rinkwitz, M.R. Bennett, and T.S. Becker, 658 Development of ramified microglia from early macrophages in the zebrafish optic tectum. 659 Dev Neurobiol 73 (2013) 60-71. 660 [27] S.A. Renshaw, C.A. Loynes, D.M. Trushell, S. Elworthy, P.W. Ingham, and M.K. Whyte, A 661 transgenic zebrafish model of neutrophilic inflammation. Blood 108 (2006) 3976-8. 662 [28] D.M. Langenau, A.A. Ferrando, D. Traver, J.L. Kutok, J.P. Hezel, J.P. Kanki, L.I. Zon, A.T. Look, and 663 N.S. Trede, In vivo tracking of T cell development, ablation, and engraftment in transgenic 664 zebrafish. Proc Natl Acad Sci U S A 101 (2004) 7369-74. 665 [29] N. Yoshida, E.M. Frickel, and S. Mostowy, Macrophage-Microbe Interactions: Lessons from the 666 Zebrafish Model. Front Immunol 8 (2017) 1703.

667 [30] T.K. Prajsnar, V.T. Cunliffe, S.J. Foster, and S.A. Renshaw, A novel vertebrate model of 668 Staphylococcus aureus infection reveals phagocyte-dependent resistance of zebrafish to non- 669 host specialized pathogens. Cell Microbiol 10 (2008) 2312-25. 670 [31] T.K.P. Samrah Masud, Gerda E.M. Lamers, Marianne Benning, Vincenzo Torraca, Michiel van der 671 Vaart, and Annemarie H. Meijer, Macrophages target Salmonella by Lc3-associated 672 phagocytosis in a systemic infection model. Autophagy (2018) in press

673 674 [32] J. Mesureur, J.R. Feliciano, N. Wagner, M.C. Gomes, L. Zhang, M. Blanco-Gonzalez, M. van der 675 Vaart, D. O'Callaghan, A.H. Meijer, and A.C. Vergunst, Macrophages, but not neutrophils, are 676 critical for proliferation of Burkholderia cenocepacia and ensuing host-damaging 677 inflammation. PLoS Pathog 13 (2017) e1006437. 678 [33] M.R. Cronan, and D.M. Tobin, Fit for consumption: zebrafish as a model for tuberculosis. Dis 679 Model Mech 7 (2014) 777-84. 680 [34] A.H. Meijer, Protection and pathology in TB: learning from the zebrafish model. Semin 681 Immunopathol 38 (2016) 261-73. 682 [35] L. Ramakrishnan, The zebrafish guide to tuberculosis immunity and treatment. Cold Spring Harb 683 Symp Quant Biol 78 (2013) 179-92. 684 [36] H. Clay, J.M. Davis, D. Beery, A. Huttenlocher, S.E. Lyons, and L. Ramakrishnan, Dichotomous role 685 of the macrophage in early Mycobacterium marinum infection of the zebrafish. Cell Host 686 Microbe 2 (2007) 29-39. 687 [37] J.M. Davis, and L. Ramakrishnan, The role of the granuloma in expansion and dissemination of 688 early tuberculous infection. Cell 136 (2009) 37-49. 689 [38] H.E. Volkman, T.C. Pozos, J. Zheng, J.M. Davis, J.F. Rawls, and L. Ramakrishnan, Tuberculous 690 granuloma induction via interaction of a bacterial secreted protein with host epithelium. 691 Science 327 (2010) 466-9. 692 [39] V. Torraca, C. Cui, R. Boland, J.P. Bebelman, A.M. van der Sar, M.J. Smit, M. Siderius, H.P. Spaink, 693 and A.H. Meijer, The CXCR3-CXCL11 signaling axis mediates macrophage recruitment and 694 dissemination of mycobacterial infection. Dis Model Mech 8 (2015) 253-69. 695 [40] M. Beyer, M.R. Mallmann, J. Xue, A. Staratschek-Jox, D. Vorholt, W. Krebs, D. Sommer, J. Sander, 696 C. Mertens, A. Nino-Castro, S.V. Schmidt, and J.L. Schultze, High-resolution transcriptome of 697 human macrophages. PLoS One 7 (2012) e45466. 698 [41] M. van der Vaart, H.P. Spaink, and A.H. Meijer, Pathogen recognition and activation of the innate 699 immune response in zebrafish. Adv Hematol 2012 (2012) 159807. 700 [42] H.E. Volkman, H. Clay, D. Beery, J.C. Chang, D.R. Sherman, and L. Ramakrishnan, Tuberculous 701 granuloma formation is enhanced by a mycobacterium virulence determinant. PLoS Biol 2 702 (2004) e367. 703 [43] A.M. van der Sar, A.M. Abdallah, M. Sparrius, E. Reinders, C.M. Vandenbroucke-Grauls, and W. 704 Bitter, Mycobacterium marinum strains can be divided into two distinct types based on 705 genetic diversity and virulence. Infect Immun 72 (2004) 6306-12. 706 [44] C. Cui, E.L. Benard, Z. Kanwal, O.W. Stockhammer, M. van der Vaart, A. Zakrzewska, H.P. Spaink, 707 and A.H. Meijer, Infectious disease modeling and innate immune function in zebrafish 708 embryos. Methods Cell Biol 105 (2011) 273-308. 709 [45] J. Rougeot, A. Zakrzewska, Z. Kanwal, H.J. Jansen, H.P. Spaink, and A.H. Meijer, RNA sequencing 710 of FACS-sorted immune cell populations from zebrafish infection models to identify cell 711 specific responses to intracellular pathogens. Methods Mol Biol 1197 (2014) 261-74. 712 [46] D. Szklarczyk, A. Franceschini, S. Wyder, K. Forslund, D. Heller, J. Huerta-Cepas, M. Simonovic, A. 713 Roth, A. Santos, K.P. Tsafou, M. Kuhn, P. Bork, L.J. Jensen, and C. von Mering, STRING v10: 714 protein-protein interaction networks, integrated over the tree of life. Nucleic Acids Res 43 715 (2015) D447-52. 716 [47] V.K. Mootha, C.M. Lindgren, K.F. Eriksson, A. Subramanian, S. Sihag, J. Lehar, P. Puigserver, E. 717 Carlsson, M. Ridderstrale, E. Laurila, N. Houstis, M.J. Daly, N. Patterson, J.P. Mesirov, T.R.

718 Golub, P. Tamayo, B. Spiegelman, E.S. Lander, J.N. Hirschhorn, D. Altshuler, and L.C. Groop, 719 PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately 720 downregulated in human diabetes. Nat Genet 34 (2003) 267-73. 721 [48] A. Subramanian, P. Tamayo, V.K. Mootha, S. Mukherjee, B.L. Ebert, M.A. Gillette, A. Paulovich, 722 S.L. Pomeroy, T.R. Golub, E.S. Lander, and J.P. Mesirov, Gene set enrichment analysis: a 723 knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad 724 Sci U S A 102 (2005) 15545-50. 725 [49] A. Zakrzewska, C. Cui, O.W. Stockhammer, E.L. Benard, H.P. Spaink, and A.H. Meijer, 726 Macrophage-specific gene functions in Spi1-directed innate immunity. Blood 116 (2010) e1- 727 11. 728 [50] Y. Tian, J. Xu, S. Feng, S. He, S. Zhao, L. Zhu, W. Jin, Y. Dai, L. Luo, J.Y. Qu, and Z. Wen, The first 729 wave of T lymphopoiesis in zebrafish arises from aorta endothelium independent of 730 hematopoietic stem cells. J Exp Med 214 (2017) 3347-3360. 731 [51] D.W. Melton, L.M. McManus, J.A. Gelfond, and P.K. Shireman, Temporal phenotypic features 732 distinguish polarized macrophages in vitro. Autoimmunity 48 (2015) 161-76. 733 [52] B.Z. Qian, H. Zhang, J. Li, T. He, E.J. Yeo, D.Y. Soong, N.O. Carragher, A. Munro, A. Chang, A.R. 734 Bresnick, R.A. Lang, and J.W. Pollard, FLT1 signaling in metastasis-associated macrophages 735 activates an inflammatory signature that promotes breast cancer metastasis. J Exp Med 212 736 (2015) 1433-48. 737 [53] R.K. Dave, M.E. Dinger, M. Andrew, M. Askarian-Amiri, D.A. Hume, and S. Kellie, Regulated 738 expression of PTPRJ/CD148 and an antisense long noncoding RNA in macrophages by 739 proinflammatory stimuli. PLoS One 8 (2013) e68306. 740 [54] C.J. Repique, A. Li, W.J. Brickey, J.P. Ting, F.M. Collins, and S.L. Morris, Susceptibility of mice 741 deficient in the MHC class II transactivator to infection with Mycobacterium tuberculosis. 742 Scand J Immunol 58 (2003) 15-22. 743 [55] K. Mukherjee, S.A. Siddiqi, S. Hashim, M. Raje, S.K. Basu, and A. Mukhopadhyay, Live Salmonella 744 recruits N-ethylmaleimide-sensitive fusion protein on phagosomal membrane and promotes 745 fusion with early endosome. J Cell Biol 148 (2000) 741-53. 746 [56] A.C. Davidson, D. Humphreys, A.B. Brooks, P.J. Hume, and V. Koronakis, The Arf GTPase- 747 activating protein family is exploited by Salmonella enterica serovar Typhimurium to invade 748 nonphagocytic host cells. MBio 6 (2015). 749 [57] D.M. Mosser, and J.P. Edwards, Exploring the full spectrum of macrophage activation. Nat Rev 750 Immunol 8 (2008) 958-69. 751 [58] L. Majlessi, P. Brodin, R. Brosch, M.J. Rojas, H. Khun, M. Huerre, S.T. Cole, and C. Leclerc, 752 Influence of ESAT-6 secretion system 1 (RD1) of Mycobacterium tuberculosis on the 753 interaction between mycobacteria and the host immune system. J Immunol 174 (2005) 3570- 754 9. 755 [59] M. van der Vaart, J.J. van Soest, H.P. Spaink, and A.H. Meijer, Functional analysis of a zebrafish 756 myd88 mutant identifies key transcriptional components of the innate immune system. Dis 757 Model Mech 6 (2013) 841-54. 758 [60] N. Oosterhof, I.R. Holtman, L.E. Kuil, H.C. van der Linde, E.W. Boddeke, B.J. Eggen, and T.J. van 759 Ham, Identification of a conserved and acute neurodegeneration-specific microglial 760 transcriptome in the zebrafish. Glia 65 (2017) 138-149. 761 [61] E.I. Athanasiadis, J.G. Botthof, H. Andres, L. Ferreira, P. Lio, and A. Cvejic, Single-cell RNA- 762 sequencing uncovers transcriptional states and fate decisions in haematopoiesis. Nat 763 Commun 8 (2017) 2045. 764 [62] S.J. Carmona, S.A. Teichmann, L. Ferreira, I.C. Macaulay, M.J. Stubbington, A. Cvejic, and D. 765 Gfeller, Single-cell transcriptome analysis of fish immune cells provides insight into the 766 evolution of vertebrate immune cell types. Genome Res 27 (2017) 451-461. 767 [63] Q. Tang, S. Iyer, R. Lobbardi, J.C. Moore, H. Chen, C. Lareau, C. Hebert, M.L. Shaw, C. Neftel, M.L. 768 Suva, C.J. Ceol, A. Bernards, M. Aryee, L. Pinello, I.A. Drummond, and D.M. Langenau,

769 Dissecting hematopoietic and renal cell heterogeneity in adult zebrafish at single-cell 770 resolution using RNA sequencing. J Exp Med 214 (2017) 2875-2887. 771 [64] M.J. Foulkes, K.M. Henry, J. Rougeot, E. Hooper-Greenhill, C.A. Loynes, P. Jeffrey, A. Fleming, 772 C.O. Savage, A.H. Meijer, S. Jones, and S.A. Renshaw, Expression and regulation of drug 773 transporters in vertebrate neutrophils. Sci Rep 7 (2017) 4967. 774 [65] S.H. Lam, H.L. Chua, Z. Gong, T.J. Lam, and Y.M. Sin, Development and maturation of the 775 immune system in zebrafish, Danio rerio: a gene expression profiling, in situ hybridization 776 and immunological study. Dev Comp Immunol 28 (2004) 9-28. 777 [66] D.M. Page, V. Wittamer, J.Y. Bertrand, K.L. Lewis, D.N. Pratt, N. Delgado, S.E. Schale, C. McGue, 778 B.H. Jacobsen, A. Doty, Y. Pao, H. Yang, N.C. Chi, B.G. Magor, and D. Traver, An evolutionarily 779 conserved program of B-cell development and activation in zebrafish. Blood 122 (2013) e1- 780 11. 781 [67] V. Wittamer, J.Y. Bertrand, P.W. Gutschow, and D. Traver, Characterization of the mononuclear 782 phagocyte system in zebrafish. Blood 117 (2011) 7126-35. 783 [68] R. Hosseini, G.E. Lamers, H.M. Soltani, A.H. Meijer, H.P. Spaink, and M.J. Schaaf, Efferocytosis 784 and extrusion of leukocytes determine the progression of early mycobacterial pathogenesis. J 785 Cell Sci 129 (2016) 3385-95. 786 [69] J.M. Davis, H. Clay, J.L. Lewis, N. Ghori, P. Herbomel, and L. Ramakrishnan, Real-time 787 visualization of mycobacterium-macrophage interactions leading to initiation of granuloma 788 formation in zebrafish embryos. Immunity 17 (2002) 693-702. 789 [70] A.J. Pagan, C.T. Yang, J. Cameron, L.E. Swaim, F. Ellett, G.J. Lieschke, and L. Ramakrishnan, 790 Myeloid Growth Factors Promote Resistance to Mycobacterial Infection by Curtailing 791 Granuloma Necrosis through Macrophage Replenishment. Cell Host Microbe 18 (2015) 15- 792 26. 793 [71] E.J. Stoop, T. Schipper, S.K. Rosendahl Huber, A.E. Nezhinsky, F.J. Verbeek, S.S. Gurcha, G.S. 794 Besra, C.M. Vandenbroucke-Grauls, W. Bitter, and A.M. van der Sar, Zebrafish embryo screen 795 for mycobacterial genes involved in the initiation of granuloma formation reveals a newly 796 identified ESX-1 component. Dis Model Mech 4 (2011) 526-36.

797

798

799 Figure Legends

800 Figure 1. Core expression of macrophages in zebrafish larvae. (A) Overlap of the genes enriched (P-

801 adj < 0.05) in zebrafish larval macrophages (zfM) at 5 or 6 dpf from mpeg1-driven Kaede and

802 mCherry reporter fish. The zfM core expression is defined as the overlap of two or three mpeg1

803 positive populations and includes 744 genes. (B) Expression table of immune cell specific genes. First,

804 second and third columns correspond respectively to macrophage expression from 5dpf

805 mpeg1:Kaede, 6dpf mpeg1:Kaede and 6dpf mpeg1:mCherry reporter larvae. Colored cells correspond

806 to genes enriched in the corresponding sequencing data whereas grey cells correspond to non-

807 enriched genes (log2 (fold change) > 1, P-adj ≥ 0.05). Numbers are fold change enrichments in

808 fluorescence positive cells compared to negative cells; Inf = infinite expression change. (C) Network

809 visualization of GO enrichment analysis of genes from the core macrophage expression data set using

810 BiNGO and EnrichmentMap. Red nodes are terms found exclusively in the zfM core dataset and

811 green nodes are found in both zfM core and neutrophil data sets. Node size corresponds to the

812 number of genes associated to the enriched GO term and edge size to the similarity coefficient

813 between two nodes.

814

815 Figure 2. Comparison of macrophage core dataset with neutrophils and lymphoid cells expression

816 sets. (A) Overlap of the genes from the zfM core data set (magenta) and the genes enriched (log2

817 (fold change) > 1, P-adj < 0.05) when comparing mpx:gfp positive and negative cells from 5 dpf

818 transgenic fish (green). Below is represented an expression table of a selection of immune cell

819 specific genes. Red cells and green cells represent genes enriched in macrophages or neutrophils,

820 respectively, whereas grey cells represent non-enriched genes. Numbers are fold change

821 enrichments in fluorescence positive cells compared to negative cells; Inf = infinite expression

822 change. (B) Network visualization of GO enrichment analysis of genes from the neutrophil expression

823 data set using BiNGO and EnrichmentMap. Green nodes are terms found exclusively in neutrophil

824 expression dataset and red nodes are found in both core macrophage and neutrophil data sets.

825 Network legend is similar to Figure 1C. (C) Overlap of the genes from the myeloid data set

826 corresponding to genes found either in the core macrophage or the neutrophil expression data sets

827 (red) and the genes enriched (log2 (fold change) > 1, P-adj < 0.05) when comparing lck:gfp positive

828 and negative cells in 5 dpf lck:gfp transgenic fish (blue). Below is represented an expression table of a

829 selection of immune cell specific genes. Red cells and blue cells represent genes detected in myeloid

830 or lymphoid cell populations, respectively, whereas grey cells represent non-enriched genes.

831 Numbers are fold change enrichments in fluorescence positive cells compared to negative cells). (D)

832 Network visualization of GO enrichment analysis of genes from the lymphoid expression data set

833 using BiNGO and EnrichmentMap. Blue nodes are terms found exclusively in lymphoid expression

834 dataset and red nodes are found in both myeloid and lymphoid data sets. Network legend is similar

835 to Figure 1C.

836

837 Figure 3. Different gene sets expressed in macrophage, neutrophil and lymphoid cell population.

838 Expression table of selected genes belonging to different GO terms. First, second and third columns

839 correspond to macrophage, neutrophil and lymphoid cell populations, respectively. Magenta, green

840 and blue cells represent genes enriched in macrophages, neutrophils, or lymphoid cells. Numbers are

841 fold change enrichments in the fluorescence positive cell fractions compared to negative cell

842 fractions. Grey cells are non- enriched genes (P-adj > 0.05).

843

844 Figure 4. Zebrafish larval macrophages have a gene signature similar to human M1 and M2 polarized

845 macrophages. (A) Overlap of the genes detected in human M1 (blue) or M2 (green) polarized

846 macrophages and of the human homologs of the zebrafish core macrophage data set (magenta).

847 Black number correspond to the comparison between genes expressed in human or zebrafish cells

848 (RPKM or FPKM>0.3) and red numbers correspond to the comparison of gene expressed in human

849 cells and specifically enriched in zebrafish macrophages (log2 (fold change) ≥ 1, P-adj < 0.05). (B)

850 Network visualization of GO enrichment analysis of human homologs of zebrafish macrophage

851 enriched genes not detected in the dataset of human M1 and M2 in vitro polarized macrophages

852 using BiNGO and EnrichmentMap. Red nodes represent GO terms. Network legend is similar to

853 Figure 1C. (C) Volcano plot showing the P-value (-log10-transformed) as a function of the fold-change

854 (log2-transformed) between human M1 and M2 gene expression level of the gene set from Beyer et

855 al. (2012). Red dots are genes with a human homolog detected in the zebrafish macrophage core

856 dataset. (D) Gene Set Enrichment Analysis (GSEA) plots of gene expression changes in human M1 in

857 vitro polarized macrophages compared to human M2 in vitro polarized macrophages from Beyer et

858 al. (2012). Gene sets used for the analyses are genes expressed in zebrafish macrophages (FPKM >

859 0.3) (top panel) and genes from the zebrafish macrophage core dataset (lower panel).

860

861 Figure 5. M. marinum infected macrophages exhibit a change in gene expression towards M1-

862 polarization. (A) MA-plot showing the fold change (log2-transformed) between gene expression in

863 Mm-infected and non-infected mpeg1:gfp positive cells from a 6 dpf embryos 5 days after injection

864 of 100-125 cfu of Mycobacterium marinum M strain containing pSMT3-mCherry as a function of the

865 normalized average count between the two conditions (log10-transformed) as calculated with

866 DEseq2. Turquoise: log2FC ≥ 1 and P-adj < 0.05, red: log2FC ≤ -1 and P-adj < 0.05. (B) Network

867 visualization of GO enrichment analysis of human homologs of up-regulated genes in infected

868 macrophages compared with uninfected macrophages from infected larvae using BiNGO and

869 EnrichmentMap. Network legend is similar to figure 1C. (C) Volcano plot showing the P-value (-log10-

870 transformed) as a function of the fold-change (log2-transformed) between human M1 and M2 gene

871 expression level of the gene set from Beyer et al. (2012). Turquoise and Red dots are genes with a

872 zebrafish homolog respectively up- and down-regulated in the infected macrophages compared with

873 the non-infected macrophages from M. marinum infected larvae. (D) Gene Set Enrichment Analysis

874 (GSEA) plots of gene expression changes in human M1 in vitro polarized macrophages compared to

875 human M2 in vitro polarized macrophages from Beyer et al. (2012). Gene sets used for the analyses

876 are human homologs of genes found up-regulated (log2FC ≥ 1 and P-adj < 0.05) (top panel) and

877 down-regulated (log2FC ≤ -1 and P-adj < 0.05) (lower panel) in macrophages upon Mm infection as

878 described in (A). (E) Table presenting the zebrafish genes expressed in M1 and M2 macrophages

879 studied in Nguyen-Chi et al. (2015). First column indicates their presence in our zfM core dataset.

880 Second column indicates their enrichment (log2Fold Change) in Mm-infected macrophages compared

881 to uninfected macrophages. Turquoise: log2FC ≥ 1 and P-adj < 0.05, light turquoise: log2FC ≥ 0, red:

882 log2FC ≤ 0.

883 Figure 6. The expression of cxcl11aa is upregulated in macrophages upon infection and requires an

884 active Myd88-immune signalling. (A) Expression of cxcl11aa in FACS-sorted macrophages (MΦ,

885 mpeg1:mCherry positive) and its infection-dependent induction (relative to negative/Mock fraction) .

886 (B) Mm- (or Mock-) injected larvae (> 100 per replicate per condition) were dissociated at 5 dpi.

887 Induction of cxcl11aa does not require the RD1 pathogenicity locus and mutants of the cognate

888 receptor of cxcl11aa (cxcr3.2-/-) are still able to upregulate cxcl11aa at comparable levels to wt. (C-E)

889 RNA was isolated from pools of > 10 whole larvae collected at 4 dpi. 800 CFU of RD1 mutant bacteria

890 versus 100 CFU of wildtype Mm were injected to reach a comparable infection level at 4 dpi.

891 Dependency of cxcl11aa induction from myd88. Expression levels (C), representative burden analysis

892 (D) and representative burden pictures (E) derive from larvae collected at 4 dpi. RNA was isolated

893 from pools of > 10 whole larvae. Each point in (D) represents 1 infected larva from a representative

894 pool. 200 CFU of wildtype Mm were injected in myd88+/+ larvae versus 100 and 200 CFU injected in

895 myd88-/- larvae to reach a comparable infection level at 4 dpi. Quantification of total bacterial pixels

896 was obtained using dedicated bacterial pixel count program (71). Scale bar in (E): 200 μm. Statistical

897 significance was analysed by one-way ANOVA with Sidak post-hoc correction on ln(n)-transformed

898 relative induction folds (real time PCRs) or untransformed data (infection burden). Significance (P-

899 value) is indicated with: ns, non-significant; *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001. Error

900 bars: mean±s.e.m.

901

902 Supplementary Material

903 Figure S1. Correlation between RNA-sequencing samples. (A-C) HeatMap of Pearson correlation

904 coefficient of 5 and 6 dpf mpeg1:gal4 ; UAS-Kaede and mpeg1:mCherry positive and negative

905 samples (A), 5dpf mpx:gfp and lck:gfp positive and negative samples (B) and 20 cell samples of

906 mpeg1:gfp positive cells infected or not with M. marinum GFP (C).

907

908 Figure S2. Principal Component Analysis of RNA-sequencing samples. (A-C) Principal Component

909 Analysis of 5 and 6 dpf mpeg1:gal4 ; UAS-Kaede and mpeg1:mCherry positive and negative samples

910 (A), 5dpf mpx:gfp and lck:gfp positive and negative samples (B), and 20 cell samples of mpeg1:gfp

911 positive cells infected or not with M. marinum GFP (C).

912

913 Figure S3. Molecular function associated to the zebrafish core macrophage expression dataset.

914 Network visualization of GO analysis enrichment (molecular function category) of genes from the

915 core macrophage expression data set using BiNGO and EnrichmentMap. Node size corresponds to

916 the number of genes associated to the enriched GO term and edge size to the similarity coefficient

917 between two nodes.

918

919 Table S1. Additional gene annotation. List of manually annotated genes added to the Ensembl

920 annotation version 79 from the genome version Zv9.

921

922 Table S2. FPKM table of macrophage, neutrophil and lymphoid cell population. FPKM for each

923 positive and negative samples were computed by using the longest transcript for each gene.

924 Presented results are average between each replicate.

925

926 Table S3. Summary of gene expression and differential expression analysis. Level of gene expression

927 was distributed based on average FPKM values among non-expressed (FPKM<0.3), moderately

928 expressed (0.3≤FPKM<100) and highly expressed (FPKM≥100) for the positive samples and an

929 average of all the negative samples present in this analysis. Fold Change (FC) between positive and

930 negative samples were computed using DESeq as described in the material and methods.

931

932 Table S4. Zebrafish core macrophage expression dataset. The 744 genes enriched (P-adj < 0.05) in at

933 least two of the three mpeg1 positive cell populations compared with their respective negative cell

934 background represent the zebrafish core macrophage expression data set. Associated gene names

935 and descriptions in bold are additional manual annotations to the Ensembl annotation. For each

936 gene, one relevant term from the Biological Process GO is presented.

937

938 Table S5. Gene expression dataset in neutrophils. List of genes enriched (FC > 0 and P-adj < 0.05) in

939 mpx:gfp positive neutrophils compared with fluorescent negative cells. Associated name and

940 description in bold are additional annotations to the Ensembl annotation. For each gene, one

941 relevant term from the Biological Process GO is presented.

942

943 Table S6. Gene expression dataset in lymphoid cells. List of genes enriched (FC > 0 and P-adj < 0.05)

944 in lck:gfp positive lymphoid cells compared with fluorescent negative cells. Associated name and

945 description in bold are additional annotations to the Ensembl annotation. For each gene, one

946 relevant term from the Biological Process GO is presented.

947

948 Table S7. List of the human homologs from zebrafish genes. List of the human homologs from the

949 genes enriched in the zebrafish core macrophage expression dataset.

950

951 Table S8. Differential expression analysis between Mycobacterium marinum infected and uninfected

952 zebrafish macrophages. List of genes upregulated (FC > 0 and P-adj < 0.05) and downregulated (FC <

953 0 and P-adj < 0.05) in mpeg1:mCherry and Mm-GFP double positive macrophages compared with

954 mpeg1:mCherry only positive macrophages. Associated name and description in bold are additional

955 annotations to the Ensembl annotation.

956

bioRxiv preprint doi: https://doi.org/10.1101/554808; this version posted February 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. A C response to organic and 5 dpf 6 dpf inorganic substances mpeg1:Kaede mpeg1:Kaede (715) (703) regulation of actin filament organization 87 33 124 peptidase activity chemotaxis 430 165 116 744 1242 proteolysis 6 dpf mpeg1:mCherry antigen processing (1953) and presentation

B immune cell markers csf1ra 31 50 85 irf8 19 41 10 marco Inf 223 immune response mfap4 323 409 296 peptidoglycan inflammation response mhc2dab 790 521 36 catabolic process signal transduction mmp13a 28 40 45 mmp9 7 23 20 mpeg1 136 811 197 macrophage node size edge size (genes) (similarity coefficient) lyz 16 30 3 208 1 macrophage mpx 18 43 46 + 2 coro1a 39 32 neutrophil 0.5 spi1a 35 91 68 ptpn6 24 13 20 ptprc 34 64 51

Rougeot_et_al.: Figure 1 bioRxiv preprint doi: https://doi.org/10.1101/554808; this version posted February 19, 2019. The copyright holder for this preprint (which zf corewas macrophage not certified by peerzf neutrophil review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made A available under aCC-BY-NC-NDB 4.0 International license. actin filament organization (744) (503) behavior chemotaxis

504 240 263

proteolysis immune cell markers M1 markers csf1ra 55 cd40 125 irf8 24 cxcl11aa 103 32 marco 223 cxcl11ac 109 mfap4 343 15 ido1 Inf immune response mhc2dab 449 il6 192 inflammatory response mpeg1 381 il8 30 13 lyz 17 2440 il12bb 331 mmp13a 38 236 mmp9 17 66 peptidoglycan mpx 36 724 tnfa 382 21 catabolic process spi1a 65 15 tnfb 48 13 coro1a 36 22 tnfrsf1b 50 45 ptpn6 19 11 carbohydrate M2 markerds ptprc 50 11 catabolic process il10 426 clec4a Inf macrophage + node size edge size neutrophils (genes) (similarity coefficient) 215 1 2 neutrophil 0.5

C zf myeloid cells zf lymphoid cells D cell cycle + (1007) (1934) phosphorylation macromolecular complex gene expression assembly regulation of peptidase activity

770 237 1697 actin cytoskeleton organization

immune cell markers M1/M2 markers csf1ra 55 cd40 125 irf8 24 cxcl11aa 103 response to organic substances marco 223 cxcl11ac 109 mfap4 343 ido1 Inf regulation of mhc2dab 449 il6 192 translation mpeg1 381 il8 30 lyz 2440 il12bb 331 18 mmp13a 236 mmp9 66 mpx 724 tnfa 382 spi1a 65 tnfb 48 coro1a 36 29 tnfrsf1b 50 ptpn6 19 7 il10 426 ptprc 50 15 clec4a Inf

lymphoid markers actin filament cd28 16 protein targeting cell redox organization cd4 113 to ER ikzf1 20 homeostasis chemotaxis metabollic lck 282 rag1 141 processes rag2 114 myeloid + node size edge size lymphoid cells (genes) (similarity coefficient) 482 1 lymphoid 2 cells 0.5

Rougeot_et_al.: Figure 2 bioRxiv preprint doi: https://doi.org/10.1101/554808; this version posted February 19, 2019. The copyright holderacti nfor ﬁ lamentthis preprint organiza (whichtion and cellular immune response proteolysis was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.component It isorganiza madeti on family Gene Name macrophage neutrophil lymphoidavailable family under aCC-BY-NC-NDGene Name 4.0 Internationalmacrophage license neutrophil. lymphoid family Gene Name macrophage neutrophil lymphoid CD CD22 80 adam adam28 8 ARP proteins arpc3 8 13 8 CD CD22 (14 of 48) 344 adam adam8a 10 16 ARP proteins arpc4 10 6 CD CD22 (17 of 48) 54 129 c6ast c6ast1 37 Inf ARP proteins arpc4l 5 CD CD22 (23 of 48) 66 c6ast c6ast3 15 cofilin cfl1 4 CD CD22 (43 of 48) 50 Inf c6ast c6ast4 15 WAS wasa 25 15 CD CD22 (46 of 48) 40 calpain capn2b 6 WAS wasb 13 15 28 CD CD22 (8 of 48) 44 caspase casp8 4 5 WAS wipf1 16 18 12 CD cd40lg 18 caspase caspa 21 47 WAS WIPF1 (1 of 2) 20 86 15 CD cd74a 198 CELA CELA1 (1 of 7) 18 CD cd74b 155 12 CELA CELA1 (6 of 7) 30 CD si:ch211-269k10.4 77 chymase CMA1 (12 of 29) 18 chemokine CCL34b 22 Inf chymase CMA1 (18 of 29) 1309 chemokine CCR2 113 8 chymase CMA1 (19 of 29) 128 chemokine CCR4 56 chymase CMA1 (20 of 29) 17 chemokine ccr6b 22 chymase CMA1 (21 of 29) 29 chemokine CR450808.2 16 chymase CMA1 (22 of 29) 10 chemokine cxcl11aa 188 32 chymase CMA1 (23 of 29) 16 chemokine cxcl11ac 109 chymase CMA1 (25 of 29) 10 chemokine cxcl19 950 33 chymase CMA1 (27 of 29) ribosome biogenesis chemokine cxcr3.3 64 chymase CMA1 (28 of 29) 49 family Gene Name macrophage neutrophil lymphoid chemokine si:ch211-122l24.2 86 chymase CMA1 (7 of 29) 57 translation factor eif6 5 chemokine si:dkey-217m5.3 78 chymase CMA1 (8 of 29) 8 fibrillarin fbl 5 chemokine si:dkey-25o1.4 22 Inf carboxypeptidase cpa1 11 other gtpbpl 3 chemokine si:dkey-25o1.6 310 carboxypeptidase cpa4 10 NHP2 nhp2 6 chemokine si:dkey-42l23.4 Inf carboxypeptidase cpa5 38 NHP2 nhp2l1b 7 chemokine XCR1-like/LOC101883597 563 carboxypeptidase cpm 10 other nip7 3 chemokine ZGC:193706 254 carboxypeptidase cpvl 8 other nop10 4 chemokine zgc:195195 81 13 chymotrypsinogen ctrb1 33 other pop4 4 complement C4BPB (3 of 3) 159 83 cathepsin ctsa 6 ribosomal protein rpl7a 9 complement C7 (2 of 2) 24 cathepsin ctsba 17 ribosomal protein rplp0 7 complement cfp 5 cathepsin ctsc 27 ribosomal protein rps17 9 complement si:dkey-5n18.1 432 18 cathepsin ctsd 8 ribosomal protein rps18 4 C-type lectin CU207259.2 26 cathepsin ctsh 44 3 ribosomal protein rps21 9 C-type lectin LOC101882781 134 cathepsin ctsk 33 ribosomal protein rps28 7 C-type lectin si:ch211-193e13.5 62 74 cathepsin ctsl.1 143 19 ribosomal protein rps6 8 C-type lectin si:ch211-214k5.3 Inf cathepsin ctssa 82 ribosomal protein rps7 7 C-type lectin si:ch211-282j17.2 25 cathepsin ctssb.1 120 101 9 ribosomal protein rps8a 5 C-type lectin si:ch211-283g2.2 134 cathepsin ctssb.2 188 23 ribosomal protein rpsa 5 C-type lectin si:ch73-122g19.1 161 cathepsin ctsz 29 other rrs1 3 C-type lectin si:ch73-335d12.2 37 elastase ela2 19 other rsl24d1 5 C-type lectin si:ch73-343l4.2 294 90 elastase ela2l 18 other sbds 3 C-type lectin si:ch73-343l4.6 259 elastase ela3l 19 other utp11l 4 C-type lectin si:ch73-343l4.8 125 Inf mmp mmp13a 38 236 C-type lectin si:dkey-12f6.5 39 mmp mmp9 17 66 C-type lectin si:dkey-83f18.10 132 psm psma1 6 interleukin CABZ01069745.1 62 57 psm psma2 5 interleukin il10 426 psm psma3 4 interleukin il12a 35 psm psma4 4 interleukin IL12a/LOC100004358 62 57 psm psma5 3 interleukin il15l 4 psm psma6a 4 interleukin il1b 113 73 psm psma6b 3 interleukin il21 89 Inf psm psma6l 14 interleukin il4 46 psm psma8 4 interleukin il6 217 psm psmb1 5 cell cycle interleukin il8 26 13 psm psmb2 5 family Gene Name macrophage neutrophil lymphoid interleukin m17 47 psm psmb3 4 cdc cdc14b 3 interleukin nIL-1FM 192 psm psmb4 5 cdc cdc20 3 interleukin receptor il-15ra 35 15 psm psmb7 3 cdc cdc42l 7 4 interleukin receptor LOC799204 13 psm psmc6 2 cdc cks1b 7 interleukin receptor si:ch73-226l13.2 71 Inf psm psmd8 3 cdc cks2 22 interleukine si:ch211-149o7.4 241 8 trypsin try 29 cdk cdk1 4 MHCI mhc1zba 9 5 trypsin zgc:171509 18 100 cdk inhibitor cdkn1bb 4 MHCI mhc1zea 4 8 centromere protein cenph 4 MHCII mhc2dab 449 chemotaxis cyclin ccna1 39 MHCII si:busm1-194e12.12 inf family Gene Name macrophage neutrophil lymphoid cyclin ccnb1 4 MHCII si:busm1-266f07.2 68 adhesion molecule alcamb 5 cyclin ccnb3 3 MHCII si:ch1073-403i13.1 201 chemokine receptor CCR5-like/LOC100329726 64 cyclin ccnd2a 9 MHCII zgc:101788 9 chemokine receptor CXCR1-like 33 232 histone h2afx 31 MHCII zgc:123107 336 chemokine recetpor ccr12.2 2236 78 other antxr2a 31 19 3 NACHT and LRRdomain si:ch211-42i6.2 42 chemokine recetpor ccr12.3 69 other arl8ba 11 4 NACHT and LRRdomain si:dkey-118k5.3 54 27 chemokine recetpor ccr2 113 8 other aspm 3 NACHT and LRRdomain si:dkey-126g1.7 143 chemokine recetpor ccr4 56 other erh 3 NACHT and LRRdomain si:dkey-165b20.2 24 17 chemokine recetpor ccr6b 22 other ewsr1b 4 NACHT and LRRdomain si:dkey-265e15.2 24 chemokine recetpor ccr9a 13 23 other fam32al 3 NACHT and LRRdomain si:dkey-7i4.1 1127 chemokine recetpor cxcr3.1 19 other HAUS2 5 NACHT and LRRdomain si:dkeyp-33c10.7 74 chemokine recetpor cxcr3.2 77 15 other lin37 3 perforin prf1.7 83 chemokine recetpor cxcr3.3 64 other lin52 5 perforin prf1.8 Inf chemokine recetpor cxcr4a 16 other mad2l1 7 TLR tlr22 84 23 chemokine recetpor cxcr4b 23 10 13 other melk 3 TNF tnfa 382 21 chemokine recetpor si:dkey-269d20.3 64 other nuf2 6 TNF tnfaip8l2a 12 5 GPCR si:dkey-225n22.5 117 other nusap1 3 TNF tnfaip8l2b 32 23 15 leukocyte chemotaxin LOC793246 28 11 11 other pelo 3 TNF tnfb 48 13 other coro1a 36 22 29 other prkcda 6 10 8 TNF tnfsf11 54 other nsmaf 3 other rab11fip4b 34 10 TNF tnfsf12 14 peptidase inhibitor spint1a 13 other rad1 4 TNF tnfsf18 89 57 PI3-kinase pik3cg 6 other ska1 10 TNF receptor fas 18 8 proteinase mmp13a 38 236 other SYCE3 13 TNF receptor TNFRSF14 (3 of 12) 13 WASP wasb 13 15 28 other sycp1 30 TNF receptor traf3 7 other tipin 4 Toll-like receptor tlr1 42 lipid metabolic process other tpx2 3 Toll-like receptor tlr21 115 family Gene Name macrophage neutrophil lymphoid other zgc:162239 16 Toll-like receptor tlr4al 78 apolipoprotein apoa1a 28 12 other zgc:56493 7 Toll-like receptor tlr4bb 44 apolipoprotein APOA4 (1 of 4) 10 p53 tp53 3 Toll-like receptor tlr5a 39 apolipoprotein APOA4 (3 of 4) 21 septin sept2 3 Toll-like receptor tlr5b 36 apolipoprotein APOA4 (4 of 4) 25 septin sept6 2 apolipoprotein apoc1l 31 septin sept9b 20 apolipoprotein apoea 24 6 transcription factor e2f4 4 Rougeot_et_al.: Figure 3 bioRxiv preprint doi: https://doi.org/10.1101/554808; this version posted February 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made A available under aCC-BY-NC-NDB 4.0 International license. response to human M1 human M2 bacterium 12327 12488

BCL2L14 312 4865 431 AKAP12 cell differentiation CASP5 7032 ANO9 CXCL11 119 387 161 CSF3 macrophage GPR56 11 13 DNASE1L3 IDO1 GPD1 chemotaxis 2468 ITGAD GPR174 114 LGALS9B LPAR5 cell adhesion and differentiation LPO zf macrophage MAPK12 LTA 9780 NCCRP1 RFESD 524 P2RY12 TLR10 PARM1 metabollic SGK2 processes TMSB15B

C D genes expressed in zf macrophage ● 0.15 6 P-val = 0.194

● ● -0.15 ● ● ● ● ● ● ● ● -0.30 ● ● ● ●

● enrichment score ● ● ● ● ● ● ● ● ) ● ● ● 4 ● ● ● ● ● ●● ● ●● ● ● ● ●●● ● ● ●● LY● Z ● ● ●● ●● ● ● ●● ● ● ● ●●● ●●● ● ● ● ●● ●● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ●●●●●● ● ● ● ● ●●● ● ● ●●●● ● ● ● ● ● ●● CLEC4A ● ● ●●●●●●●●●●●● ● ●●●● ● ● ● ●●●●●● ● ● ● ● ● ● ● ●● ●●●● ●●● ● ● ● ● ● up in M1 up in M2 ●●●●●●●●●● ●● ●● ● ( P -value ● ●● ● ● ● ●●●●●●●●●● ●● ●● ●● ● ● ● ● ● ●●● ●●●●●●● ●● ●●● ●●● ●● ●●●●●●●●●●●●●●●●● ● ●●● ● ● 10 ● ●● ● ●● ● ● ●●● ●●●●●●● ●●●●●● ● ●● ● ● ●● ●●● ●●● ●●●●●●●● ●●●●● ● ●● ● ● ●●●●●●●●●●●●●●● ●●● ●● ● ● ● ● ●● ●●●●●●●●●●●●●●●● ●●●●● ● ● ● ● ●● ●●●●● ●●●●●●●●●●●●● ●●●●●●●●●●● ● ● zfM core expression ●●●●●●●●●●●●●● ● ●●●●●● ● TNF● ●●●●●●●●●●●TNFRSF1B●●●●● ● ●● ●●●●● ● ●●● ● ● ●●●●●●●●●●●●● ●● ●●●●●● ●●● ●● -log ● ● ●●● ●●●●●●●●● ●●●●● ●●●● ● ● ● ● ● ●●●●●●●●●●●●●●●●●●●●● ●●●●●●● ●●●●●● ● ● ● ●● ●●●●●●●●●●●●●● ●●●●●●●●●●● ●●●●● ●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ● ● 0.3 ● ● ●●●●●●●●●●●●●●●●●●●●● ●●●●●●●● ● ● ● ●● ● ● ●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●● ●● ● P-val = 0.281 ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ● ● IL10●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●● ●●● ● 2 ● ●●●● ●●●●●●●●●●●●●●●●●● ●●●●●●●●●●● ●●● ● ● ● ● ● ● ●●● ●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●● ● ● ● ● ●● ● 0.2 ● ●● ●●●●●●●●●●●●●●●●●MPX●●●●●●●●●●●●●●●●●●●●●●● ●●● ● ● ●●●●● ● ●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●● ●●●●● ● ●●IDO1●● ● ●●● ●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●● ● ●● ●●●● ●● ●IL6 ● ●● ●● ●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●● ● ●●● ●● ● ● ● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●● ●●●● ●● ● ●● ●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●● ●● 0.1 ● ●● ● ●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●● ●●●●●● ● ● ● MPEG1● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●●● ● ● CXCL11● ● ●● ●●●● ● ● ● ●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●● MMP9● ● ● ●● ●●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●●●● ●●●●●● ●● ● ● ● ● ●● ●●●● ●●●●●●●●●●●●●●●●●●●●●CD40●●●●●●●●●●●●●●●●●●●●●●●●●● ● ● ● 0 ● ● ●● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ● ● ● ● ●● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ● ●● ● ● ●● ●●● ●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●● ●●●●●● ●● ●● ● ● ● ●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●● ●●● ●●● ● ● ● ● ● ● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●● ● ● ● ● ●● ●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●● ●● ● ● ● ● ● ●●●●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ● ● -0.1 ● ● ● ● ●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●● ● ●●● ● ● ●●●● ●● ●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●● ● ● ● ●●●● ● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●● ● ● ● ● −log10(res$pval..t.test.equal.variance) ●● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●● ● ● ● ● ●● ●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●● ●● ● ● ● ● ● ●●●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●● ● ● ● ● ● ● -0.2 ● ● ● ●● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●● ●● ● ● ● ● ● ●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●● ●●● ● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●● ●●●●●●●●● ●●●●● 0 enrichment score

−10 −5 0 5 10 up in M1 up in M2

log2FC humanres$LOG.FC M1 VS human M2

Rougeot_et_al.: Figure 4 bioRxiv preprint doi: https://doi.org/10.1101/554808; this version posted February 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made A B transcription Mm-infected VS non-infectedavailable macrophages under aCC-BY-NC-ND 4.0 International license. NADP or NADPH activator

● betaine-homocysteine ● ●● binding

10 ● activity ●● cxcl11aa ● ● S-methyltransferase ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ●● ● ● ● ● ●● ●● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ●● mpeg1.2● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ●● ● ● ● ● ●●●● ●●● ● ● ● ● ● ● ●● ● ● ● activity ● ●● ● ● ● ●●●● ● ● ● ● ● ●● ● ● ● ●● ● ●● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ●●●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ●● ●●● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ●● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ●● ● ● ●● ●●● ● ● ● ●● ● ● ● ● ● ●●●●● ● ● ● ● ● ●●●● ● ● ● ● ● ● ●● ●● ●● ● ● ● ● cIIta ● ● ● ● ● ● ●●● ●● ●● ●● ● ●● ● ● ● ● ● ●● ● ●● ●●●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ●● ● ● ● ● ● ● ●● ●●●●● ●● ● ● ● ● ● ● ●● ● ● ●● ●●●●●●●●●●● ● ● ● ●● ●●●●● ●● ● ● ● ● ● ● ● ● ●●●●● ● ●● ● ●● ● ●● ●● ● ● ● ●● ●● ● ● ●●● ●● ●● ● ● ●● ● ● ● ● ● ● ●● ● ●● ●●●●●●● ● ●●●●● ● ● ● ● ● ●● ● ● ● ● ●●● ● ●●●● ● ● ●●● ● ●● ● ● ● ● nsfb ● ●● ● ●●●● ● ●● ● ● ● ●●●● ●●●●● ● ●● ● ● ●●● ● ● ● ● ●● ●● ● ● ●●● ● ● ● ●● ● ●● ● ● ● ● ● ●●●● ● ●●●● ● ● ● ● ●●●● ● ●● ●● ●● ● ● ● ● ●● ● ●●●● ●●●●● ●●● ●● ●●● ● ● ●●● ●●●●● ● ● ●●●● ● ● ● tnfa ● ● ● ●● ● ●● ●●●●● ●● ● ●● ●●● ● ●●● ● ●● ● ●● ● ● ● ● ●● ●● ● ●●●● ●● ●●●● ●● ●●●● ●● ●●● ●●● ● ●● ● ● ●● ● ●● ●●● ●●● ● ● ●● ●●● ● ●●●●● ●● ● ● ● ● ●●● ● ● ●●●●●●● ● ●●● ●● ● ● ● ●● ● ● ● ● ●● ● ● ●●● ●● ● ● ●● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ●●● ● ●●●● ●●●● ●● ●● ●●●●● ● ● ●● ● ●●● ●● ● ●●●● ● ● ●●● ●● ●●● ● ● ●● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●●●● ● ●●● ● ●●● ● ●●● ● ●●●●●●● ●● ●● ● ● ● ● ● ●● ●●●●●● ● ● ●● ●● ● ● ●● ●●●● ● ● ●● ● ● ● ●● ● ●●●●●●●● ●●● ● ● ● ●●●● ● ●● ●●● ●●● ●● ●● ●●● ● ●● ● ● ●●●●●● ●● ● ●●●● ● ● ● ●● ●● ● ● ● ●● ● ● ● ● ● ●●●● ● ● ●● ●● ●● ● ●●●●●●●●●●●● ● ●●● ● ●●● ● ●● ● ● ● ● ● ●● ●●●●●●● ●● ●●● ●● ●● ● ● ●●●●●● ● ●● ● ●● ●● ● ● ● ● ● ●●●●●● ●●●●● ● ●● ●● ●●● ●● ● ●●●●● ●●●●● ● ● ● ●● ●●● ● ● ● ● ● ● ●●● ●●●● ● ●● ●● ●● ● ●●● ● ●●●● ● ●●● ●● ● ● ● ● ● ● ●●●●● ●●● ●● ● ●● ●● ● ● ●●● ●● ● ●●●●● ● ●●● ● ● ●● ● ●●● ●●●●●● ●●●●●● ● ● ● ●● ● ●● ●●● ● ●●●●● ●● ● ● ● ● ● ● ● ●●●● ●●●● ● ●●● ●● ● ● ● ●●● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ●●●●● ●●● ● ● ● ●●● ●●●●● ● ●●● ●● ●● ●● ● ● ●● ● ● ● ●●● ● ●●● ● ● ●● ●● ●●● ●● ●●●● ● ● ●● ● ● ● ● ●● ● ● ● ●●●● ● ● ● ● ● ●●● ● ● ●● ●●● ●● ● ●● ● ● ● ●● ●● ● ● ● ● ● ●●●●●●● ●●●●● ● ● ● ● ●● ●●● ●●● ●●● ● ●●● ● ● ● ● ● ● ● ● ●●●● ●●● ●●● ●● ●●●●●● ●● ● ● ● ●● ● ● ● ●● ● ● ● ● ●●●●● ●●●●● ●●●● ●● ●●● ●●● ●● ● ● ●●●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●●● ●●● ●● ●●● ● ● ● ● ●●●● ●●● ●●●● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ●●●● ●●● ●● ● ● ●● ● ● ●●●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● tgfb1a ● ●●● ●● ● ●●● ●●●● ● ● ●●●● ● ● ●●● ● ●● ●●●● ●● ● ●● ● ● ● ●● ●● ● ● ● ●● ● ● ● ● ● ● ● ● ●●● ●●●● ●●● ●● ●●●●● ●●●●● ● ● ●●●● ● ● ● ● ● ●● ●● ●●● ●●● ●●● ●●●● ●● ●●● ●●●● ● ●●● ● ●●● ● ● ● ● ●● ●● ● ● ● ● ● ●● ●●●● ● ●●● ●●●● ●●●● ●●●● ● ●●●●●● ● ●● ●● ● ●●● ● ● ● ● ● ● ● 5 ● ●●●● ●●●● ●●●● ● ●●●●●● ●● ●● ● ●● ●● ● ● ● ●● ● ● ● ● ● ● ● ●● ●●● ● ● ● ●● ● ● ● ● ● ● ●● ●● ●● ● ●● ● ● ● ● ● ● ●●●● ●●●● ●●●● ●● ●● ●● ●● ●● ● ●● ●● ●●● ●● ●●● ●● ● ● ● ● ● ●● ● ●●●● ●●● ● ● ● ● ●●●● ● ●● ●● ● ●●● ● ●●● ● ● ● ● ● ● ● ● ● ●● ●●● ●●●● ● ● ●●● ● ●● ●●● ●●● ●●●● ●● ● ● ● ●●● ● ●● ●● ● ●● ●●●● ●● ●●● ● ● ●●●● ● ●●●●●● ●●●● ●●●● ●● ● ● ● ● ● ● ● ● ●● ●●● ●●●●●●●● ● ● ● ●●●●● ●●● ●● ● ●●● ● ●●●●● ● ● ● ●● ● ● ●●●● ●●●● ● ●● ● ●●● ● ●●●●●●● ● ●●●● ● ●●●● ● ● ● ● ●●●●● ● ● ● ●● ● ● ● ● ● ● ●● ●●●● ● ●●●●●● ●●●● ● ●●● ● ●●●●●●●●● ●●●● ● ● ●● ● ● ● ● ● ●● ● ● ● ●● tgfb1b ●●●●● ●● ●● ●●●●●● ● ●● ● ● ● ●● ● ●●● ● ● ● ● ●● ● ● ●●● ● ● ●●● ● ● ● ● ● ● ● ● ●●●● ●●● ●●●●●●● ● ● ●● ●●● ●●● ●●●● ●●● ●●● ●● ●● ● ●● ● ● ● ● ● ●● ● ● ● ● ●●● ●●● ●● ●●● ●●● ●●● ●●●●● ● ●● ●● ●● ●●●● ● ●●● ● ●● ●● ● ●● ● ●● ●●● ●● ●●● ● ● ●● ●●● ●●● ● ●● ● ●●●●● ● ●● ●● ●● ● ● ● ●● ●● ● ● ● ● ● ● ●● ●● ● ●●● ●●●● ●● ● ● ●●●●● ● ●●● ●● ●● ● ● ●● ●● ● ● ● ●● ● ●●● ● ●●● ●● ●●●●● ●● ● ●● ● ● ● ● ●● ●●● ●●● ● ●● ● ● ● ● ● ● ●●● ●●● ● ● ●●●● ● ●●● ●●● ● ● ● ●●● ●● ●●●●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ●● ●●●●●●● ● ● ● ●●●● ●● ● ● ●●● ● ● ●● ● ● ● ●● ● ●●● ● ● ●● ●● ● ● ● ● ● ● ●● ●●● ● ●●●●●● ● ● ●●● ●● ●● ●●● ●●● ●●● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● protein alox5a ●●●●●●●● ●●●●●●● ● ● ● ●● ● ●●● ●● ●●● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●●●● ● ● ● ●● ●●●● ● ● ●● ●●●●●● ● ● ●● ●● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ●●●● ●●● ●●●● ●●●●●● ●● ●●●● ● ●●●●● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ●●●●● ● ●●●● ●● ●●● ●●●●● ●● ● ● ●●● ● ●●●●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●●● ●●●●●●● ● ●●●● ●●● ●●● ●● ●●●●●● ●●●● ●● ●● ● ● ●●● ●● ● ● ● ● ●●●● ● ● ● ● ● ●● ●● ● ●●● ● ●● ● ●●●●● ●● ●● ● ● ●●●● ●●●●● ●●● ●●●● ● ● ● ●● ● ● ●● ● ● ●● ● ● ●●●●●● ● ●●● ●● ● ●● ● ●●●●● ●● ●●●●●● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ●●● ●● ●●●● ●● ●●● ● ● ●●●●●●●●● ●● ●● ● ● ● ● ● ●● ● ●● ●●● ● ●● ● ●● ● ● ● ● ●● ● ●● ●● ● ● ●●● ●●● ●●●● ●● ●● ● ●●● ●● ● ● ● ●● ● ● ●●● ● ● ● ● ● ● ● ● ●● ●● ● ●● ●●●●●●●●●●● ●●●●●● ●● ● ●● ●● ●●●●●●●●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●●●●●●● ●● ● ● ● ●●●●●● ● ●●●●● ● ● ● ●●●●●● ●● ●● ●● ●● ● ● ● ●● ● ● ●● ● ●● ●● ●●●●● ● ●●●●●● ● ●● ● ● ● ●●● ● ● ●● ● ● ● ● ●●● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ● ●●●●● ● ● ● ●●● ● ●● ●●● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ●●● ●●●●● ●●●● ●●● ●●● ●●●●●●● ●●● ●● ●● ●● ● ● ● ● ● ● ● ● ● ●●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●●●● ●● ●●●● ● ● ●●●●● ●●● ●● ● ● ●●● ● ● ● ●●● ● ● ● ●●● ● ● ● ● ● ● ● ●●● ●●●●●●●●●● ●●●●●●●● ●● ● ●●●●●●● ● ●●●● ●● ●●● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ● ●●●● ●●●●● ●●● ●●● ●●● ● ●● ●●●● ● ● ●●● ● ●● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ●●●● ● ● ● ●●●● ●● ● ●●●●●● ● ●●● ●●● ●●● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ●● ●● ●●● ●●● ● ● ● ● ● ●● ● ● ●●●● ●●●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●●● ● ●● ●● ● ●●●● ●●● ●● ● ● ● ●● ● ●● ● ● ● ● ●● ● ●● ● ●●● ● ●●● ● ●● ●● ● ●● ● ● ● ● ● ●● ●● ●● ● ●●●●● ● ●●● ●● ● ● ● ●● ● ● ● ● ● ●● ●●●● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ●●●● ●●●● ●●● ● ● ● ●●●●●●● ● ● ● ● ● ● ●●● ● ● ● ●● ●●● ●●● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ●●● ● ●● ●●●●●●● ● ● ● ● ● ● ● ●● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● binding ●●● ●● ●● ● ● ●●●● ●● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●●● ● ● ● ●●● ● ●●●● ●●●●● ●● ● ●● ● ●● ● ● ●● ● ● ● ●● ● ● ●● ● ● ● ● ●● ● ● ●● ●●● ● ● ● ● ● ●●●●● ●●●●●● ● ●●● ●●● ● ● ● ●●●● ● ● ● ● ●● ●●● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ●●●●● ●● ●● ●●● ● ● ●●● ● ● ●● ●●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ●●● ●●●●●● ●●●●●● ● ●● ●● ● ● ● ●●● ● ●● ●●● ● ● ●●● ● ●● ●●● ● ●●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ●● ●●● ●●●●●●● ●● ●● ●●● ● ● ● ● ●●● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● tnfb ●●●●● ● ● ● ●● ● ● ●● ● ● ●● ●● ● ● ● ● ● ● ● ● ●● ● ●●● ●●● ● ●●● ● ●● ●●●● ● ● ● ● ●●● ●●●●●● ●● ● ●● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ●● ● ●● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ●●●● ●●●● ●●●●●● ● ●● ● ● ●●●●● ● ● ●●●● ● ● ●● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ●● ● ●●●●● ● ● ●●● ●●●● ●● ●●● ●● ●● ● ●● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ●●●● ●● ● ● ●● ●●● ● ● ● ● ● ● ● ● ● ● ● ●● ●●●●● ●● ●●● ●●● ●● ● ● ● ● ●●●● ● ●●● ● ●● ●●● ●● ●● ● ●● ● ●● ●● ● ●● ● ● ●● ● ● ●●● ● ● ● ●● ● ● ● ● ●●●●● ● ● ● ●● ● ●● ● ● ● ● ●● ●● ● ●● ● ● ●● ●●● ● ●● ●●● ●● ● ● ●● ● ● il1b ● ● ● ● ●● ●● ● ● ●●● ● ● ● ●● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●●●●● ●●● ● ● ●● ● ● ●●●● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ●● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ●● ●●●●● ● ● ● ●● ●● ●●● ● ●●●● ● ● ●●● ●●● ● ● ●● ● ●●● ●● ● ● ●● ●● ●● ● ● ● ● ● ●● ● ● ● ●● ●●● ●● ●●●●● ●● ● ●● ●●● ●●●● ● ●●● ● ● ●● ●● ● ● ●● ● ●●● ●●●● ● ● ● ●● ● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ●●●● ● ● ● ● ●●●●●●● ● ● ● ●● ● ●● ● ●● ●● ●●● ●● ● ● ● ●● ●●● ● ● ●●● ● ●● ● ●● ●●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ●●● ●●●● ●● ●● ●● ●● ●● ●● ● ● ●●●●● ● ● ● ●●● ● ● ●● ●● ●●● ● ●● ● ● ●● ● ●● ● ● ● ● ●● ●● ●●● ● ● ● ● ● ● ● il10 ●●●● ●●●●●●● ●●●● ●●●●●●●●●●●● ●● ● ●● ●● ● ● ●●● ●●● ● ● ● ●● ●● ●● ●●●● ●● ●●●● ●● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ●●●●●●● ●●● ●● ●●●●●●● ● ● ●● ●●● il6● ● ● ●● ●● ● ● ●●● ● ● ● ●●●●● ● ● ● ● ● ● ●●● ● ● ●● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ●●● ● ● ● ●● ● ● ●●● ●● ●●● ● ● ●● ● ● ● ●● ●● ●● ●● ● ● ● ●● ● ● ●● ● ● ● ●●● ● ● ●● ● ●● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ●● ●●● ● ●●●● ●●●● ●● ● ● ● ●●● ● ●● ● ●●● ●●●● ● ●●● ● ●● ●●●● ● ● ● ●●● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ●●●● ●●●● ●●●●●●● ● ● ●● ●● ● ●● ● ● ● ● ●● ●● ● ●● ● ●● ●● ● ● ● ● ● ● ● ● ● ●● ●●● ●●● ●● ●● ● ●●●● ● ● ● ● ● ● ●●●● ●● ●●●●●●●●●● ●●●●●● ●●●● ●●● ● ● ●●● ● ● ●●●● ●● ●● ● ● ●●● ● ●● ● ● ●● ●● ●● ●● ● ●●● ● ● ● ●●●● ●●●●●● ● ● ●●● ● ● ● ● ● ● ●● ●●●● ●● ●● ● ●●●● ● ●●● ● ● ●● ● ● ● ● ● ● ●● ● ●● ● ●●●● ●●● ●● ● ● ● ● ●●● ●●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● mmp9 ● ●●● ● ●● ● ● ●● ● ● ● ●● ●● ●● ● ● ●●● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ●●● ●●●●● ● ●● ●●●●● ●●● ●●● ●● ● ● ● ●●●● ●● ●●●● ● ●● ●● ● ● ●● ● ● ●● ●● ● ●● ● ● ●● ● ● ●● ● ● ●●● ●● ●● ●● ● ● ●● ● ● ● ● ● ●●● ● ●● ● ●●●● ● ● ●● ●●●●● ● ● ● ● ●●●●●● ●● ●●●● ●●●● ● ● ● ●●● ● ● ●● ●● ● ● ●● ●●● ●● ●●● ● ● ● ●● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ●●●●●● ●●●● ●● ●● ●● ●● ●●●● ●● ●● ● ● ●● ●●● ●●● ● ● ● ● ● ● ●● ●●● ● ● ●● ●●● ● ●● ●● ● ● ● ●●● ● ●●●● ● ● ● ● ● ●● ●● ●●●● ● ● ●● ● ●●● ●●●● ●● ●●●● ● ● ●●●● ●● ●●● ●●●●●● ● ●●●● ● ● ● ● ●● ● ●● ● ●● ●●●● ● ●●● ●●● ● ● ●●● ● ● ●●● ● ●● ●● ●● ● ● ● ● ● ● ● ● inositol or ● ●●●●● ● ●●●● ●●●●●● ●●●● ●●● ●●● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ●● ●● ●● ● ● ● ● ●●● ● ● ●● ● ● ●● ● ● ● ● ●● ●●●●● ● ●●●● ● ● ● ● ● ●●●● ● ●●● ●●● ●●● ●●● ● ●● ● ●●● ● ●●● ●●● ●● ● ● ●● ● ●●●● ● ●●●●● ● ● ●● ● ●●● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ●●● ●●●● ●● ●● ●● ● ● ●● ●● ● ●● ● ●● ● ● ● ● ● ● ● ●● ● ●●● ● ● ●● ● ● ● ●●●● ● ● ● ● ● ●● ● ●● ● ● ● ●● ●●● ●● ●●●● ●● ● ● ● ●● ● ● ● ● ● ●● ●●●●●● ●● ●●●● ●● ●● ● ● ●●● ● ●● ● ● ●●●●●● ●● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ● ●● ● ●● ● ●● ● ●● ● ●● ●●● ● ●●●● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ●● ●● ●●●● ●●●● ●● ●● ●●●●● ●● ● ● ● ● ● ●● ●●● ● ● ●● ● ● ● ● ●●●●●● ● ●● ● ●● ●●●● ● ● ● ●● ●●●●●● ●● ● ●● ● ●● ● ●●● ● ● ● ● ● ● ● ● ●●● ●●●●●● ● ●●● ● ● ● ●● ●● ●●●●● ●●● ● ● ●● ● ● ● ● ●●●●●● ●● ●● ● ●● ●●●● ●●● ●●●●● ● ● ●●● ● ●●● ● ● ● ● ●● ● ● ● ●● ● ● ● ●● ●● ●● ●● ●● ●● ● ●● ● ●●●● ● ● ● ●●● ● ●● ● ● ● ● ● ●● ● ● ●● ● ● ●● ● ●● ●● ● ● ●●● ●●●●● ● ● ● ● ●● ● ● ●●●●●●● ●● ●● ●● ● ●● ● ● ●●●●● ●● ● ● ●● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●●●● ●●● ●●●●● ●●●● ● ● ●● ● ●●●● ● ●●● ●● ● ● ● ● ● ● ● ●● ●●●● ●●●●● ● ● ●●● ● ● ●● ●●● ●●● ● ●● ● ●● ●● ●● ● ●●●●●●● ●●●● ● ●●● ● ●●●●●● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ●●● ●● ●●●● ● ● ●●● ● ●● ● ● ● ● ● ●● ● ●● ●●● ●●● ● ●●●●● ●●● ● ● ●●● ●●● ●●● ●●● ●● ● ● ●● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ido1 ●●● ●●●●● ● ●● ●●●● ● ● ●●●●●● ● ●●●●●● ●● ● ●● ● ●●● ● ●●● ●● ● ● ● ●●● ● ● ● ● ● ●● ●● ● ●● ● ● ● ●● ●●●●● ●● ● ●●● ●● ● ● ● ● ● ●●● ● ● ● ● ● ● ●●●● ● ●● ● ● ●● ● ●●●● ● ●● ●●● ● ● ● ●●● ●● ● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ●● ● ●● ● ●● ●● ● ● ●● ●● ● ● ●● ● ●●●● ●●●●● ● ●● ● ●● ● ● ● ●● ● ●● ●● ● ● ● ● ●●●● ● ● ●● ● ● ● ● ● ●● ● ● ● ●● ●● ● ●●● ●● ●●●●●●● ● ●● ●●● ●● ● ● ●● ● ●●● ●● ● ● ● ●● ●● ● ● ●●● ● ● ●● ● ●●● ● ● ● ● ●● ● ● ● ●●●●●● ● ●● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ●●● ● ● ● ● ●● ● ●● ●● ● ● ● ●● ●● ● ●●● ● ● ● ● ● ●● ●● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ●●● ● ● ●● ●●●●●●● ● ● ● ● ●●●● ● ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ●● ●● ● ● ●●●●●●●●●●●●● ● ● ●●● ●● ● ● ● ● ●●●● ● ●● ● ● ● ● ● ● ● ● ● ● ●●●●●●●●●●●● ●● ● ●● ●● ●● ●●● ●● ●● ●● ● ● ● ●● ●● ●●●● ● ● ●●● ●●● ● ●● ● ●● ●●●●●●● ●● ● ● ● ● ● ● ●● ● ● ●● ●● ● ● ●● ●●● ●● ● ● ● ●●● ● ● ●● ● ● ● ●● ● ● ● ● ●● ●●●●●● ●●●●● ●● ●● ● ●●●●● ●● ● ●●● ●●●●● ● ● ●● ● ● ●● ● ●● ●● ● ● ● ● ● ●● ● ● ●● ● ● ● ●● ●●● ● ●●● ●● ● ●●● ● ● ●●●● ●● ● ●● ● ● ● ● ● ● ● ● ● ●● ●● ●●●●● ●●● ●●● ●● ●● ● ●● ●● ● ● ●●●● ●ccr2●●●● ● ● ●● ● ●●● ● ● ● ● ●● ● ●● ●● ● ●● ●● ● ● ●● ● ●●●● ● ●● ●●● ● ●●●●● ● ●●● ● ● ● ●●●● ●● ● ● ● ●● ●● ● ● ● ● 0 ●●● ●●●● ●●● ●●●● ● ●● ●● ● ● ● ●● ●● ● ● ● ● ●● ●● ●● ● ● ● ●●● ●●●●● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ●●● ● ● ● ●● ●●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●●●●● ● ● ● ● ● ● ● ● ● ● ●● ● ●●● ● ● ● ● ● ● ● ●●●● ●● ●● ● ● ● ●● ● ● ●●●●●●● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●●●●● ● ●●● ● ● ● ●● ●● ● ● ●● ● ● ● ● ● ● ●● ● ●●● ● ●● ●●●● ●●●●●●●● ● ● ● ● ● ● ● ●● ●●●●● ●● ●● ● ● ●●● ● ●●●● ●● ● ●● ●● ● ● ●● ● ● ● ● ● ● ●● ●●● ● ●●● ●●● ●● ●●●●● ● ●● ● ● ● ● ● ● ● ● ●●● ●● ● ● ● ● ● ● ●●●● ● ●●●● ●● ● ● ● ●● ● ●●●● ● ● ● ● ● ●● ● ● ● ●● ●● ● ● ● ●● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ●● ●● ● ●●●●●●● ●● ●● ● ● ● ● ● ● ● ● ● ● ●● ●● ●●● ●● ● ● ● ● ● ● ●●●●● ● ● ● ● ●●●●● ●●● ●● ● ●● ● ●● ●● ● ● ●● ●● ● ● ● ● ● ●●● ● ● ● ●●● ● ●●●●● ●● ●● ●●● ● ● ●● ●● ●●● ●●● ●● ●●● ● ● ●●● ●●●● ●● ● ● ● ● ●● ● ●● ● ● ● ● ● ●● ●●● ●● ●● ● ●● ● ● ● ● ● ●●● ● ●●● ●●●●●●● ● ● ● ● ● ●● ●● ● ●● ● ●● ●● ● ● ● ●●● ●●●●● ●●● ● ●●● ●● ●●●● ● ●● ● ● ●● ● ●● ●● ● ● ● ●●● ●● ●● ●● ● ● ● ●● ● ● ● ● ●● ● ●● ● ● ● ● ●● ●● ●● ●●● ● ● ● ● ● ● ●● ● ● ● ● phosphatidylinositol ● ● ● ● ● ● ● ● ●● ● ●●● ● ● ● ● ● ● ● ● ● ●●● ●●●●● ●●● ● ● ●●● ● ●●● ● ●● ● ●● ●● ● ●● ● ●● ● ●● ●●● ● ● ●● ● ● ●●●●● ● ● ● ● ●●● ● ●● ● ● ● ●●●● ●●●●● ● ●●● ● ● ●●● ● ● ● ●●● ●● ● ● ● ● ● ● ● ●● ● ● ●●● ● ●●●●●● ●●● ●● ●● ● ●● ●●● ● ● ● ●●● ●● ●● ● ● ● ● ●● ● ● ● ● ● ●●●● ● ●●●● ●●● ● ● ●● ●●●● ●●● ● mrc1b●● ● ● ●● ●● ● ● ● ●● ●● ● ●●● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●●● ●●●●●●●●● ●●●●●●● ●● ●● ●●● ●●●●●● ● ● ● ● ● ● ● ● ● ● ● ● ●●●●● ●● ● ● ●● ●●● ●● ● ●● ● ●● ●● ●●●● ● ●● ● ● ●● ●●● ● ●●● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ●● ●●● ●●● ●● ● ●●●● ● ● ●● ● ● ●● ● ● ● ●●● ● ● ●● ● ●●●● ● ●● ● ● ●● ● ●● ●● ● ● ●●●● ●● ●●● ● ●●● ● ●● ● ● ●● ●●●●●●●● ●●● ● ● ●● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ●●●●● ●●● ● ● ● ●● ●●●●● ● ● ● ●●●● ●● ● ●●● ●● ● ● ● ● ● ● ●● ●●● ●● ●●● ● ● ● ● ●● ● ● ●● ●●● ● ●●● ● ●● ●● ● ●●●●●● ● ●●● ● ● ● ●● ●●● ● ● ● ●● ● ● ● ● ● ●●● ● ● ● ● ●● ● ● ●●● ●● ● ● ● ● ●● ●●●● ● ●●●●●●●● ● ●●● ● ● ●● ●● ● ● ●● ●● ● ● ● ●●●● ● ● ●● ● ● ●●● ●● ●●●●● ● ●● ● ● ●●● ● ● ●●●● ● ●● ● ● ●●● ● ●●●●● ● ●●● ●●●●● ● ● ● ● ●● ● ● ● ● ● ●● ● ●● ● ●● ●●● ●●● ● ●●● ●● ● ●●●● ● ● ●● ●● ●● ● ● ●● ● ● ●● ● ● ● ● ●● ● ●●● ● ● ● ● ●●●●●● ● ●● ●●●●● ●● ●● ●●●●●●●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ●● ●● ●●● ●●●● ●● ● ● ●● ●●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ●● ● ● ●● ●●●● ●●●●●● ●●●● ●●●●● ●● ● ● ●●●● ● ●●●●●● ● ● ●●● ●● ● ● ●●●● ● ●● ●● ● ● ● ● ●●● ● ●● ● ●● ● ● ● ● ●● ●● ●● ●●●● ●●● ● ● ● ● ● ●●● ● ● ● ●●● ● ● ● ●● ● ● ●● ● ●●●● ●● ● ● ● ● ● ● ●●●● ● ● ●● ●● ●● ●●● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ●●● ●●●●● ●● ●●●●●● ●● ●● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ●● ●●●●● ● ●●● ● ● ●●● ●● ● ●●●●●● ●●●● ●●●● ●● ●● ● ● ● ●●● ●● ● ● ● ● ●● ●● ● ● ● ● ● ●●●● ●●●●●●●● ●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●●●● ●● ● ● ● ● ● ●●● ●●●● ●●● ● ●● ● ● ●●● ●●● ● ● ● ●● ● ●● ●●● ●● ●● ●● ●● ● ● ● ● ● ● ● ● ●●● ● ●● ●●●●● ●●● ●● ● ●●● ● ● ● ●●●●● ●●● ●● ●●● ●● ● ●●● ●● ●● ●● ●● ●● ● ● ● ● ●● ●● ● ● ●● ● ●● ● ● ● ●● ●● ●● ●● ●● ●● ● ● ● ●● ● ● ● ● ● ● ●●●●●●● ● ●●● ●● ● ●●● ●● ● ● ● ●●● ● ●● ●●●● ● ●● ● ● ● ●●● ● ● ● ●● ● ● ●● ●●● ●● ●●●●●●●● ●●●●● ● ●● ● ● ●● ● ● ●●● ●●● ● ● ●● ● ● ● ● ●● ● ● ●● ●● ●●●● ● ● ●● ●●● ● ●● ● ● ●●● ● ●●● ● ● ●●● ● ● ●● ●●● ●● ●●● ● ●● ●● ● ●● ● ● ● ●● ● ● ●● ● ● ● ●● ● ●● ●● ●● ● ● ● ● ● ●● ● ●● ●● ●● ● ●● ●● ●● ●● ●●● ● ● ● ● ● ● ● ● ●●● ● ● ● ●● ● ●● ●●●● ● ● ●●●● ● ●● ●●●●● ● ●●●● ● ● ● ● ● ●●● ● ● ● ● ● ● ●●● ● ● ● ● ● fold change ● ●● ● ● marco● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ●● ●● ●● ●●● ● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ●●● ● ● ● ●● ● ●● ●●● ●●●● ●●● ● ● ● ● ● ●● ●● ● ●●● ●●● ●●●●●●● ●● ● ●● ● ● ● ●●● ● ● ●● ● ● ● ● ●● ●●● ● ●●● ● ● ●●● ●● ● ●●● ●● ● ● ●● ● ● ●● ● ●● ●● ●● ● ● ● ● ● ● ●●●●●●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ● ●● ●● ● ● ● ●●● ● ●●●●●● ●●●●●● ●●●● ● ● ●●●●● ● ●● ● ●● ●●● ● ●● ● ● ● ●●● ● ●● ●●● ●● ● ● ●●● ● ● ● ● ● ●● ●●● ● ● ● ●● ● ● ● ● ●●● ● ●●● ● ●● ● ● ● ●● ●● ● ●● ● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ●●●●●● ● ● ● ● ●● ● ●● ● ● ●● ● ● ● ●● ●●● ● ●● ●●●●●● ● ●● ● ● ●●● ● ● ● ●●●●● ● ● ● ●●● ● ●●● ● ●● ●● ● ● ● ●●●●●● ● ● ●● ●● ● ● ●● ● ● ●● ●● ● ● ● ●● ● ●●● ● ●●● ● ● ● ●●●● ●●●● ● ●●●●● ●● ●● ● ●● ●● ● ● ● ●● ● 2 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ●●●●●● ●●●●● ● ● ●● ● ● ●● ● ●● ● ● ●● ● ●● ●● ● ● ● ● ●● ●● ●●● ● ●● ● ● ●● ●● ● ● ●●● ● ●● kinase activity ● ● ●● ● ● ● ● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ●●●● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ● cxcr4b ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●●●●●●● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ●● ●● ●● ● ● ●● ● ●●●●●● ●●● ●● ●●●●●●●●● ● ●● ●● ●●● ● ● ● ● ●● ● ●● ● ● ●● ●● ●● ● ● ● ● ● ● ●●● ● ●● ● ● ● ● ●●● ●● ●●● ● ● ●●● ●●● ●● ● ● ● ●● ● ● ● ● ●● ● ● ●● ● ● ●● ●●●●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ●●● ● ● ● ●● ●●●●●● ●● ●●● ●● ●●● ● ● ● ● ● ● ● ● ● ● ●●●●● ●●●● ● ●● ● ● ● ● ●● ● ● ●● ● ●●● ●●● ● ● ● ● ●● ●●●● ● ● ● ●● ● ● ● ● ● ●●● ● ●●●● ● ● ●● ●● ● ●●● ●●● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●● ●● ●● ● ● ● ● ● ● ● ● ●● ● ●●●● ●● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ●●● ●● ● ● ● ●● ● ● ● ● ●●● ●● ● ●●● ● ● ● ●●● ●●● ●● ● ● ● ●● ●●● ●● ● ● ●●● ● ● ● ● ● ●●● ● ● ● ● ●● ● ● ● ● ● ● ●●● ● ●● ●●● ● ● ●●● ●●● ● ● ● ●● ● ● ●● ● ●●● ● ●●● ● ●● ● ●● ● ●●●● ● ●●● ● ●●● ● ●● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ●● ●●● ●● ● ●● ●●●●● ● ●● ● ● ● ● ●●● ● ● ● ● ● ● ●●● ●● ●● ● ● ●●● ● ●● ● ● ● ● ●● ● ● ● ● ●●● ● ● ● ● ●● ● ● ●●●●● ●●●● ●●● ● ●●●● ●●●● ● ● ● ●●● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ●●● ● ●● ● ● ● ● ● ●● ● ● ● ●●●● ● ● ● ● ● ● ● ● ● ●● ●●● ● ●● ●● ● ● ●● ●● ● ● ●●● ● ● ●●●● ●● ● ● ●● ● ● ●●●● ●● ●● ● ● ●● ● ● ● ● ● ● ●● ● ● ●● ●● ●● ●●●●● ● ● ●●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ●● ● ● ●● ● ● ● ●●● ● ●● ●● ● ● ●●● ● ● ●● ● ● ● ●●●●●● ● ●● ●● ● ● ● ● ● ● ● ● ● ●●● ●● ●●● ●● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ●● ● ● ●● ●● ● ● ●● ●● ● ●● ● ●● ●● ●● ● ● ● ● ●● ● ● ● ●● ● ● ● ● ● ●● ● ● ● ●● ●●● ● ●● ● ● ● ● ●● ● ● ●●● ● ● ● ●●●● ● ● ●● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●●● ● ● ● ● ● ● ●●●● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ●● ●● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ●●●● ● ● ●● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ●● ● ●● ●● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ●● ●● ●● ● ● ● ● ● ● ● ● ● ●● ●●●● ●● ● ● ●● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ●● ●● ●● ● ● ● ● ● ● ● ● ● ● ●● ●●●●● ●●● ● ● ● ● ● ● ● ●●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●●●● ●●● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ●●●● ●● ● ● ● ● ● ● ● log ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ●●● ● ● ●●● ● ● ● ● ●● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ●●● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ●●●●● ● ●● ● ● ● ● ● ● ● ● ● ●●● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ●●●●●●● ●● ● ●● ● ● ● ●● ● ● ● ● ● ●●● ● ●● ●● ● ● ●● ● ● ● ●● ●●●● ● ● ● ● ●● ●● ●● ● ● ● ● ● ● ●● ● ● ●● ● ●● ●● ● ●●●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ● ● ●● ● ●●● ●● ●●●● ●●● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ●● ● ● ● ●●● ● ●● ●●● ● ● ●● ● ● ● ● ● ● ● ●●● ● ●● ● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●●● ● ●●● ● ●● ●●●●● ● ● ● ●● ●● ●● ●● ● ● ●● ● ●● ● ● ● ●●● ● ● ● ● ● ● ●● ●● ●●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●●● ●●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ● ●●● ● ● ● ●● ● ● ● ● ● ●●● ●● ● ●● ● ● ● ● ● ●● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ● ● ● ● (res$log2FoldChange) ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ●●●● ● ●● ● ● ● ● ● ● ● ● ●● ●●● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●●● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●● ● ● ●● ● ● ● ● ● ● ● ●●● ● ● ● ● ●●●●●● ● ● ●● ●● ● ●● ● ●● ● ● ●●●● ● ● ● ● ●● ● ● ● ● ●● ● ● ●● ● ● ● ● ● ●●●● ● ●● ● ● ● ● ● ●● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ●●● ●●● ● ● ● ●● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ●● ●● ●● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ●●● ● ● ● ●● ● ● ● ● ● ● ●●● ● ● ● ● ●● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● −5 ● ●●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ●● ●● ● ●● ●● ● ● ●● ● ●●●● ● ●● ● ●● ●●●● ● ●● ● ● ● ●●●● ●●●● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●●●●● ● ● ●● ● ● ●● ● ● ● ●● ●● ● ●●●● ● ●● ●● ● ● ●● ● ● ● ● ●● ●●●● ● ● ● ● ● ● ●● ● ●● ● ● ● ● ●●● ● ●●● ● ● ● ●● ●● ● ● ●● ● ● ● ● ● ● ●● ●●●● ●● ● ● ● ● ● ●● ● ● ● ●● ●● ● ● ●●● ● ● ● ● ●● ● ● ● ●●● ● ● ● ●● ●●●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ●● ●●●● ●● ●● ●●●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ●● ●●●● ●● ● ● ●●● ● ● ● ● ● ● ●●●●● ●● ●● ● ●● ●● ● ● ● ● ●● ●● ● ● ● ●● ● ● ●●● ● ● ● ● ● ●●●●● ● ●● ● ● ● ●●● ● ● ● ●● ● ● ●● ● ● ●● ●●●● ●●● ● ● ●● ●● ● ●●●● ● ● ● ●● ●●● ● ●● ● ● ● ● ● ● ● ●● ● ● ●●●● ● ● ● ●● ● ●●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ●● ● ●●●●● ●● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● serine hydrolase ● ● ● ● ●●●● ●●● ● ● ● ● ● ● ●● ● ● ● ● ●●● ● ●●● ● ● ● ●●● ● ● ● ● ●●● ● ● ●● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●●●●● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ●●●●● ● ● ● ●●● ● ● ● ● ●● ● ●● ●●●● ●●● ●● ● ● ●●● ● ● ● ● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ●● ● ●● ● ●●● ● ● ● ●●● ● ● ●● ● ●●●●● ● ● ● ●● ● ● ● ●●● ● ●●● ●● ●● ● ● ●● ●● ● ●● ● ●● ● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ● ●●● ●●● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ● ●● ●●●● ● ● ● ● ● ●● ● ● ● activity ● ●●● ● ● ● ● ●●● ● ●● ● ●●● ● ● ● ● ● ● ● ●● ● ●●● ● ● ● ●● ● ● ● ● ●● ●●● ●● ●●●● ● ●● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ● ● ● ● ● ●● ● ● ● ●● ● ● ● ●● ● ●●● ● ● ●● ● ● ● ●●●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● −10 D Genes upregulated in 0 2 4 infected macrophages log Mean of normalized counts 10 res$log10BM 0.2 P-val = 0.113 0.1 C 0 Mm-infected VS non-infected macrophages -0.1 ● -0.2 6 -0.3 enrichment score

● ●

● ● ● ● ● ● ● ● up in M1 up in M2 ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ● ● ● ●● 4 ● ● ● ● ● ● ● ●● ● ● Genes downregulated in ● ● ● ● ● ● ● ● ● ●● ●● ● ● ●● ● ● ● ●●● ●●● ● ● ● ●● ● ● ● ●● ●● ●● ● ● ● ●●● ● ● ● ●● ● infected macrophages ● ● ● ●●●●● ● ● ● ●● ●● ● ● ● ●●● ● ●●●● ● ●● ● ● ● ● ●●● ●●●●●●●●●● ● ● ●● ● ● ● padj ● ●●●●●●●●● ● ●● ● ● ● ●● ●●●●●●● ●● ● ● ● ● ● ● ● ●●●●●●●●●●●●● ● ●● ● ● ● ●● ● ● ● ● ●●●●●●●●●●● ● ●●●● ● ● ● ● ● 0.1 10 ● ● ●●●●●● ●● ● ● ● ● ●● ●●●●●●●●●●●●● ● ●●●● ● ● ● ● ●●● ●●●●●●●● ●●●● ●● ● ●● P-val < 0.001 ● ●● ●● ●●● ●●●●● ●● ●●● ●●●● TNF● ●● ● ●●●●● ●●●●●●●●●● ●● ● ● ● ● ● ● ● ●●●●●●●●●●●●●●●●● ●●●● ●● ● ● ● ● ● ●●●● ●●●●●●●●●●●●● ●●●●●● ●● ● ● ● ● ●● ●●●●●●●●●●●●●●●● ●●● ●●●●●●●●●●●●● ● ● 0 ● ●●●●●●●●●●●●● ●● ●●●● ● ●●● ● ● ●●●●●●●●●●●●●●●●● ●●●●●●● ●●● ● ● ● ● ●●● ●●●●●●●●●●●●●●● ●●●●●●●● ●●● ●● ● ● -log ●●●●●●●● ●●●●● ● ● ● ● ● ●●● ●●●●● ●●●●●●●●●●●●●●●●● ● ●●●●●● ●●●●●●● ● ● ● ● ● ●●●●●●●●●●●●●●● ●●●●●● ●●●●●●●●● ●●●● ● ●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●● ●● ● ● ●● ● ●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●● ●●● ● ● ● ●● ● ● ●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●● ●● ● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●● ●● ● ● -0.1 2 ●●CIITA●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●● ●●●●●●● ●●● ● ● ● ● ●●● ●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●● ● ●● ● ●●● ● ● ●●●●●●●●●●●●●●●●●●●●●● ● ●●●●●●●●●●●● ● ● ● ● ● ●● ● ●● ●● ●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●●● ●● ● ●● ● ●● ●●●●● ●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●● ●●●● ● ● MPEG1● ●●● ● ●●●●●●●●●● ●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●● ● ●●● ●● ● ● ● ● CXCL11 ●● ● ● ●●●●● ●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●● ● ● ● ● ● ● ● ● ● ● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●● ●●●● ● -0.2 ● ● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●●●●●● ● ● ● ● ● ●● ●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●● ●●●● ●● ● ● ● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●●●●●●●● ● ● ● ● ●● ● ●●● ● ●● ● ●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●● ● ● ● ●● ●●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●● ● ● ● ● ● ● ●● ● ●●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●● ●●● ●●●●●● ● ● ● ● ●● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●● ● ● ● ● ● ● ● ● ●●●●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●● ● ●● ● -0.3 ● ● ●● ● ●●● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●ALOX5AP●●●●●● ●●●● ●● ●●● ●● ● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●● ●●● ● ● ● ● ● ● ● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ● ● ● ● ● ● ● ●●●●●● ●●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●● ● ● ● ● ● ● ● ● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ● ●● ● ● ● ● ● ● ●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●● ● ●● ● ● ● ●●●● ●●● ●● ●●●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●NSF●●●● ●● ●● ● ● ● ●●●● ● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●● ●● ● ● ● ● enrichment score −log10(res$pval..t.test.equal.variance) ●● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●● ● ● ● ● ● ● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●● ●●● ● ● ● ● ● ●●●● ●●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●● ● ● ● ● ● ● ● ● ● ●● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●● ●● ● ● ● ● ● ●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●● ●● ● ● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ● ● ● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●●●●●●●●●●●●● ●● ●●●●●●●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●●●●●●●●● ●●●●●●●●●●●● 0 ●●●●●●● up in M1 up in M2 −10 −5 0 5 10 logres$LOG.FC. fold change E 2 Gene name zfMcore expression infected macrophages il1b yes 0.86 tnfa yes 5.64 tnfb yes 1.18

M1 M1 marker il6 yes 0.40 tgfb1a no 4.07 cxcr4b yes -2.88 il10 yes 0.48

M2 M2 marker ccr2 yes -1.13

Rougeot_et_al.: Figure 5 bioRxiv preprint doi: https://doi.org/10.1101/554808; this version posted February 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

A B Fold change Fold Fold change Fold

C D Fold change Fold Rel. % % MmRel. burden infection

myd88+/+myd88+/+200 200 CFU CFU

myd88-/-myd88-/- 200 200 CFU CFU

myd88-/-myd88-/- 100 100 CFU CFU

Rougeot_et_al.: Figure 6