Telomerase Reverse Transcriptase Promoter Regulation During Myogenic Differentiation of Human RD Rhabdomyosarcoma Cells

Vol. 1, 739–746, August 2003 Molecular Cancer Research 739

Hongwen Ma,1 Virginia Urquidi,2 Jeremy Wong,1 Jeanine Kleeman,1 and Steve Goodison2

1UCSD Cancer Center and 2Department of Pathology, University of California, San Diego, La Jolla, CA

Abstract restore telomere length, a process that can be achieved by the During terminal differentiation of human and murine activity of the enzyme telomerase (2). Accordingly, while cells, telomerase activity and parallel transcription of most adult human somatic cells lack detectable telomerase, telomerase reverse transcriptase (hTERT) are inhibited. germline cells, stem cells, and most tumor cells thus far tested In this study, we used in vitro and in vivo analyses to exhibit telomerase expression (3, 4). The human telomerase determine the role of hTERT promoter elements and holoenzyme is a RNA-dependent DNA polymerase compris- associated factors during differentiation-induced ing three major components: a RNA component (hTR) that inhibition of telomerase expression in RD, a human provides the template for complementary telomere synthesis, a rhabdomyosarcoma cell line. Assay of telomerase telomerase-associated protein (TP1) that coordinates the enzyme activity, hTERT mRNA, and reporter gene assembly of the complex, and the telomerase reverse assays confirmed that the hTERT promoter was transcriptase (hTERT) (5). Cells with undetectable telomerase silenced during 12-O-tetradecanoylphorbol-13-acetate- activity most often also lack hTERT mRNA, although the induced myogenic differentiation of telomerase- presence of hTR and the telomerase-associated proteins positive RD cells. Promoter deletion and mutation remains (6). Furthermore, ectopic expression of hTERT is analyses revealed that two E-boxes and an AP-2 site sufficient to immortalize some cell types (7, 8), indicating that present in a 320-bp region of the promoter were hTERT expression is the limiting factor for telomerase essential for the transcriptional activity of the hTERT activation and that induction of hTERT transcription is a gene. Electrophoretic mobility shift assays identified key regulatory mechanism in the extension of cellular several factors that interact with this region of DNA, replicative life span. including the muscle-specific transcription factors Telomerase activity is detectable in early gestational age Myf5, Myf6, and myogenin and the ubiquitously human embryonic cells, but enzyme activity and hTERT mRNA expressed factors Sp1 and AP-2. Ectopic expression of are concomitantly down-regulated in most cell types, as the fetus the E-box binding factors c-Myc and Mad did influence develops beyond 21 weeks (9, 10). Telomerase activity and promoter activity in these cells; indeed, the presence parallel hTERT transcription are also inhibited during terminal of endogenous c-Myc protein was altered after differentiation of human and murine immortalized cells (11, 12). differentiation. Our findings suggest that the acute Recent studies have identified the E-box sequences present in the regulation of hTERT transcription is primarily proximal promoter region as being directly involved in this controlled by E-box elements, which bind a series of regulation (13, 14), and a role for a Myc/Mad molecular switch factors during the phased phenotypic changes for hTERT regulation in differentiation has been proposed (13). occurring during the differentiation of RD human However, several other HLH/LZ proteins are known to bind muscle cells. E-boxes and to be capable of transactivation from the same element (15). The complex interactions between family members and between cis-acting elements are not yet fully Introduction understood and depend on the cellular context. Progressive telomere erosion has been proposed to be a In this study, we used in vitro and in vivo analyses to limiting factor in replicative capacity and to elicit a signal for determine the role of hTERT promoter elements and associated the onset of cellular senescence (1). For human cells to factors in the differentiation-induced inhibition of telomerase proliferate beyond this senescent checkpoint, they need to expression in RD, a human rhabdomyosarcoma cell line. Reporter gene assays revealed that two E-boxes present in a 320-bp region (320 bp upstream of the translational ATG site, Received 3/24/03; revised 5/11/03; accepted 6/11/03. designated +1) of the hTERT gene were involved in the The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in regulation of promoter activity in telomerase-positive RD. We accordance with 18 U.S.C. Section 1734 solely to indicate this fact. show that ectopic expression of c-Myc and Mad could influence Grant support: Sidney Kimmel Foundation (S.G., Sidney Kimmel Scholar promoter activity in these cells. However, the overall regulation Award), California Cancer Research Program grant 570V-10189 (V.U.), and intramural support funds from the UCSD Cancer Center. appears to be more complex than just a c-Myc/Mad Requests for reprints: Steve Goodison, UCSD Cancer Center, 9500 Gilman antagonism, with a number of other E-factors and unrelated Drive, La Jolla, CA 92093-0064. Phone: (858) 822-2083; Fax: (858) 822-1111. E-mail: [email protected] transcription factors being involved in the control of hTERT Copyright D 2003 American Association for Cancer Research. transcription in these human muscle cells.

Results not after differentiation (Fig. 1A). Conversely, myogenin, a Telomerase Activity Is Regulated During RD factor expressed in growth arrested myoblasts, although down- Cell Differentiation regulated, remained expressed during RD differentiation. The RD cells were induced to differentiate by incubation with presence and absence of these factors is as expected during 12-O-tetradecanoylphorbol-13-acetate (TPA). Marked changes progression to myogenic differentiation (19). The ubiquitously in morphology were observed, with an increasing population of expressed factors USF-1 and USF-2 were present before and elongated and multinucleated cells appearing, as described after differentiation of RD cells (Fig. 1A), as was the generally previously (16, 17). Proliferation was progressively inhibited, repressive factor Mad, whereas levels of the oncogene c-Myc as these myofiber-like structures became the majority popula- appeared to be down-regulated during differentiation. None of tion after 5–7 days of TPA treatment. Differentiation status was the transcription factors monitored were up-regulated during also monitored via the expression of muscle myosin heavy RD differentiation. chain protein (Fig. 1A), an indicator of muscle cell differentiation (16). The presence of telomerase activity was analyzed hTERT Promoter Regulation During Differentiation before and after differentiation using the telomere repeat A PCR product containing 989 bp (nucleotides [nt] +1 to amplification protocol (TRAP) (18). RD cells, being derived À989) was derived from a human genomic DNA template, from a human rhabdomyosarcoma, were, as expected, found to sequenced, and cloned into a luciferase reporter gene vector. The be telomerase positive in proliferative culture. Both telomerase PCR-derived sequence was essentially the same as those activity and hTERT transcription were repressed when RD cells previously reported (20, 21). RD cells were transiently trans- were differentiated (Fig. 1, B and C). fected with a series of unidirectionally 5V-deleted and specific motif-deleted hTERT promoter reporter gene constructs Transcription Factor Expression During Differentiation (Fig. 2A). The ‘‘full-length’’ promoter (p989) exhibited Differentiation of RD cells was associated with the regulated transcriptional activity in RD cells (Fig. 3), paralleling the expression of a number of transcription factors that are capable observed telomerase activity measured by the TRAP assay of interacting with elements present in the hTERT promoter. (Fig. 1). In undifferentiated RD cells, deletion of the promoter The muscle-specific protein MyoD was expressed before but from À989 to À820 (p820) had no significant effect on activity. However, promoter deletion to À620 (p620) resulted in increased reporter activity (Fig. 3), implying that there is a ‘‘silencing’’ element between positions À820 and À620. A ‘‘core’’ promoter construct deleted to 320 bp (p320) contained all the necessary elements (22–24) for transcriptional activity in RD cells. Two E-box elements (CACGTG) are contained within the 320-bp core promoter, one at positions À242 to À237 (E1) and one at positions À34 to À29 (E2) (Fig. 2A). Evaluation of the promoter activity of p620 constructs with either individual E-box (E1 or E2) or both E-boxes (E1E2) deleted revealed that either E-box alone could support promoter activity in RD cells (Fig. 3), but deletion of both E-boxes significantly reduced transcription. As expected, overall activity of all constructs was reduced to very low levels in differentiated RD cells, with promoter activity being reduced f10-fold. However, the role of the E-boxes in promoter activity was markedly altered in the differentiated state. Neither single nor double E-box deletions had any effect in differentiated RD cells, suggesting that the loss of a positive mechanism for hTERT transcription had occurred at this stage (i.e., the necessary factor(s) for positive E-box-mediated regulation was no longer present) rather than a switch to the presence of an overriding negative factor.

FIGURE 1. A. Transcription factor expression during RD cell differentiation. RD cells were cultured in differentiation medium (F100 nM TPA) for Transcription Factor Binding Profiles During 7 days as described in ‘‘Materials and Methods.’’ Five micrograms of Differentiation of RD Cells nuclear extracts were analyzed by immunoblotting for the detection of the Electrophoretic mobility shift assays (EMSA) were per- muscle-specific (Myosin, MyoD, and Myogenin) and E-box binding (USF- 1, USF-2, Myc, and Mad) transcription factors. B. Telomerase activity is formed using the hTERT core promoter (À320 to +1) and RD inhibited during RD cell differentiation. Cellular extracts containing 0.6-Ag nuclear protein extracts obtained before and after muscle cell protein were analyzed for telomerase activity using the TRAPeze detection kit. Telomerase activity produces a 6-bp ladder of amplification products differentiation. The 320-bp region was divided into five (upper panel). No lysate (NL) and HeLa cell lysate (HeLa) reactions fragments by synthesizing overlapping double-stranded oligo- served as negative and positive controls, respectively. C. RNA was nucleotides (Fig. 2B). The first lane (unlabeled) of each panel in isolated from the same cells and subjected to nested reverse transcription- PCR designed to detect human hTERT mRNA (lower panel) as described Fig. 4 displays the complexes revealed after incubation of the in ‘‘Materials and Methods.’’ DNA fragment with nuclear protein extracts prepared from RD

FIGURE 2. A. Schematic representation of the hTERT promoter sequences contained in luciferase reporter constructs. Unidirectional deletion of the promoter to 820, 620, and 320 bp upstream of the translational start site was achieved using PCR as described in ‘‘Materials and Methods.’’ Single and double deletion of E-boxes (E1 and E2) are represented in the p620 constructs. B. Design of overlapping DNA fragments (1–5) used in EMSA, and the relative position of consensus motifs for transcription factor binding sites in the hTERT promoter. The transcriptional start site is indicated by an arrow, and the translational start site (ATG codon at position +1) is shown in bold. The E-boxes (E1 and E2) are shown, and the Sp1 and AP-2 sites, which were mutated for functional analyses, are indicated by asterisks. cells before (Undiff.) and after differentiation (Diff.). Fragment À127 to TT resulted in the loss of AP-2 binding, so this 1 (containing the E-box E2) exhibited several band shifts mutation was used in subsequent analyses. These mutations (Fig. 4), one (of unknown identity) of which disappeared during were introduced into the p620 promoter constructs and into the differentiation (band X). The identity of the factors present in constructs containing the single and dual E-box deletions. these complexes was revealed by supershift assay, whereby Reporter gene assay data obtained after transfection of these antibodies specific for transcription factors (indicated above constructs into RD cells are shown in Fig. 5. The inability of each lane in Fig. 4) were preincubated with nuclear extracts Sp1 to bind at the mutated site appeared to have no effect on the before addition of the radiolabeled DNA fragment. A supershift promoter activity of the p620 construct before or after RD of a band in the presence of the specific antibody identifies the differentiation. However, the p620AP-2mt construct had factor present in that DNA-protein complex. Supershift assays revealed that the E-box binding factors Myf5, Myf6, USF-1, USF-2, and myogenin all formed complexes with this promoter region, and one of the USF complexes appeared reduced after differentiation. Assays using fragment 2 revealed a Sp1 complex, but no alteration in band shift profile was observed after differentiation. Fragment 3 EMSA also revealed a Sp1 complex, in this case appearing to be more prevalent before differentiation. An AP-2g antibody caused a weak band shift of fragment 3, which disappeared on differentiation. Fragment 4 revealed no notable complexes with RD cell extracts (data not shown). Fragment 5 (containing E-box E1) produced several bands of high mobility, but no bands were shifted by antibodies to muscle-specific E-box factors. This fragment was retarded by both USF-1 and USF-2 antibodies in a similar manner to fragment 1. A c-Myc complex with fragment 5 was also revealed, but no alteration of any of these complexes occurred relative to differentiation status.

Role of AP-2 Binding Sites in RD Cell hTERT Promoter Activity Adjacent consensus AP-2 and Sp1 sites exist between the two E-boxes in the hTERT promoter, and both AP-2 and Sp1 antibodies were shown to retard hTERT DNA fragments in EMSA experiments (Fig. 4). Mutations in the Sp1 site at FIGURE 3. Deletion analysis of the hTERT promoter and comparison of activity before and after RD cell differentiation. RD cells were positions À136 to À128 (GGGCCCC) and at the only AP-2 transfected with a series of luciferase reporter constructs containing consensus site (CCCNNNGGG) within the hTERT promoter at different lengths of promoter (989, 820, 620, and 320 bp upstream of the nt 129 to 121 (25) were created to test the functionality of translational start site; see Fig. 2) and p620 constructs containing single À À (E1 and E2) or double (E1E2) E-box deletions. All constructs were tested these sites in hTERT regulation. A number of nucleotides in the in RD cells before (A) and after (B) differentiation. Dual-luciferase assays AP-2 consensus site were altered and tested for their ability to were performed on cell lysates as described in ‘‘Materials and Methods.’’ Firefly luciferase activity of the promoter-less pGL3-basic plasmid (control) bind AP-2 factors in EMSA assays using HeLa cell nuclear was normalized to 1, and luciferase activity of test constructs is shown extracts (data not shown). Altering nucleotides CT at position relative to control. Bars, SD.

FIGURE 4. Identification of transcription factors present in RD cells that are capable of binding to specific regions of the hTERT core promoter. EMSAs were performed with double-stranded DNA fragments 1 – 5 (see Fig. 2B). Three micrograms of nuclear extracts were incubated with radiolabeled probe before electrophoresis as described in ‘‘Materials and Methods.’’ Representative autoradiograms are shown. The first lane (unlabeled) of each panel displays the complexes revealed after incubation of the DNA fragment with nuclear protein extracts prepared from RD cells before (Undiff.) and after (Diff.) differentiation. The identity of the factors present in these complexes was revealed by supershift assay, whereby antibodies specific for transcription factors (indicated above each lane) were preincubated with nuclear extracts before addition of the radiolabeled DNA fragment. A supershift of a band in the presence of the specific antibody identifies the factor present in that DNA-protein complex.

significantly reduced (3-fold) promoter activity in undifferen- Mad, Max, USF-1, USF-2, AP-2a,andAP-2g.Ectopic tiated RD cells (Fig. 5). The combination of the AP-2 site expression of c-Myc resulted in a 3-fold induction of reporter mutation with deletion of either E-box alone had no additive or gene transcription driven by the p620 construct (Fig. 6). This subtractive effect, but most notably, the mutation of the AP-2 fold induction was observed in both predifferentiated and site negated the previously observed double E-box deletion postdifferentiated RD cells. Overexpression of the transcription repressive effect (Fig. 3). These experiments show that maximal factor Mad had a 2.5-fold inhibitory effect in undifferentiated transcription of the hTERT promoter in telomerase-positive RD cells but had no significant effect in telomerase-negative cells requires a functional E-box and the consensus AP-2 site differentiated RD cells. It is difficult to evaluate a potential centered at position À125. In differentiated RD cells, the negative effect in differentiated cells, because the promoter p620AP-2mt construct maintained the same low level of activity is already reduced to levels approaching those of the activity as the p620 construct, and no E-box deletions had promoter-less control vector. Experiments evaluating the effect any further inhibitory or enhancing effects. of cotransfection of the transcription factors with the p320 construct gave essentially the same result as that observed with Transcription Factor Overexpression Can Modulate the the p620 construct. The Sp1 site centered at position À132 was hTERT Promoter not necessary for Myc/Mad effects, as evidenced by the activity To further assess the role of specific elements and their of the p620Sp1mt promoter (Fig. 6). Reporter assays using the associated factors in hTERT promoter activity, RD cells were p620E1E2 construct were not altered by the overexpression of cotransfected with constructs p620, p320, and p620Sp1mt and any tested exogenous transcription factors (data not shown), expression vectors coding for the transcription factors c-Myc, confirming that the observed Myc/Mad factor effects are

FIGURE 5. A functional AP-2 site is required for hTERT promoter activity in RD cells. RD cells were transfected with p620 luciferase reporter constructs (with and without E-box deletions; see Fig. 3) containing Sp1 (Sp1mt) or AP-2 (AP2mt) mutations. All constructs were tested in RD cells before (A) and after (B) differentiation. Dual-luciferase assays were performed on cell lysates as described in ‘‘Materials and Methods.’’ The promoter- less pGL3-basic plasmid (control) was normalized to 1. Promoter activities are expressed as described in Fig. 3.

FIGURE 6. Exogenous transcription factor regulation of hTERT promoter activity in RD cells. RD cells were transfected with p620, p320, and p620Sp1mt (Sp1mt) luciferase reporter constructs alone (NoTF) or with expression vectors for the transcription factors c-Myc, Mad, USF-1, AP-2a (AP2a), and AP-2g (AP2g). All cotransfections were tested in RD cells before (A) and after (B) differentiation. Dual-luciferase assays were performed on cell lysates as described in ‘‘Materials and Methods.’’ Promoter activities are expressed relative to that of the promoter-less pBasic construct as described in Fig. 3. specifically mediated via these E-boxes. The expression of the Myc was specifically mediated by E2 in undifferentiated RD USF-1, AP-2 (Fig. 7), USF-2, and Max (data not shown) cells. Although the AP-2 site clearly has a role in the regulation transcription factors had no effect on wild-type or Sp1-mutated of the hTERT promoter, there does not appear to be an absolute p620 or p320 promoter activities. requirement for interaction between the AP-2 site and the E-box binding factor Myc, at least when Myc expression is Does hTERT Promoter Regulation by Myc Require manipulated to be in excess. Interaction With the AP-2 Site? Having shown that Myc can positively override regulation Discussion of the hTERT promoter in RD cells, we tested the role of both We have demonstrated that a loss of telomerase enzyme E-boxes and the AP-2 site in this enhancement. Although the activity during differentiation of RD rhabdomyosarcoma cells is AP-2 site mutation decreased the activity of all promoters paralleled by the loss of detectable hTERT mRNA and the tested, the observed 2-fold induction of promoter activity by silencing of the hTERT promoter. Deletion of the proximal Myc was not abrogated by this functional mutation (Fig. 7). promoter region revealed that the changes in hTERT regulation Independent deletion of the two E-boxes, in conjunction with during TPA-induced myogenesis were largely mediated by a the AP-2 mutation, revealed that the response to exogenous core promoter extending 320 nt upstream of the ATG

FIGURE 7. Regulation of the hTERT promoter by endogenous Myc does not require a functional AP-2 site. RD cells were transfected with wild-type p620 constructs (p620) and p620 containing single (E1 and E2) or double (E1E2) E-box deletions or a mutated AP-2 consensus site (AP2mt). These constructs were cotransfected with a c-Myc expression vector (+) or a null expression vector (À), and dual-luciferase assays were performed on cell lysates as described in ‘‘Materials and Methods.’’ Promot- er activities are expressed relative to that of the promoter-less pBasic construct as described in Fig. 3.

translational start site. EMSA analyses revealed that the RD subsequent down-regulation of Sp1 during mouse C3H10T1/2 cells express the E-box binding factors Myf5, Myf6, myogenin, cell myogenesis (33), and Nozawa et al. have shown that the loss USF-1/2, and Myc. Specific mutation of the E-box elements of both Sp1 and Sp3 binding correlates with the down-regulation revealed that either of the two E-boxes could sustain hTERT of mTERT expression in C2C12 cells in myogenesis (14). core promoter activity in RD cells, but as expected, double However, in our study, it was the loss of MyoD expression that mutation of these two E-boxes resulted in significant reduction correlated with differentiation and the absence of telomerase of transcriptional activity, confirming that these elements are activity and hTERT promoter activity in RD cells. Furthermore, essential in the regulation of the hTERT core promoter. Sp1 protein levels appeared unchanged during differentiation However, E-box regulation does not constitute the entire and hTERT inhibition. There may be fundamental differences regulatory mechanism because removal of both elements does between TERT regulation in humans and rodents, although there not fully restore or repress hTERT promoter activity to wild- are similarities between promoter sequences. type levels in any predifferentiation or postdifferentiation It is evident from this study that multiple factors capable of comparison. Upon differentiation, the E-box deletions appeared binding E-box elements are present throughout differentiation to be inconsequential, suggesting that acute promoter inhibition (USF-1/2, Myf5/6, Myc/Mad, etc.). Therefore, a subtle is not mediated via the binding of a negative factor to an E-box. interplay between these factors and with other cis-acting Long-term hTERT promoter silencing may be mediated by the elements (e.g., AP-2 site) is inferred, with competitive binding binding of the basic helix-loop-helix protein Mad, an E-box being dependent on availability of DNA, factor abundance, and factor that is associated with negative regulation (22). Mad complex protein-protein interactions. A recent study reporting regulates transcription via recruitment of histone deacetylases to the dominant-negative effect of a truncated USF on the hTERT the binding site, altering chromatin structure and making the promoter during lymphocyte activation confirms that any E-box promoter inaccessible (23, 24). It is possible that in these binding factor may have a regulatory effect in a specific cellular studies RD cell differentiation was not yet advanced enough to context (34). Indeed, as described in many other cell types (35), employ this longer-term silencing mechanism. in this study, USF-1 and USF-2 were found to be the major While there are exceptions (26), most studies show that hTERT E-box binding proteins, but their role in gene-specific Myc can elicit expression of hTERT (13, 27); consequently, regulation is unclear. The USF proteins share with Myc similar loss of Myc is a good candidate mechanism for the reduction structure and affinity for E-box binding, yet the cellular of hTERT transcription during differentiation. However, while functions of USF and Myc are very different. Overexpression c-Myc and Mad overexpression could influence hTERT of Myc, in collaboration with a second oncogene, is sufficient promoter activity in this study, there appears to be other factors to trigger the transformation of primary fibroblasts, whereas and/or elements involved in hTERT transcriptional regulation in overexpression of USF has instead been found to inhibit growth RD cells. Both the ectopic expression of specific E-factors and in a number of cancer cell lines (36, 37). The overexpression of the deletion of the elements known to mediate E-factor effects USF proteins in RD cells did not affect promoter activity in RD resulted only in 2–3-fold changes. Therefore, there must be cells. Perhaps USF acts in a more general way as an other factors and/or elements involved in hTERT transcriptional ‘‘occupying’’ factor, weakly competing out more overtly regulation in RD cells. It is conceivable that the expression of positively and negatively acting E-box binding factors while some of these ‘‘other factors’’ may also be perturbed in the keeping the promoter chromatin accessible for acute regulation. differentiated state. The ability of E-factors to interact with the The redundancy of E-box binding may enable concurrent transcriptional RNA polymerase complex may be modulated by positive and negative regulation of multiple target genes during interactions with a number of other factors (28), including AP-2 the cell cycle or phased phenotypic changes such as (29, 30). The observation that the AP-2 site mutation caused differentiation. During muscle cell differentiation, distinct a down-regulation of the promoter similar to that of the double regulatory factors are expressed serially to coordinate the E-box deletion suggested that the E-box regulatory factors expression of progressive structural components, but hTERT is either interact with or require the AP-2 site binding factors to required to be silenced relatively early in this process. During exert their effects in RD cells. High-affinity binding sites for differentiation, there may be a ‘‘swapping out’’ of E-factors AP-2 sometimes overlap Myc response elements in bona fide binding to the hTERT E-boxes, with the common effect of Myc target genes. However, this is not the case in the hTERT preventing the binding of a positive regulator. Long-term promoter, with the only consensus AP-2 binding site effects, such as Mad-mediated epigenetic changes, may be (CCCNNNGGG centered at À125). Mutation of the AP-2 site brought about only when it is pertinent to shift the balance to an did not restrict the ability of ectopic c-Myc expression to up- overall shutdown status, i.e., on terminal differentiation. In a regulate the hTERT promoter via the E2-box. The ectopic transformed tumor cell, perhaps the complexity of these expression of AP-2 factors had no additive effect on reporter competing interactions is reduced or compromised, because gene activity either, so although both AP-2 and E-box sites both the cells were previously fully differentiated and quiescent. In appear to be essential for hTERT promoter regulation in RD this scenario, the inappropriate expression of just one positive cells, it remains to be determined whether they act in factor, e.g., Myc, could override the silencing of the hTERT combination or in an independent fashion. promoter, resulting in telomerase reactivation. Previous studies have shown that telomerase activity In summary, our results show that two E-boxes and an AP-2 decreases during C2C12 mouse myoblast differentiation (31, element have critical roles in hTERT transcriptional regulation 32), and a role for Sp1 in rodent TERT promoter regulation has during human RD cell differentiation. During the phased been reported. Vinals et al. described MyoD activation and changes that occur during differentiation, these E-boxes bind a

series of transcription factors, which combine through complex Telomerase Activity Assays interactions to silence the hTERT gene. A better understanding Telomerase activity was evaluated using the PCR-based of the factors and mechanisms that can achieve and maintain TRAP assay (18). Protein extractions and amplification assays silencing of the hTERT promoter would enable manipulation of were performed using the TRAPeze XL detection kit hTERT expression, a goal relevant to the amelioration of tumor (Intergen Co., Norcross, GA). Assay products were visualized cell proliferation. by acrylamide gel electrophoresis as described previously (39).

Materials and Methods Reverse Transcription-PCR Cell Line Culture Total cellular RNA isolation and cDNA synthesis were RD cells were purchased from the American Type Culture achieved as previously described (39). Nested PCR for Collection (Rockville, MD) and were propagated using DMEM hTERT mRNA used the following primers: forward 5V- medium supplemented with 10% fetal bovine serum. Cell CGGAAGAGTGTCTGGAGCAA and reverse 5V-TCAGTC- cultures were incubated at 37jC in a humidified atmosphere of CAGGATGGTCTTGAAGTC followed by forward 5V-CTCAC- 5% CO2-95% air. All culture reagents were purchased from CCACGCGAAAACCT and reverse 5V-CCACTGTCTTCCG- Life Technologies, Inc. (Gaithersburg, MD). CAAGTTCA. Amplification of h-actin transcripts served as cDNA internal control. Induction of Muscle Cell Differentiation RD cells (used at passages 5–12) were induced to Transient Transfections and Reporter Assays differentiate by adding 100-nM TPA (Sigma Chemical Co., St. Transient transfection were performed using TransFast Louis, MO) to the medium for 7 days (16). Differentiation was reagent (Promega). Dual-luciferase assays (Promega) were assessed by microscopic observation and by monitoring the performed according to manufacturer’s protocol. Each reaction skeletal muscle myosin heavy chain expression profile (16) contained 700-ng hTERT promoter luciferase reporter, 200-ng (antibody MHC [G-4]; Santa Cruz Biotechnologies, Santa cotransfected transcription factor (when applicable), and 100-ng Cruz, CA). Progressive fusion and myotubule formation Renilla luciferase control reporter vector, pRL-SV40. The occurred 2 days after TPA treatment. Analyses were performed promoter-less pGL3-basic vector (Promega) was used to make after 5–7 days, when 60–80% of the cells had fused. equal amounts of total DNA per reaction. All experiments were performed in triplicate. Recombinant Plasmid Constructs The 5V hTERT gene flanking region (990 nt upstream from the translational initiation site, designated +1) was amplified Electrophoretic Mobility Shift Assay from human genomic DNA by PCR, ligated into a pCR2.1- Labeled, overlapping double-stranded DNA fragments (Fig. 3) were created by PCR using p989 as template, TOPO vector (Invitrogen, San Diego, CA), and sequence 33 verified. Variable lengths (989, 820, 620, and 320 bp) of hTERT incorporating [ P]dCTP during the reaction. Nuclear extracts promoter DNA fragments were subcloned into the luciferase were prepared from cell lines using NE-PER extraction reporter pGL3-basic vector (Promega, Madison, WI; Fig. 3). reagents (Pierce Chemical Co., Rockford, IL). Binding j The Myc/Mad/Max (38) and USF (35) expression constructs reactions were performed at 4 C for 10 min in a 20-Al reaction expression constructs have been described previously. l reaction containing 3-Ag nuclear protein, 1-Ag poly(deox- yinosinic-deoxycytidilic acid), 4% Ficoll 4000, 25-mM HEPES (pH 7.9), 35-mM KCl, 1-mM EDTA, 1-mM DTT, and 4-mg/ml Site-Specific Deletions BSA. About 1000–2000 counts/min of 33P-labeled DNA E-box E1 (CACGTG, position À242) was deleted using fragments were added, and the binding reaction continued at PCR primer pairs 5V nt À99/XhoI and E1R (reverse primer with 25jC for 30 min. Complexes were electrophoresed on 6% deletion of E1), E1F (forward primer containing deletion of E1) native polyacrylamide gels in 0.5Â Tris-borate EDTA buffer, and 3V nt À1/HindIII using p989 as template. Second-round and dried gels were subjected to autoradiography. Supershift amplification used flanking primers at 5V position À620/XhoI antibodies against c-Myc, Mad, Max, USF-1, USF-2, AP-2a, and 3V position À1/HindIII, and PCR products were subcloned AP-2g, MyoD, Myf5, Myf6, myogenin, and Sp1 were into the pGL3-basic vector producing p620E1. The deletion of purchased from Santa Cruz Biotechnologies. Antibodies were the proximal E-box E2 (CACGTG at À34) was performed preincubated with nuclear extracts on ice for 1 h before DNA similarly, creating p620E2. The same reactions using p620E1 as binding reactions. template created the double E-box deletion p620E1E2. Sp1 (À136 to À128) and AP-2 site (À129 to À121; CCCNNNGGG) mutations were created using the following Western Blot Analysis oligonucleotides: Sp1mt forward primer (5V-CGGCCCAGTT- Five micrograms of nuclear protein were electrophoresed CCCTCCGGGCCCTCCC) and AP-2mt forward primer in 10% SDS-PAGE gels and blotted to polyvinylidine (5V-CGGCCCAGCCCCTTCCGGGCCCTCCC). Altered difluoride membranes. Specific primary antibodies (described nucleotides are in bold italic. The Sp1 and AP-2 mutations above) were detected with peroxidase-labeled secondary were introduced into the p620 and E-box-deleted constructs to antibodies (Amersham, Piscataway, NJ) using SuperSignal create p620Sp1mt, p620AP-2mt, etc. All constructs were West Dura Extended Duration Substrate (Pierce Chemical) per sequence verified. manufacturer’s instructions.

association of human telomerase activity with immortal cells and cancer. Science, Acknowledgments 266: 2011 – 2015, 1994. We thank Prof. Hiro Ariga (Hokkaido University) for providing the Myc/ Mad/Max expression constructs and Prof. Graham Packham (Southampton 19. Molkentin, J. D., Black, B. L., Martin, J. F., and Olson, E. N. Cooperative General Hospital, United Kingdom) for providing the USF expression activation of muscle gene expression by MEF2 and myogenic bHLH proteins. constructs. Cell, 83: 1125 – 1136, 1995. 20. Cong, Y. S., Wen, J., and Bacchetti, S. The human telomerase catalytic subunit hTERT: organization of the gene and characterization of the promoter. References Hum. Mol. Genet., 8: 137 – 142, 1999. 1. Vaziri, H., Dragowska, W., Allsopp, R. C., Thomas, T. E., Harley, C. B., 21. Horikawa, I., Cable, P. L., Afshari, C., and Barrett, J. C. Cloning and and Lansdorp, P. M. Evidence for a mitotic clock in human hematopoietic characterization of the promoter region of human telomerase reverse transcriptase stem cells: loss of telomeric DNA with age. Proc. Natl. Acad. Sci. USA, 91: gene. Cancer Res., 59: 826 – 830, 1999. 9857 – 9860, 1994. 22. Ayer, D. E., Kretzner, L., and Eisenman, R. N. Mad: a heterodimeric partner 2. Autexier, C., Pruzan, R., Funk, W. D., and Greider, C. W. Reconstitution of for Max that antagonizes Myc transcriptional activity. Cell, 72: 211 – 222, 1993. human telomerase activity and identification of a minimal functional region of the 23. Wolffe, A. P. Transcriptional control. Sinful repression. Nature. 387: 16 – 17, human telomerase RNA. EMBO J., 15: 5928 – 5935, 1996. 1997. 3. Urquidi, V., Tarin, D., and Goodison, S. Role of telomerase in cell senescence 24. Cong, Y. S. and Bacchetti, S. Histone deacetylation is involved in the and oncogenesis. Annu. Rev. Med., 51: 65 – 79, 2000. transcriptional repression of hTERT in normal human cells. J. Biol. Chem., 275: 4. Sugino, T., Yoshida, K., Bolodeoku, J., Tarin, D., and Goodison, S. 35665 – 35668, 2000. Telomerase activity and its inhibition in benign and malignant breast lesions. 25. McPherson, L. A. and Weigel, R. J. AP2a and AP2g: a comparison of J. Pathol., 183: 57 – 61, 1997. binding site specificity and trans-activation of the estrogen receptor promoter and 5. Nakamura, T. M., Morin, G. B., Chapman, K. B., Weinrich, S. L., Andrews, single site promoter constructs. Nucleic Acids Res., 27: 4040 – 4049, 1999. W. H., Lingner, J., Harley, C. B., and Cech, T. R. Telomerase catalytic subunit 26. Drissi, R., Zindy, F., Roussel, M. F., and Cleveland, J. L. c-Myc mediated homologues from fission yeast and human. Science, 277: 955 – 959, 1997. regulation of telomerase activity is disabled in immortalized cells. J. Biol. Chem., 6. Meyerson, M., Counter, C. M., Eaton, E. N., Ellisen, L. W., Steiner, P., 11: 11, 2001. Caddle, S. D., Ziaugra, L., Beijersbergen, R. L., Davidoff, M. J., Liu, Q., 27. Takakura, M., Kyo, S., Kanaya, T., Hirano, H., Takeda, J., Yutsudo, M., Bacchetti, S., Haber, D. A., and Weinberg, R. A. hEST2, the putative human and Inoue, M. Cloning of human telomerase catalytic subunit (hTERT) gene telomerase catalytic subunit gene, is up-regulated in tumor cells and during promoter and identification of proximal core promoter sequences essential for immortalization. Cell, 90: 785 – 795, 1997. transcriptional activation in immortalized and cancer cells. Cancer Res., 59: 7. Vaziri, H. and Benchimol, S. Reconstitution of telomerase activity in normal 551 – 557, 1999. human cells leads to elongation of telomeres and extended replicative life span. 28. Dang, C. V., Resar, L. M., Emison, E., Kim, S., Li, Q., Prescott, J. E., Curr Biol., 8: 279 – 282, 1998. Wonsey, D., and Zeller, K. Function of the c-Myc oncogenic transcription factor. 8. Bodnar, A. G., Ouellette, M., Frolkis, M., Holt, S. E., Chiu, C. P., Morin, G. B., Exp. Cell Res., 253: 63 – 77, 1999. Harley, C. B., Shay, J. W., Lichtsteiner, S., and Wright, W. E. Extension of life 29. Batsche, E., Muchardt, C., Behrens, J., Hurst, H. C., and Cremisi, C. RB span by introduction of telomerase into normal human cells. Science, 279: 349 – and c-Myc activate expression of the E-cadherin gene in epithelial cells 352, 1998. through interaction with transcription factor AP-2. Mol. Cell. Biol., 18: 3647 – 9. Ulaner, G. A. and Giudice, L. C. Developmental regulation of telomerase 3658, 1998. activity in human fetal tissues during gestation. Mol. Hum. Reprod., 3: 769 – 30. Gaubatz, S., Imhof, A., Dosch, R., Werner, O., Mitchell, P., Buettner, R., and 773, 1997. Eilers, M. Transcriptional activation by Myc is under negative control by the 10. Ulaner, G. A., Hu, J. F., Vu, T. H., Giudice, L. C., and Hoffman, A. R. transcription factor AP-2. EMBO J., 14: 1508 – 1519, 1995. Telomerase activity in human development is regulated by human telomerase 31. Bestilny, L. J., Brown, C. B., Miura, Y., Robertson, L. D., and Riabowol, reverse transcriptase (hTERT) transcription and by alternate splicing of hTERT K. T. Selective inhibition of telomerase activity during terminal differentiation of transcripts. Cancer Res., 58: 4168 – 4172, 1998. immortal cell lines. Cancer Res., 56: 3796 – 3802, 1996. 11. Pendino, F., Flexor, M., Delhommeau, F., Buet, D., Lanotte, M., and 32. Holt, S. E., Wright, W. E., and Shay, J. W. Regulation of telomerase activity Segal-Bendirdjian, E. Retinoids down-regulate telomerase and telomere length in in immortal cell lines. Mol. Cell. Biol., 16: 2932 – 2939, 1996. a pathway distinct from leukemia cell differentiation. Proc. Natl. Acad. Sci. USA, 33. Vinals, F., Fandos, C., Santalucia, T., Ferre, J., Testar, X., Palacin, M., and 98: 6662 – 6667, 2001. Zorzano, A. Myogenesis and MyoD down-regulate Sp1. A mechanism for the 12. Xu, D., Gruber, A., Bjorkholm, M., Peterson, C., and Pisa, P. Suppression of repression of GLUT1 during muscle cell differentiation. J. Biol. Chem., 272: telomerase reverse transcriptase (hTERT) expression in differentiated HL-60 12913 – 12921, 1997. cells: regulatory mechanisms. Br. J. Cancer, 80: 1156 – 1161, 1999. 34. Yago, M., Ohki, R., Hatakeyama, S., Fujita, T., and Ishikawa, F. Variant 13. Xu, D., Popov, N., Hou, M., Wang, Q., Bjorkholm, M., Gruber, A., Menkel, forms of upstream stimulatory factors (USFs) control the promoter activity of A. R., and Henriksson, M. Switch from Myc/Max to Mad1/Max binding hTERT, the human gene encoding the catalytic subunit of telomerase. FEBS Lett., and decrease in histone acetylation at the telomerase reverse transcriptase 520: 40 – 46, 2002. promoter during differentiation of HL60 cells. Proc. Natl. Acad. Sci. USA. 98: 35. Kiermaier, A., Gawn, J. M., Desbarats, L., Saffrich, R., Ansorge, W., Farrell, 3826 – 3831, 2001. P. J., Eilers, M., and Packham, G. DNA binding of USF is required for specific 14. Nozawa, K., Maehara, K., and Isobe, K. Mechanism for the reduction of E-box dependent gene activation in vivo. Oncogene, 18: 7200 – 7211, 1999. telomerase expression during muscle cell differentiation. J. Biol. Chem., 276: 36. Qyang, Y., Luo, X., Lu, T., Ismail, P. M., Krylov, D., Vinson, C., and 22016 – 22023, 2001. Sawadogo, M. Cell-type-dependent activity of the ubiquitous transcription factor 15. Gewin, L. and Galloway, D. A. E box-dependent activation of telomerase by USF in cellular proliferation and transcriptional activation. Mol. Cell. Biol., 19: human papillomavirus type 16 E6 does not require induction of c-myc. J. Virol., 1508 – 1517, 1999. 75: 7198 – 7201, 2001. 37. Luo, X. and Sawadogo, M. Antiproliferative properties of the USF family 16. Aguanno, S., Bouche, M., Adamo, S., and Molinaro, M. 12-O-tetradeca- of helix-loop-helix transcription factors. Proc. Natl. Acad. Sci. USA, 93: noylphorbol-13-acetate-induced differentiation of a human rhabdomyosarcoma 1308 – 1313, 1996. cell line. Cancer Res., 50: 3377 – 3382, 1990. 38. Kyo, S., Takakura, M., Taira, T., Kanaya, T., Itoh, H., Yutsudo, M., Ariga, H., 17. Bouche, M., Zappelli, F., Polimeni, M., Adamo, S., Wetsel, W. C., Senni, and Inoue, M. Sp1 cooperates with c-Myc to activate transcription of the human M. I., and Molinaro, M. Rapid activation and down-regulation of protein kinase C telomerase reverse transcriptase gene (hTERT). Nucleic Acids Res., 28: 669 – a in 12-O-tetradecanoylphorbol-13-acetate-induced differentiation of human 677, 2000. rhabdomyosarcoma cells. Cell Growth Differ., 6: 845 – 852, 1995. 39. Aogi, K., Woodman, A., Urquidi, V., Mangham, D. C., Tarin, D., and 18. Kim, N. W., Piatyszek, M. A., Prowse, K. R., Harley, C. B., West, M. D., Ho, Goodison, S. Telomerase activity in soft-tissue and bone sarcomas. Clin. Cancer P. L., Coviello, G. M., Wright, W. E., Weinrich, S. L., and Shay, J. W. Specific Res., 6: 4776 – 4781, 2000.

Downloaded from mcr.aacrjournals.org on October 2, 2021. © 2003 American Association for Cancer Research. Telomerase Reverse Transcriptase Promoter Regulation During Myogenic Differentiation of Human RD Rhabdomyosarcoma Cells1 1 Sidney Kimmel Foundation (S.G., Sidney Kimmel Scholar Award), California Cancer Research Program grant 570V-10189 (V.U.), and intramural support funds from the UCSD Cancer Center.

Hongwen Ma, Virginia Urquidi, Jeremy Wong, et al.

Mol Cancer Res 2003;1:739-746.

Updated version Access the most recent version of this article at: http://mcr.aacrjournals.org/content/1/10/739

Cited articles This article cites 39 articles, 21 of which you can access for free at: http://mcr.aacrjournals.org/content/1/10/739.full#ref-list-1

Citing articles This article has been cited by 1 HighWire-hosted articles. Access the articles at: http://mcr.aacrjournals.org/content/1/10/739.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/1/10/739. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.