PET-1 SWITCHES TRANSCRIPTIONAL TARGETS POSTNATALLY TO REGULATE MATURATION OF SEROTONIN NEURON EXCITABILITY

By

STEVEN CURTIS WYLER

Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy

Dissertation Advisor: Evan S. Deneris

Department of Neurosciences

CASE WESTERN RESERVE UNIVERSITY

May 2016

Case Western Reserve University

School of Graduate Studies

We hereby approve the dissertation of

Steven Curtis Wyler

candidate for the degree of Doctor of Philosophy

Committee Chair ...... Heather T. Broihier, Ph.D.

Committee Member ...... Evan S. Deneris, Ph.D.

Committee Member ...... Lynn T. Landmesser, Ph.D.

Committee Member ...... Peter C. Scacheri, Ph.D.

February 9th 2016

*We also certify that written approval has been obtained for any proprietary material contained therein

ii

TABLE OF CONTENTS

Table of Contents ...... iii

List of Figures ...... vii

Abstract ...... 1

CHAPTER 1- INTRODUCTION TO THE SEROTONIN SYSTEM

History of the discovery of serotonin and its role in psychiatric disorders .. 3

Serotonin Metabolism ...... 8

Synthesis ...... 8

Packaging ...... 10

Reuptake/clearance ...... 11

Degradation ...... 14

Neuroanatomy ...... 16

Cytoarchitecture ...... 16

Topographical projections ...... 18

Inputs into the Serotonergic System ...... 20

Adrenergic input ...... 20

Glutamatergic inputs ...... 21

Hypocretin signaling ...... 25

Lysophosphatidic acid ...... 26

Serotonergic Receptors ...... 27

Serotonin receptor 1 family ...... 28

Serotonin receptor 2 family ...... 31

Serotonin receptor 3 ...... 34

Serotonin receptor 4 ...... 35

Serotonin receptor 5 family ...... 36

iii

Serotonin receptor 6 ...... 37

Serotonin receptor 7 ...... 38

Development of serotonin system ...... 38

Hindbrain patterning ...... 39

Anterior/ posterior axis ...... 39

Dorsal/ventral axis ...... 45

Serotonergic neuroprogenitor specification ...... 46

Terminal differentiation ...... 52

Maintenance of serotonergic identity ...... 57

PET-1 ...... 59

Gene/protein structure ...... 59

Pet-1 in peripheral serotonin system ...... 60

Role in pancreas ...... 61

Role in hematopoietic stem cells ...... 62

Invertebrate orthologs ...... 62

CHAPTER 2. PET-1 CONTROLS TETRAHYDROBIOPTERIN PATHWAY AND SLC22A3 TRANSPORTER GENES IN SEROTONIN NEURONS. Summary ...... 78

Introduction ...... 79

Methods ...... 83

Results/discussion ...... 87

CHAPTER 3. PET-1 SWITCHES TRANSCRIPTIONAL TARGETS POSTNATALLY TO REGULATE MATURATION OF SEROTONIN NEURON EXCITABILITY Summary ...... 108

Significance Statement ...... 109

Introduction ...... 109

iv

Methods ...... 112

Results ...... 125

Gene expression trajectories in maturing 5-HT neurons ...... 125

PET-1 broadly coordinates gene expression trajectories during ……maturation ...... 126

Pet-1-/- 5-HT neuron passive and active membrane properties are ……permanently immature ...... 127 PET-1 controls maturation of glutamatergic and GPCR synaptic input to ……5-HT neurons ...... 129 Stage specific switching of Pet-1 targets ...... 132 PET-1 directly controls the 5-HT neuron maturation-promoting factor, ……Engrailed 1 ...... 134 Discussion ...... 136

CHAPTER 4. DISCUSSION AND FUTURE DIRECTIONS

Heterogeneity in Serotonergic Neurons ...... 172

Prolonged loss of Pet-1 leads to increased gene downregulation ...... 174

Pet-1 as a Transcriptional Repressor ...... 178

Repressing immature phenotype ...... 178

Repression of other neuronal phenotypes ...... 180

Generation of 5-HT neuronal subtypes ...... 180

Balance of 5-HT physiological properties ...... 182

Temporally Regulated Altered Sensitivity to the loss of Pet-1 ...... 182

Identifying Pet-1-regulated Htr1a Sensitive period ...... 187

Evidence for a sensitive period of 5-HT mediated stress adaptation ...... 188

Defining 5-HT1A sensitive period ...... 189

Role of Pet-1 ...... 191

v

Conclusion ...... 193

Bibliography ...... 195

vi

List of Figures

Chapter 1

Figure 1. Serotonergic Neuron and Receptors ...... 64

Figure 2. Neuroanatomical features of 5-HT neuron development ...... 67

Figure 3. Stages in serotonergic neuron development ...... 69

Figure 4. Patterning and development of the hindbrain serotonin system . 71

Figure 5. Progenitor specification of 5-HT neurons ...... 73

Figure 6. Serotonergic transcriptional network ...... 75

Chapter 2

Figure 1. Schematic of BH4 de novo synthesis, salvage, and ……………………regeneration.pathways and its role in 5-HT synthesis ...... 95

Figure 2. Isolation of ePet-EYFP and Pet-1-/-; ePet-EYFP 5-HT neurons ...... 97

Figure 3. Microarray analyses ...... 99

Figure 4. Slc22a3 expression ...... 101

Figure 5. Slc22a3 and Htr1a expression in the adult dorsal raphe ...... 103

Figure 6. Pet-1 control of the 5-HT neuron-type gene battery ...... 105

Chapter 3

Figure 1. RNA-sequencing reveals temporal gene expression patterns in ……… maturing 5-HT neurons ...... 143

Figure 2. RNA-sequencing shows that Pet-1 globally controls the 5-HT ……… transcriptome through positive and negative regulation of gene ……… …… ………expression trajectories ...... 145

Figure 3. Pet-1 regulated a broad range of gene classes ...... 147

Figure 4. Verification of Pet-1 regulated genes by In situ hybridization .. 149

Figure 5. Pet-1-/- 5-HT neuron passive and active membrane properties ……… are permanently immature ...... 151

Figure 6. Expression Trajectories of glutamatergic receptor genes ...... 154

vii

Figure 7. Pet-1 promotes maturation of AMPA excitatory synaptic ……………input to 5-HT neurons by regulating Gria4 ...... 156

Figure 8. Pet-1 controls maturation of Adrenergic synaptic input to ……………5-HT neurons ...... 158

Figure 9. Pet-1 controls the maturation of Lysophosphatidic acid ……………input to 5-HT neurons ...... 160

Figure 10. Immature G protein signaling in Pet-1-/- mice ...... 162

Figure 11. 5-HT synthesis genes lose sensitivity to Pet-1 as 5-HT ……………neurons.mature ...... 164

Figure 12. 5-HT synthesis genes lose sensitivity to Pet-1 as 5-HT ……………neurons..mature ...... 166

Figure 13. Early postnatal Pet-1 function is essential for control of ……………multiple GPCRs ...... 168

Figure 14. Pet-1 directly regulates the 5-HT neuron maturation

……………factor, Engrailed 1...... 170

viii

Pet-1 Switches Transcriptional Targets Postnatally to Regulate Maturation of Serotonin Neuron Excitability

Abstract by

STEVEN CURTIS WYLER

The tremendous diversity of neuronal cell types enables the assembly of neural circuitry that generates and shapes complex behaviors. In contrast to the intense focus on understanding the gene regulatory programs that specify different neuron types, the programs that guide their maturation have received far less attention. Here we show the embryonic maturation of serotonergic (5-HT) neurons, and the role of the transcription factor, PET-1 in driving this maturational program.

Initally we undertook a series of experiments to define PET-1’s function in development and the early postnatal period. To this end, we used RNA-Seq in flow sorted fetal YFP+ 5-HT neurons obtained from the rostral hindbrain to identify specific temporal gene expression patterns found in maturing 5-HT neurons from E11.5 to shortly after birth (P1-P3). We found that genes downregulated from E11.5 to birth were genes associated with basic cellular processes, while genes upregulated were associated with maturing neural identity and function. Next we compared the expression profile of E15.5 +/+ and

Pet-1-/- 5-HT neurons. Expression of over 800 genes was diminished 1.5-40 fold,

1 and greater than 1000 genes were derepressed 1.5-13 fold in Pet-1-/- 5-HT neurons. Gene ontology shows that PET-1 is a regulator of diverse pathways including cell synaptic development and function, axon and dendrite development, and neural transmission. The role of PET-1’s in driving maturation of genes involved in neuronal excitability was verified by single cell recording of

5-HT neurons. Aditionally, PET-1 was found to regulate the glutamatergic AMPA receptor subunit Gria4, the alpha adrenergic receptor 1b, Adra1b, and the lysophosphtidic acid receptor 1, Lpar1. This was verified by in situ hybridization, immunohistochemistry, and electorphysiological recordings. Finally, to ascertain

PET-1’s postnatal function, we deleted Pet-1 in the early postnatal period using the Cre/loxP system. This revealed PET-1 switches its focus on regulating genes needed for 5-HT synthesis to those needed for neuronal activity. Finally, we used ChIP-seq to identify PET-1 direct targets. We found PET-1 binds within or proximal to 25-30% of PET-1 upregulated and down regulated genes, suggesting direct transcriptional activation and repression of PET-1 is required for correct 5-HT development.

2

CHAPTER 1. INTRODUCTION TO THE SEROTONIN SYSTEM

History of the Discovery of Serotonin and its Role in Psychiatric Disorders

The story of the discovery of serotonin starts almost 150 years ago, and

originates from the search of blood-derived factors which trigger vasoconstriction

and smooth muscle contraction (Stahl et al., 1992). The first hint of a blood-

derived vasoconstrictor comes from a report in 1868 by Ludwig and Schmidt who

revealed that defribinated blood increased vascular resistance in a preparation

isolated from muscle of a dog (Ludwig and Schmmidt, 1868). Although the role

this study had on driving future research is debated, during the late 1800s to

early 1900s numerous researchers sought to identify these blood-derived

vasoconstrictive “vasotonins” (Stahl et al. 1992).

One such researcher was Dr. Page of the Cleveland Clinic who was

searching for blood-derived factors which he believed resulted in hypertension.

Unfortunately, his work was hindered by a vasotonin, generated in clotting blood,

which obstructed his bioanalysis. Therefore he recruited Doctors Rapport and

Green to develop a method to remove this “nuisance” molecule so his work on

hypertensive factors could resume. Between 1946-1948, Dr. Rapport used

approximately 450 liters of beef whole blood to isolate and characterize this

“nuisance” molecule (Rapport et al 1948a, Rapport 1997). In a 1948 landmark

paper in Science, Drs. Rapport, Green and Page describe their findings as follows: “We would like provisionally to name it serotonin, which indicates that its source is serum and its activity is one of causing constriction” (Rapport et al.,

3

1948b). The following year, Rapport published the chemical structure for serotonin (Rapport, 1949). With the solving of the chemical structure, serotonin could now be synthesized and its pharmacological properties easily studied.

Although Drs. Rapport, Green and Page coined the word “serotonin,” the same compound was unknowingly discovered years earlier in the gut and named

“enteramine”. In Italy, a group led by Dr. Erspamer worked to isolate a substance produced by enterochromaffin cells which caused smooth muscle contraction. In 1937 they reported a compound extracted from rabbit gastric mucosa which they termed “enteramine” (Whitaker-Azmita, 1999). They and others continued to characterize the physiological function of enteramine, and identify its presence in multiple animals and tissues. In 1952 Dr. Erspamer published a report revealing that enteramine is the same compound as serotonin

(Erspamer and Asero, 1952).

Around this time, Dr. Twarog was in search of neurotransmitters acting in shellfish (Whitaker-Azmita, 1999). After reading about serotonin/enteramine, she hypothesized, that serotonin may act as a neurotransmitter in shellfish; which she later proved (Twarog, 1954; Whitaker-Azmita, 1999). Unfortunately, it would be two years for her work to be accepted for publication! Meanwhile, believing that serotonin could also act as a mammalian neurotransmitter, she pursued a collaboration with Dr. Page who had developed sensitive bioassays for serotonin detection, to test this idea. Although he was skeptical, due to previously published reports indicating serotonin was not found in the brain, he agreed to

4

facilitate her research. Soon after, they reported that serotonin was abundantly

found in the mammalian brain (Twarog and Page 1953).

Due to this study, and Dr. Gaddum’s pharmacological analysis of the

serotonergic competitive agonist, lysergic acid diethylamide (LSD), Doctors

Woolley and Shaw proposed serotonin-deficiency as a potential cause for

psychiatric disorders (Gaddum, 1953, Woolley and Shaw 1954). Soon after, the

literature became flooded with reports of serotonin’s function in the brain and

periphery (Gothert, 2013). Some hallmarks included the development of the first

antidepressants, and identification of different classes of serotonin receptors.

Additionally, with the advent of new histological techniques for fluorescently

marking monoamines, Drs. Dahlström and Fuxe published numerous studies supplying evidence that serotonin was a brain neurotransmitter, including describing the cellular localization of serotonin-producing neurons in the brain stem and showed its presence in axonal terminals (Dahlström and Fuxe 1964,

Fuxe, 1965).

Around this time a revolution was well underway in the way clinicians, psychiatrists, and scientists thought about the cause of mental illness.

Serendipitous discoveries in mood-altering effects of drugs resulted in a neurochemical theory for the cause of mental illness. Two important pharmaceutical discoveries were paramount for both the advancement of serotonin research and treatment of mental illness. The first was that derivatives of an antituberculosis medicine—Iproniazide had unexpected mood enhancing effects in some individuals with mental illness. This led to the marketing of the

5 first class of “antidepressants”, the monoamine oxidase inhibitors (MAOI), which acted to prevent the degradation of biogenic amines including serotonin. A second drug class soon followed, the tricyclic antidepressants whose founding member Imipramine, was originally developed as an antihistamine. With discoveries such as Dr. Axelrod’s Nobel Prize work on the mechanism of neurotransmitter “reuptake” and Dr. Carlsson’s revelation that Imipramine acted by blocking these reuptake transporters, the role of biogenic amines in psychiatric disorders was well underway to being generally accepted (Carlsson et al., 1968; Lopez-Muñoz and Alamo, 2009).

However, during the 50s and 60s, and still to this day, the relative roles of the various biogenic amines in mental illness were unclear. Numerous important discoveries pointed to serotonin as an essential neurotransmitter in this process.

Of note was the discovery that the drug reserpine reduces levels of serotonin in the brain in animals, and this reduction was associated with “depressive” behaviors. Importantly, these behaviors were remitted as the 5-HT levels returned to normal. Additionally, clinical evidence bolstered the “serotonin hypothesis” as reduced levels of serotonin metabolites were found in the cerebral spinal fluid of depressed patients, and postmortem studies found reduced levels of serotonin in the brains of those who committed suicide.

This evidence led to the development of the first FDA-approved targeted drug for the serotonin system—fluoxetine—trade name Prozac (Wong et al

1974). This antidepressant, the founding member of the class of drugs named the selective serotonin reuptake inhibitor (SSRI) was the first psychiatric drug

6

developed through rational-targeted drug design. Thirteen years later, it was

approved for treatment of depression and marketed as Prozac. This

development was made possible by a new assay for measuring serotonin uptake

into rat synaptic preparations which facilitated the screening of dozens of

derivatives of the antihistamine, diphenhydramine (Benadryl), for compounds

which would selectively uptake serotonin, but not other biogenic amines. Since

that time, numerous other antidepressants have been developed including

Citalopram (Celexa), Escitalopram (Lexapro), Paroxetine (Paxil), Sertraline

(Zoloft), and Fluvoxamine (Luvox) which differ on pharmacology and pharmacokinetics, thus affecting off target effects, activity, drug interactions, and

efficacy (Sanchez et al., 2014; Solai et al., 2001)

The history of the discovery of serotonin and the generation of the

serotonin hypothesis of disease is a fascinating story in, both in how serotonin

was discovered, its identification and function in neurons, and how it led to a

revolution in modern treatment of mental illness. Although the “serotonin

hypothesis” of mental illness has recently been challenged, largely due to its

oversimplification of serotonin’s role in psychiatric disease, advancements in

uncovering the mechanisms of 5-HT function will undoubtedly lead to better

treatments for mental illnesses.

7

Serotonin Metabolism.

Serotonin Biosynthesis.

Serotonin is synthesized from the essential amino acid l-tryptophan (TRP)

in two enzymatic steps by the enzyme tryptophan hydroxylase (TPH) and

aromatic l-amino acid decarboxylase (AADC; Figure 1). In the first step, TPH converts TRP to 5-Hydroxytryptophan (5-HTP). In a second step the carboxyl group is removed by AADC to form 5-Hydroxytryptamine (5-HT, serotonin).

TPH is the rate limiting enzyme in 5-HT synthesis, (Fitzpatrick, 1999).

There are two isoforms of TPH found in mice and primates termed TPH1 and

TPH2, encoded by Tph1, Tph2 respectively (Walther et al., 2003; Walther and

Bader 2003; Zill et al., 2004). In the periphery, Tph1 is found in the 5-HT

producing enterochromaffin cells, the placenta and mammillary gland epithelium

while Tph2 is found in enteric neurons; both isoforms are found in the pancreas

(Bonnin et al., 2011; Cote et al., 2003; Matsuda et al., 2004; Ohta et al., 2011).

Within the CNS, TPH2 is localized to the hindbrain raphe nuclei, while Tph1 is predominantly expressed in the pineal gland where is it involved in the biosynthesis of melatonin (Patel et al., 2004; Sakowgki et al., 2006; Zill et al.,

2007). TPH1 is also found to a lesser extent in the raphe 5-HT system as well

(Huynh et al., 2011). Germline deletion of Tph1 in mice has a small effect on brainstem 5-HT levels, but leads to an almost complete loss of gut (~3 % of WT levels) and blood 5-HT (8-15% of WT levels) (Cote et al., 2003; Izikki et al., 2007;

Savelieva, et al., 2008). Conversely, genetic targeting of Tph2 has no effect on

8

peripheral 5-HT levels, but leads to a 93-97% loss of forebrain 5-HT (Alenina et al., 2009; Savelieva et al 2008). Interestingly, Tph1/Tph2 double knockout mice are viable and show a 95-99% loss of brain 5-HT, 93% loss of blood 5-HT and

over 99% loss in the intestinal jejunum (Savelieva et al 2008). The residual 5-HT

may be either an artifact of the HPLC analysis, or the action of enzymes such as

phenylalanine hydroxylase which is capable of hydroxylating tryptophan in vitro

(Renson et al., 1962). The catalytic reaction driven by TPH is dependent on the

2+ presence of Fe , the cofactor tetrahydrobiopterin (BH4), and molecular oxygen

(Roberts and Fitzpatrick, 2013). The conversion of tryptophan to 5-HTP takes

2+ 2+ place in two steps. In the first, Fe -dependent step, BH4 and Fe are

simultaneously oxidized to 4α-carbinolamine and the FeIVO intermediate respectively. In the second step, the oxygen of the FeIVO intermediate is

transferred to carbon 5 on the aromatic ring through an electrophilic aromatic

substitution reaction. As stated above, in this reaction, BH4 is oxidized to 4α-

carbinolamine which can be regenerated to BH4 through multiple pathways. BH4 is also synthesized de novo from GTP. The details of the regeneration and de

novo synthesis pathways of BH4 will be discussed in chapter 2: Pet-1 Controls

Tetrahydrobiopterin Pathway and Slc22a3 Transporter Genes in Serotonin

Neurons.

The second decarboxylation step is catalyzed by the enzyme AADC

(commonly called DOPA decarboxylase; gene symbol: Ddc). AADC is a general

decarboxylase which is required for the synthesis of biogenic amines including 5-

HT, dopamine (DA), noradrenaline (NA) and adrenaline (AD) and thus is found in

9

DA, NA, AD, and 5-HT neurons (Jaeger et al 1984). The study of this gene in mouse models is hindered by the fact that Ddc-/- mice die in utero (Lee et al.,

2013). A few cases have been reported of individuals with a deficiency in AADC function (Brun et al., 2010). Consistent with its role in 5-HT synthesis, these individuals have low CSF (cerebrospinal fluid) levels of the 5-HT metabolite, 5- hydroxy-3-indolacetic acid (HIAA). Additionally, a mouse model of one of these hypomorphic mutations has been generated (Lee et al., 2013). Mice homozygous for this allele have severe ataxia, reduced survival, reduced body size, and reduced levels of brain DA and 5-HT (Lee et al. 2013). The catalytic reaction of

5-HTP to 5-HT is dependent on the cofactor pyridoxal phosphate (PLP), more commonly known as the “active form” of vitamin B6 (Phillips, 2015). In the first step, PLP covalently binds to Lys303 of AADC which facilitates a nucleophilic attack by the amine group of 5-HTP thereby forming a PLP-5-HTP intermediate and breaking the PLP-AADC bond. Next, AADC promotes the removal of the carboxyl group as a molecule of CO2. In the final step, the PLP-AADC intermediate reforms releasing the newly formed 5-HT molecule.

Vesicular packaging

Once synthesized, serotonin is packaged into secretory vesicles by the vesicular monoamine transporters, VMATs (Schuldiner et al., 1995). There are two isoforms of VMAT, VMAT1 and VMAT2 (gene symbols: Slc18a1 and Slc18a2 respectively). Generally speaking, VMAT1 is found in non-neural tissues of the periphery, while VMAT2 is found primarily in monoaminergic neurons, including

5-HT neurons (Gonzalez et al., 1994; Peter et al., 1995; Schafer et al., 2013;

10

Weihe et al., 1994). Vmat2-/- mice die within a few days of birth and show a

severe depletion in brain 5-HT, DA, and NA, while mice heterozygous for Vmat2

live to adulthood and only have mild loss of monoamines and depressive like

behaviors (Fon et al., 1997; Fukui et al., 2007; Wang et al 1997). Mice with loss

of Vmat2 specifically within 5-HT neurons survive to adulthood, although they

have reduced body weight for the first 6 weeks of life and severe depletion of

brain 5-HT (Narboux-Neme et al., 2011, 2013).

Serotonin Reuptake/Clearance

Serotonin is cleared from the extracellular space by two general

transporter types. The first is through the high-affinity, low-capacity transporter

serotonin transporter (SERT, gene symbol: Slc6a4). The second is through

promiscuous low-affinity-high capacity transporters including the organic cation

transporters (OCT1-3, gene symbols: Slc22a1-3), plasma monoamine

transporter (PMAT, gene symbol: Slc29a4) and the norepinephrine and

dopamine transporters, NET (Slc6a2) and DAT, (Slc6a3) respectively (Daws,

2009).

The bulk 5-HT transporter is undisputedly the high-affinity, low-capacity

SERotonin Transporter, SERT or 5-HTT (Blakely et al., 1991; Chang et al., 1996,

Hoffman et al., 1991). As such, this transporter has been a target for treatment

of numerous psychological disorders attributed to disrupted 5-HT signaling. Thus,

the most commonly prescribe antidepressants in America target either SERT

exclusively (SSRI, selective serotonin reuptake inhibitors) or in addition with the

11

norepinephrine transporter, NET (SNRI, Serotonin and norepinephrine reuptake inhibitors). In the adult CNS, SERT is limited to the 5-HT system, however during

development, it is transiently expressed in non-5-HT producing cells including the

dorsal thalamus, hypothalamus and limbic cortex (Cases et al., 1998; Hansson et

al., 1998; Lebrand et al., 1996, 1998; Pavone et al., 2008). There are several

hypotheses as to the function of this transient non-5-HT SERT expression

(Gaspar et al., 2003). As many of these cells also express Vmat2, one

possibility that 5-HT may act as a “borrowed transporter” for 5-HT signaling in

these neurons. Another possibility is this may aid in generating a morphogenic

gradient of 5-HT required for CNS development. A third is this transient SERT

expression serves as a mechanism for rapid clearance of 5-HT release from

growing neurites prior to establishing correct innervation patterns. In support of

the latter two hypotheses, ablation of Slc6a4 only within glutamatergic neurons

leads to defects in patterning of thalamocortical axonal projections and dendrite

arborization in the somatosensory cortex due to high 5-HT levels at these sites

(Chen et al., 2015).

In addition to the action of SERT, 5-HT can be taken up into both 5-HT

neurons and non-5-HT neurons and glia through low-affinity-high-capacity

transporters. These transporters will only clear 5-HT at high concentrations, such

as in the presence of SERT inhibitors or Slc6a4 loss of function alleles (Baganez

et al., 2008; Hagen et al. 2011; Horton et al 2013). Among these low-affinity

transporters are the three organic cation transporters, OCT1-3. All three OCTs

have been shown to transport monoamines, but differ in their affinities for the

12

various monoamines and to their tissue expression. Expression analyses

indicate that all three OCT transporters are expressed throughout the brain, with

Oct1 and Oct2 having weak, diffuse expression and Oct3 having strong

expression in the thalamus and dorsal raphe nucleus in both neuronal and glia

(Amphoux et al., 2006; Gasser et al., 2009; Vialou et al., 2008). Of the three

OCTs, OCT3 has the highest affinity for 5-HT in vitro and is the most studied of

these transporters regarding their CNS function (Amphoux et al., 2006). Due to

its relatively high expression in 5-HT neurons, OCT3 is likely involved in 5-HT

reuptake and recycling. Due to its function as a low-affinity-high capacity 5-HT

transporter, it is hypothesized that blockade of this transporter may potentiate the

effects of SSRI treatment by increasing synaptic 5-HT levels. In agreement with

this hypothesis, administration of decynium-22 (D-22) an OCT/PMAT inhibitor, has no antidepressive effect on its own, but when used in conjunction with a subclinical dose of the SSRI fluvoxamine or in Sert+/- or Sert-/- background, leads

to antidepressive effects in the tail suspension test (Baganez et al., 2008; Horton

et al. 2013). It should be noted that OCT3 function is not limited to a

compensatory role due to reduced SERT function, as Oct3-/- mice have reduced

anxiety in the elevated plus maze and open field test along with modest

reductions in brain 5-HT, DA and histamine levels (Vialou et al., 2008; Wultsch et

al., 2009).

OCT2 likely also plays a functional role in 5-HT uptake in vivo as OCT2 is

weakly expressed in a subset of 5-HT neurons (Bacq et al., 2012). Oct2-/- mice

show a modest reduction in forebrain but not hindbrain 5-HT levels and reduced

13

anxiety and depressive phenotypes in the open field test, elevated O-maze and

the forced swim test. To my knowledge, no studies have directly investigated

OCT1 inhibition in vivo, but it likely also functions in clearance of monoamines

including 5-HT.

The plasma monoamine transporter, PMAT, is another low-affinity transporter. In vitro assays suggest PMAT has a relatively high affinity for dopamine and 5-HT and a much lower affinity to histamine, noradrenaline, and adrenaline; however it’s in vivo function regarding 5-HT transport has only been evaluated in the choroid plexus where Pmat-/- (Slc29a4-/-) mice show reduced 5-

HT uptake in these cells (Duan and Wang, 2010, 2013).

In addition to the OCTs and PMATs, 5-HT can be cleared by the

norepinephrine and dopamine transporters, but the physiological function of such

transport is unknown (Daws et al. 2009). The biological role for these

“promiscuous” transporters is not completely known, but may serve as a

homeostatic mechanism for rapid clearance of excessive release of 5-HT and

other monoamines.

Degradation/conversation

5-HT is degraded and/or converted to other substances in multiple

pathways, with some metabolites having known or proposed biological function

(Jang et al., 2010; Lozda and Purvins, 2014; Svensson et al., 1999, Tosini et al.,

2012; Uchihashi et al 2013; Undenfriend et al., 1956). In the most predominate degradation pathway; 5-HT is converted to 5-hydroxy-3-indolacetaldehyde, 5-

14

HIAL, by the enzyme monoamine oxidase (MAO) whereby the amine group is

replaced with an aldehyde group. 5-HIAL is then converted to 5-hydroxy-3-

indolacetic acid, 5-HIAA, by aldehyde dehydrogenase (ALDH) where the

aldehyde becomes a carboxylic acid. 5-HIAA diffuses and is transported to the

bloodstream where it is excreted by the kidneys (Undenfriend et al., 1956).

The two monoamine oxidase enzymes MAOA/ B are membrane bound

mitochondrial flavoproteins. They have been widely studied for their role in neural

function likely due to their historic role as the target of the first class of

antidepressants (Youdim, 1975). MAOA and MAOB are encoded by two separate genes (Maoa and Maob) and differ in both their affinity to the various monoamines and tissue expression pattern (Bach et al 1988; Edwards, 1980).

Both are expressed in 5-HT neurons, but MAOA has a higher affinity for 5-HT

than MAOB (Edwards 1980). Interestingly, Maoa, but not Maob, knockout mice

results in a significant increase in brain 5-HT levels with a corresponding

decrease 5-HIAA levels (Cases et al., 1995; Grimsby et al., 1997). However,

Maoa/Maob double knockout mice show greater CNS 5-HT increase and 5-HIAA

decrease than the Maoa-/- mice. Taken together, MAOA appears to be the

dominate isoform required for 5-HT degradation, with MAOB playing a smaller

yet significant role.

There has been little research in identifying the ALDH isoform(s)

responsible for 5-HIAA generation. However, it appears that the mitochondrial

ALDH isoform, Aldh2, is partially required for conversion of 5-HIAL to 5-HIAA, at

least in the liver (Keung et al., 1998; Rooke et al., 2000).

15

Although not a degradation pathway, in the pineal gland, 5-HT is an

intermediate in melatonin synthesis where it is converted into N-acetyloserotonin and then melatonin by the enzymes, Aralkylamine N-acetyltranferease and hydroxyindolo-O-methyltransferase respectively.

Neuroanatomy of the Serotonergic System.

The 5-HT system is composed of approximately 26,000 cells in the mouse, and approximately 300,000 in the human (Baker et al., 1991; Hornung,

2003; Ishimura et al., 1988). Despite representing less than 0.001% of brain

neurons, 5-HT neurons modulate neuronal activity of a vast majority of neuronal

populations by innervating virtually every area of the brain.

Cytoarchitecture

The 5-HT neurons are located in the midbrain, pons, and medulla, mostly

along the midline, and are known as raphe nuclei. The 5-HT system is roughly

divided into two groups—the ascending system, and the descending system,

which are further subdivided into 9 phylogenetically conserved nuclei, termed the

B1-B9 nuclei (Figure 2A; Deneris and Wyler 2012). This “B” designation was

originally developed by Dahlstrom and Fuxe who characterized the

cytoarchitecture of catacholaminergic (A nuclei) and 5-HT neurons in the adult rat

brain (Dahlstrom and Fuxe 1964). Besides the “B” nomenclature, the subdivision

of the 5-HT system is characterized based on the anatomical structures in which

the neurons reside, and the cytoarchitecture of the nuclei themselves.

16

The descending system. The B nuclei are organized in a caudal-B1 to rostral-B9 fashion. The B1-B3 nuclei are the most caudal cells located on the ventral midline of the hindbrain/medulla. As they generally send axons down the spinal cord they compose the descending 5-HT system. The most caudal B1 nucleus comprises the raphe pallidus, and is found in the ventral medulla. The

B2 forms the raphe obscurus, and is located just dorsal to the raphe pallidus.

The B3 nucleus is the most rostral of the caudal B nuclei, and forms the raphe magnus along the midline. The B3 nucleus is also found in two bilateral groupings in the rostral ventrolateral medulla, and lateral paragigantocellular reticular nucleus. B3 neurons can also be seen in the pontine region ventrally to the B6/B5 and caudal B7 nuclei in coronal sections. Developmentally, these neurons arise from rhombomeres 5-8 (Figure 1B, C).

The ascending system. The ascending system is organized in 5 nuclei termed the B4-B9 nuclei, which compose the dorsal and median raphe nuclei, and the supralemniscal B9 region; approximately 85% of all 5-HT neurons are found the ascending system (Hornung, 2003; Jenson et al., 2008). The B4 nucleus is found in the caudal ventral DRN just ventral to the cerebellum. The literature is split on rather the B4 is part of the rostral or caudal 5-HT system; however based on fate mapping experiments, B4 was found to originate from rhombomere 1, along with the B6 and B7 DRN nuclei, placing it as the most caudal part of the DRN (Figure 2B, 2C; Jensen et al., 2008). The B5 nucleus is located in the ventral caudal hindbrain also termed the caudal portion of the medium raphe nucleus (MRN). The B6 nucleus is located along the midline of

17 the caudal DRN. The majority of the 5-HT neurons (50 %) are located in the B7 nucleus which comprises the majority of the DRN. The B8 nucleus comprises the majority of the median raphe and is found in a medial cluster in the median raphe nucleus. The B9 nucleus is an intriguing morphological structure. It is composed of two clusters in the supralemniscal rostral ventral hindbrain. As stated above, the DRN (B4, B6, and B7 nuclei) is also segregated based on the cytoarchitectural appearance and anatomical location of the nuclei regions (Hale and Lowry, 2011). In this nomenclature, the B4 and dorsal section of the B6 nuclei are called the dorsal raphe caudal (DRC), and the ventral part of B6 and ventral-caudal region B7 are called the dorsal raphe interfascicular part (DRI).

The remainder of the B7 nucleus is divided in to several groups including dorsal raphe ventral (DRV), dorsal raphe ventral lateral (DRVL) or “lateral wings”, and dorsal raphe dorsal (DRD). The B5 and B8 nuclei are segregated as follows: dorsal median raphe is called the Central linear nucleus (CLi) the ventral median raphe is called the interpeduncular nucleus (IPA) and the remainder of the B5/

B8 raphe is simply called the median raphe nucleus (MRN). Additionally, there is also a small population of “scattered” neurons not found in a raphe nucleus called the pontomesencephalic reticular formation (PMRF) neurons.

Topographical Projections of Serotonergic Neurons

5-HT neurons innervate a vast majority of the brain. Numerous studies using retrograde and anterograde tracers have mapped the topographical projection of the various raphe nuclei throughout the brain. (Jacobs and Azmitia,

18

1992; Halliday et al., 1995; Harding et al., 2004; Muzerelle et al 2014; Vertes,

1991). There is a great deal of overlap between brain regions innervated by the

various nuclei, but there appears to be a bias of various regions being innervated

by cytoarchitecurally distinct 5-HT neural populations. The ventral DRN (DRV)

has the greatest projection to the olfactory bulb, nucleus stria terminalis,

amygdala, cortex and medial thalamus with moderate innervation of brain stem

regions such as the substantia nigra and cranial nuclei. The dorsal medial DRN

(DRD) has moderate innervation to the lateral thalamus, anterior and preoptic hypothalamus and parts of the amygdala. The lateral DRN (DRVL) has strong innervation of the lateral thalamus and prepostius nucleus with moderate innervation of medial thalamus, mammillary nucleus and cerebellum. The caudal

DRN (B6 or DRC) moderately innervates regions of the septum, sensory cortex, preoptic hypothalamus and regions of the hippocampus. Compared to the DRN, the MRN has many distinct innervation patterns. The MRN (B8) has strong innervation to the lateral septum, paraventricular nucleus, hypothalamus and hippocampus. Almost all input into the dorsal tegmental and interpeduncular nuclei originate from the MRN. Finally the oft forgotten B9 nucleus has moderate innervation to the caudate putamen, medial septum, locus coeruleus,

periaqueductal gray region, ventral tegmental nucleus, and cerebellum.

Additionally, although B9 is traditionally considered to be part of the ascending

system, it also sends projections down the spinal cord (Muzerelle et al 2014,

Bang et al 2012).

19

Inputs into the serotonergic system

Serotonergic neurons respond to a vast number of

neurotransmitters/signaling molecules including glutamate, GABA, noradrenaline,

neuropeptides, signaling lipids, and 5-HT itself. Over the past few decades,

numerous studies have sought to identify these various inputs and their role in

modulating serotonergic function. As part of my thesis, we discovered PET-1 regulates a large number of these receptors; therefore, here I give a background on the pertinent inputs.

Adrenergic input

The raphe nuclei receive noradrenergic input largely from the locus coeruleus which drives tonic firing of 5-HT neurons (Adell et al, 2002;

Vandermaelen and Aghajanian, 1983). There are 3 classes of adrenergic receptors (AR), α1, α2 and β which respond to noradrenaline (NA) and

adrenaline (Chen and Minneman, 2005; Zheng et al. 2005). All ARs are GPCRs,

encoded by a total of 9 genes which differ on their expression profile,

pharmacological properties, and coupling to downstream effectors. The α1 class

(Gene symbols: Adra1a, Adra1b, Adra1d) is Gq/11 linked; the α2 class (Gene

symbols: Adra2a, Adra2b, Adra2c) is Gi/o linked, and the β ARs (Gene symbols:

Adrb1, Adrb2, Adrb3) are coupled to the Gs and/or Gi/o pathways. Expression

analysis suggests Adra1b and Adra2a are the predominate isoforms found within

the DRN, with lesser expression of Adra1a and Adra2c. Adra1d, Adra2b and

Adrb1-b3 have little or no expression within the DRN (Day et al., 1997, 2004;

20

Nicholas et al., 1991; Scheinin et al., 1994). Numerous studies suggest that α1 and α2 receptors have antagonistic roles in modulating 5-HT neuron firing, where

α1 receptors stimulate 5-HT neuronal activity, and α2 receptors inhibit it (Adell et al., 2002; Maejima et al., 2013). In agreement with mRNA expression studies showing a lack of Adrb1-3 RNA in the DRN, the activity of 5-HT neurons are not affected by application of a β AR antagonists (Gallager and Aghajanian, 1976). It is not entirely clear the interplay between NA afferents onto 5-HT verses non-5-

HT neurons in driving serotonergic tone. In vitro recordings on cultured 5-HT neurons and/or genetic targeting of different ARs within the different neuronal types found in the DRN would help elucidate the function of noradrenergic input specifically upon 5-HT neurons.

Glutamatergic inputs

There is abundant evidence that 5-HT neurons respond to glutamate through AMPA and NMDA receptors; however little is known about the specific receptor subunits expressed in 5-HT neurons, nor the role these subunits have on 5-HT neuron function. (Adell et al., 2002; Levine and Jacobs, 1992; Gartside et al., 2007; Weber et al, 2015; Maejma et al., 2013). Below is a brief summary of the different glutamate receptors and what is known about their role in 5-HT neurons.

Glutamate is the major excitatory neurotransmitter in the mammalian brain, and acts through 4 types of receptors. There are the three ionotropic,

Kainate, AMPA, NMDA receptors, and the metabotropic, mGluR, receptors

21

(Doumazane et al. 2011). Additionally, there are 2 delta (δ) “glutamate”

receptors; however they do not appear to respond to glutamate (Schmidt and

Hollmann, 2008). These receptors play an essential role in a large number of

neuronal processes including neural development, synaptic potentiation, and

learning and memory. However, surprisingly little is known about their function or

expression in 5-HT neurons.

AMPA Receptors. The AMPA receptors are cation channels historically defined by their ability to be activated by the amino acid, α-Amino-3-hydroxy-5-

Methyl-4-isoxazolePropionic Acid (Traynelis, 2010). There are 4 subunits of

AMPA receptors encoded by 4 genes, GluA1-4 also called GluR1-4 (Gene symbol:

Gria1-4). These tetrameric receptors consist of either homotetramers or two

homodimers of a GluR2 subunit and a homodimer of a GluR1, 3, or 4 subunit.

2+ The permeability of AMPA to Ca is dependent on the GluR2 subunit. GluR2

usually undergoes A (adenosine) to I (Inosine) RNA editing which switches the

codon for residue 607 from Q-to-R (glutamine to arginine) making the channel

impermeable to Ca2+.

NMDA Receptors. The NMDA receptors are defined based on their being agonized by the amino acid N-Methyl-D-Aspartic acid (Traynelis 2010). NMDA

receptors are activated by binding of glutamate and a coagonist like glycine or d-

serine (Shleper, et al. 2005). These receptors are both ligand and voltage

dependent as the channels are blocked at a low resting membrane potential by

Mg2+. Upon depolarization, the Mg2+ ion is expelled, allowing the passage of

cations including Ca2+. Receptor subunits are divided into three classes GluN1,

22

GluN2 and GluN3 encoded by 7 genes (GluN1 [Grin1], GluN2A-D [Grin2a-d], and

GluN3A-B [Grin3a-b]). These receptors require two GluN1 subunits and at least

one of the 4 GluN2 subunits. The 4th subunit can either be another GluN2 subunit

or a GluN3 subunit. The GluN2 subunit binds glutamate while the GluN1 and

GluN3 subunits bind to glycine and/or d-serine.

Kainate Receptors. As the name implies, the kainate receptors are

defined by their ability to be activated by red-alga-derived agonist, kainate

(Traynelis 2010). They exist as either homo or heterotetramers and are largely

+ + permeable to Na and K . The 5 kainate receptor subunits GluK1-5, (historically

called gluR5-7 and KA-1, KA-1 respectively) are each encoded by five genes

(Grik1-5). GluK1-3 can form both homo- or heteromeres, but GluK4-5 only

function with GluK1-3.

Metabatropic Glutamate Receptors. There are 8 metabotropic

glutamate receptors mGluR1-8 (gene symbol: Grm1-8). The mGluR1 and

mGluR5 are linked to the Gq pathway while mGluR2-4 and 6-8 are linked to the

Gi/o pathway.

Glutamatergic Input into 5-HT Neurons. As stated above there is a

large body of electrophysiological and histological data demonstrating

glutamatergic input into the 5-HT system. Whole cell recordings of 5-HT neurons indicate glutamate increases cell firing (Adell et al., 2002; Levine and Jacobs,

1992) due to direct activation of AMPA, NMDA and kainate receptors.

Administration of various AMPA and NMDA agonist increase 5-HT cell firing in a

23

concentration dependent manner which are blocked by their respective

antagonist (Gartside et al., 2007; Weber et al, 2015). In agreement with glutamatergic innervation, 5-HT neurons are closely associated with

glutamatergic terminal makers VGLUT1, VGLUT2, and PSD-95 localized near

their dendrites (Crawford et al., 2011; Soiza-Reilly et al. 2011).

Surprisingly few studies have sought to identify the specific receptor

subunits found on 5-HT neurons (Soiza-Reilly et al. 2011; Templin et al., 2012;

Weber et al., 2015). Immunohistochemistry indicates the presence of the AMPA

receptor subunit GluA1 (Gria1) in 5-HT neurons (Weber et al., 2015). Two

additional studies reported expression of glutamate receptors in the DRN based

on their surveying Allan Brain Atlas’s in situ hybridization database (Soiza-Reilly

et al. 2011; Templin et al., 2012). They reported high expression of all 4 AMPA

subunit RNA (Gria1-4); high expression of NMDA gene Grin1; kainate receptor

subunits Grik2, Grik5; and high expression of metabotropic receptor genes Grm4

and Grm5. They also reported moderate expression of kainate receptors Grik1,

3, 4, and low levels of Grin3a and Grm1 with very low or undetectable expression

of the remainder of the glutamate receptors, including the δ-receptors.

Recently, the 5-HT-specific function of GluA1 was investigated in vivo by

deleting Gria1 specifically within adult 5-HT neurons in mice (Gria1fl/fl; Tph2-

CreER; Weber et al., 2015). These mice showed no depressive phenotype in the

tail suspension or forced swim test, but showed anxiety-like behaviors in the

light-dark box, elevated O-maze, and novel cage exploration tests. These mice

also had a ~40% decrease in midbrain but not forebrain 5-HT. Additionally, raphe

24 neurons from these mice had a potentiated response to AMPA and reduced autoinhibitory response to 5-HT.

Hypocretin Signaling

The hypocretins (HCRT), also called orexins, are neuropeptides which modulate multiple physiological processes including food intake, emotion, attention, and arousal (Li et al., 2016). The two hypocretins, HCRTA, HCRTB are generated from the cleavage of a single precursor protein. Hypocretin is produced in the posterior hypothalamus and sends projections which directly synapse on 5-HT neurons (Peyron et al. 1998). Two receptors have been identified which respond to hypocretins. Both are GPCRs linked to multiple effector pathways. Both hypocretin receptors, HCRTR1 and HCRTR2 (Gene symbols: Hcrtr1, Hcrtr2) are expressed in the DRN in 5-HT and non-5-HT neurons (Brown et al., 2002; Wang et al. 2005). HCRT stimulation exerts a neuroexcitory effect on 5-HT neurons as DRN administration of HCRT or a receptor agonist depolarized 5-HT neurons, whereas receptor antagonists hyperpolarize 5-HT neurons (Brown et al., 2001, 2002; Ishibashi et al., 2015; Liu et al., 2002).

At least part of HCRT function in 5-HT neurons is modulating arousal

(Hasegawa et al., 2014; Li et al., 2016). The 5-HT system has long been known to control sleep patterns. 5-HT neuronal activity is highest in awake animals, lower in slow-wave sleep and almost quiescent during REM (rapid eye movement) sleep (Portas et al. 2000). HCRT neuronal simulation increase probability of sleep-wake transitions and HCRT receptor antagonists are sleep-

25

promoting in animals and humans (Li et al., 2016). Additionally, approximately

90% of individuals with narcolepsy have low levels of HCRT in their CSF, and mutations in HCRT or its receptors cause narcolepsy/cataplexy (spontaneous

wake to sleep transitions/ and loss of muscle control) in dogs, mice and sheep

(Tsujino and Sakurai, 2013)

Driving Hcrtr2 expression in 5-HT neurons in an otherwise Hcrtr1/r2 double knockout background almost completely rescued cataplexy, but had no effect on REM sleep initiation or duration (Hasegawa et al. 2014). It is unclear

from these experiments the unique roles Hcrtr1 and Hcrtr2 have in 5-HT neurons.

Additional caveats are it is unknown how the AAV-Pet-1-Hcrtr2 recapitulates the expression levels, or 5-HT neuronal subpopulations which naturally express Hcrt receptors.

Additionally, Hcrtr1 and Hcrtr2 have opposing roles in mediating depressive like behaviors in mice (Scott et al. 2011). Loss of Hcrtr1 leads to antidepressive phenotypes where loss of Hcrtr2 has depressive phenotypes. As to if these phenotypes are mediated through its action on 5-HT neurons has remained to be explored.

Lysophosphatidic Acid Receptors

Lysophosphatidic acid (LPA) is a class of extracellular signaling lipids which are metabolites of membrane phospholipids. LPA generally refers to 18:1 oleoyl-LPA (1-acyl-2-hydroxy-sn-glycero-3-phosphate), however LPAs vary in their acyl chain lengths and degree of saturation (Tokumura, 1995). LPA signals at least through the six LPA receptors, LPA1-6 (Gene symbols: Lpar1-6). These

26

are GPCRs coupled to diverse pathways including Gs, Gq/11, Gi/o. G12/13

(Fukushima et al. 1998). These receptors are ubiquitously expressed and play

roles in cell survival, proliferation, migration, and morphology in the development

of the vascular endothelium, bone tissue, adipocytes, and immune cells (Sheng

et al. 2015). In the CNS, LPA affects cell differentiation, influences neural

morphology, neurite retraction, and neural polarity (Yung et al., 2015). LPA1 is

the most studied LPA receptor. LPA1-deficent mice show reduced ventricular

zone thickness, increased cortical cell death, as well as a reduction in

proliferation, differentiation, and survival of adult-born neurons in the hippocampus (Estivill-Torrus et al., 2008; Matas-Rico et al., 2008). With regard to serotonergic function, LPA1 is functionally expressed in 5-HT neurons and

Lpar1-/- mice show decreased serotonin turnover (Harrison et al., 2003;

Spaethling et al., 2014). Furthermore, LPA1 deficient mice show altered

adaptation to chronic stress, increased anxiety, and decreased fear extinction

although it is unknown if this is mediated through the 5-HT system (Castilla-

Ortega, et al. 2010; Castilla-Orgeta et al., 2011).

Serotonin Receptors

Classically there are 14 serotonin receptors, however due to alternative

splice variants, hetero and homo dimers, and RNA editing there are potentially

dozens of receptors each with unique expression patterns and physiological and

pharmacological properties (Figure 1; Hoyer, et al. 2002). The serotonin

receptors are divided into 7 families (5-HT1-7) comprised of 17 genes in humans

and 14 genes in mouse. Of these, all are G-protein coupled receptors except for

27

the 5-HT3 receptor which is a ligand-gated cation channel (Hannon and Hoyer

2008). The different 5-HT receptors were originally defined by their

pharmacologic properties in conjunction with their mRNA expression patterns.

Serotonin Receptor 1 Family

The 5-HT1 receptor family comprises 5 single-exon genes, each encoding

one of the 5-HT1A, 1B, 1D, 1E and 1F receptors. Due to historical class

reassignment, there is no 1C receptor. All 5-HT1 receptors are G-protein coupled

receptors linked to the Gi/o signaling pathway which inhibits adenylyl cyclase,

decreasing intracellular cAMP concentrations leading to closing of cAMP

dependent Ca2+ channels (De Vivo and Maayani, 1986).

5-HT1A Receptor. 5-HT1A is the most studied serotonergic receptor. It is

localized to the somadendritic region of both 5-HT and non-5-HT neurons where

it acts to inhibit neuronal firing by activating GIRK (G-protein inner rectifying K+), channels, increasing K+ conductance, thereby hyperpolarizing the neuron

(Aghajanian, and Lakoski, 1984; Llamosas et al., 2015; Luscher et al. 1997; Riad

et al. 2000). 5-HT1A is found in a majority of 5-HT neurons where it functions as a 5-HT autosensor to modulate serotonergic tone (Andrade et al., 2015;

Fernandez et al, 2015; Kiyasova et al., 2013). It is also expressed in non-5-HT

neurons in areas including the hippocampus, amygdala, thalamus, hypothalamus

and septum found mainly in granular cells and GABA interneurons (Albert et al.,

1996; Garcia-Garcia et al., 2014; Tanaka et al., 2012). Knockout and

pharmacological studies in mice, and pharmacological studies in humans

28

implicate this receptor in a wide variety of psychiatric-related behaviors including

modulating anxiety and stress (Glikmann-Johnston et al., 2015; Gross et al.,

2000; Gross et al., 2002; Heisler et al., 1998; Kennett et al., 1987; Loane and

Politis, 2012). Additionally, PET (positron emission tomographic) studies show a correlation between reduced 5-HT1A bindings in individuals with anxiety

disorders. Variation in HTR1A, especially at the C-1019G polymorphism has been linked to stress induced depression, bipolar disorder, major depressive disorder and possibly schizophrenia (Albert 2012; Kim et al. 2011; Kishi et al.

-/- 2011). Mice with a genetic deletion of 5-HT1A (Htr1a ) have increased anxiety

behaviors (Heisler et al., 1998; Parks et al., 1998; Ramboz et al., 1998). Multiple pharmaceutical and genetic studies have investigated the temporal and spatial role of 5-HT1A in mediating anxiety, depressive and stress-adaptive responses

(Bert et al., 2006; Gross et al., 2002; Kusserow et al., 2004; Piszczek 2013,

2015; Richardson-Jones et al., 2010, 2011) Although studies differ on the exact

function of the hetero/auto receptors, it appears that the heteroreceptors are

sufficient to reduce or rescue the anxiety phenotype found in Htr1a-/-, whereas

autoreceptors play less of a role in mediating this behavior.

5-HT1B Receptor. Htr1b is expressed in the globus pallidus, hippocampus,

superior colliculus, caudate putamen, trigeminal nerve, and dorsal raphe nucleus

localized to axons and terminals (Riad et al., 2000; Sari, 2004; Voigt et al., 1991).

Pharmaceutical and genetic analyses of the 5-HT1B receptor suggest it plays a

role in psychiatric, substance abuse, and pain disorders. Specifically, mice

deficient in 5-HT1B show increased aggression and decreased anxiety (Saudou

29

et al., 1994; Zhuang et al., 1999). In humans, polymorphisms in HTR1B have

been linked to drug and alcohol abuse, major depression and obsessive

compulsive disorder (Cao et al., 2013; Huang, 2003; Mas et al., 2014).

Additionally, 5-HT1B is a target for the classes of antimigraine medication called

the triptans which are 5-HT1B, 1D and 1F receptor agonists and are a major

treatment for migraines by constricting cerebral blood flow, inhibiting

neuropeptide release from the trigeminal nerve and decreasing pain transmission

(Durham and Russo, 2002).

5-HT1D Receptor. The 5-HT1D receptor is pharmacologically similar to the 5-HT1B receptor. This receptor is found in CNS areas including the dorsal raphe nucleus,

caudate putamen, nucleus accumbens, olfactory cortex, locus coeruleus, and

trigeminal nerve. As stated above, it is believed that its action in the trigeminal

nerve may play a role in migraines (Durham and Russo 2002). Additionally, it

may mediate anxiety-related behaviors, as treatment with GR127935, a 5-HT1B/1D

receptor antagonist, has anxiolytics effects in forced swim test in guinea pigs

(Rex et al., 2008). Although there are Htr1d knockout mice reported in the

Mouse Genome Informatics, MGI database (www.informatics.jax.org), no

phenotype has been published. Interestingly, Htr1d seems to be a good marker for gamma motor, and proprioceptive sensory neurons (Enjin et al., 2012).

5-HT1E Receptor. There is little data on the function of 5-HT1E due to lack of 1E-

specific pharmaceuticals or genetic animal models. There appears to be no

ortholog in rats or mice, but its expression pattern has be identified in the guinea

pig where it is found mainly in the hippocampus and olfactory bulb with lesser

30

expression in the thalamus, pons, hypothalamus, midbrain, striatum, and

cerebellum (Bai et al., 2004; Klein and Teitler, 2012).

5-HT1F Receptor. The 5-HT1F receptor is also of interest as a potential

therapeutic target for migraines. This receptor is expressed in olfactory cortex,

caudate putamen, hippocampus, cingulate, frontal cortex, and trigeminal nerve

(Amlaiky et al., 1992; Hannon and Hoyer, 2008). Although the existence of an

Htr1f knockout mouse was also reported in MGI, there is no published

phenotypic characterization of this mouse. Currently the 1F receptor agonist,

lasmiditan, is under clinical trials for treatment of migraines (Nelson et al., 2010;

Reuter et al., 2015)

Serotonin 2 Receptors

The 5-HT2 (5-HT2A-C) family consists of three Gq/11-linked, G-protein coupled receptors, each encoded by a separate gene called Htr2a, Htr2b, and Htr2c

(Hannon and Hoyer, 2008). Upon binding of 5-HT, the Gq subunit activates

phospholipase C which cleaves phosphatidylinositol 4, 5 bisphosphate (PIP2)

thereby creating inositol triphosphate (IP3). IP3 binds to ligand-gated calcium

channels on endoplasmic reticulum leading to release of intracellular Ca2+ stores

(Hoyer et al., 1988, 1989).

5-HT2A Receptor. The 5-HT2A receptor is of great pharmacological importance.

Based on their high affinity for the 2A receptor, it has been hypothesized that

much of the therapeutic effects of atypical antipsychotics such as clozapine and

risperidone acts through their antagonism of this receptor (Corena-McLeod,

31

2015; Meltzer 2002; Richtand et al. 2008). Additionally, it’s believed this receptor is largely responsible for the hallucinogenic effects of lysergic acid diethylamide

(LSD) and psilocybin (Gonzalez-Maeso and Sealfon, 2009; Roth et al., 1998). 5-

HT2A is highly expressed in the olfactory bulb, pyramidal and interneurons of the neocortex, and several cranial nerve nuclei (Hannon and Hoyer 2008;

Pompeiano et al., 1994). Interestingly, cortical 5-HT2A function appears to mediate a “top down” risk assessment as, Htr2a-/- mice show decrease anxiety in light-dark box and elevated plus maze which was restored with expression of

Htr2a only in cortical neurons (Weisstaub et al., 2006). Multiple splice variants have been identified in humans, however little is known about how these variants affect receptor function (Guest et al., 2000; Smith et al., 2013). Allelic variation in this gene has been linked to major depressive disorder, and to the effectiveness of antidepressants in treating depression (Lin et al., 2014; Zhao et al. 2014).

Additionally, there is a possible link with this gene and schizophrenia, however this is debated (Ni et al., 2013; Sujitha et al., 2014; Yidiz et al., 2013).

5-HT2B Receptor. The mouse 5-HT2B receptor was originally cloned in 1992

(Foguet et al., 1992; Kursar et al., 1992). It appears to mainly function in the periphery and is highly expressed in the liver, kidney, fundus, heart, lungs, and pancreas (Bonhaus et al., 1995). In the rat brain, low expression is also found in the cerebellum, lateral septum, dorsal hypothalamus and medial amygdala

(Duxon et al., 1997; Kursar et al., 1994). No splice variants have been reported.

Even though, its CNS expression is low, is appears to mediate social interaction, learning and memory, locomotor activity, sleep and assists in 3,4-

32 methylenedioxymethamphetamine (MDMA ecstasy) induced hyperlocomotion

(Bevilacqua et al., 2010; Doly et al., 2008; Pitychoutis et al., 2015). 5-HT2B also plays a critical role in heart development and function, as 30% of Htr2b-/- mice exhibit gestational lethality associated with cardiac malformations, with another

30% dying in first postnatal week due to heart defects. Mice surviving to adulthood have cardiomyopathy and abnormal cardiac tissue morphology

(Nebigil et al., 2000, 2001). Of note, due to unanticipated activation of 2B receptors in the lungs and heart by a metabolite of the weight-loss drug, Fen-

Phen, multiple patients developed valvular heart disease and pulmonary hypertension leading to its removal from the market in 1997 (Hutcheson et al.,

2011; Rothman and Baumann, 2009).

5-HT2C Receptor. The 2C receptor was the first of the 5-HT2 receptor family to be cloned, and was originally classified as the 5-HT1C receptor (Humphrey et al.,

1993., Julius et al., 1988) Its expression is highest in the neocortex, hippocampus, striatum, hypothalamus, amygdala and choroid plexis (Pasqualetti et al. 1999; Pompeiano et al. 1994). This receptor plays a role in reward seeking behavior, locomotion, seizure susceptibility, and energy balance (Berglund et al.

2013; Giorgetti and Tecott, 2004; Tecott et al., 1995). It also may play a role in the hallucinogenic effects of LSD (Passie et al., 2008). Interestingly, this receptor undergoes adenosine-to-inosine RNA editing which leads to 32 potential mRNAs encoding 24 different protein isoform (Morabito et al., 2010; O’Neil and Emeson,

2012). These protein variants bestow differential efficacy in the coupling to downstream signaling pathway, and affects the degree of ligand-independent

33

constitutive receptor activity. Of note, the 2C receptor agonist, Lorcaserin, was

recently approved by the FDA as a weight loss drug which is believed to act on

POMC neurons of the arcuate nucleus of the hypothalamus triggering satiety

(Aronne et al., 2014; Thomsen et al., 2008; Voigt and Fink, 2015). Because of

the 2C receptor’s role in energy balance, the hyperphagic associated weight gain

associated with atypical antipsychotics have been partially attributed to inhibition

of this receptor. In agreement with this hypothesis, polymorphisms in the HTR2C

allele have been linked to susceptibility of antipsychotic-induced weight gain (Ma

et al., 2014).

Serotonin 3 Receptor

The 5-HT3 receptor is the only 5-HT ligand gated ion channel. In the

human, there are five genes (HTR3A-E) encoding 5 channel subunits, whereas

rodents only have the 5-HT3A and 3B subunit genes (Barnes et al 2009; Holbrook

et al., 2009; Karnovsky et al., 2003; Niesler et al., 2003; Niesler et al., 2007).

The channels consist of a pentamer requiring at least one 5-HT3A subunit

(Barrera et al., 2005; Boess et al., 1995). Upon binding of 5-HT, the channels

become permeable to Na+, K+ and Ca2+ (Peters et al., 2010). Incorporation of

3B-E subunits affects the pharmacological properties of the channels. For example, incorporation of the 3B subunit increases channel conductance and decreased Ca2+ permeability (Davies et al., 1999; Noam et al., 2008). Except for

HTR3C, multiple splice variants have been identified in humans, which also can

affect channel localization and functional properties (Corradi et al., 2015;

Holbrook 2009; Jensen et al., 2008; Niesler 2007, 2008, 2011). In the brain,

34

receptors are mostly found presynaptically on axon terminals of inhibitory

neurons (Miquel et al., 2002). These receptors are also expressed in dorsal vagal

complex where it modulates the vomiting reflex and in the caudate nucleus and

putamen, amygdala, hippocampus, and cortex (Barnes et al., 2009). In the

periphery, they are found in human GI tract, liver, and kidney (Kapeller et al.,

2011; Niesler 2003). SNPs in all subunits have been linked to human disorders

including: Autism spectrum disorders, alcohol and drug abuse, bipolar disorder,

and irritable bowel disorder (Gu et al., 2015; Walstab et al., 2010).

Serotonin 4 Receptors

The 5-HT4 receptor is positively coupled to adenylyl cyclase (Gs), and can be activated in both a ligand-dependent (5-HT) and ligand-independent manner

(Gerald et al., 1995). Although the 5-HT4 receptor is encoded by a single gene, it

produces multiple splice-variant isoforms; many with unique expression patterns

(Gerald et al., 1995; Brockaert et al., 2008 ; Claeysen et al., 1996; Claeyson et

al., 2001). Initial functional characterization of these isoforms in heterologous

cell systems indicates they all have a similar pharmacological response to 5-HT binding (Bach et al., 2001; Vilaro et al., 2002). However, they differ to the degree

of their ligand-independent activation activity. Unfortunately, it is unknown what

role of 5-HT-independent signaling has in vivo. The 5-HT4 receptor is expressed

in the hypothalamus, hippocampus, nucleus accumbens, amygdala, ventral

tegmental area, and frontal cortex as well as the heart, GI tract, and adrenal

gland (Gerald et al, 1995). These receptors mediate stress-induced anorexia;

locomotor activity; and learning and memory (Bockaert et al., 2008; Compan et

35 al., 2004). Additionally Htr4-/- mice show increased sensitivity to phenothiazine- induced seizures compared with wild-type mice suggesting a possible role for this receptor in seizure disorders (Compan et al., 2004).

Serotonin 5 Receptor Family

The 5-HT5 receptors are among the least studied of the 5-HT receptors because, until recently, there was no good 5-HT5 specific drugs (Hannon and

Hoyer, 2008; Yamazaki et al., 2015). Two 5-HT5 genes have been identified in rodents termed Htr5a and Htr5b. However, in most mammals, including humans,

Htr5b is likely a pseudogene due to several stop codons in the coding sequence

(Grailhe et al., 2001). The 5A receptor has only 2 exons and no reported splice variants. It is coupled to the Gi/o pathway and can activate GIRK currents

(Francken et al., 1998; Goodfellow et al., 2012; Thomas et al., 2004). It appears to be CNS specific with brain expression found in layers II, III, V and VI in the cortex, hippocampus, dorsal and median raphe, suprachiasmatic nucleus and

Purkinje cells of the cerebellum (Chen et al., 1998; Duncan et al., 2000, Geurts et al., 2002; Oliver et al., 2000; Pasqualetti et al., 1998). Mice lacking 5A show increase exploratory activity but no anxiety-related behaviors (Grailhe et al.,

1999). Furthermore, this receptor partially mediates the effects of LSD as LSD- induced stimulation of exploratory behavior in mice was attenuated in Htr5a-/- mouse (Grailhe et al. 1999). Variation in HTR5A is linked to susceptibility to schizophrenia and possibly bipolar disorder (Arias et al., 2001; Dubertret et al.,

2004; Yosifova et al., 2009).

36

Serotonin 6 Receptor

This receptor is encoded by a single gene and is coupled to the Gs pathway (Monsma et al, 1993; Ruat et al, 1993). Although an alternative splice variant has been identified in humans, its role is unknown (Olsen et al., 1999).

This receptor has high expression in the caudate nucleus and nucleus accumbens with lower levels in the hippocampus and amygdala, striatum, and is mostly found in cell bodies and dendrites of neurons (Hamon et al., 1999;

Marazziti et al. 2012). Pharmacological studies implicate this receptor in drug seeking behaviors, cognition, and sleep (Frantz et al. 2002; Hamon et al., 1999;

Mitchell et al. 2009; Morairty, 2008). However, Htr6-/- mice show no disrupted circadian rhythm, no change in locomotor activity, and no learning defects

(Bonasesa et al., 2006; Frassetto et al., 2008). This stark contrast in phenotype suggests compensation to developmental loss of Htr6 or off-target effects of the

5-HT6 drugs. These mice do show reduced alcohol-induced ataxia and reduced food intake on a high-fat diet (Bonasesa et al. 2006; Frassetto et al. 2008).

Additionally, evidence suggest these receptors play a role in cortical development by promoting neurite outgrowth and arborization, neuronal migration, and cellular proliferation (Dayer et al., 2015). Due to its proposed role in cognition and cortical neuronal growth, multiple labs are investigating this receptor as a potential therapeutic target of Alzheimer’s disease (Benhamu et al.,

2014).

37

Serotonin 7 Receptors

The cloning of the 5-HT7 receptor was first reported in 1993, and was

found to be coupled to the Gs pathway (Lovenberg, et al. 1993; Bard, et al., 1993;

Ruat et al., 1993). In the CNS, it’s localized to hypothalamus, thalamus,

hippocampus, cortex on dendrites and axon terminals, where it plays a role in

thermoregulation, in some forms of memory, and circadian rhythm (Belenky et

al., 2001; Glass et al. 2003; Guscott et al. 2003; Leopoldo et al., 2011; Roberts

and Hedlund, 2012). In the periphery, it’s found in blood vessels and intestines

where it mediates vasoconstriction, vasodilation, and ilium peristalsis

(Vanhoenacker et al., 2000). Multiple evolutionarily conserved and species-

specific splice variants have been identified; many with tissue-specific expression

patterns (Heidman, et al., 1997, 1998; Jasper, et al., 1997). However, the 3

human variants don’t differ in their pharmacological properties, at least in vitro

(Krobert and Levy, 2002). Experiments on rodent models, and human

association studies suggests 5-HT7 is involved in anxiety, schizophrenia, pain

disorders, and substance abuse (Hedlund, 2009).

Development of the Serotonin System The development of the serotonin system can be divided into several phases lasting for several weeks in the mouse and years in the human (Figure 3;

Deneris and Wyler 2012). In the prepatterning phase, both intrinsic and extrinsic cues generate neuroprogentors cells competent to produce 5-HT neurons. A

second phase accompanies the generation of committed postmitotic precursors

which are destined to become 5-HT neurons, but have yet to acquire 5-HT

38 neuronal characteristics. In a third maturational phase, 5-HT neurons express genes needed for cellular migration, firing characteristics, and circuit formation.

The neuron then enters the final phase where the neuron acts in a mature neural circuit.

Hindbrain Patterning Anterior/posterior axis During gastrulation the presumptive nervous system develops from dorsal ectoderm. As the neural plate develops into the neural tube (neurulation), an early observation (3rd week human ~E9 mouse) is three “bulges” (vesicles) and two constrictions which appear along the anterior posterior (AP) axis demarking the prosencephalon (forebrain), mesencephalon (midbrain), and rhombencephalon (hindbrain; Baldock et al., 2015). Soon after, within the rhombencephalon, multiple additional “bulges” develop called rhombomeres.

These structures (numbered rostral-caudally as r1, r2, etc.) have been extensively characterized along the AP axis as their positioning correlates with boundaries of Hox gene expression which are essential for the AP positioning of cranial nuclei (Tumpel et al., 2009). A narrowed region between the mesecephalon and rhombencephalon designates the mid/hindbrain boundary

(MHB) also called the mid/hindbrain organizer (MHO) or isthmic organizer

(Figure 4). Transcriptional regulators and secreted factors expressed at the MHB are critical for the proper placement and development of midbrain and hindbrain structures, and for the genesis of neuronal types including dopaminergic and serotonergic neurons.

39

During development, the MHB serve as a division of the presumptive midbrain and rostral hindbrain termed mesencephalon and metencephalon respectively. Early chick/quail transplantation studies identified this region as a crucial organizer for the development of the mesencephalon and metencephalon

(Alvarado-Mallart, 1993). By mouse embryonic day, 7.5 (E7.5, 0 somite stage) the presumptive MHO is demarked by the restricted antagonistic expression of two homeodomain transcription factors, OTX2 (Orthodenticle homeobox 2) and

GBX2 (Gastrulation brain homeobox 2) which define the future mesencephalon and metencephalon boundaries (r1-r2 hindbrain) respectively (Joyner et al.,

2000; Sunmonu et al., 2011; Wurst and Bally-Cuif, 2001). Reduced OTX2 function leads to rostral expansion of the MHO, Gbx2 expression, mesencephalic dopamine neurons, and serotonergic (5-HT) neurons (Acampora et al., 1998;

Brodski et al., 2003; Martinez-Barbera et al., 2001; Sakurai et al., 2010), whereas ectopic expression of OTX2 in r1 leads to the caudal expansion of midbrain structures (Broccoli et al., 1999; Brodski et al., 2003). Conversely, in Gbx2-/- mice, Otx2 expression and the MHB are shifted caudally, and fail to form r1-3 hindbrain structures (Millet et al., 1999; Wasserman, et al., 1997). Additionally, missexpression of GBX2 in the midbrain leads to repression of Otx2 in the posterior midbrain and a rostral shift of midbrain structures and genes (Millet et al., 1999; Katahira et al., 2000). Although OTX2 and GBX2 are essential for the proper positioning of the presumptive MHB, they appear to be dispensable for the induction of the subsequent morphogenic factors Wnt1 (Wingless-type 1) and

Fgf8 (Fibroblast growth factor 8) and the homeobox transcription factors Pax2

40

(Paired box 2) and En1 (Engrailed 1) all which are required for hindbrain

formation (Li and Joyner, 2001; Martinez-Barbera et al., 2001).

Between E7.75 and E8.5, transcription factors and morphogens begin to

be broadly expressed in the MHB region. Initially, Pax2 is expressed at the presomite stage, sequentially followed by the induction of En1 and Wnt1 (1-2

somite stage) and then En2, Pax5, and Fgf8 (3-5 somite stage; Asano and

Gruss, 1992; Davis et al., 1988; Davis and Joyner, 1988; Joyner, 1996; Rowitch

and McMahon, 1995; Song et al., 1996; Ye et al., 2001). By E9.5 the expression

of En1, Pax2, Fgf8, Wnt1 and En2, and Pax5 all become more restricted towards

the MHB (Joyner et al., 2000).

Identification of the function of PAX2 in hindbrain development is

complicated by the fact that the phenotype of Pax2 mutant mice is highly

dependent on background with some mutant strains dying in utero, while others

seem largely unaffected and survive to adulthood (Favor, et al., 1996; Schwartz

et al., 1997; Torres et al., 1996; Ye et al., 2001). In one study, Pax2 mutants

show malformation of the inferior colliculi, cerebellum and failure of closure of the

neural tube (Favor et al., 1996). A second study also reported the loss of neural

tube closure; however they didn’t examine the inferior colliculi or cerebellum

(Torres et al., 1996). A third study of Pax2-/- mice reported no overt phenotype of

Pax2-/- mice, but Pax2/Pax5 double knockout mice show a loss of colliculi and

cerebellum (Schwartz et al., 1997). There also appears to be a discrepancy in

PAX2 regulation of Pax5, En2, and Fgf8 as some report these genes are targets

of PAX2 while others say PAX2 is dispensable for their expression (Schwartz et

41

al., 1997; Torres et al., 1996; Ye et al., 2001). Identification of strain-specific

PAX2 genetic modifiers may help clarify PAX2’s developmental function.

The two mammalian Engrailed (EN) paralogs, En1 and En2, act in a partially compensatory manner to control of the development of dorsal midbrain

structures including the colliculi and hindbrain structures including the cerebellum

(Joyner et al., 1991; Millen et al., 1994; Orvis et al., 2012; Simon et al., 2005;

Wurst et al., 1994). Loss of En1 (En1-/-) leads to mid and hindbrain defects

including loss of the inferior colliculi; cranial nerves III and IV; almost complete

loss of the cerebellum, while loss of En2 only has a modest effect on cerebellar

development. In En1/2 double knockout mice, there is a more severe loss of

midbrain superior and inferior colliculi and hindbrain cerebellum. Even though

Engrailed is required for the formation of mid/hindbrain structures, the MHO

genes—Fgf8, Pax5, and Wnt1 are still induced in the normal temporal pattern in

En1/2 double knockout mice, but expression fades soon after, suggesting

Engrailed is dispensable for induction, but is required to maintain expression of

these genes either directly, or through its prevention of death of hindbrain tissues

(Chi et al., 2003; Liu and Joyner, 2001; Simon et al., 2005). Interestingly, 5-HT

neurogenesis appears to be largely spared in En1 null mice, as at P0, the gross

organization of DRN 5-HT neurons appear normal, although, there is a small

decrease in 5-HT neurons (Simon et al., 2005). However in Engrailed double

mutants (En1/2-/-) ; there is almost a complete loss of the r1 derived DRN 5-HT

neurons, with a general sparing of r1-r3 derived MRN 5-HT neurons (Simons, et

al., 2005, Jenson et al., 2008).

42

Between E8.0 and E8.5 two secreted molecules, WNT1 and FGF8; begin

to be produced in adjacent regions of the mes and metencephalon respectively

(Figure 4A). During the next day, expression becomes more restricted with Wnt1

expression becoming largely limited to the caudal midbrain, and Fgf8 to the

rostral metencephalonic region (Crossley and Martin et al., 1995; Heikinheimo et

al., 1994). Either by use of an Fgf8 hypomorphic allele, or conditional deletion of

Fgf8 only in En1 expressing cells of the mid/hindbrain region (Fgf8flox/flox ; En1-

Cre:ER), it was determined that FGF8 directs the development of the mid and

hindbrain by inducing and/or maintaining expression of several MHO genes

including Wnt1, Gbx2, and other Fgfs (Fgf17, Fgf18), and by inhibiting apoptosis

of these structures (Chi et al., 2003; Meyers et al., 1998; Sato and Joyner, 2009).

The FGF receptor 1, (FGFR1), plays a major role in development/maintenance of

the r1 hindbrain region, and for the generation of r1-derived 5-HT neurons.

flox/flox Conditional loss of Fgfr1 (Fgfr1 ; En1-Cre) in the MHO region results in caudal expansion of midbrain markers and expression of tyrosine hydroxylase+

neurons with a corresponding reduction of r1 expression of the 5-HT neural

marker Pet-1 and a major reduction in 5-HT staining in rostral region of

ascending 5-HT system. No effect was seen in r2-r3-derived 5-HT neurons, or in

the caudal 5-HT system (Jukkola et al., 2006). Conditional loss of Fgfr2

(Fgfr2flox/flox; En1-Cre) or germline loss of Fgfr3 (Fgfr3-/-) show no defects in MHB gene expression or development.

The morphogen, WNT1 is also essential for mid/hindbrain development.

WNT1 is expressed in the presumptive mesoderm beginning by the 1-somite

43 stage and becomes increasing restricted to the rostral portion of the MHO

(Echelard et al., 1994; Wilkinson et al., 1987). Wnt1-/- mice have a largely disrupted mesencephalon, cerebellum and rostral hindbrain associated with loss of En1, En2, Pax5 and Fgf8 expression (Danielian and McMahon, 1996;

McMahon and Bradley, 1990; Simon et al., 2005; Thomas and Capecchi, 1990).

Much of this morphological phenotype results from the loss of Engrailed expression, as Wnt1-/- mice with rescued En1 expression driven by the Wnt-1 locus (Wnt-1-En1; Wnt-1-/-) show a variable yet substantial rescue of the mesencephalon, rostral hindbrain, and cerebellum associated with restored expression of hindbrain genes Pax5 and Fgf8 (Danielian and McMahon, 1996).

The large body of literature identifying the intrinsic and extrinsic cues driving mid/hindbrain formation and organization has provided much insight into the development of this brain region. However, in many of these loss of function and ectopic expression studies, it is difficult to identify the direct verses indirect effect of these cues. It would be pertinent to define the order of autonomous events by using combinations of chromatin immunoprecipitation (ChIP) for the various transcription factors, in vivo reporter assays to verify the function of these

ChIP sites, and inactivation of small sub populations of neurons with techniques such as Mosaic Analysis with Double Markers MADM or simply by using a

Cre:ER, a floxed allele and Cre-activatible reporter with a low dose of tamoxifen to delete the gene in a small subpopulation of neurons (Zong et al., 2005).

44

Dorsal/Ventral Axis

Just dorsal to the floorplate sit bilateral neuroprogenitor populations which

express the homeodomain transcription factor NKX2-2 (named as mouse homologue of drosophila Nk gene class [Price et al 1992]) and give rise to

several neural types including 5-HT, brachial and visceral motor neurons, and

V3 interneurons (Figure 4B; Jarrar et al., 2015a,b). These NKX2-2+ progenitors

are commonly referred to as p3 cells. By E8.5, the notochord and floorplate

(ventral midline of neural tube) produce the morphogen Sonic Hedgehog (SHH)

which is an essential inductive cue required for ventral neural development

(Echelard et al., 1993; Marti et al., 1995). Inhibition or loss of SHH or its

downstream effectors, the transcription factors, GLI-1 or GLI-2, results in

disrupted floorplate development, and reduced number of p3 progenitors

resulting in an almost complete loss of the p3-derived 5-HT neurons (Chiang et

al., 1996; Matise et al., 1998; Ye et al., 1998). Additionally, a mutated

constitutively active SHH receptor, Smoothen, suppress dorsal markers and

activate ventral markers such as NKX2-2/NKX2-9 and leads to ectopic induction

of dopamine and 5-HT neurons in the dorsal mid and hindbrain regions

respectively (Craven et al., 2004; Hynes et al., 2000). Additionally, GLI2 activates

the 5-HT promoting TF Ascl1/Mash1 by directly binding to its promotor. Prior to

SHH signaling, FGF4 and FGF2 secreted from the primitive streak may also play

a role in preparing the presumptive hindbrain to become competent to produce 5-

HT neurons (Ye et al., 1998).

45

Serotonergic Neuroprogenitor Specification

In the mouse, 5-HT neurons are born between embryonic day 9.5-12

(E9.5-12) and in the human between gestational weeks 5 and 6 (Pattyn et al.,

2003; Sundstrom, et al., 1993). The timing and intrinsic and extrinsic factors driving 5-HT neurogenesis have been extensively studied in the chick and mouse embryo. 5-HT neurons are born in two waves. Initially from E9.5 to E10.5, they are generated in the p3 region in rhombomere 1 (r1; Figure 5; Jacob et al.,

2007). However during this period, p3 progenitors in rhombomeres 2-8 (r2-8) produce visceral motor neurons (vMN). About a day later, p3 progenitors switch from producing vMN to producing 5-HT neurons in r2-3 and r5-8. This switch is associated with a downregulation of the vMN transcription factor, PHOX2B, and upregulation of the 5-HT-promoting transcription factor, FOXA2. In r4, 5-HT neurons are never produced as the p3 neurons always produces vMN (Jacob et al., 2007; Pattyn et al., 2003).

Neural progenitor specification of rhombomere 1 (r1) derived neurons

The p3 domain is demarked by the homeodomain transcription factor,

NKX2-2, which is found in bilateral regions flanking the floor plate found along the entire rostral-caudal axis of the neural tube and acts in DV pattering of the neural tube (Briscoe et al., 1999; Jarrar et al., 2015b). NKX2-2 is induced by the morphogenic signaling of SHH through direct activation of GLI (Vokes et al.,

2007). Although r1 neurons arise from NKX2-2+ cells, loss of NKX2-2 itself doesn’t affect the generation of these neurons, possibly due to compensation

46

from NKX2-9 (Craven et al., 2004). E9.5 expression of FOXA2 facilitates this

early generation of 5-HT neurons as evident by r1 conditional deletion of the

transcription factor, Foxa2 in mice (Foxa2fl/fl; Wnt1-cre) which leads to ectopic

generation of vMN-like neurons in r1 at the expense of 5-HT neurons (Jacob et al., 2007 ). Additionally, PHOX2B is never expressed in r1. It would be interesting to determine if this early expression of Foxa2 is facilitated by r1

restricted transcription factors such as Engrailed and/or signaling molecules such

as FGF8.

Neural progenitor specification of rhombomeres 2-3 and 5-8 (r2-3; 5-8) derived

neurons.

An extensive study by Alexandre Pattyn and colleagues identified an intrinsically-

driven temporal switch in p3 progenitors from the initial generation of vMN to the

generation of 5-HT neurons (Pattyn et al., 2003). Although Nkx2-2 is

dispensable for production of 5-HT neurons in r1, its loss results in loss of 5-HT

neurons in r2-8 with a simultaneous expansion of vMN production without

effecting the generation or maintenance of p3 progenitors (Briscoe et al., 1999;

Craven et al., 2004). Brdu (5-Bromo-2′-deoxyuridine) dating of vMN

neurogenesis indicates that by E11, vMNs are finished being produced from p3

progenitors in r2 and r5. Brdu dating indicates 5-HT neurogenesis commences

between E9.5 and E10.5 in r2-3; r5-8 and has subsided by E11.5. This shift of

vMN to 5-HT neurogenesis is associated with a downregulation of the vMN–

promoting homeobox transcription factor—PHOX2B (Paired-like homeobox 2b)

and NKX2.9. Phox2b and Nkx2.9 expression is downregulated in the ventral

47 hindbrain at the onset of 5-HT neurogenesis, and the loss of PHOX2B in these neurons leads to a premature expression of PET-1 in p3 progenitors.

Recent work suggests that TGF-β2 is critical for establishing the correct timing of the vMN to 5-HT neural fate switch, but is dispensable for 5-HT production (Diaz et al, 2014). During vMN neurogenesis, TGF-β2 is restricted to the floor plate, but its expression expands dorsally into the ventral p3 neurons at the onset of 5-HT neurogenesis. TGF-β2 appears to inhibit Phox2b expression by acting as an autocrine and/or paracrine signal, signaling at least in part through the TGFBR1 receptor. Additionally, TGF-β2 upregulates Tgfbr1, thereby upregulating TGFβ signaling in a feed-forward fashion. Premature activation of

TGFβ signaling through a constitutively active TGFBR1 receptor results in a premature downregulation of Phox2b and premature 5-HT neurogenesis, whereas loss of Tgfbr1 (Tgfbr1fl/fl; Nkx6.2-Cre) results in prolonged vMN generation and a delay in 5-HT neurogenesis. Besides driving the vMN program,

PHOX2B appears to repress the function of 5-HT-promoting transcription factor,

FOXA2, (Diaz et al., 2014; Jacob et al., 2007). In the absence of Tgfbr1, 5-HT neurogenesis commencement is delayed, but not halted, as by E14.5 there are normal numbers of 5-HT neurons in the Tgfbr1 conditional knockout mice. This delayed rescue of 5-HT numbers may result from delayed activation of the TGF-β program or possibly to other signaling molecules which activate effectors downstream of the TGF-β receptors.

48

Neural progenitor specification of rhombomeres 4 (R4) derived neurons

Under normal circumstances, r4, p3 progenitors only produce vMN, but they are competent to produce 5-HT neurons; however 5-HT neurogenesis is

inhibited through maintained Phox2b expression (Jacob et al. 2007; Pattyn et al.,

2003). From E9.5-E10.5, vMN are produced in r4 as in r2-3, r5-8. However, at

the onset of 5-HT neurogenesis in other rhombomeric regions, these cells

continue to express PHOX2B, and produce vMN until E11.5. Loss of the r4

restricted transcription factor, HOXB1, results in expansion of the 5-HT neuron

marker, Pet-1, into the ventral r4 region indicating that HOXB1 represses 5-HT

generation likely by repressing the temporally induced repression of Phox2b in

this region (Pattyn et al., 2003). It is a tantalizing hypothesis that HOXB1

represses the TGFβ-induced temporal fate-switch of vMN to 5-HT neurogenesis.

Repression of 5-HT neurogenesis in the spinal cord

Spinal cord p3 progenitors ordinarily produce SIM1+ V3 interneurons, but

are also competent to produce 5-HT neurons; however 5-HT neurogenesis is

inhibited through a retinoic acid-directed program (Carcagno et al., 2014; Jacob

et al., 2013). Retinoic acid (RA) signals in a graded fashion along the AP axis of

the spinal cord and hindbrain. Using a RA response element-dependent reporter

transgene, the activation of RA has been mapped in the mouse spinal cord and

hindbrain. (Jacob et al., 2013; Maden, 2006). Reporter expression is high in the

rostral spinal cord and low or absent in the rhombencephalon (Jacob et al., 2013;

Maden, 2006). Forced expression of a constitutively active RA receptor (RARCA)

49

in the hindbrain inhibits 5-HT neurogenesis and leads to ectopic generation of

SIM1+ V3 interneurons, whereas inhibition of RA signaling in the rostral spinal

cord leads to ectopic generation of 5-HT+ cells at the expense of V3

interneurons. RA inhibition of 5-HT neurogenesis in the spinal cord is mediated

(at least in part) through activation of the BHLH transcription factor Neurogenin 3

(NEUROG3; Caragno et al., 2014). Neurog3 is found in spinal cord p3

progenitors, but is absent from hindbrain p3 cells. As with RARCA hindbrain

electroporation, Neurog3 electroporated into the hindbrain leads to ectopic

generation of V3 neurons. Conversely, Neurog3-/- mice show ectopic 5-HT

neurons produced in the spinal cord. NEUROG3 appears to inhibit 5-HT

neurogenesis by inhibiting expression of the 5-HT neuron-promoting transcription factor ASCL1 (Achaete-Scute complex-like 1) by activating the ASCL1 repressor,

HES5 (Hairy enhancer of split 5; Caragno et al., 2014, Jacob et al., 2013).

ALSCL1 and FOXA2 in 5-HT neuroprogenitors

As alluded to above, the transcription factors ASCL1 and FOXA2 are

required for 5-HT neurogenesis. The basic helix-loop-helix (BHLH) transcription

factor, ASCL1 originally called MASH1 (Mammalian achaete-scute homolog-1) is

expressed in the ventral neural tube by E9.5 (Caragno et al., 2014, Jacob et al.,

2013) and is likely a direct target of SHH signaling through GLI2 activation

(Hirsch et al., 1998; Jacob et al., 2009; Voronova et al., 2011). Although it is

expressed in both vMN and 5-HT progenitors, ASCL1 appears to play a direct

role in driving 5-HT neurogenesis, although it is dispensable for vMN generation

(Jacob et al., 2009, 2013; Pattyn et al., 2004). Ascl1-/- mice, have a complete loss

50

of 5-HT+ cells throughout the entire rostral-caudal axis associated with loss of

Pet-1, Gata2, Gata3, and Lmx1b but not Nkx2-2 and Nkx2.9 (Carcagno et al.,

2014; Jacob et al., 2009).

FOXA2 has at least two roles in 5-HT production. First, it is required for

the downregulation of the PHOX2B-dependent genesis of vMN neurons. Second,

it directly promotes 5-HT neurogenesis and/or identity by aiding in the activation

the 5-HT developmental program (Jacob et al., 2007). The forkhead box

transcription factor, FOXA2, is originally expressed in the floor plate, but its

expression expands laterally into the p3 region at the onset of 5-HT

neurogenesis (Jacob et al., 2007). In r1, it is detected in 5-HT progenitors at

E9.5. However, during vMN neurogenesis in lower rhombomeric levels, p3 cells

have little to no FOXA2 expression. However, during 5-HT production its

expression is upregulated in r2-3 and r5-8 by E10.5. In r4 it remains confined to

the floorplate, and never expands into the p3 region due to HOXB1 repression as

evident by ectopic r4, p3 FOXA2 expression found in Hoxb1-/- mice. Additionally

in r2-8, PHOX2B inhibits Foxa2 as Phox2b-/- mice have precocious expression of

Foxa2. FOXA2 in turn, is critical for repression of Phox2b and Nkx2.9 in r1 as

loss of Foxa2 in this region (Foxa2fl/fl; Wnt1-Cre) leads to misexpression of

PHOX2B in r1, and an almost complete loss of 5-HT neurons in r1. Beyond its

role in Phox2b repression, FOXA2 is required for proper generation of 5-HT

neurons after the vMN-5-HT progenitor fate switch (Jacob et al. 2007).

Conditional deletion of Foxa2 after the vMN-5-HT switch results in ~50% reduction in 5-HT+ neurons and 5-HT markers of Pet-1, Lmx1b and Gata2. This

51 is neither a result of cell death or reinduction of the PHOX2B-vMN program.

Additionally, neither Ascl1 nor Gata3 expression is perturbed, suggesting FOXA2 takes part in driving part of the 5-HT maturational program apart from its role in neuroprogenitor specification.

Terminal differentiation/ maturation

Once the 5-HT neuron has exited the cell cycle, it begins to express genes required for 5-HT synthesis, vesicular packaging, reuptake, and degradation as well as genes needed for neuronal survival, cell migration, neurite outgrowth and circuit connectivity. Several terminal transcription factors act to induce and/or maintain expression of these genes. Over the past 1-2 decades the function of many of these transcription factors have been identified including, INSM1,

GATA2, GATA3, Engrailed, LMX1B, and PET-1 which will be discussed below.

INSM1. INSM1 (insulinoma associated 1) is a zinc finger transcription factor expressed for a brief period in the 5-HT lineage (Jacob et al., 2009). Brdu pulse labeling at E10.5, during 5-HT neurogenesis, suggest that Insm1 is induced during the last cell division of newly born neurons. INSM1 is needed for the proper expression of 5-HT differentiation/maintenance factors, Lmx1b, Gata2, and Pet-1. In Insm1-/- mice, these genes are still induced, but at a lower level associated with a corresponding decrease in 5-HT immunoreactivity. However, in insm1-/- mice neuroprogenitors markers, Nkx2-2 and Foxa2 are unaffected suggesting it is not needed in the progenitor phase. Interestingly, r2-3 neurons seem to be the most dependent on INSM1 function, as null mice show almost a

52

complete loss of r2-3 5-HT staining while other regions (r1, r5-8) still have ~40%

of their 5-HT+ cells. This differential sensitivity may result from partial

compensation of rhombomeric specific factors, and may partially explain the

heterogeneity seen in adult 5-HT neuron gene expression and function. INSM1

also have a specific role in the induction/maintenance of the 5-HT synthesis gene

Tph2, but not the 5-HT synthesis gene Ddc.

GATA2. Gata2 expression is induced by E10.5 in the ventral midbrain,

hindbrain, and spinal cord, and is required to direct a downstream 5-HT program

(Craven et al., 2004, Nardelli et al., 1999). In Gata2-/- embryos, there is a failure

of the induction of Pet-1, however Gata3, Nkx2-2 and Nkx6.1 expression is

unaltered suggesting GATA2 is not required for progenitor function (Craven et al., 2004; Nardelli et al., 1999). Because Gata2-/- mice die between E9.5 and

E11.5, the role of GATA2 was studied using explants. Gata2-/- hindbrain explants

don’t produce 5-HT+ neurons although the dopamine/noradrenaline marker TH+

is induced normally (Craven et al., 2004). Interestingly, forced expression of

Gata2 in developing chick hindbrains is able to induced ectopic 5-HT neurons

only in r1 (Craven et al. 2004). Several lines of evidence support direct

regulation of Pet-1/FEV by GATA2 (Krueger and Deneris, 2008). First mutation

of 2 highly conserved GATA binding sites (-144, -61), in a FEV-LacZ reporter

transgenic mouse leds to a large loss of reporter expression. Additionally,

Chromatin immunoprecipitation for GATA2 shows it binds to the mouse Pet-1

proximal promoter.

53

Engrailed. Engrailed 1, and to a lesser extent Engrailed 2, are highly expressed in postmitotic 5-HT neurons (Fox and Deneris, 2012; Wylie et al.,

2010). En2 expression rapidly declines and is undetectable by E17.5 while En1

remained expressed throughout life (Fox and Deneris, 2012). 5-HT neuron-

specific deletion of either En1 (En1Pet-1cko) or En2 (En2Pet-1cko) or in combination

(En1/2Pet-1cko) indicates Engrailed is required for expression of genes needed for

proper cellular migration. Deletion of either En1Pet-1cko or En2 Pet-1cko had little or

no effect on neuronal migration, however En1/2Pet-1cko showed a major disruption

in lateral placement in 5-HT neurons. EN’s role in inducing 5-HT gene

expression is unclear due to the defects in hindbrain development found in

germline knockout mice (Simon et al., 2005). It would be interesting to identify its

function in neural progenitors to specify 5-HT fate by ablating EN at the

progenitor phase with an Nkx2-2- or Foxa2-Cre.

LMX1B. Lmx1b is induced downstream of transcription factors INSM-1

and GATA-2 (Craven et al., 2004; Jacob et al., 2009). LMX1B function in 5-HT

neuron terminal differentiation has been studied in Lmx1b-/- mice and mice with

conditional deletion in 5-HT neurons (Lmx1bfl/fl; Pet-1-Cre). Lmx1b expression is

first seen around E10.75 preceding 5-HT staining (Ding et al., 2003). Germline

loss of Lmx1b doesn’t affect the specification of neural progenitors, as Nkx2-2

staining appears normal in lmx1b-/- mice (Cheng et al., 2003). Additionally,

postmitotic precursors are born as Pet-1, and Gata3 expression is unaffected at

E11.5 in rostral 5-HT neurons, although Gata3 is largely lost in caudal neurons

(Ding et al., 2003 ). However, these mice fail to express many 5-HT genes

54

including Tph2, Slc6a4, Slc18a2, and multiple neuropeptides coexpressed in 5-

HT neurons (Ding et al., 2003; Yan et al., 2013; Zhao et al., 2006).

GATA3. Hindbrain Gata3 is expressed bilaterally, flanking the floorplate of the

ventral hindbrain by E11.5 (George et al. 1994; Oosterwegel et al., 1992; van

Doorninck et al., 1999). Adult analysis shows that Gata3 is found in a large

proportion of DRN, MRN, and caudal 5-HT neurons. The analysis of Gata3

mutants is difficult as they die between E9.5 and E11.5, initially from

noradrenaline deficiencies; however death can be delayed until at least 16.5 with

administration of NA intermediates (Lim et al., 2000; Pandolfi et al., 1995). Gata3-

/- chimeric mice, show no loss of 5-HT staining in rostral Gata3-/- cells; but the

caudal system shows ~70 reduction in 5-HT+ Gata3-/- cells without a change in

total cell number (van Doorninck et al., 1999). Similar results were seen in NA-

treated Gata3-/- mice, where E13.5 investigation revealed no change in the

number of 5-HT+ cells in the rostral (r1-r3) domain, but an approximately 70%

reduction in 5HT+ cells in the caudal system. However, Lmx1b and Pet-1 were

still present indicating GATA3 is required for expression of caudal 5-HT markers,

but not generation or early maintenance of 5-HT neurons (Lim et al., 2000).

Even though rostral 5-HT neurons don’t have altered cell number, GATA3 is

required for proper expression of genes needed for 5-HT synthesis and

packaging. Conditional deletion of Gata3 (Gata3fl/fl; Pet-1-Cre) results in a

reduction in Ddc, Tph2 corresponding 25-30% reduction in forebrain 5-HT (Liu et al., 2010). Additionally, GATA3 is required for Slc18a2 but NOT Htr1a

55

expression; highlighting the unique and redundant roles of the various 5-HT

developmental transcription factors in regulating the 5-HT gene battery.

PET-1. Of all the previously mentioned TFs, Pet-1 is unique as its expression is

restricted to 5-HT neruons in the brain where it plays a critical role in 5-HT

neuronal function; however it is dispensable for 5-HT neurogenesis and cell

survival (Hendricks et al. 1999; Hendricks et al., 2003; Krueger and Deneris,

2012; Liu et al., 2010). Pet-1-/- mice have an approximately 70-80% reduction in

5-HT+ cells corresponding to an 85-90% reduction in brain 5-HT due to

dysregulation of genes needed for 5-HT synthesis, Tph2 and Ddc (Hendricks et

al., 2003; Kiyasova et al., 2011; Liu et al., 2010). These mice also show dysregulation of genes needed for vesicular packaging, Slc18a2; reuptake,

Slc6a4; and autosensing Htr1a, Htr1b of 5-HT (Hendricks et al., 2003; Jacobsen et al., 2011; Liu et al., 2012). Of these genes, at least Tph2, Slc6a4, and Htr1a are direct targets of PET-1 (Jacobsen et al., 2011; Liu et al., 2010). Additionally,

PET-1 is self-regulating as expression of reporters driven by the Pet-1 regulatory

elements show reduced or lost expression in the absence of Pet-1 (Scott et al.,

2005a; Liu et al., 2010).

As stated above, Pet-1 is not required for 5-HT neurogenesis or cell

survival as the total numbers of neurons fated to become 5-HT neurons (5-HTPet-

1-/-) are unchanged in most raphe nuclei (Hendricks et al., 2003; Krueger and

Deneris, 2008; Liu et al., 2010). An exception to this, is a loss of 5-HTPet-1-/- cells

in the B6 nucleus. This B6 cell loss may result from migrational defects or a

unique role of PET-1 in preventing cell death in this subpopulation of 5-HT

56

neurons. Pet-1 is also required for proper migration of 5-HT neurons in the dorsal raphe, as these mice have irregular groupings of 5-HTPet-1-/- neurons in the lateral

wings in multiple layers of the DRN (Krueger and Deneris, 2008; Liu et al., 2010).

Pet-1-/- neurons are likely sequestered in a progenitor state and are not

misfated to other cell types as 5-HTPet-1-/- neurons do not stain for motor neuron

markers ChAT (Choline acetyltransferase) or the dopaminergic/noradrenergic

marker tyrosine hydroxylase (Krueger et al., 2008; Liu et al., 2010). Orthologs of

Pet-1 have been found in brain 5-HT neurons of the mouse, rat, human,

macaques and zebrafish suggesting its 5-HT function is conserved among

vertebrates (Hendricks et al. 1999; Hendricks et al., 2003; Iyo et al., 2005;

Lillessar et al., 2007; Lima et al., 2009; Maurer et al., 2004). It should be noted

that there appears to be a small subpopulation of Pet-1+ 5-HT- cells largely found

in the B9 nucleus; however the function of these cells are unknown (Pelosi et al.,

2014).

Maintenance of 5-HT neuronal identity

A few papers have investigated the need for PET-1, EN1/2 and LMX1B

acting autonomously in maintaining 5-HT neuron identity and cell survival (Fox

and Deneris, 2012; Krueger and Deneris, 2008; Liu et al., 2010; Song et al.,

2011; Zhao et al., 2006). LMX1B and EN are required to maintain the normal

number of 5-HT neurons postnatally by preventing cell death. In these studies,

Lmx1b or En1/2 were deleted in Pet-1 expressing cells labled with a cre-

activatible, βgal reporter (βgalPet-1). Loss of Lmx1b specifically within 5-HT neurons has no effect on P0 cell numbers; however, in 8-12 week old mice there

57 is a large reduction in βgalPet-1 cell numbers (Zhao et al., 2006). Likewise, Loss of En1/2 leads to a gradual loss of cell number at least partially through apoptosis starting between P0 and P10 and leading to a 50% reduction of βgalPet-

1 neurons by 6 weeks. A single allele of En1 in the absences of En2Pet-1 is sufficient to prevent cell loss. However, En2 provides some compensatory effects in En1 as the cell loss seems is significantly increased with loss of both alleles.

Neither GATA3 nor PET-1 are required to maintain cell numbers, at least in the first few months of life, as βgal staining of Pet-1/Fev marked cells are unchanged in the Pet-1 mutants (Krueger and Deneris, 2008; Liu et al., 2010).

In addition to maintaining cell survival, LMX1B and EN are required to maintain expression of key serotonergic genes. Adult loss of Lmx1b leads to reduced expression of Tph2, Sert and VMAT2 without affecting Aadc, Pet-1, or

Lmx1b expression (Song et al., 2011). Engrailed is required to maintain TPH2 expression as 5-HT specific deletion results in a gradual loss of TPH2 immunoreactivity and loss of 5-HT levels in the late embryonic stages prior to loss of cell numbers (Fox and Deneris, 2012). Additionally, Pet-1 is required to maintain expression of Tph2, Sert, and Pet-1 resulting in a decrease in 5-HT levels; interestingly, Pet-1 is not required for expression of Vmat2, Aadc, or Htr1a in adulthood (Liu et al., 2010). Surprisingly, many genes which require Pet-1 or

Lmx1b embryonically do not require them in adulthood, suggesting temporal requirements for these genes and a sensitive period for the function of these transcription factors.

58

PET-1

Gene/protein structure

PET-1, or Pheochromocytoma ETS (E26 transformation-specific) domain

transcription factor-1 is an ETS domain transcription factor of the ERG (ETS-

related gene) subfamily (Cooper et al., 2015; Hollenhorst et al., 2011; Wei et al.,

2010). The ETS domain family of transcription factors is evolutionarily conserved

across all metazoans with 27 genes found in humans and 26 in the mouse.

These factors form hetero and homodimers with other ETS transcription factors

and also interact with other non-ETS transcription factors. ETS factors play an

important role in a myriad of cellular processes including proliferation, differentiation, migration and apoptosis, while misregulation of many of these genes are associated with cancer and as such they are a proposed therapeutic target for cancer drugs.

The Pet-1 gene consists of 3 exons encoding a polypeptide of 237 amino acids in the mouse and 238 amino acids in humans (human ortholog: FEV, Fifth

Ewing Variant). PET-1 contains the canonical ETS domain; however it doesn’t

contain the ERG domain found in other ERG-type ETS transcription factors

(Hollenhorst et al., 2011). Of note, PET-1 has an alanine rich c-terminal domain

which may mediate repressor activity (Fyodorov et al., 1998; Maurer et al., 2003;

Wang et al., 2013). Using in vitro gel mobility shift assay, protein binding

microarrays, and microwell‐based DNA‐binding specificity assays a consensus

sequence and position weight matrix for PET-1/FEV binding have been identified

centered around the canonical ETS GGA(A/T) core (Hendricks et al., 1999; Wei

59

et al., 2010). Recently, the crystal structure of FEV bound to its consensus

sequence has been reported. FEV contains 3 alpha helices flanking a four

stranded beta sheet. Residues Arg-103, Arg-106, and Tyr-107 confer specificity to the core GGA sequence with each residue 103, 106 and 107 making a 1:1 contact with the G, G, and A respectively (Cooper et al., 2015).

Although its expression is restricted to serotonergic (5-HT) neurons in the brain, Pet-1 is found in numerous other tissues including the adrenal cortex, enterochromaffin cells, pancreatic islets, hematopoietic stem cells, and the uterine buds of the kidney. (Fyodorov et al., 1998; Ohta et al., 2011; Pelosi et al.,

2014, Wang et al., 2010, Wang et al., 2013). The pleiotropic role of Pet-1 has

been investigated in a few of these tissues including 5-HT neurons, enterochromaffin cells, pancreatic islets, and hematopoietic stem cells.

Although Pet-1-/- mice are born in Mendelian ratios they have a high

perinatal mortality rate of around 30% compared to 4% of littermate controls

(Erickson et al., 2007). The cause of death is partially due to defects in 5-HT-

mediated breathing patterns found in the first 10 days of life in Pet-1-/- mice. The

role of PET-1 in brain 5-HT neurons was discussed in the Development of the

serotonin system section.

Pet-1 in Peripheral Serotonin Synthesis

PET-1 is required to generate proper levels of 5-HT from the intestines

(Lerch-Haner, 2008; Wang et al., 2010). The bulk of 5-HT (~95%) found in the

body is produced by the enterochromaffin (EC) cells located in the mucosal layer

of the intestines (Gershon and Tack, 2007). Reporters of Pet-1 expression

60 indicate PET-1 is only expressed in TPH1+ EC cells (Lerch-Haner, 2008; Wang et al., 2010). As with brain 5-HT neurons, Pet-1-/- is not required for the genesis or survival of EC cells, as Pet-1-/- mice have normal numbers of TPH1+ cells.

However they have ~50% reduction in Tph1 expression associated with an approximately 70% reduction in EC-derived blood 5-HT (Lerch-Haner, 2008).

Role in pancreas

In addition to its role in 5-HT production, the autonomous function of Pet-1 has also been investigated in pancreas (Ohta et al., 2011). Pet-1 is robustly expressed in pancreatic islets from at least E12.5 to adulthood. Although Pet-1-/- pancreases appear histologically normal, with normal islets, they have reduced mRNA and protein expression of insulin (INS), but not other pancreatic hormones, glucagon, somatostatin or ghrelin. Ins is likely a direct target of PET-

1 in both mice and humans as chromatin immunoprecipitation (ChIP) for a FLAG- tagged PET-1 in insulin-producing, βTC3 cell line showed enrichment for evolutionary conserved elements in the Ins proximal promoters and transfection of Pet-1 increases luciferase expression driven by the human INS promoter in the mPAC cell line (pancreatic ductal cell). Associated with its regulation of pancreatic insulin production, Pet-1-/- mice show reduced glucose disposal

(clearance of glucose) in a glucose tolerance test. Interestingly, pancreatic expressed genes regulated by PET-1 in the brain including Tph2, Ddc, Slc18a2, or Slc6a4 are unaffected. This surprising result indicates that either different transcriptional programs drive the 5-HT gene battery in pancreatic islets or other pancreatic transcriptional factors compensate for loss of Pet-1 function.

61

Pet-1 in hematopoietic stem cells

PET-1 also autonomously regulates hematopoietic stem cell (HSC)

proliferation through direct regulation of ERK2 signaling (Wang et al., 2013).

HSCs give rise to all blood lineages including erythrocytes, macrophage,

neutrophil, monocyte, and lymphoid (B and T cell). Morpholino knockdown or

germline deletion of fev (Pet-1) in zebrafish leads to reduced expression of erk2 and the ERK2 target, runx1. RUNX1 is a master regulator of HSC specification in

fish and mice (Dzierzak and Speck, 2008). Consistent with HSC disruption, these

fish show reduced T-cell numbers in the thymus and reduced luminal size

uniquely in the HSC-producing region of the dorsal aorta. Examination of human

umbilical cord (UC) derived CD34+ HSC cells revealed FEV (PET-1) is also

expressed in human HSC. In vitro knockdown of FEV in these UC-CD34+ cells

resulted in reduced proliferation of these cells compared to control. Taken

together, these data suggest Pet-1 acts in HSCs to control HSC function.

Invertebrate orthologs of Pet-1

Finally the worm ortholog of Pet-1, ets-5, has been studied in C. elegans.

ets-5 and FEV (PET-1) are reciprocally the “best match” ortholog between C.

elegans and human as predicted by the Drosophila RNAi Screening Center

Integrative Ortholog Prediction Tool (DIOPT; Hu et al., 2011). It is not expressed

in 5-HT neurons, but instead appears to play a critical role in the expression of

genes needed for proper function of the CO2-sensing BAG neurons, but not for

the generation or survival of these neurons (Brandt, et al., 2012; Guillermin, et

62 al., 2011). There appears to be no study of Pet-1 ortholog function in d. melanogaster.

63

64

Figure 1. Serotonergic Neuron and Receptors. Serotonin (5-HT) is produced

in two enzymatic steps (Blue, TPH2, AADC) from tryptophan (TRP). 5-HT is

packaged into vesicle by the vesicular monoamine transporter 2 (VMAT2) for

release. 5-HT transporters such as SERT and OCT3 take 5-HT up from the

synapse where it can either be recycled or degraded by monoamine oxidase and aldehyde dehydrogenase (MAO, AD). An important cofactor for 5-HT synthesis is tetrahydrobiopterin (BH4) which is oxidized to tetrahydrobiopterin-4α-

carbinolamine (BH4αC) by TPH2. BH4 can be synthesized de novo (Red) from

Guanine triphosphate (GTP), or regenerated by PCD and DHPR (orange). 5-HT

neurons also respond to numerous signaling molecules including glutamate

(AMPA and NMDA receptors), noradrenaline (ADRA1B receptors),

neuropeptides such as Hypocretin (HCRTR1/2 receptors) and signaling lipids

(LPA1 receptor). Additionally 5-HT neurons express autoreceptors such as 5-

HT1A and 5-HT1B which act in a feedback loop controlling levels of 5-HT release.

Postsynaptically (Green) 5-HT neurons signal through several types of receptors.

All except for the inotropic 5-HT3 receptor are metabotropic receptors. TPH2,

tryptophan hydroxylase 2; AADC, aromatic L-amino acid decarboxylase; SERT,

serotonin transporter; OCT3, organic cation transporter 3; VMAT2, vesicular

monoamine transporter 2; MAO, monoamine oxidase; AD, Aldehyde

dehydrogenase; GFRP, GTP cyclohydrolase I feedback regulator; GCH1, GTP

cyclohydrolase 1; PTPS, 6-pyruvoyl-tetrahydropterin synthase; SR, sepiapterin

reductase; PCD, pterin-4-alpha-carbinolamine dehydratase; DHPR,

dihydropteridine reductase. BH4 synthetic intermediates: H2NTP, 7,8-

65 dihydroneopterin triphosphate; PTP, 6-pyruvoyl-5,6,7,8-tetrahydropterin; BH4αC, tetrahydrobiopterin-4α-carbinolamine; qBH2, quinoid dihydrobiopterin; AMPA, α-

Amino-3-hydroxy-5-Methyl-4-isoxazole Propionic Acid receptor; NMDA, N-

Methyl-D-Aspartic acid receptor; ADRA1B, α-adrenergic receptor 1b; LPA1, lysophosphatidic acid receptor 1.

66

Figure 2

67

Figure 2. Neuroanatomical features of 5-HT neuron development. (A).

Anatomical positioning of the nine 5-HT nuclei in the mid and hindbrain. DRN, dorsal raphe nucleus: B4, B6, B7; MRN, median raphe nucleus: B6, B8; and the supraleminscal, B9 nucleus. B1, raphe obscurus; B2, raphe pallidus; B3, raphe magnus. (B). Embryonic brain showing rhombomeric (r) organization of ascending (r1-r3) and descending system (r5-8) (C). Adult positioning of 5-HT neurons based on rhombomeric origin. (r1, green; r2, blue; and r3, yellow; r5 brown, r6-8; violet).

68

69

Figure 3. Stages in serotonergic neuron development. 5-HT neuronal progenitors exit the cell cycle becoming postmitotic precursors, which have

committed to 5-HT identity, but have yet to produce 5-HT. This takes about a ½

day in rostral neurons and 1-2 days in caudal neurons. The neuron then enters a

prolonged embryonic and maturational phase which can last for several weeks. It

begins to express genes needed for neuronal migration, neurite outgrowth,

intrinsic membrane characteristics and afferent receptors. An adult neuron has

fully integrated into the neural circuit.

70

Figure 4

71

Figure 4. Patterning and development of the hindbrain serotonin system.

(A). Sagittal view of developing brain. Morphogens, WNT1 (red) and FGF8

(fibroblast growth factor 8; green) produced at the MHO (mid/hindbrain organizer) are essential for the early pattering of the hindbrain. SHH (sonic hedgehog; blue) produced by the floorplate (FP, dark blue) and TGFβ (transforming growth factor

β) pattern the ventral hindbrain. RA (retinoic acid) signaling inhibits generation of

5-HT neurons in the spinal cord. (B). Coronal section through the developing hindbrain. SHH produced from the FP induced the expression of Nkx2-2+ p3 progenitors. DA, dopamine neurons.

72

73

Figure 5. Progenitor specification of 5-HT neurons. 5-HT neurons are produced from p3 progenitors (gray cell) from embryonic day 9.5 (E9.5) to E10.5 in r1 (rhombomere 1) and from E10.5 to E11.5 in r2-3 and r5. In r1, FOXA2

(forkhead box protein A2) represses the generation of vMN (visceral motor neurons) by repressing expression of the vMN-promoting transcription factor,

PHOX2B (paired-like homeobox 2b). FOXA2 also directly promotes 5-HT

neurogenesis. Between E9.5 and E10.5, in r2-r3 and r5-8, p3 progenitors

express PHOX2B, which represses FOXA2, and promotes vMN neurogenesis.

By E10.5 TGFβ (transforming growth factor β) inhibits PHOX2B expression

allowing for a FOXA2-directed 5-HT neuronal program. In r4, 5-HT neurons are

never produced due to HOXB1 repression of Foxa2 expression. In the spinal

cord RA (Retinoic acid) signaling inhibits the 5-HT promoting factor ASCL1

(arcuate-scute like 1) transcription factor by prepressing its expression through a

NEUROG3 (Neurogenin 3)/ HES (hairy enhancer of split) program.

74

Figure 6

75

Figure 6. Serotonergic transcriptional network.

Stage-specific networks are defined by each block. Solid lines represent

transcriptional regulation. Dashed lines are possible regulatory connections.

Black balls represent direct transcriptional regulation. Transcriptional network

acts to drive the induction and/or proper expression of 5-HT neuronal identity/

functional features including those needed for 5-HT synthesis (Tph2, Aadc);

vesicular packaging (Vmat2), reuptake (Sert), and degradation (Maob). Genes

needed for autosensing are induced during 5-HT maturation (pink box). Red

circular arrows indicate autoregulation of Pet-1. Additionally, Pet-1 and Lmx1b are required in adulthood to maintain 5-HT identify by controlling expression of genes such as Vmat2, Tph2 and Sert. Engrailed 1/2 are expressed prior to 5-HT progenitor specification and is needed for proper hindbrain formation, its role at the progenitor stage is unknown. It is required to maintain 5-HT neuronal identity and survival. Foxa2, forkhead box A2; Ascl1, achaete-scute like 1; Nkx2-2, Nk homeobox 2-2; Insm1, insulinoma associated 1; Gata2, GATA binding protein 2;

Lmx1b, LIM homeobox transcription factor 1, beta; En, engrailed 1/2; Tph2, tryptophan hydroxylase 2. Aadc, aromatic amino acid decarboxylase, Vmat2, vesicular monoamine transporter 2; Sert, serotonin transporter; monoamine oxidase b.

76

CHAPTER 2

PET-1 CONTROLS TETRAHYDROBIOPTERIN PATHWAY AND SLC22A3

TRANSPORTER GENES IN SEROTONIN NEURONS

By: Wyler SC*, Donovan LJ*, Yeager M, Deneris E.

*These authors contributed equally to this work

Repoduced with permission from ACS Chemical Neuroscience, 2015 July

15;6(7):1198-205 Copyright (2015). American Chemical Society http://pubs.acs.org/doi/abs/10.1021/cn500331z

77

Summary

Coordinated serotonin (5-HT) synthesis and reuptake depends on

coexpression of TPH2, AADC (Ddc), and SERT (Slc6a4) in brain 5-HT neurons.

However, other gene products play critical roles in brain 5-HT synthesis and

transport. For example, 5-HT synthesis depends on coexpression of genes

encoding the enzymatic machinery necessary for the production and

regeneration of tetrahydrobiopterin (BH4). In addition, the organic cation

transporter 3 (OCT3, Slc22a3) functions as a low affinity, high capacity 5-HT

reuptake protein in 5-HT neurons. The regulatory strategies controlling BH4 and

OCT3 gene expression in 5-HT neurons have not been investigated. Our

previous studies showed that Pet-1 is a critical transcription factor in a regulatory program that controls coexpression of TPH2, AADC, and SERT in 5-HT neurons.

Here, we investigate rather a common regulatory program determines global 5-

HT synthesis and reuptake through coordinate transcriptional control. We show with comparative microarray profiling of flow sorted YFP+ Pet-1–/– and wild type 5-

HT neurons that Pet-1 regulates BH4 pathway genes, Gch1, Gchfr, and Qdpr.

Thus, Pet-1 coordinates expression of all rate-limiting enzymatic (Tph2, Gch1) and post-translational regulatory (Gchfr) steps that determine the level of mammalian brain 5-HT synthesis. Moreover, Pet-1 globally controls acquisition of

5-HT reuptake in dorsal raphe 5-HT neurons by coordinating expression of

Slc6a4 and Slc22a3. In situ hybridizations revealed that virtually all 5-HT neurons in the dorsal raphe depend on PET-1 for Slc22a3 expression; similar results were

78

obtained for Htr1a. Therefore, few if any 5-HT neurons in the dorsal raphe are resistant to loss of Pet-1 for their full neuron-type identity.

Introduction

Coexpression of unique gene combinations encoding numerous kinds of neuron-type and pan neuronal characteristics establishes the identity of different neurons (Hobert et al., 2010). However, the gene regulatory mechanisms controlling the acquisition of neuron-type identities are poorly understood. One key and obvious identity feature that distinguishes different neuron types is transmitter identity. Transmitter identity is commonly defined by the presence of a particular transmitter together with the coexpression of genes required for its synthesis, reuptake, and vesicular transport in specific neuron types (Deneris and Hobert, 2014). In the case of serotonin (5-HT) neurons, the gene products that typically define serotonergic transmitter identity are tryptophan hydroxylase 2

(TPH2), aromatic amino acid decarboxylase (AADC, gene symbol: Ddc), serotonin transporter (SERT, gene symbol: Slc6a4), vesicular monoaminergic transporter 2 (VMAT2, gene symbol: Slc18a2), and the 5-HT1A (gene symbol:

Htr1a) and 5-HT1B (gene symbol: Htr1b) autoreceptors.

A serotonergic gene regulatory network, comprising multiple interacting

transcription factors, has been identified that coordinates expression of Tph2,

Aadc, Slc6a4, Slc18a2, Htr1a, and Htr1b in brain 5-HT neurons (Deneris and

Wyler, 2012). Transcription factors ASCL1, NKX2-2, and FOXA2 are required for

specification of serotonergic progenitors in the ventral hindbrain. These factors

subsequently activate a downstream transcription factor network comprising

79

GATA-2, INSM1, GATA3, LMX1B, Engrailed1/2, and PET-1, which acts in

postmitotic serotonergic precursors to initiate 5-HT neuron-type differentiation

(Craven et al., 2004; Ding et al., 2003; Fox and Deneris, 2012; Hendricks et al.,

2003; Jacob et al., 2009; Pattyn et al., 2004). Germ line targeting of each of these factors results in aborted differentiation to varying extents depending on which factor is missing (Deneris and Wyler, 2012). For example, the Pet-1 ETS factor is required for coordinate expression of Tph2, Ddc, Slc6a4, Slc18a2,

Htr1a, and Htr1b in postmitotic serotonergic precursors as expression of each of these 5-HT identity genes is severely reduced in Pet-1–/– 5-HT neurons.

(Hendricks, et al., 1999; Hendricks et al., 2003; Liu et al., 2010). In vivo

chromatin immunoprecipitation and in vitro DNA binding assays have

demonstrated that PET-1 coordinates expression of these serotonergic genes

through direct binding to a common conserved ETS DNA binding site in their

promoter regions (Jacobsen et al., 2011; Liu et al., 2010). Although PET-1 is

expressed in what appears to be all brain 5-HT neurons, Tph2 continues to be

expressed, albeit at reduced levels, in a subset of Pet-1–/– 5-HT neurons

suggesting the presence of a PET-1 resistant subpopulation of 5-HT

neurons(Hendricks et al., 1999; Hendricks et al., 2003; Kiyasova et al., 2011).

In addition to the genes described above, other gene products play critical

roles in 5-HT synthesis and transport and therefore are necessary for 5-HT to

function as a transmitter. For example, in addition to TPH2 and AADC, 5-HT

synthesis depends on coordinate expression of the enzymatic machinery

catalyzing the production and regeneration of 6R-l-erythro-5,6,7,8-

80

tetrahydrobiopterin (BH4), an obligatory cofactor for Tph2 enzymatic activity as

well as the enzymatic activity of other monoaminergic monooxygenases, nitric

oxide synthases, and alkylglycerol monooxygenase (Kapatos, 2013; Tietz et al.,

1964; Watschinger et al., 2010; Werner et al., 2011). BH4 is synthesized de novo

from the precursor guanosine triphosphate (GTP) in four or five enzymatic steps

(Figure 1) catalyzed by GTP cyclohydrolase I (GTPCH, gene symbol: Gch1), 6-

pyruvoyltetrahydropterin synthase (PTPS, gene symbol: Pts), and sepiapterin

reductase (SR, gene symbol: Spr). The enzymatic steps catalyzed by SR,

however, can be alternatively catalyzed by aldo-keto-reductase family 1 member

3 (mouse orthologue: Akr1c18), aldo-keto-reductase family 1 B1 (mouse

orthologue: Akr1b3), and carbonyl reductase (CR, gene symbol: Cbr1) in various

combinations (Figure 1) (Kapatos, 2013). Although it is commonly accepted that

TPH2 is a rate-limiting step for the production of 5-HT, GTPCH activity is rate

limiting for BH4 synthesis and therefore control of its expression level is a critical

determinant of 5-HT synthesis. GTPCH enzymatic activity is also controlled post- translationally through negative feedback regulation by GTP cyclohydrolase I feedback regulatory protein (GFRP, gene symbol Gchfr) (Harada et al., 1993;

Yoneyama and Hatakeyama, 1998). The allosteric binding of BH4 to GTPCH

stimulates the formation of a multimeric GFRP:GTPCH complex in which GTPCH

activity is inhibited (Maita et al., 2004; Yoneyama and Hatakeyama, 1998). In

contrast, l-phenylalanine can stimulate BH4 biosynthesis in a GFRP-dependent

manner Kapatos et al. 1999). After its enzymatic conversion to 4α-hydroxy-

tetrahydrobiopterin in a monooxygenase or synthase reaction, BH4 can be

81

regenerated in a two-step pathway catalyzed by pterin-4α-carbinolamine dehydratase (PCD, gene symbol Pcbd1 and Pcbd2) and dihydropteridine reductase (DHPR, gene symbol: Qdpr, quinoid dihydropteridine reductase)

(Werner et al., 2011). A large number of rare mutations, causing BH4 and

monoamine deficiency, have been identified in human GCH1, PTS, SPR,

PCBD1, and QDPR genes and are responsible for several neurological motor control disorders such as dopa-responsive dystonia or Segawa disease (Thony and Blau, 2006).

The 5-HT transporter, SERT (gene symbol Slc6a4), is responsible for high affinity reuptake of 5-HT (Blakely and Edwards, 2012; Murphy and Lesch, 2008).

However, other transporters are now recognized as playing important roles in clearing 5-HT from the synaptic cleft and extrasynaptic sites (Daws, 2009). For example, OCT3 (gene symbol: Slc22a3) has been shown to function as a low-

affinity, high-capacity 5-HT transporter (Baganz et al; 2008). Slc22a3 expression

is abundant in brain 5-HT neurons, and importantly, it is a critical determinant of

SSRI efficacy (Horton et al., 2013). However, the regulatory mechanisms that

control expression of BH4 and Slc22a3 genes in 5-HT neurons have not been

investigated.

A possibility is that a regulatory network distinct from that controlling Tph2,

Ddc, Slc6a4, Slc18a2, Htr1a, and Htr1b controls these additional key

serotonergic genes. This possibility seems plausible as BH4 enzymatic pathways

are expressed in numerous neural and non-neural cell types of the brain and

periphery and are required for other cellular functions in addition to 5-HT

82

synthesis (Kapatos, 2013; Werner et al. 2011). Similarly, Slc22a3 is widely

expressed in many different neuron types and glia of the adult rodent brain unlike

Tph2, Slc6a4, and Slc18a2 (Gasser et al., 2009; Vialou et al., 2008).

Alternatively, as for other neural expressed the complex expression patterns of

Slc22a3 and BH4 genes might be generated through separate cis regulatory

control modules one of which positively responds to the same transcription

factors that control other serotonergic genes such as Tph2 (Serrano-Saiz et al.,

2013; Wenick and Hobert, 2004).

Methods

Animals

Pet-1–/– mice have been described previously (Hendricks et al., 2003). All in situ

hybridizations were performed on age and sex matched adult mice 6–8 weeks of

age unless otherwise stated. The National Institutes of Health guide was followed

for the care and use of laboratory animals. All experiments were approved by the

Case Western Reserve University School of Medicine Institutional Animal Care.

Perfusion and Sectioning

Mice were anesthetized with Avertin (0.5 g of tribromoethanol/39.5 mL of H2O +

0.31 mL of tert-amyl alcohol) and transcardially perfused with saline followed by cold 4% paraformaldehyde (PFA). Brains were extracted and post-fixed for 2 h

and incubated overnight (O/N) in 30% sucrose-PBS solution at 4 °C. Floating 25

μm coronal brain sections of the dorsal raphe serotonin system were taken,

83

mounted on SuperFrost Plus slides (Fisher Scientific), and dried in a vacuum

chamber for at least 1 h before use.

In Situ Hybridization (ISH)

Digoxigenin (Roche Diagnostics, Indianapolis, IN) labeled antisense RNA probes

( 600 bp) were synthesized using cDNA fragments of Slc22a3, Htr1a, Gch1,

Gchfr∼ , or Tph2 that were PCR amplified with reverse primers containing bacteriophage T3 promoter sequences at their 5′ ends. A previously published in situ hybridization protocol was followed (Hendricks et al., 1999).

Quantitative Real-Time PCR (RT-qPCR)

RNA was isolated from E12.5 Pet-1+/– and Pet-1–/– animals from the rostral

serotonin system using the PureLinkTM RNA Mini Kit (Ambion by Life

Technologies, Carlsbad, CA). Purified RNA was converted to cDNA by PCR

using the Transcriptor FirstStrand cDNA Synthesis Kit (Roche Diagnostics,

Indianapolis, IN) and stored at −20 °C. qPCR was performed in triplicate using

Fast Start Universal Syber Green ROX Master solution (Roche Diagnostics,

Indianapolis, IN). Samples were normalized to β-actin.

Immunohistochemistry (IHC)

Fluorescent immunohistochemistry was performed using a polyclonal primary

rabbit antibody against 5-HT (1:1000, ImmunoStar, Hudson, WI) or a primary

chicken antibody against GFP (1:1000, Abcam, San Francisco, CA) O/N at 4 °C

and an anti-rabbit or anti-chicken Alexa Fluor488 secondary antibody (1:500,

Invitrogen by Life Technologies, Carlsbad, CA) for 1 h. at room temperature in

the dark. A standard IHC protocol was used (Fox and Deneris, 2012).

84

Fluorescent images were taken using a SPOT RT color digital camera

(Diagnostic Instruments, Sterling Heights, MI) using an Olympus Optical BX51 microscope (Center Valley, PA).

FACS of YFP+ Cells

The rostral hindbrain domain from the mesencephalic flexure to the pontine flexure of either ePet-EYFP+/+ and ePet-EYFPPet-1–/– embryos was dissected and then treated with 0.25% trypsin-EDTA (Life Technologies) to dissociate cells as described previously. (Wylie et al., 2010). Cells were filtered through a 40 μm filter and sorted using a Becton Dickinson FACS Aria digital cell sorter with an argon laser (200 mW at 488 nm). Cells were sorted directly into Trizol

(Invitrogen) for RNA extraction. Approximately 7000 YFP+ cells were isolated from +/+ or Pet-1–/– embryos. Each of the four biological replicates (4 +/+, 4 Pet-

1–/–) consisted of between 20,000 and 30,000 cells from independent litters.

Microarray

Total RNA was isolated after the addition of 20 μg of glycogen (Invitrogen) using phenol chloroform extraction. RNA amplification and cDNA libraries were prepared using the AmbionWT Expression Kit (Life Technologies) according to the manufacturer’s protocol. An amount of 5.5 μg of single-stranded DNA was fragmented and labeled using the Affymetrix GeneChip WT Terminal Labeling

Kit. Probes were hybridized overnight at 45 °C to a GeneChip Mouse Gene 1.0

ST Array (Affymetrix). After hybridization, chips were washed in a Genechip

Fluidics Station (Affymetrix) and scanned at high resolution using an Affymetrix

High Density GeneChip Scanner 3000. The .CEL files from the eight chips were

85

normalized using the Robust MultiChip Averaging (RMA) using Affymetrix

Expression Console Software version 1.1.

To begin to understand the regulatory mechanisms that control Slc22a3

expression and BH4 production in mouse 5-HT neurons, we investigated whether

their serotonergic expression is controlled by PET-1. We previously reported a microarray method for transcriptome studies of flow sorted yellow fluorescent protein (YFP)-expressing fetal 5-HT neurons obtained from the ePet-EYFP

transgenic mouse line (Scott et al. 2005; Wylie et al., 2010). Here, we present a

protocol for flow sorting of ePet-EYFP-marked Pet-1–/– 5-HT neurons from the

fetal rostral hindbrain. We used this new protocol for comparative microarray

–/– analyses of Slc22a3 and BH4 gene expression in wild type and Pet-1 5-HT

neurons. In addition, we investigated the relative PET-1 dependency of

serotonergic genes in the adult dorsal raphe.

In previous histochemical studies, we found comparable numbers of Pet-

1–/– 5-HT neuron cells bodies and wild type 5-HT neuron cell bodies in the

midbrain dorsal raphe Krueger and Deneris, 2008). Here, we crossed ePet-

EYFP+/+ and ePet-EYFPPet-1–/– mice to generate ePet-EYFPPet+/– offspring. These

offspring were then interbred to generate ePet-EYFP+/+ and ePet-EYFPPet-1–/–

littermate embryos. Anti-YFP immunostaining of fetal 5-HT neurons in the ePet-

EYFP+/+ and ePet-EYFPPet-1–/– brain revealed comparable levels of YFP

expression and similar numbers of wild type and mutant neurons (Figure 2A, B).

These findings suggested we should be able to sort sufficient numbers of Pet-1–/–

5-HT neurons for microarray gene expression profiling. Embryonic (E) 12.5 YFP+

86

rostral hindbrain domains were dissected, dissociated, and purified by flow

cytometry as previously described Wylie et al., 2010). Because PET-1 may

regulate the rostral and caudal 5-HT system differently, we only used tissue from the rostral 5-HT system which gives rise to the dorsal and median raphe and B9 nuclei.

Results and Discussion

Both +/+ and Pet-1–/– 5-HT neurons were readily sorted (Figure 2C–F),

and comparable numbers were obtained (Figure 2G). Quantitative real-time PCR

(RT-qPCR) revealed, as expected, a complete lack of Pet-1 expression in YFP+

RNA isolated from Pet-1–/– rostral hindbrain (Figure 2H). Moreover, Tph2 and

Slc6a4 RNA levels were also dramatically reduced in Pet-1–/– embryos compared

to control levels as expected (Hendricks et al., 2003). Importantly, the expression

of Lmx1b, a serotonergic transcription factor whose expression is independent of

Pet-1 at fetal stages, was unchanged Ding et al. 2003). Thus, flow sorted PET-1–

/– YFP+ 5-HT neurons can be used to determine the impact of Pet-1 loss of

function on Slc22a3 and BH4 gene expression.

Having established a protocol for flow cytometry of Pet-1 mutant 5-HT

neurons we set up crosses to generate sufficient numbers of embryos to perform

four microarray biological replicates for both Pet-1–/– and +/+ 5-HT neurons.

Based on our previous studies, we collected between 20, 000 and 30, 000 cells

per replicate (Wylie et al., 2010). This yielded sufficient RNA to generate labeled

cDNA probes, which were then hybridized to the GeneChiP Mouse Gene 1.0 ST

array.

87

As a validation of our microarray approach, we first examined Pet-1 probe

intensities in arrays hybridized with +/+ and Pet-1–/– cDNA (Figure 3A). Analysis

of probe intensities revealed background levels of Pet-1 expression. As a further

test of our approach, we examined expression levels of several known Pet-1

downstream targets. Expression levels of Tph2, Ddc, Slc6a4, Slc18a2, and Htr1a

were all significantly reduced in Pet-1–/– vs +/+ arrays (Figure 3A) to extents that

correlate well with previous histochemical studies of these genes in Pet-1–/– mice.

We also note that expression of Lmx1b, a gene not regulated by PET-1 in fetal 5-

HT neurons, (Ding et al., 2003; Liu et al., 2010). was not altered in the present microarray analysis of its expression in mutant 5-HT neurons. Our array findings indicated very low expression of Hrt1a and Hrtr1b, which is consistent with our earlier findings that expression of these two autoreceptor genes is not strongly induced until after E14 (Liu et al., 2010) . Thus, the very low, near background levels, of these genes at E12.5 likely precluded detection of Htr1b’s Pet-1 dependency, although Htr1a did show significantly reduced expression in sorted

Pet-1–/– 5-HT neurons (Figure 3B). Importantly, our array findings for Tph2, Ddc,

Slc6a4, Slc18a2, Htr1a, and Lmx1b were perfectly consistent with our previously

published studies of their Pet-1 dependency (Deneris 2011).

Having demonstrated the validity of our array approach for reproducible

and accurate detection of gene expression changes in response to loss of Pet-1

we analyzed our data sets for expression of Slc22a3 and BH4 genes (Figure 3B).

Examination of the +/+ arrays revealed that, in comparison to Pet-1 and other 5-

HT genes, Slc22a3, Gchfr, Qdpr, and Pcbd1 are robustly expressed at E12.5.

88

Gchfr was the most abundantly expressed BH4 gene in our data set, which is

consistent with previous studies showing strong expression of this feedback

regulator gene in adult rat 5-HT neurons and as shown here it is expressed

strongly in a serotonergic pattern in the adult mouse dorsal raphe (Figure 3C)

(Kapatos et al., 1999). In contrast, its expression is undetectable in other brain

monoaminergic neuron types. This suggests that BH4 production in 5-HT

neurons is especially sensitive to GFRP-dependent BH4 negative feedback and

GFRP-dependent l-Phe stimulation of BH4 biosynthesis. (Kapatos et al, 1999).

One possibility is that this provides for rapid and precise adjustments in 5-HT

synthetic rates in response to changing behavioral and metabolic states. The

Pcbd1 paralogue, Pcbd2, has a relatively low expression level (Pcbd1 average probe intensity, 1897 ± 239; Pcbd2, 384 ± 13), suggesting Pcbd1 plays the major

role in BH4 regeneration in 5-HT neurons. Although, Gchfr, Qdpr, and Pcbd1

were robustly expressed at E12.5, Gch1, Pts, and Spr expression was relatively

low (Figure 3B). Yet, the level of Gch1, Pts, and Spr expression must be

adequate to support evident abundant synthesis of 5-HT at this fetal stage. In situ

hybridization (ISH) confirmed that, by adulthood, Gch1 is indeed strongly

expressed in the mouse dorsal raphe (Figure 3D).

Besides SR, several other enzymes can catalyze the last three steps of

the de novo BH4 synthesis pathway. Of these, enzymes encoded by Akr1b3 and

Cbr1 but not Akr1c18 are robustly expressed at E12.5, suggesting multiple BH4

synthesis pathways may be involved in 5-HT synthesis in immature 5-HT

89

neurons (Figures 3B and 1). Finally, the regeneration/salvage gene, Dhfr, is

weakly expressed in immature 5-HT neurons (Figure 3B).

Interestingly, our array experiments revealed a severe loss of Slc22a3

expression in Pet-1–/– 5-HT neurons thus demonstrating that Pet-1 controls not

simply high-affinity, low-capacity 5-HT transport (SERT) but also low-affinity, high-capacity transport (OCT3) (Figure 3B). Our findings further revealed

substantially reduced expression of Gchfr, and Gch1 (Figure 3B). Therefore, Pet-

1 is a major transcriptional regulator of the rate limiting enzymatic and post-

translational regulatory steps for BH4 synthesis. Given the substantial loss of

expression of Gchfr and Gch1 expression in Pet-1–/– 5-HT neurons, it is

somewhat surprising that the expression levels of the other BH4 synthetic genes,

Spr and Pts were unchanged. Perhaps the very low expression of Pts and Spr

near background levels detected for these genes at E12.5 precluded detection of

Pet-1 dependency as was likely the case for Htr1b. Further studies of PET-1

dependency for these two genes at later stages of life will be required. The array

results also indicated a role for PET-1 in regulation of the BH4 regeneration

pathway as Qdpr levels were significantly reduced in Pet-1–/– 5HT neurons

(Figure 3B). However, loss of Pet-1 had no effect on Pcbd1, Pcbd2, Cbr1,

Akr1b3, Akr1c18, and Dhfr expression level. Given the strong and comparable

levels of expression of Pcbd1, Cbr1, and Akr1b3 in the wild type and mutant

arrays we conclude that Pet-1 is not necessary for their expression at least at

E12.5. One possibility is that LMX1B or GATA-3 is required for expression of

these other BH4 synthesis, regeneration, and salvage pathway genes.

90

Alternatively, all three transcription factors may play compensatory roles in the

expression of these genes so that removal of a single regulatory partner has little

or no effect on expression of these genes. A final possibility is that the more

broadly expressed broadly functional BH4 genes such as Akr1b3 are controlled

by another gene regulatory network.

Together these findings reveal an extended battery of serotonergic genes under

the control of PET-1. Slc22a3 and the BH4 pathway genes are expressed in

many cell types in brain and periphery, while Pet-1 expression in the brain is restricted to the 5-HT lineage. Therefore, it seems likely that the cis regulatory regions of the Slc22a3 and BH4 genes possess a PET-1 binding module that functions specifically to direct their expression to 5-HT neurons. Either LMX1B and/or GATA-3 or other unknown factors may also control expression of Gchfr,

Gch1, and Qdpr and may account for the residual expression of these BH4

pathway genes in Pet-1–/– 5-HT neurons.

Although we obtained highly concordant array results among our biological

replicates for Slc22a3, Gch1, Gchfr, and Qdpr dependence on Pet-1, we selected

Slc22a3 for RT-qPCR verification using dissected E12.5 neural tubes (Figure 4

4A). Consistent with the array results, we detected significantly reduced

expression of Tph2, Slc6a4, and Slc22a3 but not Lmx1b in Pet-1–/– neural tubes

(Figure 4A).

We next investigated adult Slc22a3 expression with ISH. Consistent with

the Allen Brain Atlas ISH analysis of Slc22a3, we found a highly restricted

serotonergic raphe pattern of expression for this gene in the midbrain and pons

91

(Figure 4B, left panel, and data not shown), suggesting a highly selective

serotonergic role for this gene in these brain regions.

Analysis of Slc22a3 expression in in adult Pet-1–/– mice revealed a striking

nearly complete loss of its expression (Figure 4B, right panel). This finding was

surprising given that expression of other serotonergic identity features such as

Tph2 and 5-HT itself are not absolutely dependent on Pet-1 for their full

expression in about 20–30% of 5-HT neurons,(7, 13) which is shown here in

Figure 4C for comparison to the Slc22a3 dependency on Pet-1 (Hendricks et al.,

2003; Kiyasova et al., 2011). Thus, our Slc22a3 findings suggest that whether or not some 5-HT neurons are resistant to loss of Pet-1 depends on specific identity features expressed in these neurons. We note, however, that the residual expression of Tph2 in individual Pet-1–/– 5-HT neurons (Figure 4C, lower panels)

appears to be substantially weaker than its expression level in individual wild

type 5-HT neurons, suggesting Pet-1 controls Tph2 expression in all 5-HT neurons.

To further investigate Slc22a3 dependency on Pet-1, we systematically investigated its expression throughout the entire dorsal raphe nucleus of Pet-1–/–

adults. ISH was performed on every other 25 μm section spanning the entire

dorsal raphe. As shown in Figure 5A–H, we found a nearly complete elimination

of Slc22a3 expression at all levels of the dorsal raphe in Pet-1–/– mice. Residual

expression, if any, was confined to scattered cells in numbers far lower than the

number of mutant neurons still expressing Tph2 or 5-HT in the Pet-1–/– brain

(Figure 4C). These findings indicate that in the case of the Slc22a3 identity

92

feature, its expression is completely dependent on PET-1 as virtually no 5-HT

neurons are resistant to loss of PET-1. Thus, few if any 5-HT neurons acquire their complete adult identity in the absence of Pet-1 and the number of PET-1

resistant 5-HT neurons that exist is far fewer than previously thought (Hendricks

et al., 2003; Kiyasova et al., 2011).

To extend this analysis to an additional key identity gene, we investigated

Htr1a’s dependency on PET-1. ISH throughout the dorsal raphe indicated a

similar severe loss of Htr1a expression in Pet-1–/– mice (Figure 5I–P). Few if any

cells in the mutant dorsal raphe expressed Htr1a at levels comparable to levels

of Htr1a in wild type dorsal raphe or levels of residual Tph2 expression in cells of

the Pet-1–/– dorsal raphe (Figure 4C). Instead, a low uniform level of blue

precipitate was present in cells of the mutant dorsal raphe, which might be

background ISH signal, low residual expression in mutant 5-HT neurons, or

normal expression in non-serotonergic cells. Thus, in the case of the Htr1a

identity feature, far fewer 5-HT neurons are resistant to loss of PET-1 compared to the number of PET-1 resistant 5-HT neurons in the case of the Tph2 gene.

Further gene expression studies are likely to reveal other serotonergic identity features whose expression is dependent on PET-1 in all brain 5-HT neurons.

In summary, our findings provide additional insight into the regulatory strategies that enable 5-HT synthesis and reuptake in the brain. We show that

Pet-1 globally controls acquisition of the brain’s capacity for 5-HT synthesis by coordinating coexpression of Tph2, Ddc, and genes required for BH4 cofactor synthesis, regeneration, and post-translational negative feedback (Figure 6).

93

Thus, PET-1 controls all of the known rate-limiting enzymatic (TPH2, GCH1) and post-translational regulatory (GFRP) steps that determine the level of mammalian brain 5-HT synthesis. In addition, we show that PET-1 globally controls acquisition of 5-HT reuptake in dorsal raphe 5-HT neurons by coordinating

expression of high-affinity, low-capacity transport via SERT and low-affinity, high- capacity transport via OCT3 (Figure 6). We show that few, if any, 5-HT neurons in the dorsal raphe are resistant to loss of Pet-1 for expression of Slc22a3.

Similarly, PET-1 is indispensable for expression of Htr1a in what appears to be all or nearly all 5-HT neurons of the dorsal raphe that normally express this gene.

These findings indicate that while some 5-HT neurons are not absolutely dependent on PET-1 for expression of Tph2 virtually all dorsal raphe 5-HT neurons require Pet-1 for expression of other key identity genes. Therefore, few if any 5-HT neurons in the dorsal raphe are truly resistant to loss of PET-1 for their neurochemical differentiation.

Funding Information

This research was supported by NIH Grants P50 MH096972, RO1MH062723, and T32 NS067431.

94

Figure 1

95

Figure 1. Schematic of BH4 de novo synthesis, salvage, and regeneration

pathways and its role in 5-HT synthesis. TPH2, tryptophan hydroxylase 2;

AADC (Ddc), aromatic l-amino acid decarboxylase; GFRP (Gchfr), GTP cyclohydrolase I feedback regulator; GTPCH (Gch1), GTP cyclohydrolase; PTPS

(Pts), 6-pyruvoyl-tetrahydropterin synthase; SR (Spr), sepiapterin reductase;

AKR1C3, aldo-keto-reductase family 1 member 3; AKR1B1, aldo-keto-reductase family 1 B1; CR (Cbr1), carbonyl reductase; DHFR, dihydrofolate reductase;

DHPR (Qdpr), dihydropteridine reductase; PCD (Pcbd1, Pcbd2), pterin-4 alpha- carbinolamine dehydratase. Dashed lines indicate nonenzymatic steps.

96

Figure 2

97

Figure 2. Isolation of ePet-EYFP and Pet-1-/-; ePet-EYFP 5-HT neurons. (A, B).

Sagittal sections of E12.5 embryonic hindbrain. Dashed line indicates division

between rostral and caudal 5-HT neurons. (C, D). Flow cytometry data of sorted

YFP+ cells. X-Axis forward scatter area (FSC-A). Y-Axis 488 nm fluorescent intensity. (E, F). Sorted 5-HT neurons. (G). Number of YFP+ cells per embryo collected from either +/+ or Pet-1–/– animals (p = 1.00). (H). RT-qPCR validation of selected 5-HT genes in +/+ vs Pet-1–/– samples. Scale, 200 μm; zoom, 10 μm.

98

Figure 3

99

Figure 3. Microarray analyses. (A). Signal intensities of 5-HT neuron-type identity genes. (B). Signal intensities of BH4 pathway genes and Slc22a3. In situ hybridization of (C) Gchfr and (D) Gch1 probes at two rostro-caudal levels of the dorsal raphe of 3 week old mice. Scale, 200 μm. Genes were analyzed by a

Student’s t test followed by a Bonferroni correction. Corrected p-value: *p < 0.05,

**p < 0.01, ***p < 0.001.

100

Figure 4

101

Figure 4. Slc22a3 expression. (A). RT-qPCR analyses of 5-HT genes with RNA obtained from unsorted hindbrain dissections of E12.5 Pet-1+/– or Pet-1–/–

embryos. (B). Comparative in situ hybridization of Slc22a3 probe in +/+ and Pet-

1–/– mice. (C). 5-HT immunohistochemistry and Tph2 in situ hybridization in +/+

and Pet-1–/– adult mice. Scale, 200 μm. Genes were analyze by a Student’s t

test. p-value: *p < 0.05, **p < 0.01, ***p < 0.001.

102

Figure 5

103

Figure 5. Slc22a3 and Htr1a expression in the adult dorsal raphe. 25 μm coronal brain sections processed by in situ hybridization and developed for 15 h using an (A–H) Slc22a3 or (I–P) Htr1a probe on either wild type or Pet-1–/– tissue

sections. Alternate sections through the entire dorsal raphe were used for each

probe. “A” anterior; “P” posterior. Scale, 200 μm.

104

Figure 6

105

Figure 6. Pet-1 control of the 5-HT neuron-type gene battery. PET-1 coordinates expression of genes required for 5-HT synthesis (orange), vesicular transport and reuptake (purple), and autoreceptor function (blue). Filled red circles indicate direct control of genes as determined by chromatin

immunoprecipitation, reporter assays, and in vitro mobility shift assays. Other

genes in the schematic may also be direct targets of Pet-1 but have not yet been

investigated.

106

CHAPTER 3 PET-1 SWITCHES TRANSCRIPTIONAL TARGETS POSTNATALLY TO REGULATE MATURATION OF SEROTONIN NEURON EXCITABILITY By: Wyler SC*, Spencer WC*, Green NH, Rood BD, Crawford L, Craige C, Gresch P, McMahon DG, Beck SG, Deneris E.

Repoduced with permission from the Journal of Neuroscience, Feb 3;36(5):1758-

74. Copyright 2016.

*These authors contributed equally to this work

107

Summary

Newborn neurons enter an extended maturation stage during which they acquire excitability characteristics that are crucial for development of pre- and postsynaptic connectivity. In contrast to earlier specification programs little is known about the regulatory mechanisms that control neuronal maturation. The

Pet-1 ETS factor is continuously expressed in 5-HT neurons and initially acts in postmitotic precursors to control acquisition of 5-HT transmitter identity. Using a combination of RNA-sequencing, electrophysiology, and conditional targeting approaches we determined gene expression patterns in maturing flow-sorted 5-

HT neurons and the temporal requirements for PET-1 in shaping these patterns for functional maturation of mouse 5-HT neurons. We report a profound disruption of postmitotic expression trajectories in Pet-1-/- neurons, which prevented postnatal maturation of 5-HT neuron passive and active intrinsic membrane properties, G protein signaling, and synaptic responses to glutamatergic, lysophosphatidic and adrenergic agonists. Unexpectedly, conditional targeting revealed a postnatal stage-specific switch in PET-1 targets from 5-HT synthesis genes to transmitter receptor genes that are required for afferent modulation of 5-HT neuron excitability. 5-HT1A autoreceptor expression depended transiently on PET-1 thus revealing an early postnatal sensitive period for control of 5-HT excitability genes. Chromatin immunoprecipitation followed by sequencing revealed that PET-1 regulates 5-HT neuron maturation through direct gene activation and repression. Moreover, PET-1 directly regulates the 5-HT neuron maturation factor, Engrailed 1, which suggests PET-1 orchestrates

108

maturation through secondary postmitotic regulatory factors. The early postnatal

switch in PET-1 targets uncovers a distinct neonatal stage-specific function for

PET-1 during which it promotes maturation of 5-HT neuron excitability.

Significance Statement

The regulatory mechanisms that control functional maturation of neurons are poorly understood. We show that in addition to inducing brain 5-HT synthesis and reuptake the PET-1 ETS factor subsequently globally coordinates postmitotic expression trajectories of genes necessary for maturation of 5-HT neuron excitability. Further, PET-1 switches its transcriptional targets as 5-HT neurons mature from 5-HT synthesis genes to GPCRs that are necessary for afferent synaptic modulation of 5-HT neuron excitability. Our findings uncover gene- specific switching of downstream targets as a previously unrecognized regulatory strategy through which continuously expressed transcription factors control acquisition of neuronal identity at different stages of development.

Introduction

The development of mature neuronal identities is a crucial step in the formation of neural circuitry that enables behavioral output and plasticity (Fishell and Heintz, 2013). Neuronal maturation emerges progressively as earlier specification programs are suppressed and new gene expression trajectories commence to provide for acquisition of adult neuron-type morphological and functional characteristics. Tremendous progress has been made in elucidating the transcriptional mechanisms that control neural cell-type specification and

109

differentiation (Greig et al., 2013; Philippidous and Dasen, 2013; Shirasaki and

Pfaff, 2002; Smidt and Burbach). Much less is known, however, about the

precisely controlled gene expression patterns that are required for subsequent

postmitotic neuronal maturation and how they are transcriptionally controlled

early in life to generate functionally mature neurons (Okaty et al., 2009). This

constitutes a significant gap in understanding brain development as it is during

the maturation stage that synaptic connectivity is shaped, which is crucial for the

opening and closing of critical periods for experience dependent plasticity (de la

Torre-Ubieta and Bonni, 2011; Hensch, 2005; LeMagueresse and Monyer,

2013). Furthermore, genetic or environmental perturbation of gene expression

trajectories underlying pre- and postnatal neuronal maturation is thought to

directly contribute to autism and other neurodevelopmental disorders (Levitt et

al., 2004; Meredith et al., 2012; Tebbenkamp et al., 2014).

The regulatory mechanisms controlling the development of serotonin (5-

HT) neurons are of particular interest, as 5-HT has wide-ranging modulatory

effects on central neural circuitry. In addition, altered serotonergic gene

expression early in life has been implicated in several neurodevelopmental

disorders (Leonardo and Hen, 2008; Deneris and Wyler, 2012). Specification of

mouse serotonergic progenitors and acquisition of 5-HT transmitter identity is

controlled by a well-defined 5-HT gene regulatory network (GRN). The 5-HT

GRN comprises several transcription factors (TFs) including ASCL1, FOXA2,

which act at the progenitor stage, and GATA-2, LMX1B and PET-1, which act in postmitotic precursors to induce expression of a 5-HT gene battery, Tph2, Gch1,

110

Gchfr, Slc6a4 (SERT), Slc22a3, (OCT3), Slc18a2 (VMAT2), that enables initiation of 5-HT synthesis, reuptake, and vesicular transport (Deneris and Wyler,

2012). Newly differentiated 5-HT neurons then enter an extended fetal to early postnatal maturation stage during which they migrate to form the various raphe nuclei, develop connections with numerous other neuron-types, and acquire mature functional characteristics (Lidov and Molliver, 1982; Maejima et al., 2013).

A critical event at this stage is the maturation of the excitability features that are needed to establish appropriate pre- and postsynaptic connectivity (Lidov and

Molliver, 1982; Maejima et al., 2013). Indeed, intrinsic membrane properties, G- protein signaling and neurotransmitter afferent synaptic responses of 5-HT neurons do not acquire adult characteristics until the early postnatal period (Rood et al., 2014). In contrast to well-studied earlier specification stages that determine

5-HT transmitter identity, little is known about the regulatory factors that control postnatal maturation of 5-HT neuron excitability.

Here, we used whole genome approaches in fetal and postnatal 5-HT neurons to comprehensively investigate the regulatory strategies that shape maturation of postmitotic 5-HT neurons. We show that in addition to inducing brain 5-HT synthesis and reuptake PET-1 subsequently coordinates postmitotic expression trajectories of genes necessary for maturation of 5-HT neurons. The broad disruption of gene expression patterns blocked functional maturation of 5-

HT neuron passive and active membrane properties, multimodal afferent synaptic inputs and G protein signaling. To understand how PET-1 controls 5-HT neuron maturation, we used conditional targeting approaches and found that

111

PET-1 switches targets from those required in newborn 5-HT neurons for

initiation of 5-HT synthesis to those required postnatally for extrinsic control of 5-

HT neuron excitability. Further, we uncover an early postnatal sensitive period for

control of 5-HT autoreceptor expression by PET-1. ChIP-seq analyses suggest

PET-1 controls maturation through direct activation and repression of

downstream targets including several TFs with known roles in neuronal

maturation. Our findings reveal a previously unrecognized stage-specific function

for Pet-1 that is critical for postnatal maturation of 5-HT neuron excitability.

Methods

Animals

Mice were maintained in ventilated cages on a 12 light/dark cycle with access to food and water ad libitum with 2-5 mice per cage. All mice except the ePet-mycPet-1 mice were backcrossed at least 5 generations onto a C57Bl/6J background. ePet-mycPet-1 mice were maintained on a mixed

C57Bl/6*129sv*SJL background. Embryonic age was defined by the number of days following the appearance of a vaginal plug, designated as embryonic day

0.5 (E0.5). The date of birth was designated at postnatal day 0 (P0). All procedures were approved by the Institutional Animal Care and Use Committees of Case Western Reserve University, Vanderbilt University and Children Hospital of Philadelphia in accordance with the National Institutes of Health Guide for the

Care and Use of Laboratory Animals. Mice were genotyped using the following primers: Pet-1: 5’-CGGTGGATGTGGAATGTGTGCG-3’, 5’-

112

CGCACTTGGGGGGTCATTATCAC-3’, 5’-

GCCTGATGTTCAAGGAAGACCTCGG-3’ floxed Pet-1: 5’-

TAGGAGGGTCTGGTGTCTGG-3’ 5’-GCGTCCTTGTGTGTAGCAGA-3’ ePet- mycPet-1: 5’-GGGCCTATCCAAACTCAACTT -3’ 5’-

GGGAGGTGTGGGAGGTTTT-3’ ePet-EYFP: 5’-

TATATCATGGCCGACAAGCAG -3’, 5’-GAACTCCAGCAGGACCATGT-3’ eFev-

βgal 5’-CAAAGACAGGAGGAGGTTGGTAGC 3’, 5’-

TTGGGTAACGCCAGGGTTTTCC-3’.

Flow cytometry and total RNA isolation ePet-EYFP or Pet-1-/-;ePet-EYFP mice were used to collect YFP+ 5-HT neurons

with flow cytometry. E11.5 and E15.5 hindbrain tissue was dissected between

the mid hindbrain boundary and rhombomere 4. For isolation of postnatal

neurons (PN), the corresponding region of the dorsal and median raphes from

P1-P3 was excised. To dissociate cells, dissected embryonic tissue was treated

with trypsin following a previously published protocol (Wylie et al., 2010; Wyler et

al., 2015). Postnatal tissue was dissociated with a modified protocol: Tissue was

collected in SSS media [Hibernate A, (Life technologies), 2% B27 and 0.25%

Glutamax (Invitrogen)] then washed in PBS and incubated on a shaker at 37°C

for 40min using a papain/DNase I solution (Worthington, Papain Disassociation

kit: 20units/ml papain, 1mM L-cysteine, 0.5mM EDTA, 0.05mg/ml DNase I in

Earle's balanced salt solution). Dissociated cells were washed in Leibovitz's L-15

(Life Technologies) media and resuspended in SSS media followed by trituration

using a series of three fire polished glass pipettes with decreasing bore width.

113

Cells were passed through a 40μm filter (BD Biosciences) and sorted on a

Becton Dickinson FACS Aria digital cell sorter with an argon laser (200 mW at

488 nm) using an 85μm nozzle. Cells were sorted directly into 500μl Trizol

(Invitrogen). Each biological replicate is defined as an independent sorting

experiment from pooled embryos on different days of different litters. Total RNA

was isolated after addition of 10 μg Glycoblue (Ambion) using chloroform

extraction. RNA was purified and DNase I treated using the RNA Clean &

Concentrator™-5 kit (Zymo). RNA quality was analyzed using an Agilent 2100

bioanalyzer. All samples had a RIN ≥ 8.3.

RNA sequencing analysis

Purified total RNA was amplified with the SMARTer Ultra-low mRNA-Seq kit (Clontech) or Ovation RNA-Seq System V2 (NuGEN). Libraries were sequenced using paired-end reads for 50 to 100 cycles on the HiSeq 2500 system (Illumina). Sequence reads were mapped to the Mus musculus transcriptome (UCSC mm9) using annotation supplied by Illumina

(ftp://igenome:[email protected]/Mus_musculus/

UCSC/mm9/Mus_musculus_UCSC_mm9.tar.gz). Gene expression quantification and differential expression was analyzed using Cufflinks v2.2.1. High Spearman rank correlations within biological replicate groups (>0.95) and between conditions (>0.85), as well as, the number of high-quality mapped read pairs per

sample indicate the high-quality nature of the RNA-seq data. FPKM values were

compared using the time-series option of Cufflinks. In the trajectory expression

profiling and ePet-EYFP versus Pet-1-/-;ePet-EYFP comparisons, genes were called

114

differentially expressed if fold-change was ≥ 1.5 and FDR was ≤ 5%. Hierarchical

clustering of genes differentially expressed over development was performed in

Matlab (Mathworks) using row-scaled expression values with average linkage

and Euclidean distance. Gene ontology analysis was performed using

WebGestalt (http://www.webgestalt.org), requiring a minimum of 2 genes per

category and hypergeometric test p-value ≤ 0.01 (Zhang et al., 2005). Protein functional class annotation was performed using PantherDB version 9.0, which uses conserved protein families to categorize gene sets (Mi et al., 2013).

Chromatin immunoprecipitation sequencing (ChIP-seq)

YFP+ tissue between the mid-hindbrain boundary and rhombomere 4 of

E12.5 to E15.5 hindbrains from Pet-1-/-; ePet-mycPet-1; ePet-EYFP embryos was

dissected and quickly flash frozen on dry ice. Chromatin was isolated and

immunoprecipitated using a ChIP grade, goat anti-Myc antibody (Abcam ab9132,

Cambridge, MA) with proprietary protocols (Active Motif, Carlsbad, CA). Reads were mapped to the Mus musculus genome (UCSC mm10) using the Burroughs-

Wheeler Aligner (BWA) and were filtered to select reads that map to a single location (Li and Durbin, 2009). Peak calling was performed with MACS v1.4.2 modified to accept a custom scaling factor of 0.8195945 derived from the

Normalization ChIPseq software (NCIS) (Zhang et al., 2008; Liang and Keleş,

2012). MycPet-1 ChIP peaks were associated to genes using the GREAT web service v3.0 (mm10) with 5kb intervals upstream and downstream of the TSS and TTS of each gene model along with peaks that overlap the gene body. ChIP

115

peak signal coverage was visualized in the UCSC genome browser (Rhead et

al., 2010).

Electrophysiology

Slice preparation and recording

Brain slices from Pet-1-/- mice or their wild-type (+/+) littermates were prepared as previously described from P21 (P20-P24) or adult (>P60) mice

(Crawford et al., 2011; Green et al., 2015). Brains were sectioned using a vibratome (Leica Microsystems, Wetzlar, Germany) at approximately 200 μm and maintained in ice-cold sucrose aCSF (see below, 248 mM sucrose substituted for

NaCl) during sectioning as previously described (Beck et al., 2004; Calizo et al.,

2011; Crawford et al., 2011). Once sectioned, slices were maintained in a holding chamber containing aCSF (in mM, NaCl 124, KCl 2.5, NaH2PO4 1.25, MgSO4

2.0, CaCl2 2.5, dextrose 10, NaHCO3 26 and L-tryptophan) bubbled with

95%O2/5%CO2 mixture at 37°C for one hour, then at room temperature until recording. L-tryptophan (2.5 μM; Sigma-Aldrich, St. Louis, MO) was included in the holding chamber to maintain 5-HT synthesis, but was not present in aCSF when recording (Liu et al., 2005). During a recording session, slices were placed in a recording chamber (Warner Instruments, Hamden, CT) and bathed in continuous flow of aCSF heated to 32-34oC with an inline heater (Warner

Instruments). Neurons were visualized using a Nikon E600 upright microscope

(Nikon, Tokyo, Japan) and targeted under DIC. Recordings were made using

glass electrodes (3-6 MΩ access resistance) filled with electrolyte (mM; K-

116

gluconate, 130; NaCl, 5; Na phosphocreatine, 10; MgCl2, 1; EGTA, 0.02;

HEPES, 10; MgATP, 2; and Na2GTP, 0.5; with biocytin, 0.1%; pH 7.3). Whole-

cell recordings were controlled using a Multiclamp 700B amplifier (Molecular

Devices, Sunnyvale, CA) and signals were collected and stored using a Digidata

1320 analog-to digital converter and pClamp 9.0 or 10.0 software (Molecular

Devices). Following recording, slices were stored in 4% paraformaldehyde at

4oC for immunohistochemical detection of TPH2 to verify 5-HT neuron identity. In

some experiments, +/+ and Pet-1-/- possessed the eFEV-LacZ transgene, which was used to verify 5-HT neurons with anti-βgal immunostaining (Krueger and

Deneris, 2008). Chemicals for buffers and electrolytes were purchased from

Sigma-Aldrich. Statistical tests were performed using STATISTICA (StatSoft).

Data were analyzed using one-factor and two-factor ANOVAs. Post hoc analyses were conducted using the Student–Newman–Keuls method. A probability level of p < 0.05 was considered significant in all analyses.

Passive and active membrane characteristics

Passive and active membrane characteristics were recorded using current

clamp techniques as previously described (Calizo et al., 2011). To obtain data on

neuronal membrane characteristics (e.g., resting membrane resistance, resting

membrane potential, and membrane time constant), action potential

characteristics (e.g., action potential threshold, amplitude, duration, and after-

hyperpolarization amplitude) and excitability (frequency versus current), each cell

received 500 ms current injections starting at -100 pA and stepping to 180 pA in

117

20 pA steps. Current pulses were separated by 10s and voltage responses were

recorded in response to each current pulse.

Glutamatergic synaptic activity

Baseline glutamate activity at adult stages, in the form of excitatory post-

synaptic currents (EPSCs), was examined by recording current in voltage clamp

mode for 2-5 min as previously described (Lemos et al., 2006; Crawford et al.,

2011). Several characteristics of EPSCs were examined including frequency, rise and decay time, amplitude, and charge. A minimum of 200 EPSC events was used to calculate average EPSC characteristics. Statistical comparisons of EPSC characteristics were calculated using Students t-tests.

5-CT and GTPγS responses

To investigate 5-HT1A autoreceptor function, the non-selective 5-HT1,7

agonist 5-carboxamidotryptamine (5-CT; 100 nM, Sigma-Aldrich) was added and

current was recorded until a steady state outward potassium current was

obtained (a total of ~5 min). This outward hyperpolarizing current has previously

been characterized as mediated by the 5-HT1A receptor in the dorsal and median

raphe. GTPγS is a non-hydrolyzable form of GTP that can be used to directly

activate G-protein coupled channels including G-protein inner rectifying

potassium (GIRK) channels. In normal dorsal raphe serotonin neurons, the

inhibitory 5-HT1A autoreceptor activates GIRK channels resulting in an outward

potassium current. This response is mimicked by activation of G-protein

regulated channels by adding GTPγS to the electrode solution. To measure the

118

effect of GTPγS activation, voltage clamp techniques were used to record from 5-

HT neurons from P21 Pet-1-/- and +/+ mice with either normal electrolyte or with

electrolyte containing 10μM GTPγS (15 mM; Roche Diagnostics, Indianapolis,

IN) as previously described (Rood et al., 2014). Recordings of current were taken using voltage clamp techniques immediately upon membrane rupture so that the outward current elicited by the GTPγS activation of the G-protein could be recorded as it dialyzed into the cell and achieved steady state levels, approximately 3-5 min. Statistical comparisons of GTPγS responses were made with a two-factor ANOVA using genotype and electrolyte solution as factors, followed by Student–Newman–Keuls t-tests.

Multielectrode array recordings

As there are differences in the electrophysiological properties of neurons in the medial and lateral wing subfields of the DR, placement on the array and the dimensions of the electrode grid were such that recordings were made only from ventromedial DRN neurons (vmDRN). Mid-DRN slices of 280μm thickness were taken between -4.5 mm and -4.75 mm back from bregma. We used a 6X10 perforated array with electrodes that have a diameter of 30 μm and 100 μm spacing between electrodes. The slice was placed so the electrodes cover an area spreading 1200 μm down from the cerebral aqueduct in the ventral direction and 340 μm laterally on either side of the midline (for a 680 μm total recording width). Placement of the array in the vmDRN region assured that the vast majority of cells in our recordings were 5-HT neurons based on extensive immunohistochemical detection of TPH2, 5-HT and genetic markers of 5-HT

119

neurons in this region (Scott et al., 2005; Krueger and Deneris, 2008). Data files

were saved as .mcd files and analyzed in offline sorter. For analysis a Besel filter

with a 150 Hz frequency cut off was applied to the raw data traces. The threshold

for detection was set manually to a level that will include all legitimate spikes with

the least amount of unipolar noise spikes included (between 13 μV and 35 μV).

Once spikes were detected they were sorted by a combination of a K means

scan method and manual verification. The manual verification was conducted

after the K means scan was run and divided spikes into groups based on

criterion such as amplitude, power under the curve and spike duration (for full list of criterion see offline sorter V3 manual under the K means scan, Plexon Inc.).

Once waveforms were sorted into groups and judged to be biologically relevant each spike was validated by eye and spikes that did not fit the average waveform shape were invalidated. All unsorted spikes were visualized manually and any spikes that matched the average waveform shape in the relevant group were added to that group. Spikes were then sorted into two classes using mean spike width as well as coefficient of variance (COV= standard deviation/ mean) of their firing pattern to categorize each cell. Spikes were sorted into one group that had a large waveform, 0.2ms or longer starting from the initial depolarization to the end of recovery, as well as a low COV, below 0.9 (arbitrary units, calculated using MATLAB by Mathworks). The other population was defined by a smaller waveform, below 0.2ms, and a more variable firing pattern, a COV above 0.9.

These cutoff values were determined by trial and error with most cells that had a waveform width above 0.2 also displaying a COV below 0.9 and vice versa.

120

Perfusion/sectioning

Mice were anesthetized with Avertin (44mM tribromoethanol, 2.5% tert- amyl alcohol) 20 ml/kg and transcardially perfused with phosphate buffered saline (PBS) followed by 4% paraformaldehyde (PFA) (Electron microscopy sciences) in PBS for 20 minutes. Brains were extracted and fixed for an additional 2hr in 4% PFA/PBS and incubated in 30% sucrose in PBS at 4°C overnight. Sections were collected using a freezing sliding microtome and mounted on SuperFrost Plus slides (Fisher Scientific). Slides were stored at -

80°C until use. All histology was performed on sex-matched littermate controls.

For all experiments, sections were taken from the entire rostral caudal axis of the dorsal raphe nucleus. Mice were between 2-4 months unless stated otherwise.

Immunohistochemistry

Twenty μm sections from 2 month, female eFev-LacZ and Pet-1-/-; eFev-LacZ littermates (Krueger and Deneris, 2008) were washed for 15 minutes in 1x

Phosphate buffered saline pH 7.4 (PBS) with 0.3% triton x-100 (Fisher). Slides were blocked in10% normal goat serum (NGS) (Millipore) in PBS with 0.1% triton

(PBS-T). Slides were then incubated at 4°C overnight in 5% NGS PBS-T with rabbit anti-ADRA1B 1:500(Protos, NR-102, New York, NY) and chicken polyclonal anti-β-galactosidase, 1:1000 (Abcam ab9361, Cambridge, MA, validation at abcam.com). Slides were washed 6 times in PBS-T and incubated for 2 hours at room temperature with Alexa Fluor-488, Alexa Fluor-594 anti- chicken or anti-rabbit antibody 1:500(Invitrogen) in 5% NGS PBS-T. Slides were

121

then washed 6 times in PBS-T and mounted with ProLong® Antifade Reagents

(Life Technologies).

In situ hybridization

RNA isolated from an adult C57Bl/6 mouse was used to generate cDNA

using the Transcriptor First Strand cDNA Synthesis Kit (Roche). cDNA template

was amplified by PCR with T3 viral promoter sequences at the 5’ end of the

reverse primer (see Table below for primer sequences). Probes were ~500-600

nucleotides and had less than 70% sequence identity to other paralogs (based

on NCBI blastn). PCR product was ligated into either the pCR™2.1 Vector (TA

Cloning® Kit, Life Technologies) or pGEM®-T Easy Vector (Promega) and transformed into One Shot® TOP10 Chemically Competent E. coli. (Invitrogen).

Each probe was verified by Sanger sequencing. T3 RNA polymerase (Roche) used to generate DIG-labeled antisense probes with digoxigenin-11-UTP according to the manufacturer’s instructions. To increase sensitivity for Lpar1,

Slc22a3, Gria4, and Htr1a, two probes corresponding to different regions of the transcript were co-hybridized to endogenous mRNA. Sections were treated for 10 min with 4% PFA in PBS (Electron Microscopy Sciences) and washed 3x 3 minutes with 0.1% diethylpyrocarbonate (DEPC) (Sigma) containing phosphate buffered saline (PBS). Sections were then incubated in 10μg/ml proteinase K

(Ambion) in 0.05 M Trizma buffer, 0.0156 M EDTA, pH 7.4 for 16 min. Sections were fixed for 5 min in 4% PFA and washed 3x 3 minutes in DEPC-PBS.

Sections were incubated for 10 min in 0.25% acetic acid anhydride (Sigma) v/v in

0.1M Triethanolamine (Sigma), pH 8.0. Slides were washed 3x in DEPC-PBS

122

and prehybridized for 2 hr in hybridization buffer (50% formamide (Roche),

5xSSC buffer (Fisher), 5X Denhardts solution (Fisher) 250μg/ml yeast RNA

(Sigma), 500 μg/ml salmon sperm DNA (Sigma). Slides were incubated 8-16 hr

at 65°C with digoxigenin-11-UTP labeled probe in hybridization buffer covered by

Hybrislip coverslips (Life Technologies). Slides were washed twice for 1hr in

2xSSC 50% formamide at 65°C followed by 10 min in 1x SSC at 37°C. Slides were equilibrated at room temperature for 10 min in buffer B1 (0.1M Trizma,

0.15M NaCl, pH 7.5). Slides were blocked for 1hr in 10% heat inactivated goat serum in buffer B1 and incubated at 4°C overnight in 1:2500 anti-digoxigenin-ap fab fragments (Roche) in 5% goat serum in buffer B1. Slides were washed 5x 5 min in buffer B1 and incubated for 10 min in buffer B2 (0.1 M Trizma, 0.1M NaCl, and 50mM MgCl2 and 2 μM levamisole). Slides were developed in a chromogen solution (340mg/ml 4-Nitro blue tetrazolium chloride (Roche), 180 mg/ml BCIP 4- toluidine salt (Roche) in Buffer B2 for 6-24hr. Slides were then fixed in 4% PFA for 10 min and serially dehydrated in 50%, 60%, 70%, 80%, 90%, 100% ethanols followed by d-limonene (MP Biochemicals) and mounted using VectaMount

Permanent Mounting Media (Vector Laboratories). All histology was performed on sex-matched littermate controls

Imaging

Slides were imaged on an Olympus Optical BX51 microscope (Center

Valley, PA) using a SPOT RT color digital camera (Diagnostic Instruments,

Sterling Heights, MI). Images were converted to gray scale and brightness and

123

contrast were adjusted using ImageJ (http://rsb.info.nih.gov/ij) across the entire

image.

Prazosin binding assay

Prazosin binding was performed as previously described (Green et al.,

2015). Homogenized midbrain membranes were incubated with [3H] prazosin [6

nM] in the presence or absence of prazosin [10 μM] to measure non-specific and

total binding, respectively. Reaction buffer included the alpha 1A receptor

antagonist WB 4101 [10 μM]. Specific binding was calculated by subtracting non-

specific binding from total binding and expressed as bound ligand (fmol) per mg

protein. All experiments were performed in duplicate. Significance was calculated

by a two-tailed t-test for independent samples.

Viral injections

P0 injection: Pups were cryoanesthetized for the entire procedure. Pups

were injected bilaterally with Stoelting Lab standard stereotaxic instrument using

coordinates from lambda (x= +/- 0.5 mm; y= -2 mm, z= -2.5mm) with 0.5 μl

AAV1.CMV.Pl.eGFP.WPRE.bGH (AAV1-GFP)/side or 0.5 μl

AAV1.CMV.Pl.Cre.rBG (AAV::Cre)/side (University of Pennsylvania Viral Core).

P22 pups and adults were anesthetized with isoflurane and bilaterally injected using the following coordinates: P22 (x= +/- 0.5 mm; y= -1.0 mm, z= -3.5 mm),

P60 and older (x= +/- 0.5 mm; y=0.0 mm, z= -4.2 mm). Knock down of Pet-1 was verified by taking every 3rd or 4th section and processing for Pet-1 expression

by ISH.

124

Results

Gene expression trajectories in maturing 5-HT neurons.

To study 5-HT neuron maturation, we first used RNA-sequencing in flow sorted EYFP+ 5-HT neurons to temporally profile their genome-wide patterns of gene expression. EYFP+ 5-HT neurons were flow sorted at E11.5, when the vast majority of 5-HT neurons are born (Pattyn et al., 2003); E15.5, when 5-HT neurons are actively extending dendrites and axons; and postnatal days 1-3 (PN) when 5-HT neurons have coalesced into mature raphe nuclei and are acquiring mature functional properties. We isolated total RNA from three biological replicates at each time point and synthesized cDNA libraries suitable for mRNA- seq. We obtained an average of 37 million uniquely mapped paired-end reads to the mouse transcriptome for each biological replicate at each time point. Using time-series differential expression analysis, we identified 6,126 genes whose expression changed at least 1.5X fold at ≤ 5% FDR from E11.5 to E15.5 and from E15.5 to PN. These data indicated that global changes in gene expression occur as newly born 5-HT neurons begin to establish synaptic connectivity and are acquiring mature functional characteristics.

Unsupervised hierarchical clustering of genes with significantly altered expression across maturation revealed discrete groups that share highly similar temporal expression patterns characterized by either ascending or descending mean trajectories (Figure 1A). Gene ontology (GO) analyses were used to predict shared function of expression clusters. Three ascending clusters, C6, C7,

125

and C9, were significantly enriched for GO annotation terms associated with

maturation of neuronal morphology and function: axonogenesis, growth cone,

extracellular glutamate gated ion channel, synaptic vesicle membrane, and

synaptic transmission (Figure 1B). In contrast, clusters C1, C2, and C10

displayed descending trajectories and are enriched for GO terms associated with

downregulation of earlier developmental programs involved in progenitor

proliferation and specification (Figure 1B). These data suggest that while earlier specification programs are downregulated, new programs commence to control morphogenesis and acquisition of mature functional properties.

PET-1 broadly coordinates gene expression trajectories during maturation

To determine the regulatory strategies through which dynamic gene

expression patterns are controlled in maturing 5-HT neurons we focused on PET-

1 as it is continuously expressed in maturing 5-HT neurons and unlike Lmx1b,

Pet-1 is not required for their survival (Hendricks et al., 1999; Kiyasova et al.,

2011; Krueger and Deneris, 2008; Zhao et al., 2006). Three biological replicates

of flow sorted +/+ and Pet-1-/- 5-HT neurons were collected at E15.5 and

analyzed for differential expression by RNA-seq. As expected, expression of the

known PET-1 controlled 5-HT battery genes (Tph2, Slc6a4, Slc18a2, Htr1a,

Gch1, Gchfr, Qdpr) were severely reduced in Pet-1-/- vs. +/+ (data not shown)

thus validating our RNA-seq approach.

Loss of PET-1 causes extensive changes in expression trajectories with

hundreds of genes displaying substantially decreased as well as increased

126

expression (Figure 2A). GO analysis of PET-1 regulated genes showed

enrichment for terms that function in basic cellular processes as well as neuron-

specific processes (Figure 2B). We manually annotated genes exhibiting

significantly increased or decreased expression. A large number of

TFs/chromatin modifiers, G-protein coupled receptors, ion channels,

transporters, cell adhesion/axon guidance, peptide, synaptic and broadly

expressed genes showed significantly altered expression in Pet-1-/- 5-HT neurons (Figure 3). In situ hybridization (ISH) verified PET-1’s broad regulatory scope (Figure 4). We also verified potential repression of some genes by PET-1 and found that expression of the hypocretin receptor 1 gene, Hcrtr1, was substantially upregulated in the Pet-1-/- dorsal raphe nucleus (DRN), but not in

non-serotonergic sites of Hcrtr1 expression (Figure 4). These findings demonstrate that, in addition to controlling the 5-HT gene battery for acquisition of 5-HT transmitter identity, PET-1 also positively and negatively regulates many disparate functional categories of genes as 5-HT neurons mature.

Pet-1-/- 5-HT neuron passive and active membrane properties are

permanently immature

To directly test whether PET-1 was required for functional maturation of

postmitotic 5-HT neurons we used whole cell patch clamp electrophysiology to

assess passive and active intrinsic membrane characteristics of Pet-1-/- 5-HT

neurons. Previous studies demonstrated that 5-HT neuron passive and active

membrane characteristics mature postnatally and do not exhibit maturity until

around P21 (Rood et al., 2014). Thus, we directly compared functional

127

membrane characteristics in Pet-1-/- and +/+ slices obtained from P21 mice and

also in slices from adult mice to examine whether any differences persisted.

Although not different at P21, resting membrane potential was significantly

depolarized in slices obtained from Pet-1-/- adults compared to adult +/+ slices

(Figure 5B1), thus indicating an immature functional characteristic of Pet-1-/- 5-HT

neurons as defined previously (Rood et al., 2014). In P21 slices, membrane

resistance was increased in Pet-1-/- 5-HT neurons compared to membrane

resistance in +/+ slices (Figure 5B2), which further corresponds to an immature

functional state (Rood et al., 2014). In addition, the membrane time constant, tau, was also increased in Pet-1-/- 5-HT neurons compared to tau in +/+ slices

(Figure 5B3).

Several active membrane properties were also altered in Pet-1-/- mice and thus (Figure 5C) consistent with an immature functional state (Rood et al., 2014).

Action potential (AP) amplitude was significantly decreased while AP firing

threshold was more hyperpolarized and after-hyperpolarization (AHP) amplitude

was decreased in Pet-1-/- 5-HT neurons (Figure 5C1-C4). These changes

persisted into adulthood indicating permanent immaturity. Most of these

parameters combine to govern neuron excitability, thus changes in these

characteristics would suggest changes in excitability. Depolarizing current pulse

injection revealed significantly greater and permanent current-induced excitability

of Pet-1-/- neurons (Figure 5D). Together our findings reveal numerous altered

passive and active membrane characteristics of Pet-1-/- neurons, indicative of an

128

immature stage of 5-HT neurons (Rood et al., 2014), which therefore reveal a

crucial role for PET-1 in programming their functional maturation.

PET-1 controls maturation of glutamatergic and GPCR synaptic input to 5-

HT neurons

Gene ontology analyses revealed significant enrichment in ascending

clusters C6 and C7 for terms/genes associated with extracellular ligand-gated ion

channel activity and glutamate-gated ion channel activity, respectively (Figure

1B), which suggested that a key step in 5-HT maturation is expression of

ionotropic receptors that are required for proper afferent control of 5-HT neuronal

firing and transmitter release (Maejima et al., 2013). A major source of direct

excitatory synaptic input to 5-HT neurons is glutamatergic afferents acting via

AMPA/kainate receptors (Crawford et al., 2011). However, little is known about

the specific glutamate receptor subtypes expressed in 5-HT neurons and how

their expression is controlled.

RNA-seq analyses indicated that Gria2 and Gria4 were the principal

AMPA receptor subunit genes expressed in maturing 5-HT neurons, while Gria1 and Gria3 were expressed at much lower levels throughout the E11 to P3 stage of maturation (Figure 6). ISH verified strong Gria2 and Gria4 expression with

weak expression of Gria1 in the adult DRN; Gria3 expression was not detected in

adult DRN 5-HT neurons (Figure 7A). RNA-seq revealed that PET-1 deficiency

resulted in a specific decrease in Gria4 expression (Figure 7B), which was

verified by ISH (Figure 4).

129

The control of Gria4 by Pet-1 suggested that Pet-1 promotes maturation of functional AMPA receptor (AMPAR) responses in 5-HT neurons. To test this idea, we performed whole cell recordings in slices obtained from +/+ and Pet-1-/- slices (Figure 7C-H). Although EPSC frequency was not altered we found a significant increase in the variability of EPSC frequency indicating decreased glutamatergic input to Pet-1-/- neurons (Figure 7E, p<0.0005). Moreover, Pet-1-/-

neurons exhibited an overall decrease in EPSC amplitude (Figure 7F) and

shortening of the EPSC decay time (Figure 7G) leading to a reduction in the

charge carried by each current (Figure 7H). Together these findings suggest

decreased postsynaptic AMPAR numbers and therefore PET-1 is required for functional maturation of excitatory glutamatergic input onto 5-HT neurons through its specific control of the Gria4 expression trajectory.

To determine whether PET-1 plays a broader role in coordinating maturation of afferent synaptic responsivity in 5-HT neurons, we examined

GPCR expression in our RNA-seq datasets. A critical synaptic input to the 5-HT system originates from noradrenergic neurons that drive tonic firing of 5-HT neurons through α1 adrenoceptors (Vandermaelen and Aghajanian, 1983).

Adra1b expression was substantially increased during the maturation phase while Adra1a and Adra1d expression was weak or undetectable (Figure 8A), which is consistent with previous studies (Day et al., 2004). Thus, late fetal-early postnatal upregulation of Adra1b appears to be a key event in the functional maturation of 5-HT neurons (Figure 8A). Immunostaining (Figure 8B), gene expression (Figure 8C) and membrane ligand binding with the α1 adrenergic

130

receptor antagonist [3H]-prazosin (Figure 8D) verified loss of the receptor in Pet-

1-/- DRN. Furthermore, multielectrode array (MEA) recordings demonstrated that

Pet-1-/- 5-HT neurons lacked functional α1 adrenergic receptors as they failed to

display an increase in excitability in response to increasing doses of

phenylephrine (PE), a selective ADRA receptor agonist (Figure 8E).

Lysophosphatic acids (LPAs) are critical lipid signaling molecules in the

nervous system. LPAs have been implicated in the regulation of neural

development and cognition through six different GPCRs, LPA1-LPA6 (mouse

gene names Lpar1-Lpar6; Yung et al., 2015). In contrast to other Lpar genes,

Lpar1 expression increased from E11.5 to E15.5 with little change in expression level at birth (Figure 9A). RNA-seq (Figure 9B) indicated a loss of Lpar1

expression in Pet-1-/- 5-HT neurons and ISH verified that Pet-1 was required for

Lpar1 expression in the DRN (Figure 4). MEA recordings indicated that in

contrast to 5-HT neurons in +/+ slices 5-HT neurons in Pet-1-/- slices, did not

exhibit a dose response relationship with NAEPA, a selective LPA1 agonist

(Figure 9C).

We next investigated whether in addition to coordinating GPCR

expression PET-1 controls downstream G-protein signaling, which also develops

postnatally in 5-HT neurons (Rood et al., 2014). Voltage clamp recordings were

used to test activation of G-protein coupled channels with the non-hydrolysable

GTP analog, GTPγs (Rood et al., 2014). The magnitude of the response elicited

by GTPγs in Pet-1-/- neurons was significantly lower than the response observed

in control 5-HT neurons (Figure 10), which suggests immature G-protein to GIRK

131 channel signaling in Pet-1-/- neurons. Our collective electrophysiological findings presented in Figures 4, 5, and 6 demonstrate that Pet-1-/- 5-HT neurons fail to acquire mature ionotropic and GPCR synaptic pathways that provide for extrinsic control of 5-HT neuron excitability.

Stage specific switching of Pet-1 targets

The continuous expression of PET-1 led us to inquire whether its function is required specifically in the early postnatal period as excitability of 5-HT neurons is maturing. Thus, we developed an adeno-associated viral (AAV) mediated Cre/loxP approach to target PET-1 at different postnatal stages (Figure

7A). Pet-1fl/- mice at postnatal day 0 (P0) were stereotaxically injected with either

AAV-Cre (Pet-1fl/-;AAV-Cre) or AAV-GFP (Pet-1fl/-;AAV-GFP). Four weeks following injection, Pet-1 expression was assayed by ISH throughout the DRN. Neither

AAV-GFP injection into the Pet-1fl/- pons nor AAV-Cre injected into Pet-1+/- pons had any effect on the expression of Pet-1 (Figure 11). In contrast, AAV-Cre injections into the Pet-1fl/- brain eliminated more than 95% of Pet-1 expression throughout the entire DRN (Figure 11).

We next investigated the temporal requirements for PET-1 in the control of

5-HT neuron transmitter identity. ISH assays verified that expression of 5-HT synthesis genes, Tph2, Gch1, Gchfr, was nearly eliminated in Pet-1-/- mice

(Figure 12A). Unexpectedly, however, we found a dramatic change in the sensitivity of these genes to PET-1 deficiency in the early postnatal period: Tph2 and Gchfr expression were only slightly reduced while Gch1 expression was not

132

altered (Figure 12B). These findings reveal a surprising temporal change in the

dependence of 5-HT synthesis genes on PET-1 as 5-HT neurons mature. We

then examined Htr1a as its expression is low at the onset of 5-HT synthesis in

newborn 5-HT neurons and is subsequently upregulated as 5-HT neurons

mature, which is consistent with the postnatal development of the 5-HT1A

autoreceptor pathway (Liu et al., 2010; Rood et al., 2014). In striking contrast to

5-HT synthesis genes, neonatal targeting of Pet-1 resulted in severely decreased

expression of Htr1a in the DRN (Figure 13A). Similarly, neonatal targeting of Pet-

1 nearly eliminated upregulation of Adra1b expression and substantially reduced

Gria4 expression specifically in the DRN (Figure 13A). We also examined

whether PET-1 function was required in the early postnatal period to repress

some targets. Indeed, Hcrtr1 expression was increased after neonatal targeting

of Pet-1 (Figure 13B). These findings reveal a stage-specific switch in PET-1

targets from 5-HT synthesis genes to GPCR excitability genes during early

postnatal 5-HT neuron maturation.

To further investigate stage-specific control of 5-HT excitability genes, we

targeted Pet-1 at additional postnatal time points. AAV-Cre injection into Pet-1fl/-

mice at P22 also led to a near complete loss of Htr1a expression (Figure 13C). In

contrast, when P60 Pet-1fl/- mice were injected with AAV-Cre we found a

markedly reduced sensitivity of Htr1a to loss of Pet-1 (Figure 13C). The early life closing of Pet-1 dependent control of Htr1a was not due to a general loss of PET-

1 function as, Slc22a3, the low-affinity high-capacity 5-HT transporter gene

(Baganz et al., 2010), remained highly sensitive to loss of Pet-1 at P60 (Figure

133

8C) and even in 18 month old mice (Figure 13D). Whole cell recordings verified the PET-1 dependence of 5-HT1A agonist responses in adult 5-HT neurons and

further revealed that despite the eventual loss of Htr1a’s sensitivity to PET-1

compensatory restoration of autoreceptor function does not occur later in life

(Figure 13E). Together these findings uncover an early postnatal sensitive period for control of Htr1a expression by PET-1.

PET-1 directly controls the 5-HT neuron maturation-promoting factor,

Engrailed 1

To investigate the regulatory mechanisms through which PET-1 controls

5-HT neuron maturation, we performed ChIP-seq with the ePet-mycPet-1 mouse rescue line (Figure 14A; Liu et al., 2010). We collected chromatin from 168 PET-

1 expressing rostral hindbrains of E12.5-E15.5 embryos to capture the early epoch of PET-1 occupancy in 5-HT chromatin. With over 27 million uniquely mapped sequencing reads from mycPET-1 immunoprecipitated DNA, we identified 4,953 mycPet-1 ChIP peaks enriched over the input sample ≥2 fold (p- value ≤ 1.0e-05). As predicted for an ERG-type ETS domain TF (Wei et al.,

2010), mycPET-1 ChIP peaks were enriched near transcription start sites (TSS), with 33% of peak regions located within 5kb upstream of the TSS.

The MEME suite was used to identify sequence motifs enriched within the mycPET-1 ChIP peaks (Bailey et al., 2009). Comprehensive examination, in vitro, has defined a position weight matrix (PWM) of PET-1/FEV high affinity- binding sites (Wei et al., 2010). Importantly, the most significant de novo

134

enriched motif was an exact match to the PET-1/FEV high affinity-binding site that provides for sequence-specific Pet-1/FEV transactivation or repression

(Fyodorov et al., 1998; Maurer et al., 2003; Wang et al., 2013) (Figure 14B). We found that 82.8% of all mycPet-1 ChIP peaks contain at least one PET-1/FEV high affinity PWM hit (Figure 9B, p-value ≤ 1.0e-03), which are highly phylogenetically conserved compared to PWM hits in random genomic regions

(data not shown). The highly significant enrichment of high affinity PET-1/FEV motifs in mycPET-1 ChIP peaks provides strong independent validation of PET-1

binding sites, in vivo.

We identified a large number of PET-1 regulated genes with at least one

mycPET-1 peak containing the PET-1/FEV high affinity motif. Pet-1 itself and the

5-HT battery genes Slc22a3 and Gchfr had multiple mycPET-1 peaks with PET-

1/FEV high affinity binding motifs (Figure 14E-H). Interestingly, Slc22a3 possessed 13 PET-1/FEV high affinity motifs within a 626 bp region of mycPET-1 enrichment within intron 2 (Figure 14H). Further, an additional 172 genes with decreased expression and 300 genes upregulated in Pet-1-/- 5-HT neurons were

associated with at least one PET-1/FEV motif containing mycPET-1 peak (Figure

14B-C), suggesting PET-1 controls maturation of 5-HT neurons not only through direct gene activation, but also through direct repression.

Bioinformatic analyses with the Panther classification tool and GO term analyses revealed a significant enrichment for genes classified as nucleic acid binding or TF proteins in the intersected set of PET-1 regulated genes with mycPET-1 occupancy near TSSs. Included were several TFs with well-defined

135

functions in the 5-HT neuron lineage (En1, Nkx2-2, Nr3c1) or in other postmitotic

neuron-types (Foxa1, Nr2f2) (Pattyn et al., 2003; Espallergues et al., 2012; Fox

and Deneris, 2012; Domanskyi et al., 2014; Jochems et al., 2015). For example,

our previous studies showed that EN1 is intrinsically required to control

postmitotic 5-HT neuron identity, migration and survival (Fox and Deneris, 2012).

ChIP-seq revealed mycPET-1 peaks with PET-1/FEV motifs upstream and downstream of the En1 TSS (Figure 14G) and ISH analyses revealed that

postmitotic expression of En1 critically depends on PET-1 (Figure 4). Moreover,

AAV-Cre targeting showed that PET-1 was required in the early postnatal period to support continued postmitotic En1 expression (Figure 14I). These results suggest that PET-1 controls maturation of 5-HT neurons, in part, by directly regulating a known 5-HT neuron maturation factor and possibly several other potential 5-HT regulatory factors.

Discussion

The regulatory strategies through which continuously expressed transcription factors control postmitotic neuronal development are poorly understood. Using a combination of RNA-sequencing of flow sorted 5-HT neurons, electrophysiological studies and conditional targeting approaches we investigated PET-1- a regulatory factor continuously expressed in 5-HT neurons at different stages across fetal to early postnatal life. We report that in addition to its well-known role in initiating brain 5-HT synthesis in newly born 5-HT neurons

(Hendricks et al., 2003), PET-1 subsequently plays a much broader role in coordinating global postmitotic expression trajectories of genes necessary for

136

functional maturation of 5-HT neurons. RNA-sequencing revealed that loss of

PET-1 led to altered expression of hundreds of genes encoding various

transcription factors, GPCRs, ion channels and transporters, among others.

Whole cell recordings indicated that several passive and active membrane

properties of Pet-1-/- 5-HT neurons as well as G-protein to GIRK channel signaling were highly characteristic of immature neonatal 5-HT neurons (Rood et al., 2014). Further, PET-1 was necessary for coordinating maturation of glutamatergic, adrenergic, serotonergic, and lipid excitatory synaptic input to 5-

HT neurons through control of Gria4, Adra1b, Htr1a and Lpar1 expression trajectories, respectively. This previously unrecognized extensive role for PET-1 in postnatal 5-HT neuron maturation led us to probe the temporal requirements for PET-1. Thus, we developed an AAV-Cre targeting approach to eliminate Pet-

1 expression at different postnatal stages. Unexpectedly, we found that as 5-HT neurons mature 5-HT synthesis genes, Tph2, Gch1, Gchfr, lost sensitivity to

PET-1 but 5-HT excitability genes, Htr1a, Adra1b and Hcrtr1, critically depended on PET-1 in early postnatal life. These distinct gene-specific temporal dependencies on PET-1 reveal a previously unrecognized stage-specific regulatory strategy in which continuously expressed Pet-1 switches transcriptional targets to control maturation of 5-HT neuron excitability.

Previous studies showed that PET-1 acts to induce expression of 5-HT synthesis genes, Tph2, Gch1, Gchfr, at the serotonergic precursor stage and thereby initiate brain 5-HT synthesis (Hendricks et al., 2003; Wyler et al., 2015).

Activation of these genes in Pet-1-/- precursors is severely reduced, which results

137 in a deficiency of 5-HT in newly born 5-HT neurons. Interestingly, through conditional postnatal targeting of Pet-1, we found that the dependence of 5-HT synthesis genes on PET-1 greatly diminishes in magnitude as 5-HT neurons progress from fetal to postnatal stages of development. Although Pet-1’s control of Tph2 substantially diminishes by the early postnatal period, Tph2 is partially dependent on PET-1 in adulthood and therefore its sensitivity to PET-1 may fluctuate throughout life (Liu et al., 2010). In contrast to 5-HT synthesis genes, several GPCR genes were highly dependent on PET-1 expression in the early postnatal period. Expression of Adra1b and Htr1a was nearly eliminated after neonatal targeting of Pet-1 in 5-HT neurons of the DRN; Hcrtr1 was substantially upregulated suggesting ongoing repression by PET-1 during maturation. The critical dependence of Adra1b and Htr1a on PET-1 coincides with their postnatal upregulation and the stage at which 5-HT neurons begin to develop appropriate

GPCR pathways needed for responses to diverse afferent synaptic input (Rood et al., 2014). These findings suggest that as postmitotic development proceeds there is a switch in PET-1 targets from those required in newborn 5-HT neurons for initiation of 5-HT synthesis to those required postnatally for maturation of extrinsically controlled 5-HT neuron excitability. Further conditional targeting studies indicated that Htr1a expression becomes nearly independent of PET-1 in young adulthood while other genes such as Slc22a3 remain completely dependent on PET-1 throughout life. These findings reveal a transcriptional sensitive period for PET-1 dependent control of Htr1a expression. Although several TFs are required in postmitotic neurons for maintenance of gene

138

expression, to our knowledge early postnatal transcriptional sensitive periods

have not been described (Deneris and Hobert, 2014; Kadkhodaei et al., 2013;

Laguna et al., 2015). How discrete gene-specific regulatory sensitive periods

open and close is unclear, but may involve highly dynamic changes in chromatin

accessibility that occurs at cis-regulatory elements as neurons mature (Ding et

al., 2013; Frank et al., 2015).

The existence of a regulatory sensitive period for Htr1a is potentially

significant in view of abundant evidence supporting the early postnatal period in

rodents as a critical period for serotonergic control of behaviors related to

depression, anxiety, and fear (Leonardo and Hen, 2008). Alterations in 5-HT

signaling during the early postnatal period, but not in adulthood can alter

emotional behaviors later in life (Rebello et al., 2014). Moreover, suppression of

Htr1a expression during the P14-30 stage (but not in adulthood) resulted in

increased anxiety-like behaviors and decreased social behaviors later in life,

suggesting a neurodevelopmental critical period for 5-HT1A function (Donaldson

et al., 2014). The transcriptional sensitive period we have uncovered for Htr1a coincides with the critical period for Htr1a function, which highlights the necessity of precise transcriptional control of Htr1a autoreceptor expression during the

early postnatal maturation stage. These findings raise the possibility that the

regulatory sensitive period for Htr1a represents a time-restricted window when

Htr1a function is particularly susceptible to alterations in PET-1 driven postnatal regulatory programs (Meredith et al., 2012). Disruption of the transcriptional

139 controls on Htr1a within this window may precipitate life-long adverse consequences on emotional health.

The results presented here provide insight into vertebrate terminal- selector-like function. Terminal selectors were originally described in C. elegans as TFs that are continuously expressed in postmitotic neurons and function to initiate expression of neuron-type identity features during development and then maintain those features later in life through direct binding to conserved cis- regulatory motifs (Hobert, 2008). Several vertebrate transcription factors that control acquisition of transmitter identity are continuously expressed in specific neuron-types (Allan and Thor, 2015; Deneris and Hobert, 2014; Holmberg and

Perlmann, 2012; and Kadkhodaei et al., 2013). However, in most cases there has yet to be an in-depth analysis of their terminal-selector properties.

PET-1’s functional characteristics in 5-HT neurons fulfill the defining criteria of a terminal selector-type TF (Cheng et al., 2003; Liu et al., 2010). In addition to developmental stage-specific switching of PET-1 targets discussed above our results further illuminate PET-1’s terminal selector characteristics.

PET-1 (FEV) possesses a strong autonomous transcriptional repressor domain in a conserved alanine-rich carboxyl-terminal region and can function as a transcriptional repressor through binding to ETS high affinity binding sites at least in cell line reporter assays (Fyodorov et al., 1998; Maurer et al., 2003). Here, we present evidence in support of a prominent role for Pet-1-mediated repression in regulating 5-HT neuron maturation, in vivo. Indeed, RNA-seq analyses identified a greater number of significantly upregulated genes than downregulated ones in

140

Pet-1-/- 5-HT neurons. ChIP-seq revealed that a large number of upregulated

genes in Pet-1-/- 5-HT neurons possessed at least one PET-1/FEV high affinity

binding site within mycPet-1 peaks situated near transcriptional start sites.

Previous ChIP-seq studies of ETS factors reported that PET1/FEV-like ETS

factors occupied regions that are enriched for high-affinity ETS sequence motifs,

suggesting high affinity FEV ETS binding sites mediate ETS factor function, in vivo (Wei et al., 2010). The mRNA of the homeodomain factor, Nkx2-2, was

significantly derepressed in Pet-1-/- 5-HT neurons and two mycPET-1 peaks were

detected within 5kb of the Nkx2-2 TSS. NKX2-2 is expressed in the ventricular

zone where it is required for specification of 5-HT progenitors (Pattyn et al.,

2003). These findings suggest PET-1 helps to suppress earlier progenitor specification programs by repressing Nkx2-2 as 5-HT precursors become postmitotic. Further, neonatal targeting of Pet-1 resulted in a dramatic upregulation of Hcrtr1 expression suggesting ongoing PET-1-mediated repression may set appropriate level of orexin input to 5-HT neurons.

Our results suggest that PET-1 promotes 5-HT neuron maturation through direct regulation of secondary regulatory factors. This notion is well illustrated with evidence in support of En1 as a direct PET-1 target. We showed previously

that EN1 is intrinsically required for maturation and survival of 5-HT neurons in

the DRN (Fox and Deneris, 2012). RNA-seq and in situ hybridization analyses

revealed that Pet-1 was essential for sustained expression of En1 in 5-HT

neurons. ChIP-seq revealed multiple mycPET-1 peaks, within and upstream of

the En1 locus, with most possessing conserved high affinity PET-1/FEV binding

141 sites. Thus, these findings indicate that similar to certain C. elegans terminal selectors Pet-1 is a regulatory intermediary that directly controls secondary maturation factors (Etchberg et al., 2007). PET-1 and EN1 might function in a feedforward manner analogous to direct control of the OTX-type TF, ceh-36, by the dedicated maintenance zinc-finger factor, che-1, which subsequently operate together to control several identity features of ASN chemosensory neurons in C. elegans (Etchberger et al., 2007).

In summary, we present new insights into how continuously expressed terminal selector regulatory factors control postmitotic neuronal development.

Our findings show that continuously expressed PET-1 acts as postnatal maturation-promoting factor of 5-HT neuron excitability through a stage specific switch in its transcriptional targets and through direct control of secondary maturation regulatory factors. The discovery of a previously unrecognized early postnatal sensitive period for PET-1 dependent control of the 5-HT1A autoreceptor opens a new direction for study of stage-specific transcriptional control of 5-HT signaling critical periods.

142

Figure 1

143

Figure 1. RNA-sequencing reveals temporal gene expression patterns in maturing 5-HT neurons. Total RNA from flow sorted E11.5, E15.5, and P1-P3

(PN) YFP+ 5-HT neurons (n=3 biological replicates/time point) was used for sequencing to determine expression patterns followed by hierarchical clustering of differentially expressed genes. (A). Row-mean-normalized heatmaps (left) and mean temporal expression levels (right) are shown for each cluster. Number of genes in each cluster is shown on the right of each trajectory. In total 6,126 genes were differentially expressed at ≥ 1.5X fold-change and ≤ 5% FDR. (B).

Gene ontology (GO) enrichment analysis of gene expression clusters. GO terms enriched in clusters 6, 7, and 9 suggest increasing expression of genes related to neuronal maturation processes (Hypergeometric test, p-value ≤ 0.01). GO terms enriched in clusters 1, 2, and 10 are associated with downregulation of earlier developmental programs involved in progenitor proliferation and specification

(Hypergeometric test, p-value ≤ 0.01).

144

Figure 2

145

Figure 2. RNA-sequencing shows that Pet-1 globally controls the 5-HT

transcriptome through positive and negative regulation of gene expression

trajectories. (A). Scatterplots showing altered expression of genes in Pet-1-/- vs

+/+ 5-HT neurons in each expression cluster (Figure. 1). (B). Gene ontology enrichment analysis of genes upregulated (top) and downregulated (bottom) by

PET-1.

146

Figure 3

147

Figure 3. Pet-1 regulated a broad range of gene classes.

Relative changes in expression (FPKM) for various categories of some PET-1- controlled genes. “*” Benjamini-Hochberg q-value ≤ 0.05; n=3. Error bars are

SEM.

148

Figure 4

149

Figure 4. Verification of Pet-1 regulated genes by In situ hybridization.

In situ hybridization verification of genes regulated by PET-1. Scale bar= 300 μm.

Dotted oval shows non-serotonergic site of Hcrtr1 expression. Genes: Tph2,

Tryptophan hydroxylase 2; En1, Engrailed 1; Nr3c1, glucocorticoid receptor;

Adra1b, Alpha adrenergic receptor 1b; Scn3b, Sodium channel subunit 3b;

Nxph4, Neurexophilin 4; Cited 1; Cbp/p300-interacting transactivator; Lpar1,

Lysophosphatidic acid receptor 1; Slc6a17, Solute carrier family 6 (neutral amino

acid transporter), member 17; Gnaq, Guanine nucleotide-binding protein Gq

subunit alpha; Hcrtr1, Hypocretin receptor 1; Gria4, AMPA receptor subunit 4.

150

Figure 5

151

Figure 5. Pet-1-/- 5-HT neuron passive and active membrane properties are permanently immature. (A). Whole cell recordings of membrane voltage responses to hyperpolarizing and depolarizing current injection from P21 and adult +/+ and Pet-1-/- 5-HT neurons in the DRN. (B). Passive membrane properties of Pet-1-/- 5-HT neurons are functionally immature. (B1). Resting membrane potential (RMP), (ANOVA F (df 3,97) =9.177, p<0.0001; n= 26, 11,

37, 27. SNK post hoc test: adult Pet-1-/- vs. adult +/+ 5-HT neurons was significantly different. (B2). Membrane resistance, (ANOVA F (df 3,97)=11.92, p<0.0001; n=26, 11, 37, 27. SNK t-test: P21 and adult Pet-1-/- 5-HT neurons were significantly different from P21 and adult +/+ 5-HT neurons, respectively. (B3).

Membrane time constant (tau), (ANOVA F (df 3,97) = 9.574, p<0.0001; n= 26,

11, 37, 24. SNK t-test: P21 and adult Pet-1-/- 5-HT neurons were significantly different from P21 and adult +/+ 5-HT neurons, respectively, p<0.05. (C).

Persistent immaturity of action potential characteristics in P21 and adult Pet-1-/-

5-HT neurons. (C1). Representative raw data traces of an action potential recorded from a P21 +/+ and a P21 Pet-1-/- 5-HT neuron. (C2). Action potential amplitudes in P21 and adult +/+ and Pet-1-/- 5-HT neurons (ANOVA F (df 3,95) =

10.25, p<0.0001; n= 26, 11, 35, 27. SNK t-test confirmed that action potential amplitude in P21 and adult Pet-1-/- 5-HT neurons was significantly smaller than

P21 and adult +/+ 5-HT neurons, respectively. (C3). Pet-1-/- 5-HT neuron action potential firing threshold was significantly more hyperpolarized in P21 and remained more hyperpolarized in adult Pet-1-/- 5-HT neurons (F (df 3,95) = 37.92, p<0.0001; n= 26, 11, 35, 27. SNK t-test confirmed that P21 and adult Pet-1-/- 5-

152

HT neurons more hyperpolarized than P21 and adult +/+ 5-HT neurons, respectively, p<0.05). (C4). After-hyperpolarization amplitudes were smaller in

P21 and adult Pet-1-/- 5-HT neurons (F (df 3, 95) = 8.153, p<0.0001; n= 26, 11,

35, 27. SNK test confirmed that P21 and adult Pet-1-/- 5-HT neurons were smaller than P21 and adult +/+ 5-HT neurons, respectively. (D). Excitability of Pet-1-/- 5-

HT neurons. Increased numbers of action potentials were elicited with depolarizing current pulses in P21 and adult Pet-1-/- 5-HT neurons compared to

P21 and adult +/+ 5-HT neurons. (Two-way ANOVA significant interaction

(ANOVA F (df 12, 296) = 13.13, p<0.0001; n= 26, 11, 17, 24).

153

Figure 6

154

Figure 6. Expression trajectories of glutamatergic receptor genes. RNA-seq analysis of all glutamatergic receptor genes. AMPA receptor subunits (Gria1-4).

NMDA receptors (Grin1, Grin2a-d, Grin3a,b), Kainate receptors (Grik1-5); metabotropic glutamate receptors (Grm1-Grm8).

155

Figure 7

156

Figure 7. Pet-1 promotes maturation of AMPA excitatory synaptic input to

5-HT neurons by regulating Gria4. (A). ISH for Gria1-Gria4 in control mice. (B).

FPKM’s for Gria1-4 in +/+ and Pet-1-/- sorted E15.5 5-HT neurons (n=3). (C-D).

Raw traces of EPSC synaptic activity (C), and averaged (from 200 individual

events) single EPSC current events (D), recorded under voltage clamp

conditions. (E-H) EPSC input onto adult Pet-1-/- 5-HT neurons is characteristic of

immature EPSCs at early postnatal stages. (E). EPSC frequency was not

different; however, the variances differed significantly (Pet-1-/- 9.132 ± 1.125

N=17 and +/+ 13.75 ± 2.458 N=22; F=6.179, p<0.0005; n= 22, 17). EPSC events

in Pet-1-/- 5-HT neurons on average had (F) smaller amplitudes (t-test t=5.102,

df=37,p<0.0001; n=22, 17), (G) shorter decay time (t-test, t=2.461, df=37, p=0.0186; n=22, 17), and (H) smaller charge (t-test, t=3.755, df=37, p=0.0006; n=22, 17). Error bars are SEM.

157

Figure 8

158

Figure 8. Pet-1 controls maturation of Adrenergic synaptic input to 5-HT neurons. (A). RNA-seq analysis of α1 adrenergic receptor gene expression trajectories in flowed 1148 sorted +/+ 5-HT neurons. (B). co-immunostaining of β-

galactosidase (eFev::lacZ) marked 5-HT neurons (green), and ADRA1B (red). (C).

RNA-seq analysis of Adra1 receptor gene expression in +/+ and Pet-1-/- at E15.5.

(D). [3H]-prazosin binding in +/+ vs. Pet-1-/- midbrain, t (df 5)=2.43, p=0.07; n=3.

(E). Multielectrode array recordings (MEA) of α1-selective agonist,

phenylephrine (PE) responses. +/+, n =19 cells/6 mice; Pet-1-/-, n= 24 cells/9

mice.

159

Figure 9

160

Figure 9. Pet-1 controls the maturation of Lysophosphatidic acid input to 5-

HT neurons. (A). RNA-seq analysis of Lpar1-6 expression trajectories in flowed sorted +/+ 5-HT neuron. (B). FPKM’s for Lpar1 in +/+ and Pet-1-/- sorted E15.5

5-HT neurons (n=3). (C). MEA recording of LPA1 selective agonist, (Z)-N-[2-

(Phosphonooxy)ethyl]-9-octadecenamide (NAEPA). +/+, n=27 cells/4 mice; Pet-

1-/-, n=9 cells/3 mice. Scale bar =300 μm. ***P<0.001.

161

Figure 10

162

Figure 10. Immature G protein signaling in Pet-1-/- mice. (A). Representative

image of GTPγS elicited responses in +/+ and Pet-1-/- neurons. (B).

Quantification of GTPγS elicited response. ANOVA ACSF content F (1, 31) =

13.59 p=0.0009, Genotype F (1,31) = 6.798, p=0.0139; n=4, 9, 6, 16. SNK t-tests indicated that +/+ normal vs. Pet-1-/- normal was not significantly different, +/+

normal vs. +/+ GTPγS electrolyte was significant (*p<0.05), and Pet-1-/- normal

vs. Pet-1-/- GTPγS was not significant.

163

Figure 11

164

Figure 11. 5-HT synthesis genes lose sensitivity to Pet-1 as 5-HT neurons

mature. (A) Experimental scheme: Pet-1fl/- mice were injected with AAV-Cre or

AAV-GFP to conditionally delete Pet-1 in the early postnatal period followed by in situ hybridization (ISH) at P28. (B). ISH along the rostral-caudal axis of AAV-GFP and AAV-Cre injected Pet-1fl/- mice. B, ISH for Pet-1fl/- and Pet-1+/- injected with

AAV-GFP or AAV-Cre respectively.

165

Figure 12

166

Figure 12. 5-HT synthesis genes lose sensitivity to Pet-1 as 5-HT neurons mature. (A). ISH for Pet-1 showing that AAV-Cre eliminates Pet-1 expression in the DRN. (B). ISH reveals nearly complete elimination of expression of 5-HT synthesis genes, Tph2, Gchfr and, Gch1, in the Pet-1-/- DRN. (C). ISH in P0 AAV injected mice reveals nearly total insensitivity of Tph2, Gchfr and, Gch1 expression to loss of Pet-1.Scale bar = 300 μm.

167

Figure 13

168

Figure 13. Early postnatal Pet-1 function is essential for control of multiple

GPCRs. (A). ISH of Htr1a, Adra1b, and Gria4 expression in P0 injected mice.

(B). Neonatal targeting of Pet-1 results in increased Hcrtr1 expression in 5-HT neurons. (C). Early postnatal transcriptional sensitive period for Htr1a control by

Pet-1. Pet-1fl/- mice were injected with AAV-Cre or AAV-GFP at the indicated

postnatal ages. ISH: Htr1a, P22 assayed at P43; Htr1a, P60 assayed at P180;

Slc22a3, P0 assayed at P28; Slc22a3, P60 assayed at P90. (D). ISH for Pet-1

and Slc22a3 of P545 injected mice assayed at P590. (E). Permanent immaturity

of 5-CT elicited responses in adult DRN slices. p = 0.0003, t (df 36) = 4.053. Pet-

1-/-, n=22; +/+, n=16. Scale bar = 300 μm.

169

Figure 14

170

Figure 14. Pet-1 directly regulates the 5-HT neuron maturation factor,

Engrailed 1. (A) qPCR of MycPet-1 rescue of Pet-1-/- 5-HT neurons. (B) de novo

MEME motif analysis identifies the top significantly enriched motif in myc-Pet-1

peaks (top). TOMTOM identifies a highly significant match of the top enriched

motif to Pet-1/FEV high affinity binding site (bottom) defined, in vitro (Wei et al.,

2010). (C) Fraction of mycPet-1 ChIP peaks with at least one match to the known

Pet-1/FEV PWM motif. (D) Fraction of Pet-1 up-regulated (left) and down-

regulated (right) genes with mycPet-1 ChIP peaks within 5kb from the TSS or

TTS. (E-H) Genome browser screen shots showing mycPet-1 enrichment over

input control for (E) Pet-1, (F) Gchfr, (G) En1, and (H) Slc22a3. Orange bars indicate area of significant peak enrichment. Black vertical lines indicate presence of Pet-1/FEV high affinity motifs. (I) P28 In situ hybridization for En1 of

P0 Pet-1fl/- injected mice.

171

CHAPTER 4

DISCUSSION AND FUTURE DIRECTIONS

The goal of this thesis was to identify how a transcription factor-PET-1

aids in driving the maturation of a 5-HT neuron. In the process of my thesis

research, we found PET-1 plays a critical role in driving 5-HT neuronal identity by

controlling a broad panel of genes beyond those needed for synthesis, vesicular

packaging, reuptake, degradation and autosensing. Many of these genes play

an essential role in the basic electrophysiological properties of 5-HT neurons as

well as their ability to respond to signaling from other neurons and cell types.

Additionally we found that PET-1 directs this maturational program through both direct transcriptional activation and repression. Finally, we uncovered differential sensitive periods of PET-1 regulation where it is repurposed from driving expression of genes needed for 5-HT synthesis to driving expression of, at least

some, genes needed for 5-HT neurons to respond to neurotransmitters. This

work provides novel insights into neuronal development and maturation, and

provides direction for many new exciting lines of research in 5-HT neuron

development and function.

Heterogeneity in Serotonergic Neurons (Related to chapter 2)

In chapter 2, we discuss a subpopulation of Pet-1-/- 5-HT neurons (about

30%) which still express Tph2 and produce 5-HT (Hendricks et al., 2003;

Kiyasovia et al., 2011). It has been proposed by Kiyasovia et al. that these

TPH2+, Pet-1-/- neurons represent a genetically distinct population with reduced

dependence on PET-1. However, we show in chapter 2 that although this

172

subpopulation has reduced sensitivity to the loss of Pet-1 regarding genes

needed for 5-HT synthesis, PET-1 is absolutely required in these neurons for the

expression of the 5-HT genes, Htr1a and Slc22a3 (OCT3). As Pet-1 is

expressed in a vast majority, and likely all, 5-HT neurons (Pelosi et al., 2014;

Hendricks et al., 1999) this begs the following questions: What are the

autonomous determinates which specify this subset of TPH2+, Pet-1-/- neurons?

Which of the PET-1 targets identified in chapters 2 and 3 are dependent on PET-

1 in these TPH2+, Pet-1-/- cells, and which of these gene are not dependent on

PET-1? Even though roughly 30% of Pet-1-/- neurons express enzymes required

to synthesize 5-HT, are these synthesis genes partially dependent on PET-1 as

well? Are there other genetically distinct subpopulations of 5-HT neurons which

could be defined based on an alternative 5-HT identity feature expressed in a

different subset of Pet-1-/- neurons?

There are several ways to address these questions using 5-HT neuron

transcriptomic analysis. One way would be to compare the transcriptomes of the

TPH2+ and TPH2- population of Pet-1-/- 5-HT neurons. This could be

accomplished by labeling the TPH2+ cells with TD-tomato while simultaneously

labeling all Pet-1-/- cells with our ePet-eYFP transgene. TPH2+, Pet-1-/- cells

could be fluorescently marked by using a Cre-recombinase driven by the Tph2 regulatory elements in conjunction with a Cre-activatable reporter allele, such as

Rosa-TD-tomato (R26R-CAG-loxPstop-tdTomato). Pet-1-/- mice containing

Tph2-Cre and Rosa-TD-tomato would theoretically only express TD-tomato in the

30% of TPH2+ cells. All 5-HT cells could be simultaneously labeled with our

173

ePet-eYFP transgene. By generating the following mice: Pet-1-/-; epet-eYFP;

Tph2-Cre; Rosa-TD-tomato. TPH2+ and TPH2- cells could be segregated by flow

cytometry. All Pet-1-/- 5-HT neurons would be positive for YFP, whereas only the

TPH2+ cells would be positive for TD-tomato. By sorting cells into YFP+, TD-

tomato+ and YFP+, TD-tomato- groups, one would be able to segregate these

populations for subsequent RNA analysis. An alternative approach would be to

perform single cell analysis (such as manual cell sorting or RNA-capture by

electrophysiological pipettes [Okaty et al., 2015; Spaethling et al. 2014]) on a

large population of Pet-1-/- epet-eYFP neurons, and then segregate the neurons

based on their Tph2 expression. Possible results would be the identification of

transcription factors (TFs) which compensate for loss of Pet-1 in these cells, and

the identification of PET-1 targets with altered sensitivity to the loss of Pet-1 in

these neurons.

Prolonged loss of Pet-1 leads to increased gene downregulation

In the work described in chapter 3, we identified many new facets to PET-

1 function in 5-HT neurons. One early finding was that many Pet-1 targets appeared to become more sensitive to the germline loss of Pet-1 as 5-HT neuronal maturation progresses. With the exception of a few genes such as Tph2 and Slc22a3, most raphe-enriched genes only show ~40- 70% loss of mRNA expression at E15.5. For example Engrailed1, Gria4, and Adra1b only show 40-

50% reduction in mRNA levels at E15.5; surprisingly, when assaying these genes in adulthood with in situ hybridization, we discovered a virtual wipeout of expression these genes in the Pet-1-/- animals (Chapter 3, Figures 3, 4). This

174

increase in sensitivity suggests that an early perturbation in the network may lead

to a gradual breakdown of the network over time. Mechanistically, this could

occur in a network model where multiple transcription factors maintain each other’s expression. Loss of one factor would lead the decreased expression of other network TFs which could lead to a gradual feedforward downregulation of the transcriptional network. This “breakdown” would be initiated as the early

inductive/maintenance factors which originally activated the terminal

transcriptional network are downregulated as part of their normal temporal

program, leaving the remaining terminal network unable to sustain its own

expression. Although this breakdown would be unlikely in network model where a

single terminal TF is solely is required to maintain its own expression, in a more

complex network model where multiple factors work in an “additive” fashion to

maintain TF levels, the loss of one factor could lead to a gradual degeneration of

the network.

We have some data hinting at this possibility. Lmx1b expression is

independent of PET-1 embryonically, but becomes partially sensitive to PET-1 in

adulthood. In situ hybridization for Lmx1b in Pet-1-/- E16.5 embryos show no

obvious change in Lmx1b expression, and no change in Lmx1b expression was

seen by either qPCR, or in the RNA-seq database of E15.5 ePet-eYFP sorted neurons (data not shown, Ding et al., 2003). However, we recently stained for

Lmx1b in 4 month Pet-1-/- mice, and found a large reduction of Lmx1b expression

in the dorsal raphe. As LMX1B is known to regulate many genes needed for 5-

HT neuronal function, the later loss of LMX1B could lead to increased reduction

175

of PET-1/LMX1B coregulated genes. Additionally, we identified 3 ChIP peaks at

5’ end of Lmx1b associated with 8 PET-1 PWMs, supporting direct regulation of

PET-1. As Lmx1b expression is unaffected in E15.5 Pet-1-/- embryos, PET-1

could function redundantly with another embryonically expressed TF until the

embryonically expressed TF is downregulated, at which point PET-1 helps

maintains Lmx1b expression. Similarly this could apply to Engrailed 1. En1 is

induced by E7.5 in the hindbrain regions giving rise to the DRN, preceding Pet-1

expression by at least two days (Simon et al., 2005). However, En1 expression

becomes dependent on PET-1 by E12.5 (E12.5 Microarray data and E12.5 RNA-

seq data). This later dependence of En1 on PET-1 may result from the

downregulation of early inductive factors, and the failure of PET-1 to maintain

En1’s expression. Multiple studies have reported degenerative role of

developmental loss of a transcription factor (Fox and Deneris 2012; Kittappa et

al., 2007 Laguna et al., 2015; Rekaik et al., 2015 Kadkhodaei; Swaroop et al.,

2010). This has been extensively studied in mesencephalic dopaminergic

neurons (mDA). Numerous transcription factors required for development of

mDA such as EN1, NR4A2, FOXA2 and LMX1B, are required to prevent

degeneration of these neurons. Of particular interest, the loss of a single allele of

En1 (En1+/-) is sufficient for gradual degeneration of mDA neurons by 6 weeks indicating that networks can be highly sensitive to gene dosage of a transcriptional regulator. The gradual disassembly of the TF network may

partially explain the phenotype found in neurodegenerative diseases which have

prolonged dysregulation of neuronal function.

176

Future Experiments

Although no change in 5-HT cell number is observed at 2 months in Pet-1-

/- mice, PET-1 may be required to prevent loss of 5-HT neurons at later stages.

An early study would be to determine if Pet-1 is needed to prevent

neurodegeneration and cell death. This could be done by labeling 5-HT neurons with our epet-Cre and a Cre-activatible reporter allele such as Rosa-TD-tomato.

Initial studies would be to quantify 5-HT cell numbers at 1 month, 6 months, 12

months, and 18 months.

Additionally, it would pertinent to identify the timing of Lmx1b becoming

sensitive to loss of PET-1 with in situ hybridization (ISH). It would also be

interesting to map the progression of other genes such as En1, Gria4, and

Adra1b to map their progression of increased sensitivity to the loss of Pet-1,

correlating it with the temporal downregulation of Lmx1b. Finally, transcriptomic

analysis of postnatal Pet-1-/- neuronal transcripts would aid in identifying the

progressive increase in sensitivity to the loss of Pet-1. Although I was unable to

sort neurons past postnatal day 3, several methods have been developed to

profile the transcriptome of adult neurons each with their benefits and caveats.

One possibility is laser capture microdissection, which has been employed in profiling adult DA neurons (Kadkhodaei et al., 2013). Another possibility is manual cell sorting, which was recently used to sort mature 5-HT neurons (Okaty et al., 2015). A third possibility is RNA-capture through electrophysiological pipettes (Spaethling et al., 2014). Additionally immunoprecipitation methods such as TRAP (Translating Ribosome Affinity Purification) method or the UPRT (uracil

177

phosphoribosyl transferase)-mediated labeling of nascent 5-HT RNAs could be used (Dougherty et al., 2013; Tallafuss et al., 2015). I propose the best times to profile Pet-1-/- transcriptomes would be at P0, P21, P60, and P180 mice.

Pet-1 as a Transcriptional Repressor

Work from the Deneris lab and others have focused on PET-1s role as a

transcriptional activator (Hendricks et al., 2002; Jacobsen et al. 2011; Liu et al.,

2010). Early in vitro studies suggested that PET-1 may also act as a

transcriptional repressor; however this had never been tested in vivo (Maurer et

al. 2003). Interestingly of the 1039 genes we found to be derepressed (1.5 fold;

FDR 5%) in Pet-1-/- 5-HT neurons, about 29% contained an enriched peak within

5kb of the gene in the chromatin immunoprecipitation/DNA-sequencing assay

(Chapter 3, Figure 14D). This provides evidence that PET-1 acts as both as a

activator and repressor. There are several reasons why PET-1 could have a dual activator/repressor role. It may act to repress an immature state while simultaneously promoting a mature neuronal phenotype. It may act to repress other neuronal phenotypes. It may help drive diversity of the 5-HT system. It may be required for proper excitatory/inhibitory balance of 5-HT genes.

Repressing immature phenotype.

One possibility is PET-1 drives neuronal development by repressing the

precursor/progenitor program, while simultaneously promoting a maturation

program. An example for this is seen in photoreceptor development, where CRX

directly activates a photoreceptor program while simultaneously directly

repressing expression of the photoreceptor precursor/progenitor protein OTX2

178

(Hennig et al., 2008). Many of the genes downregulated from E11.5 to E15.5 by the postnatal period are transcription factors which have known functions in neural progenitors (Chapter 3, Figure 1). As PET-1 repressed expression of many of these genes, this presents the enticing hypothesis that part of PET-1’s maturational program is to repress the neuroprogenitor fate. One of these factors which is of great interest is the NK homeodomain transcription factor

NKX2-2. In 5-HT development, NKX2-2 specifies the p3 neuroprogenitor domain and is required for the generation of r2-3 and r5-8 5-HT neurons (Nkx2-2 seems dispensable in r1 likely do to compensation of other NKX TFs; Craven et al.,

2004). Based on the 5-HT developmental trajectory data, Nkx2-2 is robustly expressed at E11.5, but its expression is rapidly downregulated by E15.5 and the

PN period (Data not shown). This gene appears to be directly repressed by PET-

1 as the Pet-1-/- neurons have a 2.5 fold increase in Nkx2-2 expression and there are several mycPET-1 ChIP peaks found around this gene (Data not shown).

This suggests that a function of PET-1 to drive maturation in 5-HT neurons is to directly repress TFs and other genes which function in the progenitor state. This bifunctional property of PET-1 has yet to be investigated, and could reveal important functions of TFs in driving maturation. It would be interesting to drive

Nkx2-2 in maturing neurons (such as with a Pet-1-Nkx2-2 transgene) to see if the neurons fail to mature properly, ie. remain, a least partially, in an immature state.

Also functional validation of the ChIP peaks in vitro and/or in vivo would be an essential experiment to test the hypothesis of PET-1 direct repression of Nkx2-2 is needed for proper maturation of 5-HT neurons.

179

Repression of other Neuronal Phenotypes.

Another role for PET-1 is it may act to repress other neurotransmitter

phenotypes. Previously our lab has shown that the Pet-1-/- neurons don’t express the motor neuron marker, ChAT, or dopamine neuron marker, TH

(Krueger and Deneris, 2008; Liu et al., 2010). Futhermore, I don’t see much evidence for other neuronal markers being upregulated in E15.5 KO neurons.

Therefore, I doubt that PET-1 represses other neuronal phenotypes. However it

is plausible that PET-1 could work in a redundant fashion with other serotonergic

transcription factors such LMX1B to prevent this fate transformation.

Generation of 5-HT neuronal subtypes.

A third role for repression is it helps drive diversity within the 5-HT

system. As stated above, 5-HT neurons are an extremely complex group of cells

which differ in their coexpression of neurotransmitters (such as GABA,

glutamate, and various neuropeptide), their axonal projections, cellular

morphology, and electrophysiological properties (Andrede and Haj-Dahmane;

Calizo et al., 2011; Commons, 2015; Kiasovia et al., 2013; Okaty et al., 2015;

Shikanai et al., 2012; Spaethling et al., 2014). One such division with clear

functional and genetic differences is the rostral and caudal domains of the 5-HT

system. 5-HT neuronal populations are generated in two clusters, the rostral

group, produced in rhombomeres r1-3, and the caudal group produced in r5-8.

Work from our lab (Wylie et. al. 2010), and recently the Gaspar lab (Okaty et al.,

2015), have shown different transcriptomic profiles between the rostral and

caudal system. Wondering if PET-1 aids in the repression of a caudal phenotype

180

in rostral 5-HT neurons, I used the Wylie et al., database to extract caudal- enriched 5-HT neurons and compared these genes with genes derepressed in rostral Pet-1-/- neurons. I found a significant enrichment of caudal-enriched

-/- 2 genes derepressed in the Pet-1 neurons (χ test, p<0.001). Although Pet-1 is expressed in both cell groups, it could interact with domain-specific TFs (such as

Hox genes) to segregate a rostral and caudal program. It would be interesting to perform a similar study in caudal 5-HT neurons and determine if Pet-1-/-

derepressed genes are enriched in the rostral 5-HT system. There are several

examples where neuron transcription factors aid first in driving neural identity,

and then function in driving heterogeneity in the system. Examples include CRX

in driving rod and cone photoreceptor maturation and OTX2 in generating VTA

(ventral tegmental area) and SNc (substantia nigra pars compacta) neurons

(Panman et al., 2014). A nice example is seen in C. elegans. The zinc finger TF,

CHE-1, is required for generation of the glutamatergic ASE neuron class

(Etchberger et al., 2009; Hobert et al., 2002). ASE neurons can be further

subdivided into left and right side neurons--ASEL and ASER subtypes. The

ASEL and ASER are morphologically and synaptically equivalent and have

similar gene expression profiles. However, they have asymmetric expression of

chemoreceptor genes. CHE-1 drives the terminal fate of the ASE neurons and

then drives a L/R program by activating L/R specific TFs and miRNAs; and by

functionally interacting with LR specific TFs.

181

Balance of 5-HT physiological properties.

Additionally, multiple receptors, and genes related to neuronal excitability were derepressed in the Pet-1-/- mouse. These include sodium, potassium and calcium channels as well as neurotransmitter receptors. Of note, was the

Hypocretin receptor 1 (Chapter 3 Figure 3,4). E15.5 Pet-/- neurons show a 2.5 fold increase in this gene and adult ISH show large increase in Hcrtr1 staining specifically within the DRN. This suggests that PET-1-mediated transcriptional repression is required to generate a proper balance of afferent input and neuronal excitability. Of note, in WT cells Hcrtr1 is highly enriched in 5-HT neurons (Dougherty et al., 2013). Therefore, the repressive function of PET-1 must be countering a positive program driving Hcrtr1 in 5-HT neurons.

Temporally Regulated Altered Sensitivity to the Loss of Pet-1

Another key finding was that several genes needed for 5-HT synthesis such as Tph2, Gchfr, and Gch1, whose expression is largely disrupted in the germline KO mouse, have reduced dependence on PET-1 by the early postnatal period (Chapter 3, Figure 12). This was revealed by postnatal deletion of Pet-1 through injection of AAV-Cre into P0 pups containing a floxed Pet-1 and null allele (AAV-Cre; Pet-1fl/-). Interestingly, other genes such as Htr1a, Adra1b, and

Oct3 remained almost completely dependent on PET-1 at this stage. This result has some important implications. 1. This suggests that PET-1 has a prolonged role in 5-HT neuron maturation beyond its early embryonic function described

182 previously (Liu et al., 2010; Hendricks et al., 2003). 2. This suggests that PET-1 changes targets throughout development.

It is well established that many transcription factors (TFs) which are required early in neuronal development are also required throughout life to maintain neural identity (Deneris and Hobert, 2014). Most of the mouse studies have investigated the function of TFs in maintaining neural identity in a mature mouse. However, I am aware of only one other study that has investigated the function of a TF in the early postnatal stage while leaving its developmental role intact (Kadkhodaei et al., 2013). The remainder of the studies examined more mature mice in the post adolescent/adult period. Generally speaking, disrupted expression of these TFs embryonically has a profound effect on gene expression while adult disruption indicated that many of these genes have reduced sensitivity or become insensitive to the loss of the TF (Liu et al., 2010;

Kadkhodaei et al., 2009, 2013; Pristera et al., 2015; Song et al., 2006).

The Kadkhodaei et al. (2013) study examined the effect of targeting the

TF Nr4a2 (Nurr1, nuclear receptor related 1) in dopamine (DA) neurons at E13.5,

P0, and 5 week old mice using the Cre/loxP system with either a Slc6a3-Cre or

Slc6a3-CreER. E13.5 targeting of Nr4a2 resulted in a large reduction in expression of the DA-neuron genes including: Th (tyrosine hydroxylase), Ddc

(dopa decarboxylase), Slc18a2 (VMAT2, vesicular monoamine transporter 2) and

Slc6a3, (DAT, dopamine transporter). However, targeting Nr4a2 at P0 or 5 weeks in Slc6a3-CreER; floxed Nr4a2 mice led to reduced expression of Th, and

183

Slc18a2, where Ddc largely becomes insensitive to the loss of Nr4a2 by P0.

Slc6a3 remains sensitive to P0, Nr4a2 loss, but not loss of Nr4a2 at 5 weeks.

Mechanistically, how can germline loss of a TF such as PET-1 have a

profound effect in regulating gene expression while later loss has less of the

effect? One possibility is PET-1 activates other autoregulatory transcription

factors (maintenance factors) which act to maintain expression of the 5-HT gene

battery. Another possibility is PET-1 is required for the generation/maintenance of chromatin states which allow for DNA motif access for other TFs to maintain

expression of PET-1 targets. A third possibility is TFs such as PET-1 and

LMX1B are corequired for the initial induction 5-HT gene expression, but become

redundant in their requirement to maintain gene expression later in life.

Pet-1 may regulate 5-HT identity through a feed-forward TF network

We found that PET-1 directly activates (and represses) many transcription

factors suggesting that PET-1 may activate other maturation/maintenance factors

which in turn autoregulate or are maintained by other TFs such as LMX1B.

These TFs could act to coregulate 5-HT genes. There are numerous examples of

TFs regulating neuronal terminal identity features through activating coregulators

in a feedforward fashion (Swaroop et al., 2010; Lin et al., 2009; Hennig et al.,

2008). For example, in cone photoreceptor development, the TF, CRX (cone

rode homeobox) activates the TF, NRL (Neural Retinal Leucine Zipper). Both

TFs then act to coregulate numerous genes needed for rod photoreceptor

function (Swaroop et al., 2010; Henning et al., 2008). In DA neurons, TFs FOXA1

184

and FOXA2 regulate the DA synthetic enzyme TH (tyrosine hydroxylase) expression both through direct activation, and by directly activating downstream

TFs Lmx1b and Lmx1a, which in turn also activate TH expression (Lin et al.,

2009).

This may also be the case for Lmx1b in 5-HT neurons. LMX1B is not

needed for the induction of Pet-1, but is needed by E14.5 to maintain Pet-1 after

its initial inductive signals (such as GATA2) are downregulated. LMX1B itself is

needed for proper embryonic expression of Pet-1 and its coregulation of many

PET-1-regulated such as Tph2, Slc6a4 (Sert), and Slc18a2 (VMAT2). This

suggests that PET-1 may act as a feedforward target of LMX1B for proper

expression of 5-HT neuron genes.

Therefore it seems plausible that these PET-1 regulated TFs may partially

maintain expression of PET-1 targets after the loss of Pet-1 in the postnatal

period. Additionally, these factors may also affect the proper expression of Pet-1

in a transcriptional maintenance network. As such, the reduced sensitivity of 5-

HT battery genes to PET-1 may, at least in part, be due to the activation of

downstream autoregulatory factors or maintenance factors such as Engrailed.

A second possibility, is PET-1 is needed embryonically to open chromatin

regions allowing for other TFs to access their DNA binding motifs. In a recent

article by Frank et al. they map the DHS (DNAse hypersensitivity site) of the

cerebellum during development (2015). DHS are associated with open chromatin

regions and TF binding. Frank et al. provide evidence that opening of the

chromatin allows accessibility of the broadly expressed Zic (zinc finger of the

185

cerebellum) TFs to bind to their targets. Zics are broadly expressed TFs involved

in neural pattering and cerebellar development (Mikoshiba, 1999; Houtmeyers et

al., 2013). PET-1 may act in a similar fashion. PET-1 may aid in the opening of chromatin regions so that more generally expressed TFs are allowed access to their binding motifs, thus maintaining expression of PET-1 targets after later loss of PET-1. This is the proposed mechanism for tissue-specific gene regulation of the ubiquitously expressed TF MEF2D in rod photoreceptor development

(Andzelm et al., 2015). CRX binding opens chromatin near photoreceptor genes allowing for the binding of MEF2D to sites made available by the TF, CRX.

A third possibility is that multiple TFs are required for the initial induction and/or embryonic maintenance of gene expression, whereas only a single TF is needed to maintain expression in the postnatal/adult period. In one scenario, 5-

HT developmental TFs such as PET-1, LMX1B, and GATA3 function synergistically to open the chromatin and make the environment suitable (ex. histone modifications, prevent DNA methylation) for transcription of target genes.

After this early function, the actual maintained expression could be driven simple by the presence of either LMX1B or PET-1 in a redundant fashion. This could be tested by conditional deletion of both PET-1, LMX1B in the early developmental period.

Although I presented several mechanisms for the change in sensitivity to

PET-1, in all actuality, the mechanism of PET-1 altered sensitivity is likely due to a combination of several of these ideas.

186

Future experiments

It would be interesting to identify genes with reduced postnatal dependence of PET-1 by profiling the transcriptomes of 5-HT neurons after the targeting of Pet-1 at various stages. Postnatal transcriptomic analysis could be performed as described in the previous section. I propose the best times to investigate this would be P0, P21 and P60 targeted mice. This would allow us to define which genes remain sensitive to PET-1 postnatally and adulthood, and to identify the timing of this reduced sensitivity.

Identifying the Pet-1-regulated Htr1a Sensitive period

The final result I will discuss is the discovery that a temporal window for

PET-1 regulation of the serotonin autoreceptor—5-HT1A correlates with a previously defined window in 5-HT1A function (Chapter 3 figure 13A,C;

Donaldson et al., 2014). Previous work from our lab, and other, showed that embryonic loss of Pet-1 results in a nearly complete loss of Htr1a, whereas adult loss resulted in no change in 1A expression as assayed by qPCR (Chapter 2,

Figure 5A; Liu et al., 2010 Jacobsen et al., 2011). This indicates that there is some sort of temporal sensitive period whereby PET-1 is absolutely required for

Htr1a expression early in life, but largely dispensable adulthood.

In order to identify the temporal requirements of PET-1 for Htr1a autoreceptor regulation, we injected AAV-Cre into mice with a floxed and null

Pet-1 allele (Pet-1fl/-; AAV-Cre) at postnatal day 0 (P0), P3, P6, P14, P22, and

P60. Unlike other classical 5-HT genes such as Tph2, Gchfr, and Gch1, we found that deletion of Pet-1 in the early postnatal period had a profound effect on

187

Htr1a expression, while adult deletion had a much more mild effect. Specifically,

injection of AAV-Cre into mice with a floxed and null Pet-1 allele (Pet-1fl/-; AAV-

Cre) at P22 or earlier led to a complete wipeout of Htr1a mRNA in the raphe

nucleus, whereas injection of 2 month old mice had a much lesser effect on

Htr1a expression. Therefore, PET-1 acts in the postnatal period to drive Htr1a,

and likely other genes required for 5-HT neuronal maturation. As this period is

critical for the proper development of lifelong 5-HT electrophysiological properties

and stress responsiveness, this leads to the exciting hypothesis that

environmentally induced fluctuations in PET-1 function in the early postnatal

period may have life-long effects on expression of Htr1a and likely other genes

such as Adra1b. This opens the possibility that PET-1 may mediate a recently

defined sensitive period for serotonergic function in setting life-long anxiety adaptive behavior. Previously, pharmacological, behavior, and genetics studies have shed much light on the timing of this critical period. Furthermore, work form

Rene Hen’s lab has identified a temporal window for the serotonin autoreceptor in mediating life-long stress adaption.

Evidence for a sensitive period of 5-HT mediated stress adaptation

Neural development consists of interplay between a genetically defined maturation programs which are fine-tuned through environmental inputs. Since the 1960s, researchers have known that there is a state of heightened developmental/functional neural plasticity early in life which has resilient effects throughout life. This time-window is often termed a “critical period” or “sensitive

188

period”. Numerous studies suggest a sensitive period in serotonergic-mediated development of anxiety associated behaviors exists. An early clue came from

the observation that germline deletion of the serotonin transporter, SERT,

paradoxically leads to increased anxiety and maladaptation to stress (Ansorge et

al., 2004; Holmes et al., 2003a, 2003b). This result was unexpected, as

pharmacological inhibition of SERT in adulthood decreases stress and anxiety,

hence their use as an antidepressant.

Numerous studies set out to identify the mechanism and timing of this

switch in roles of 5-HT in signaling. Pharmaceutical inhibition of SERT, in utero,

generally had a mild effect on lifelong adaption to stress, whereas inhibition of

the serotonin transporter in the first few weeks of life lead to lifelong maladapted

effects in stress, anxiety, and depressive behaviors (Angsorge et al., 2004;

Kepser and Homberg, 2015; Rayen et al., 2011). Parallel experiments using

either a 5-HT1A receptor agonist, or antagonists, have revealed similar results (Lo

Iacono and Gross 2008, Vinkers, 2010).

Defining 5-HT1A’s sensitive period

Perhaps the most fascinating evidence comes from the work of Rene

Hen’s lab. He is interested in defining the spatiotemporal function of the 5-HT1A

receptors in modulating stress, anxiety, and depressive behaviors. To

investigate this, his group generated a method to repress and/or rescue Htr1a

expression in different tissues, at different times throughout life, using the

tTS/tetO system. In order to investigate this, initially they created a Tet

189

repressible rescue line in the Htr1a background (Gross et al 2002). Later they

generated a suppressible Htr1a (Tet-Off) allele by inserting a tetracycline response element TRE upstream of the Htr1a coding region (Richardson-Jones

et al 2010). Derepression of the TetO allele occurs when mice are fed

doxycycline (Dox), an inhibitor of the tetracycline-dependent transcriptional

suppressor (tTS) repressor protein, thus allows for suppression of Htr1a

expression in mice expressing the tTS repressor in the absence of Dox (Grossen

and Bujard, 1992; Zhang et. al 2012). Of importance, 1A heteroreceptor rescue

from P15 is sufficient to rescue anxiety phenotypes of the Htr1a-/- mice, whereas

rescues of Htr1a heteroreceptor after P21 results in life-long increases in anxiety

(Heisler et al, 1998; Leonardo and Hen, 2008; Parks et al, 1998; Ramboz et al,

1998, Richardson-Jones et.al 2010, 2011). Relating to PET-1’s Htr1a autoreceptor regulation, lifelong suppression, but not adult specific suppression of the Htr1a receptor only in 5-HT neurons, is sufficient to phenocopy the anxiety phenotype found in Htr1a-/- mice (Richardson-Jones et al., 2010). Specifically,

mice reared on Dox from conception until ~P50, but then taken off Dox for the

remainder of their life show no anxiety phenotype whereas mice reared on Dox

throughout life showed increased anxiety.

Based on the previously mentioned postnatal pharmacological studies

with 5-HT1A antagonists, this led them to investigate the timing of 5-HT1A function

in the early postnatal period (Donaldson et al., 2014). By removing dox from

tetO/tetO Htr1a ; Pet1-tTs mice from P0 to P21 they were able to reduce 5-HT1A

levels only in 5-HT neurons from P14 to P28 with a maximal repression of 40% at

190

P21. These mice showed increased anxiety as in the open field and elevated

plus maze. Furthermore, 5-HT neurons from these mice at 9 months of age were

hyperexcitable, indicating life-long sensitivity to postnatal 5-HT1A inhibition.

When used in conjunction with previous data, they revealed a temporal window

for 5-HT1A autoreceptor function encompassing a temporal window from P14-

P28.

The Role of PET-1 in Htr1a’s postnatal development

The timing of Htr1a’s sensitive period described above overlaps with the

sensitive period for PET-1 in regulating Htr1a. As PET-1 is a direct transcriptional activator of Htr1a (Jacobsen et al., 2011), this leads to an enticing hypothesis that PET-1 may act as a “sensor” for environmental perturbations which can affect postnatal serotonergic neuron function, thus affecting life-long

stress adaption. One could image several ways in which environmental

perturbations could alter PET-1 function, such as through transcriptional

regulation, protein translation, posttranslational modifications, and changes in

interaction with other proteins. Nothing is known about which if any

posttranslational modifications may affect PET-1 function; however there is a rich

literature of other ETS domain TFs showing their activity can be regulated

through phosphorylation, acetylation, sumoylation, ubiquination and

glycosylation (Charlot et al., 2010; Tootle and Rebay, 2005; Yordy and Muise-

Helmricks, 2000). Within other ETS TFs these modifications have been shown to

affect a myriad of functions including DNA binding, repressor/activator activity,

191 subcellular localization, protein interacting partners, and protein stability. Again nothing is known about interacting partners of PET-1, but other ETS are known to synergistically act with multiple TFs including SRF, RUNX, SP1, PAX5,

GATA1 and AP1.

It would be interesting to conditionally delete Pet-1 at various points throughout development and assay both the expression and function of 5-HT1A.

To further test if Pet-1 function in the postnatal period it would be interesting to generate a repressible, TetO Pet-1, allele and test the effects of altering Pet-1 for brief periods throughout development to dissect out functional time points of Pet-

1 function. Additionally, investigations into the effect environmental perturbations have on Pet-1 expression would be fairly simple. More work would be required to determine if 1. Has posttranslational modifications and 2. What effect these have on Pet-1 function.

Note on the use of AAV-Cre

It should be pointed out, that it is unknown when the function of PET-1 is lost with this AAV-injection protocol. In order to see if a gene is dependent on

Pet-1, the virus must express the Cre recombinase. The cre must excise the allele; allow time for Pet-1 mRNA to degrade, allow the protein to degrade, and finally allow the RNA of the target gene to be degraded. By injecting P0 mice and surveying Pet-1 and Htr1a at P12, I found a complete wipeout of Pet-1 mRNA and a loss of Htr1a RNA. This indicates it a takes a maximum of 12 days for the loss of PET-1protien.

192

Conclusion

Through this thesis work, we have greatly enhanced our understanding of the early development of 5-HT neurons and the role of PET-1 in driving this maturation. In this work, we identified the transcriptomic changes occurring as a newly born 5-HT neuron matures into a postnatal neuron. We found that genes downregulated from birth were those associated with basic transcription and translation, while upregulated genes were associated with maturing neuronal identity and function. Through RNA-sequencing of Pet-1-/- 5-HT neurons, we found that PET-1 regulates a broad transcriptional program needed to drive the proper excitability of these cells and their ability to properly respond to inputs.

This work was further extended by the exciting result that PET-1 has multiple functions throughout development to first initiate a program needed for 5-HT synthesis, and then a program for the neuron to properly respond to these inputs.

Of great interest, we defined a sensitive period for PET-1-Htr1a regulation, which may have important implications of PET-1 postnatal function in generating the proper response to stress. Finally, by using chromatin immunoprecipitation we found that PET-1 drives maturation by acting both as a transcriptional activator and repressor. PET-1 appears to be a key factor in driving 5-HT neuron maturation by activing the 5-HT gene battery, activating a downstream transcriptional network, and through repression of transcription factors and genes needed to establish the proper balance of gene expression needed for 5-HT neuronal function. The result presented in this thesis will drive further research in

193

5-HT neuron development and function, and may lead to a better understanding of transcriptional networks in psychiatric disease.

194

BIBLIOGRAPHY

Acampora, D., Mazan, S., Lallemand, Y., Avantaggiato, V., Maury, M., Simeone, A. and Brulet, P. (1995). Forebrain and midbrain regions are deleted in Otx2–/– mutants due to a defective anterior neuroectoderm specification during gastrulation. Development. 121, 3279-3290.

Adell, A.,Celada, P., Abellan,M. T., and Artigas,F.(2002).Origin and functional role of the extracellular serotonin the midbrain raphe nuclei. Brain Res Rev. 39, 154–180.

Aghajanian, G.K., and Lakoski, J.M., (1984). Hyperpolarization of serotonergic neurons by serotonin and LSD: studies in brain slices showing increased K+ conductance. Brain Research. 305: 181-185.

Albert, P.R., Lembo, P., Storring, J.M., Charest, A., and Saucier, C. (1996). The 5-HT1A receptor: signaling, desensitization, and gene transcription. Neuropsychopharmacology. 14(1):19-25.

Allan, D.W., and Thor, S. (2015). Transcriptional selectors, masters, and combinatorial codes: regulatory principles of neural subtype specification. Wiley Interdiscip Rev Dev Biol. 4(5):505-28.

Alvarado-Mallart, R.M. (1993). Fate and potentialities of the avian mesencephalic/metencephalic neuroepithelium. J Neurobiol 24:1341- 1355.

Amlaiky, N., Ramboz, S., Boschert, U., Plassat, J.L., and Hen, R. (1992). Isolation of a mouse "5HT1E-like" serotonin receptor expressed predominantly in hippocampus. J Biol Chem. 267(28):19761-4.

Andrade, R., Huereca, D., Lyons, J.G., Andrade, E.M., and McGregor, K.M. (2015). 5-HT1A Receptor-Mediated Autoinhibition and the Control of Serotonergic Cell Firing. ACS Chem Neurosci. 6(7):1110-5.

Andzelm, M.M., Cherry, T.J., Harmin, D.A., Boeke, A.C., Lee, C., Hemberg, M., et al. (2015). MEF2D drives photoreceptor development through a genome-wide competition for tissue-specific enhancers. Neuron. 86(1):247-63.

Ansorge, M.S., Zhou, M., Lira, A., Hen, R., and Gingrich, J.A. (2004). Early-life blockade of the 5-HT transporter alters emotional behavior in adult mice. Science. 306(5697):879-81.

195

Arias, B., Collier, D. A., Gasto, C., Pintor, L., Gutierrez, B., Valles, V., et al. (2001). Genetic variation in the 5-HT5A receptor gene in patients with bipolar disorder and major depression. Neurosci Lett. 303, 111−114.

Aronne, L., Shanahan, W., Fain, R., Glicklich, A., Soliman, W., Li, Y., Smith, S. (2014). Safety and efficacy of lorcaserin: a combined analysis of the BLOOM and BLOSSOM trials. Postgrad Med. 126(6):7-18.

Asano, M. and Gruss, P. (1992). Pax-5 is expressed at the midbrain-hindbrain boundary during mouse development. Mech. Dev. 39, 29–39.

Bach, T., Syversveen, T., Kvingedal, A.M., Krobert, K.A., Brattelid, T., Kaumann, A.J., and Levy, F.O. (2001). 5HT4(a) and 5-HT4(b) receptors have nearly identical pharmacology and are both expressed in human atrium and ventricle. Naunyn Schmiedebergs Arch Pharmacol. 363(2):146-60.

Baganz, N. L., Horton, R. E., Calderon, A. S., Owens, W. A., Munn, J. L., Watts, et al. ( 2008) Organic cation transporter 3: Keeping the brake on extracellular serotonin in serotonin-transporter-deficient mice. Proc. Natl. Acad. Sci. U.S.A. 105, 18976–18981.

Baganz, N., Horton, R., Martin, K., Holmes, A., and Daws, L.C. (2010) Repeated swim impairs serotonin clearance via a corticosterone-sensitive mechanism: organic cation transporter 3, the smoking gun. J Neurosci. 30:15185-15195.

Bai, F., Yin, T., Johnstone, E.M., Su, C., Varga, G., Little, S.P. et al. (2004). Molecular cloning and pharmacological characterization of the guinea pig 5-HT1E receptor. Eur J Pharmacol. 484: 127–139.

Bailey, T.L., Boden, M., Buske, F.A., Frith, M., Grant, C.E., Clementi, L., et al. (2009). MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res. 37:W202-208.

Baker, K.G., Halliday, G.M., Halasz, P., Hornung, J.P., Geffen, L.B., Cotton, R.G., and Tork, I. (1991). Cytoarchitecture of serotonin-synthesizing neurons in the pontine tegmentum of the human brain. Synapse. 7, 301– 320.

Baldock, R., Bard, J., Davidson, D., and Morriss-Kay, G. (2015), Kaufman’s Atlas of Mouse Development Supplement: With Coronal Sections. Academic Press, Science pg 208.

Bang, S.J., Jensen, P., Dymecki, S.M., and Commons, K.G. (2012). Projections and interconnections of genetically defined serotonin neurons in mice. Eur J Neurosci. 35(1):85-96.

196

Bard, J.A, Zgombick, J., Adham, N., Vaysse, P., Branchek, T.A., and Weinshank, R.L. (1993). Cloning of a novel human serotonin receptor (5-Ht7) positively linked to adenylate cyclase. J Biol Chem. 268:23422–6.

Barnes, N.M., Hales, T.G., Lummis, S.C., and Peters, J.A. (2009). The 5-HT3 receptor--the relationship between structure and function. Neuropharmacology. 56(1):273-84.

Barrera, N.P., Herbert, P., Henderson, R.M., Martin, I.L., Edwardson, J.M. (2005). Atomic force microscopy reveals the stoichiometry and subunit arrangement of 5-HT3 receptors. Proc Natl Acad Sci USA. 102(35):12595-600.

Baumgardt, M., Miguel-Aliaga, I., Karlsson, D., Ekman, H., and Thor, S. (2007). Specification of neuronal identities by feedforward combinatorial coding. PLoS Biol. 2007 Feb;5(2):e37.

Beck, S.G., Pan, Y.Z., Akanwa, A.C., and Kirby, L.G. (2004). Median and dorsal raphe neurons are not electrophysiologically identical. J Neurophysiol. 91:994-1005.

Belenky, M.A. and Pickard, G.E. (2001). Subcellular distribution of 5-HT1b and 5- HT7 receptors in the mouse suprachiasmatic nucleus. J. Comp. Neurol. 432, 371–388.

Benhamu, B., Martin-Fontecha, M., Vazquez-Villa, H., Pardo, L., and Lopez- Rodriguez, M.L. (2014). Serotonin 5-HT6 receptor antagonists for the treatment of cognitive deficiency in Alzheimer's disease. J Med Chem. 57(17):7160-81.

Berglund, E.D, Liu, C., Sohn, J.W., Liu, T., Kim, M.H., Lee, C.E., et al. (2013). Serotonin 2C receptors in pro-opiomelanocortin neurons regulate energy and glucose homeostasis. J Clin Invest. 123(12):5061-70.

Bevilacqua, L., Doly, S., Kaprio, J., Yuan, Q., Tikkanen, R., Paunio, T., et al. (2010). A population-specific HTR2B stop codon predisposes to severe impulsivity. Nature. 468(7327):1061-6.

Blakely, R. D. and Edwards, R. H. ( 2012). Vesicular and plasma membrane transporters for neurotransmitters. Cold Spring Harbor Perspect. Biol.

Bockaert, J., Claeysen, S., Compan, V., and Dumuis, A. (2008). 5-HT(4) receptors: history, molecular pharmacology and brain functions. Neuropharmacology. 55(6):922-31.

197

Boess, F.G., Beroukhim, R., and Martin, I.L. (1995). Ultrastructure of the 5- hydroxytryptamine 3 receptor. J Neurochem. 64(3):1401-5.

Bonasera, S.J., Chu, H.M., Brennan, T.J., and Tecott, L.H. (2006). A null mutation of the serotonin 6 receptor alters acute responses to ethanol. Neuropsychopharmacology. 31(8):1801-13.

Bonhaus, D.W., Bach, C., Desouza, A., Salazar, F.H.R., Matsuoka, B.D., Zuppan, P., et al. (1995). The pharmacology and distribution of human 5- hydroxytryptamine(2b) (5-Ht2b) receptor gene-products – comparison with 5-Ht2a and 5-Ht2c receptors. Br J Pharmacol. 115:622–8.

Brandt, J.P., Aziz-Zaman, S., Juozaityte, V., Martinez-Velazquez, L.A., Petersen, J.G., Pocock, R., and Ringstad, N. (2012). A single gene target of an ETS- family transcription factor determines neuronal CO2-chemosensitivity. PLoS One.7(3).

Briscoe, J., Sussel, L., Serup, P., Hartigan-O’Conner, D., Jessell, TM., Rubenstein, JL, et al. (1999). Homeobox gene Nkx2-2 and specification of neuronal identity by graded Sonic hedgehog signaling. Nature. 398(6728):622-7.

Broccoli, V., Boncinelli, E., and Wurst, W. (1999). The caudal limit of Otx2 expression positions the isthmic organizer. Nature. 401. 164-168.

Brodski, C., Weisenhorn, D.M.V., Signore, M., Sillaber, I., Oesterheld, M., Broccoli, V., et al. (2003). Location and size of dopaminergic and serotonergic cell populations are controlled by the position of the midbrain- hindbrain organizer. J Neurosci. 23(10):4199–207.

Brown, R.E., Sergeeva, O., Eriksson, K.S., and Haas, H.L. (2001). Orexin A excites serotonergic neurons in the dorsal raphe nucleus of the rat. Neuropharmacology 40:457–459.

Brown, R.E., Sergeeva, O.A., Eriksson, K.S., and Haas, H.L. (2002). Convergent excitation of dorsal raphe serotonin neurons by multiple arousal systems (orexin/hypocretin, histamine and noradrenaline). J Neurosci. 22:8850– 8859.

Calizo, L.H., Akanwa, A., Ma, X., Pan, Y.Z., Lemos, J.C., Craige, C., et al. (2011) Raphe serotonin neurons are not homogenous: electrophysiological,

198

morphological and neurochemical evidence. Neuropharmacology. 61:524- 543.

Cao, J, LaRocque, E, and Li, D. (2013). Associations of the 5-Hydroxytryptamine (Serotonin) Receptor 1B Gene (HTR1B) With Alcohol, Cocaine, and Heroin Abuse. Am J Med Genet B Neuropsychiatr Genet. 162B(2):169-76.

Carcagno, A.L., Di Bella, D.J., Goulding, M., Guillemot, F., and Lanuza, G.M. (2014). Neurogenin3 restricts serotonergic neuron differentiation to the hindbrain. J Neurosci. 34(46):15223-33.

Castilla-Ortega, E., Sanchez-Lopez, J., Hoyo-Becerra, C., Matas-Rico, E., Zambrana-Infantes, E., Chun, J., et al. (2010). Exploratory, anxiety and spatial memory impairments are dissociated in mice lacking the LPA1 receptor. Neurobiol Learn Mem. 94(1):73-82.

Castilla-Ortega, E., Hoyo-Becerra, C., Pedraza, C., Chun, J., Rodriguez De Fonseca, F., Estivill-Torrús, G., and Santín, L.J. (2011). Aggravation of chronic stress effects on hippocampal neurogenesis and spatial memory in LPA1 receptor knockout mice. PLoS ONE. 6, e25522.

Charlot, C., Dubois-Pot, H., Serchov, T., Tourrette, Y., and Wasylyk, B. (2010). A review of post-translational modifications and subcellular localization of Ets transcription factors: possible connection with cancer and involvement in the hypoxic response. Methods Mol Biol. 2010;647:3-30.

Chen, J.J., Vasko, M.R., Wu, X., Staeva, T.P., Baez, M., Zgombick, J.M., and Nelson, D.L. (1998). Multiple subtypes of serotonin receptors are expressed in rat sensory neurons in culture. J Pharmacol Exp Ther. 287(3):1119-27.

Chen, Z.J., and Minneman, K.P. (2005). Recent progress in alpha1-adrenergic receptor research. Acta Pharmacol Sin. 26(11):1281-7.

Cheng, L., Chen, C.L., Luo, P., Tan, M., Qiu, M., Johnson, R., and Ma, Q. (2003) Lmx1b, Pet-1, and Nkx2.2 coordinately specify serotonergic neurotransmitter phenotype. J Neurosci. 23:9961-9967.

Chi, C.L., Martinez, S., Wurst, W., and Martin, G.R. (2003). The isthmic organizer signal FGF8 is required for cell survival in the prospective midbrain and cerebellum. Development. 130(12):2633-44.

Chiang, C., Litingtung, Y., Lee, E., Young, K.E., Corden, J.L., Westphal, H., and Beachy, P.A. (1996). Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature. 383(6599):407-13.

199

Ciarleglio, C.M., Resuehr, H.E., Axley, J.C., Deneris, E.S. and McMahon, D.G. (2014). Pet-1 deficiency alters the circadian clock and its temporal organization of behavior. PLoS One. 9(5):e97412.

Claeysen, S., Sebben, M., Becamel, C., Parmentier, M.L., Dumuis, A., and Bockaert, J. (2008). Constitutively active mutants of 5-HT4 receptors are they in unique active states? Mol Pharmacol. 58(1):136-44.

Claeysen, S., Sebben, M, Journot, L, Bockaert, J, and Dumuis, A. (1996). Cloning, expression and pharmacology of the mouse 5-HT(4L) receptor. FEBS Lett. 398(1):19-25.

Compan, V., Zhou, M., Grailhe, R., Gazzara, R.A., Martin, R., Gingrich, J, et al. (2004). Attenuated response to stress and novelty and hypersensitivity to seizures in 5-HT4 receptor knock-out mice. J Neurosci. 24(2):412-9.

Cooper, C.D., Newman, J.A., Aitkenhead, H., Allerston, C.K., and Gileadi, O. (2015). Structures of the Ets Protein DNA-binding Domains of Transcription Factors Etv1, Etv4, Etv5, and Fev: Determinants of DNA Binding and Redox Regulation by Disulfide Bond Formation. J Biol Chem. 290(22):13692-709.

Corena-McLeod, M. (2015). Comparative Pharmacology of Risperidone and Paliperidone. Drugs R D. 15(2):163-74.

Corradi, J., Thompson, A.J., McGonigle, I., Price, K.L., Bouzat, C., and Lummis, S.C. (2015). 5-HT3 Receptor Brain-Type B-Subunits are Differentially Expressed in Heterologous Systems. ACS Chem Neurosci. 6(7):1158-64.

Craven, S.E., Lim, K.C., Ye, W., Engel, J.D., De Sauvage, F., and Rosenthal, A. ( 2004) Gata2 specifies serotonergic neurons downstream of sonic hedgehog. Development. 131, 1165–1173.

Crawford, L.K., Craige, C.P., and Beck, S.G. (2011). Glutamatergic input is selectively increased in dorsal raphe subfield 5-HT neurons: role of morphology, topography and selective innervation. Eur J Neurosci. 34:1794-1806.

Crossley, P.H. and Martin, G.R. (1995). The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development. 121, 439–451.

Cummings, K.J., Li, A., Deneris, E., and Nattie, E. (2014). Bradycardia in serotonin deficient Pet-1-/- mice: influence of respiratory dysfunction and hyperthermia over the first two postnatal weeks. PLoS One. 9(5):e97412.

200

Dahlstroem, A., and Fuxe, K. (1964). Evidence for the existence of monoamine- containing neurons in the central nervous system. I. Demostration of monoamines in the cell bodies of brain stem neurons. Acta Physiol Scand Suppl. Suppl. 232:1-55.

Danielian, P.S., and McMahon, A.P. (1996). Engrailed-1 as a target of the Wnt-1 signalling pathway in vertebrate midbrain development. Nature. 383(6598):332-4.

Davis, C.A. and Joyner, A.L. (1988) Expression patterns of the homeobox containing genes En1 and En2 and the proto-oncogene int-1 diverge during mouse development. Genes Dev. 2, 1736–1744.

Davis, C.A., Noble-Topham, S.E., Rossant, J., and Joyner, A.L. (1988). Expression of the homeobox-containing gene En2 delineates a specific region of the developing mouse brain. Genes Dev. 2, 361–371.

Davies, P.A., Pistis, M., Hanna, M.C., Peters, J.A., Lambert,J.J., Hales, G., et al. (1999). The 5-HT3B subunit is a major determinant of serotonin-receptor function. Nature. 397, 359–363.

Daws, L.C. ( 2009) Unfaithful neurotransmitter transporters: focus on serotonin uptake and implications for antidepressant efficacy. Pharmacol. Ther. 121, 89– 99.

Day, H.E., Greenwood, B.N., Hammack, S.E., Watkins, L.R., Fleshner, M., Maier, S.F., and Campeau, S. (2004). Differential expression of 5HT-1A, alpha 1b adrenergic, CRF-R1, and CRF-R2 receptor mRNA in serotonergic, gamma-aminobutyric acidergic, and catecholaminergic cells of the rat dorsal raphe nucleus. J Comp Neurol. 474:364-378.

Day, H.E.W., Campeau, S., and Watson, S.J., (1997). Akil H. Distribution of a1a-, a1b- and a1d-adrenergic receptor mRNA in the rat brain and spinal cord Journal of Chemical. Neuroanatomy. 13 115–139.

Dayer, A.G., Jacobshagen, M., Chaumont-Dubel, S., and Marin, P. (2015). 5- HT6 Receptor: A New Player Controlling the Development of Neural Circuits. ACS Chem Neurosci. 6(7):951-60.

de la Torre-Ubieta, L., and Bonni, A. (2011). Transcriptional regulation of neuronal polarity and morphogenesis in the mammalian brain. Neuron. 72:22-40.

De Vivo, M., and Maayani, S. (1986). Characterization of the 5- hydroxytryptamine1a receptor-mediated inhibition of forskolin-stimulated

201

adenylate cyclase activity in guinea pig and rat hippocampal membranes. J Pharmacol Exp Ther. 238(1):248-53.

Deneris, E.S. (2011). Molecular genetics of mouse serotonin neurons across the lifespan. Neuroscience. 197, 17–27.

Deneris, E. S. and Hobert, O. (2014) Maintenance of postmitotic neuronal cell identity. Nat. Neurosci. 17, 899–907.

Deneris, E.S., and Wyler, S.C. (2012). Serotonergic transcriptional networks and potential importance to mental health. Nat Neurosci. 15(4):519-27.

Diaz, J.M., Alekseenko, Z., Applequist, J.M., and Ericson, J. (2014). Tgfβ signaling regulates temporal neurogenesis and potency of neural stem cells in the CNS. Neuron. 84, 927-939.

Ding, B., Wang, W., Selvakumar, T., Xi HS., Zhu, H., Chow, C.W., et al. (2013). Temporal regulation of nuclear factor one occupancy by calcineurin/NFAT governs a voltage-sensitive developmental switch in late maturing neurons. J Neurosci. 33:2860-2872.

Ding, Y. Q., Marklund, U., Yuan, W., Yin, J., Wegman, L., Ericson, J., Deneris, E., Johnson, R. L., and Chen, Z. F. ( 2003) Lmx1b is essential for the development of serotonergic neurons. Nat. Neurosci. 6, 933–938.

Doly, S., Valjent, E., Setola, V., Callebert, J., Herve, D., Launay, J.M., and Maroteaux, L. (2008). Serotonin 5-HT2B receptors are required for 3,4- methylenedioxymethamphetamine-induced hyperlocomotion and 5-HT release in vivo and in vitro. J Neurosci. 28(11):2933-40.

Domanskyi, A., Alter, H., Vogt, M.A., Gass, P., and Vinnikov, I.A. (2014). Transcription factors Foxa1 and Foxa2 are required for adult dopamine neurons maintenance. Front Cell Neurosci. 8:275.

Donaldson, Z.R., Piel, D.A., Santos, T.L., Richardson-Jones, J., Leonardo, E.D., Beck, S.G., Champagne, F.A., and Hen, R. (2014). Developmental Effects of Serotonin 1A Autoreceptors on Anxiety and Social Behavior. Neuropsychopharmacology. 39, 291–302.

Doumazane, E., Scholler, P., Zwier, J.M., Trinquet, E., Rondard, P., and Pin, J.P. (2011). A new approach to analyze cell surface protein complexes reveals specific heterodimeric metabotropic glutamate receptors. FASEB J. 25(1):66-77.

202

Dubertret, C., Hanoun, N., Ades, J., Hamon, M., and Gorwood, P. (2004). Family-based association studies between 5-HT5A receptor gene and schizophrenia. J Psychiatr Res. 38(4):371-6.

Duncan, M.J., Jennes, L., Jefferson, J.B., and Brownfield, M.S. (2000). Localization of serotonin(5A) receptors in discrete regions of the circadian timing system in the Syrian hamster. Brain Res. 869(1-2):178-85.

Durham, P.L., and Russo, A.F. (2002). New insights into the molecular actions of serotonergic antimigraine drugs. Pharmacol Ther. 94(1-2):77-92.

Duxon, M.S., Flanigan, T.P., Reavley, A.C., Baxter, G.S., Blackburn, T.P., and Fone, K.C. (1997). Evidence for expression of the 5-hydroxytryptamine-2B receptor protein in the rat central nervous system. Neuroscience. 76(2):323-9.

Dzierzak, E., and Speck, N.A. (2008). Of lineage and legacy: the development of mammalian hematopoietic stem cells. Nat Immunol. 9(2):129-136.

Echelard, Y., Epstein, D.J., St-Jacques, B., Shen, L., Mohler, J., McMahon, J.A., and McMahon, A.P. (1993). Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell. 75(7):1417-30.

Enjin, A., Leao, K.E., Mikulovic, S., Le Merre, P., Tourtellotte, W.G., and Kullander, K. (2012). Sensorimotor function is modulated by the serotonin receptor 1d, a novel marker for gamma motor neurons. Mol Cell Neurosci. 49(3):322-32.

Erickson, J.T., Shafer, G., Rossetti, M.D., Wilson, C.G., and Deneris, E.S. (2007). Arrest of 5HT neuron differentiation delays respiratory maturation and impairs neonatal homeostatic responses to environmental challenges. Respir Physiol Neurobiol. 159(1):85-101.

Espallergues, J., Teegarden, S.L., Veerakumar A, Boulden J, Challis C, Jochems J, et al. (2012) HDAC6 regulates glucocorticoid receptor signaling in serotonin pathways with critical impact on stress resilience. J Neurosci. 32:4400-4416.

Estivill-Torrus, G., Llebrez-Zayas, P., Matas-Rico, E., Santin, L., Pedraza, C., De Diego, I. et al. (2008). Absence of LPA1 signaling results in defective cortical development. Cereb Cortex. 18(4):938-50.

Etchberger, J.F., Flowers, E.B., Poole, R.J., Bashllari, E., and Hobert, O. (2009). Cis-regulatory mechanisms of left/right asymmetric neuron-subtype specification in C. elegans. Development. 136(1):147-60.

203

Etchberger, J.F., Lorch, A., Sleumer, M.C., Zapf, R., Jones, S.J., Marra, M.A., et al. (2007). The molecular signature and cis-regulatory architecture of a C. elegans gustatory neuron. Genes Dev. 21:1653-1674.

Favor, J., Sandulache, R., Neuhauser-Klaus, A., Pretsch, W., Chatterjee, B., Senft, E., et al. (1996). The mouse Pax2(1Neu) mutation is identical to a human PAX2 mutation in a family with renal-coloboma syndrome and results in developmental defects of the brain, ear, eye, and kidney. Proc Natl Acad Sci USA. 93(24):13870-5.

Fernandez, S.P., Cauli, B., Cabezas, C., Muzerelle, A., Poncer, J.C., and Gaspar, P. (2015). Multiscale single-cell analysis reveals unique phenotypes of raphe 5-HT neurons projecting to the forebrain. Brain Struct Funct.

Fishell, G., and Heintz, N. (2013). The neuron identity problem: form meets function. Neuron. 80:602-612.

Foguet, M., Hoyer, D., Pardo, L.A., Parekh, A., Kluxen, F.W., Kalkman, H.O., et al. (1992). Cloning and functional—characterization of the rat stomach fundus serotonin receptor. EMBO J. 11:3481–7.

Fox, S. R. and Deneris, E. S. ( 2012) Engrailed is required in maturing serotonin neurons to regulate the cytoarchitecture and survival of the dorsal raphe nucleus J. Neurosci. 32, 7832– 7842.

Francken, B.J., Jurzak, M., Vanhauwe, J.F., Luyten, W.H., and Leysen, J.E. (1998). The human 5-ht5A receptor couples to Gi/Go proteins and inhibits adenylate cyclase in HEK 293 cells. Eur J Pharmacol. 361(2-3):299-309.

Frank, C.L., Liu, F., Wijayatunge, R., Song, L., Biegler, M.T., and Yang, M.G., et al. (2015). Regulation of chromatin accessibility and Zic binding at enhancers in the developing cerebellum. Nat Neurosci. 18:647-656.

Frantz KJ, Hansson KJ, Stouffer DG, Parsons LH. (2002). 5-HT(6) receptor antagonism potentiates the behavioral and neurochemical effects of amphetamine but not cocaine. Neuropharmacology. 42(2):170-80.

Frassetto, A., Zhang, J., Lao, J.Z., White, A., Metzger, J.M., Fong, T.M., and Chen, R.Z. (2008). Reduced sensitivity to diet-induced obesity in mice carrying a mutant 5-HT6 receptor. Brain Res. 1236:140-4.

Fukushima, N., Kimura, Y., and Chun, J. (1998). A single receptor encoded by vzg-1/lpA1/edg-2 couples to G proteins and mediates multiple cellular

204

responses to lysophosphatidic acid. Proc Natl Acad Sci USA. 26;95(11):6151-6.

Fyodorov, D., Nelson, T., and Deneris, E. (1998) Pet-1, a novel ETS domain factor that can activate neuronal nAchR gene transcription. J Neurobiol. 34:151-163.

Gallager, D.W., and Aghajanian, G.K. (1976). Effect of antipsychotic drugs on the firing of dorsal raphe cells. I. Role of adrenergic system. Eur J Pharmacol. 39(2):341-55.

Gartside, S.E., Cole, A.J., Williams, A.P., McQuade, R., and Judge, S.J. (2007). AMPA and NMDA receptor regulation of firing activity in 5-HT neurons of the dorsal and median raphe nuclei. Eur J Neurosci. 25(10):3001-8.

Garcia-Garcia, A.L., Newman-Tancredi, A., and Leonardo, E.D. (2014). P5-HT1A receptors in mood and anxiety: recent insights into autoreceptor versus heteroreceptor function. Psychopharmacology. 231:623–636.

Gasser, P.J., Orchinik, M., Raju, I., and Lowry, C.A. ( 2009). Distribution of organic cation transporter 3, a corticosterone-sensitive monoamine transporter, in the rat brain. J. Comp. Neurol. 512, 529–555.

George, K.M., Leonard, M.W., Roth, M.E., Lieuw, K.H., Kioussis, D., Grosveld, F., and Engel, J.D. (1994) Embryonic expression and cloning of the murine GATA-3 gene. Development. 120(9):2673-86.

Gerald, C., Adham, N., Kao, H.T., Olsen, M.A., Laz, T.M., Schechter, L.E., et al. (1995). The 5-HT4 receptor: molecular cloning and pharmacological characterization of two splice variants. EMBO J. 14(12):2806-15.

Gershon, M.D., and Tack, J. (2007). The serotonin signaling system: from basic understanding to drug development for functional GI disorders. Gastroenterology. 132(1):397-414.

Geurts, F.J., De Schutter, E., and Timmermans, J.P. (2002). Localization of 5- HT2A, 5-HT3, 5-HT5A and 5-HT7 receptor-like immunoreactivity in the rat cerebellum. J Chem Neuroanat. 24(1):65-74.

Giorgetti, M., and Tecott, L.H. (2004). Contributions of 5-HT(2C) receptors to multiple actions of central serotonin systems. Eur J Pharmacol. 488(1- 3):1-9.

205

Glass, J.D., Grossman, G.H., Farnbauch, L., and DiNardo, L. (2003). Midbrain raphe modulation of nonphotic circadian clock resetting and 5-HT release in the mammalian suprachiasmatic nucleus. J Neurosci. 23(20):7451-60.

Glikmann-Johnston, Y., Saling, M.M., Reutens, D.C., and Stout, J.C. (2015). Hippocampal 5-HT1A Receptor and Spatial Learning and Memory. Front Pharmacol. 10;6:289.

Grailhe, R., Grabtree, G.W., and Hen, R. (2001). Human 5-HT5 receptors: the 5- HT5A receptor is functional but the 5-HT5B receptor was lost during mammalian evolution. Eur J Pharmacol. 418:157–67.

Grailhe, R., Waeber, C., Dulawa, S.C., Hornung, J.P., Zhuang, X., Brunner, D., et al. (1999). Increased exploratory activity and altered response to LSD in mice lacking the 5-HT(5A) receptor. Neuron. 22 (3): 581–591.

Green, N.H., Jackson, C.R., Iwamoto, H., Tackenberg, M.C., and McMahon, D.G. (2015). Photoperiod programs dorsal raphe serotonergic neurons and affective behaviors. Curr Biol. 25:1389-1394.

Greig, L.C., Woodworth, M.B., Galazo, M.J., Padmanabhan, H., and Macklis, J.D. (2013). Molecular logic of neocortical projection neuron specification, development and diversity. Nat Rev Neurosci. 14:755-769.

Gross, C., Santarelli, L., Brunner, D., Zhuang, X., and Hen, R. (2000). Altered fear circuits in 5-HT(1A) receptor KO mice. Biol Psychiatry. 48(12):1157- 63.

Gu, Q.Y, Zhang, J., Feng, Y.C., Dai, G.R., and Du, W.P. (2015). Association of genetic polymorphisms in HTR3A and HTR3E with diarrhea predominant irritable bowel syndrome. Int J Clin Exp Med. 8(3):4581-5.

Guest, P.C., Salim, K., Skynner, H.A., George, S.E., Bresnick, J.N., and McAllister, G. (2000). Identification and characterization of a truncated variant of the 5-hydroxytryptamine(2A) receptor produced by alternative splicing. Brain Res. 876(1-2):238-44.

Guillermin, M.L., Castelletto, M.L., and Hallem E.A. (2011). Differentiation of carbon dioxide-sensing neurons in Caenorhabditis elegans requires the ETS-5 transcription factor. Genetics. 189(4):1327-39.

Guscott, M.R., Egan, E., Cook, G.P., Stanton, J.A., Beer, M.S., Rosahl, T.W., et al. (2003). The hypothermic effect of 5-CT in mice is mediated through the 5-HT7 receptor. Neuropharmacology. 44(8):1031-7.

206

Gonzalez-Maeso, J., and Sealfon, S.C. (2009). Psychedelics and schizophrenia Trends in Neurosciences, 32:225.

Goodfellow, N.M., Bailey, C.D., and Lambe, E.K. (2012). The native serotonin 5- HT(5A) receptor: electrophysiological characterization in rodent cortex and 5-HT(1A)-mediated compensatory plasticity in the knock-out mouse. J Neurosci. 32(17):5804-9.

Hale MW, and Lowry CA. (2011). Functional topography of midbrain and pontine serotonergic systems: implications for synaptic regulation of serotonergic circuits. Psychopharmacology (Berl). 213(2-3):243-64.

Hamon, M., Doucet, E., Lefevre, K., Miquel, M.C., Lanfumey, L., Insausti, R., et al. (1999). Antibodies and antisense oligonucleotide for probing the distribution and putative functions of central 5-HT6 receptors. Neuropsychopharmacology. 21(2 Suppl):68S-76S.

Hannon, J., and Hoyer, D. Molecular biology of 5-HT receptors. (2008). Behav Brain Res. 195(1):198–213.

Harada, T., Kagamiyama, H., and Hatakeyama, K. (1993). Feedback regulation mechanisms for the control of GTP cyclohydrolase I activity. Science. 260, 1507–1510.

Harrison, S.M., Reavill, C., Brown, G., Brown, J.T., Cluderay, J.E., Crook, B., et al. (2003). LPA1 receptor-deficient mice have phenotypic changes observed in psychiatric disease. Mol. Cell. Neurosci. 24, 1170–1179.

Hasegawa E, Yanagisawa M, Sakurai T, and Mieda M. (2014). Orexin neurons suppress narcolepsy via 2 distinct efferent pathways. J Clin Invest. 124(2):604-16.

Hedlund, P.B. (2009). The 5-HT7 receptor and disorders of the nervous system: an overview. Psychopharmacology (Berl). 206(3):345-54.

Heidmann, D.E.A., Metcalf, M.A., Kohen, R., and Hamblin, M.W. (1997). Four 5- hydroxytryptamine (7) (5-HT7) receptor isoforms in human and rat produced by alternative splicing: species differeces due to altered intron- exon organization. J Neurochem. 68:1372-81.

Heidmann, D.E.A., Szot, P., Kohen, R., and Hamblin, M.W. (1998). Function and distribution of three rat 5-hydroxytryptamine(7) (5-HT7) receptor isoforms produced by alternative splicing. Neuropharmacology. 37:1621–32.

Heikinheimo, M., Lawshe, A., Shackleford, G.M., Wilson, D.B., and MacArthur, C.A. (1994). Fgf-8 expression in the post-gastrulation mouse suggests

207

roles in the development of the face, limbs and central nervous system. Mech Dev. 48(2):129-38.

Heisler, L.K., Chu, H.M., Brennan, T.J., Danao, J.A., Bajwa, P., Parsons, L.H., et al. (1998). Elevated anxiety and antidepressant-like responses in serotonin 5-HT1A receptor mutant mice. Proc Natl Acad Sci USA. 95:15049–54.

Hendricks, T., Francis, N., Fyodorov, D., and Deneris, E. ( 1999) The ETS Domain Factor Pet-1 is an Early and Precise Marker of Central 5-HT Neurons and Interacts with a Conserved Element in Serotonergic Genes J. Neurosci. 19, 10348–10356.

Hendricks, T. J., Fyodorov, D. V., Wegman, L. J., Lelutiu, N. B., Pehek, E. A., Yamamoto, B., et al. ( 2003). Pet-1 ETS gene plays a critical role in 5-HT neuron development and is required for normal anxiety-like and aggressive behavior Neuron. 37, 233–247.

Hennig, A.K., Peng, G.H., and Chen, S. (2008). Regulation of photoreceptor gene expression by Crx-associated transcription factor network. Brain Res. 1192:114-33.

Hensch, T.K. (2005). Critical period plasticity in local cortical circuits. Nat Rev Neurosci. 6:877-888.

Hirsch, M.R., Tiveron, M.C., Guillemot, F., Brunet, J.F. and Goridis, C. (1998). Control of noradrenergic differentiation and Phox2a expression by MASH1 in the central and peripheral nervous system. Development. 125, 599– 608.

Hobert, O. (2008). Regulatory logic of neuronal diversity: terminal selector genes and selector motifs. Proc Natl Acad Sci USA. 105:20067-20071.

Hobert, O., Carrera, I., and Stefanakis, N. (2010). The molecular and gene regulatory signature of a neuron. Trends Neurosci. 33, 435– 445.

Holbrook, J.D., Gill, C.H., Zebda, N., Spencer, J.P., Leyland, R., Rance, K.H., et al. 2009. Characterisation of 5-HT3C, 5-HT3D and 5-HT3E receptor subunits: evolution, distribution and function. J Neurochem. 108(2):384- 96.

Hollenhorst, P.C, McIntosh, L.P., and Graves, B.J. (2011). Genomic and biochemical insights into the specificity of ETS transcription factors. Annu Rev Biochem. 80:437-71.

208

Holmberg, J., and Perlmann, T. (2012). Maintaining differentiated cellular identity. Nat Rev Genet. 13:429-439.

Holmes, A., Murphy, D.L. and Crawley, J.N. (2003) Behavioral phenotypes of serotonin transporter knockout mice; parallels with human anxiety and depression. Biol Psych in press.

Hornung, J.P. (2003). The human raphe nuclei and the serotonergic system. J. Chem. Neuroanat. 26, 331–343.

Horton, R. E., Apple, D. M., Owens, W. A., Baganz, N. L., Cano, S., Mitchell, N. et al. ( 2013) Decynium-22 enhances SSRI-induced antidepressant-like effects in mice: uncovering novel targets to treat depression J. Neurosci. 33, 10534–10543.

Houtmeyers, R., Souopgui, J., Tejpar, S., and Arkell, R. (2013). The ZIC gene family encodes multi-functional proteins essential for patterning and morphogenesis. Cell Mol Life Sci. 70(20):3791-811

Hu, Y., Flockhart, I., Vinayagam, A., Bergwitz C., Berger B., Perrimon, N., and Mohr, S.E. (2011). An integrative approach to ortholog prediction for disease-focused and other functional studies. BMC Bioinformatics. 12:357.

Huang, Y.Y., Oquendo, M.A., Friedman, J.M., Greenhill, L.L., Brodsky, B., Malone, K.M., et al. (2003). Substance abuse disorder and major depression are associated with the human 5-HT1B receptor gene (HTR1B) G861C polymorphism Neuropsychopharmacology. 28(1):163-9.

Humphrey, P.P., Hartig, P., and Hoyer, D. (1993). A proposed new nomenclature for 5-HT receptors. Trends Pharmacol Sci. 14(6):233-6.

Hutcheson, J.D., Setola, V., Roth, B.L., and Merryman, W.D. (2011). Serotonin receptors and heart valve disease--it was meant 2B. Pharmacol Ther.132(2):146-57.

Hoyer, D. (1988). Molecular pharmacolology and biology of 5-Ht1c receptors. Trends Pharmacol Sci, 9: 89–94.

Hoyer, D., Hannon, JP, and Martin, GR. (2002). Molecular, pharmacological and functional diversity of 5-HT receptors. Pharmacol Biochem Behav.71 533– 554.

Hoyer, D., Waeber, C., Schoeffter, P., Palacios, J.M., and Dravid, A. (1989). 5- HT1C receptor-mediated stimulation of inositol phosphate production in

209

pig choroid plexus. A pharmacological characterization. Naunyn Schmiedebergs Arch Pharmacol. 339(3):252-8.

Hynes, M., Ye, W., Wang, K., Stone, D., Murone, M., Sauvage, Fd., and Rosenthal, A. (2000). The seven-transmembrane receptor smoothened cell-autonomously induces multiple ventral cell types. Nat Neurosci. 3(1):41-6.

Ishibashi, M, Gumenchuk, I, Kang B, Steger C, Lynn E, Molina NE, et al.(2015). Orexin Receptor Activation Generates Gamma Band Input to Cholinergic and Serotonergic Arousal System Neurons and Drives an Intrinsic Ca(2+)- Dependent Resonance in LDT and PPT Cholinergic Neurons. Front Neurol. 6:120.

Ishimura, K. Takeuchi, Y., Fujiwara, K., Tominaga, M., Yoshioka, H., and Sawada, T. (1988). Quantitative analysis of the distribution of serotonin- immunoreactive cell bodies in the mouse brain. Neurosci. Lett. 91, 265– 270.

Iyo, A.H., Porter, B., Deneris, E.S., Austin, M.C. (2005). Regional distribution and cellular localization of the ETS-domain transcription factor, FEV, mRNA in the human postmortem brain. Synapse. 57(4):223-8.

Jacob, J., Ferri, A.L., Milton, C., Prin, F., Pla, P., Lin W. et al. (2007). Transcriptional repression coordinates the temporal switch from motor to serotonergic neurogenesis. Nat Neuro. 10(11):1433-9.

Jacob, J., Kong, J., Moore, S., Milton, C., Sasai, N., Gonzalez-Quevedo, R., et al (2013). Retinoid acid specifies neuronal identity through graded expression of Ascl1. Curr Biol. 23:412–418.

Jacob, J., Storm, R., Castro, D.S., Milton, C., Pla, P., Guillemot, F., et al. (2009). Insm1 (IA-1) is an essential component of the regulatory network that specifies monoaminergic neuronal phenotypes in the vertebrate hindbrain. Development. 136(14):2477-85.

Jacobsen, K. X., Czesak, M., Deria, M., Le Francois, B., and Albert, P. R. (2011) Region-specific regulation of 5-HT1A receptor expression by Pet-1- dependent mechanisms in vivo J. Neurochem. 116, 1066-1076.

Jarrar, W., Dias, J.M., Ericson, J., Arnold, H.H., and Holz, A. (2015). Nkx2.2 and Nkx2.9 are the key regulators to determine cell fate of branchial and visceral motor neurons in caudal hindbrain. PLoS One. 10(4):e0124408.

210

Jarrar, W., Vauti, F., Arnold, H.H., and Holz, A. (2015). Generation of a Nkx2.2(Cre) knock-in mouse line: Analysis of cell lineages in the central nervous system. Differentiation. 89(3-4):1-7.

Jasper, J.R., Kosaka, A., To, Z.P., Chang, D.J., and Eglen, R.M. Cloning, expression and pharmacology of a truncated splice variant of the human 5-HT7 receptor (h5-HT7(b). Br J Pharmacol. 122:126–32.

Jawahar, M.C., Murgatroyd, C., Harrison, E.L., and Baune, B.T. (2015). Epigenetic alterations following early postnatal stress: a review on novel aetiological mechanisms of common psychiatric disorders. Clin Epigenetics. 14;7:122.

Jensen, A.A., Davies, P.A., Brauner-Osborne, H., and Krzywkowski, K. (2008). 3B but which 3B? And that’s just one of the questions: the heterogeneity of human 5-HT3 receptors. Trends Pharmacol Sci. Vol.29 No.9.

Jensen, P., Farago, A.F., Awatramani, R.B., Scott, M.M., Deneris, E.S., and Dymecki, S.M. (2008). Redefining the serotonergic system by genetic lineage. Nat Neurosci. 11(4):417-9.

Jochems, J., Teegarden, S.L., Chen, Y., Boulden, J., Challis, C., Ben-Dor, G.A., et al. (2015). Enhancement of stress resilience through histone deacetylase 6-mediated regulation of glucocorticoid receptor chaperone dynamics. Biol Psychiatry. 77:345-355.

Joyner, A.L., (1996). Engrailed, Wnt and Pax genes regulate midbrain-hindbrain development. Trends Genet. 12(1):15-20.

Joyner, A.L., Herrup, K., Auerbach, B.A., Davis, C.A., and Rossant, J. (1991). Subtle cerebellar phenotype in mice homozygous for a targeted deletion of the En-2 homeobox. Science. 251(4998):1239-43.

Joyner, A.L., Liu, A., and Millet, S., (2000). Otx2, Gbx2 and Fgf8 interact to position and maintain a mid-hindbrain organizer. Curr Opin Cell Biol. 12:736-41.

Jukkola, T., Lahti, L., Naserke, T., Wurst, W., and Partanen, J. (2006). FGF regulated gene-expression and neuronal differentiation in the developing midbrain-hindbrain region. Dev Biol. 297: 141–157.

Julius, D., MacDermott, A.B., Axel, R., and Jessell, T.M. (1988). Molecular characterization of a functional cDNA encoding the serotonin 1c receptor. Science. 241(4865):558-64.

211

Kadkhodaei, B., Alvarsson, A., Schintu, N., Ramskold, D., Volakakis, N., Joodmardi, E., et al. (2013). Transcription factor Nurr1 maintains fiber integrity and nuclear-encoded mitochondrial gene expression in dopamine neurons. Proc Natl Acad Sci USA. 110:2360-2365.

Kadkhodaei, B., Ito, T., Joodmardi, E., Mattsson, B., Rouillard, C., Carta, M., et al. (2009). Nurr1 is required for maintenance of maturing and adult midbrain dopamine neurons. J Neurosci. 29, 15923-15932.

Kapatos, G. ( 2013). The neurobiology of tetrahydrobiopterin biosynthesis: a model for regulation of GTP cyclohydrolase I gene transcription within nigrostriatal dopamine neurons. IUBMB Life. 65, 323–333.

Kapatos, G., Hirayama, K., Shimoji, M., and Milstien, S. ( 1999). GTP cyclohydrolase I feedback regulatory protein is expressed in serotonin neurons and regulates tetrahydrobiopterin biosynthesis. J. Neurochem. 72, 669–675.

Kapeller, J., Moller, D., Lasitschka, F., Autschbach, F., Hovius, R., Rappold, G., et al. (2011). Serotonin Receptor Diversity in the Human Colon: Expression of Serotonin Type 3 Receptor Subunits 5-HT3C, 5-HT3D, and 5-HT3E. J Comp Neurol. 519(3):420-32.

Karnovsky, A.M., Gotow, L.F., McKinley, D.D., Piechan, J.L., Ruble, C.L., Mills, C.J., et al. (2003). A cluster of novel serotonin receptor 3-like genes on human chromosome 3. Gene. 319:137–48.

Katahira, T., Sato, T., Sugiyama, S., Okafuji, T., Araki, I., Funahashi, J., and Nakamura, H. (2000). Interaction between Otx2 and Gbx2 defines the organizing center for the optic tectum. Mech Dev. 91(1-2):43-52.

Kennett, G.A., Dourish, C.T., and Curzon, G. (1987). "Antidepressant-like action of 5-HT1A agonists and conventional antidepressants in an animal model of depression". Eur. J. Pharmacol. 134 (3):265-274.

Kim, H.K., Kim, S.J., Lee, Y.J., Lee, H.J., Kang, S.G., Choi, J.E., et al. (2011). Influence of the interaction between the serotonin 1A receptor C-1019G polymorphism and negative life stressors on the development of depression. Neuropsychobiology. 64(1):1-8.

Kishi, T., Okochi, T., Tsunoka, T., Okumura, T., Kitajima, T., Kawashima, K., et al. (2011). Serotonin 1A receptor gene, schizophrenia and bipolar disorder: an association study and meta-analysis. Psychiatry Res. 185(1- 2):20-6.

212

Kittappa, R., Chang, W.W., Awatramani, R.B., and McKay, R.D. (2007). The foxa2 gene controls the birth and spontaneous degeneration of dopamine neurons in old age. PLoS Biol. 5(12):e325.

Kiyasova, V., Bonnavion, P., Scotto-Lomassese, S., Fabre, V., Sahly, I., Tronche, F., et al. (2013). A subpopulation of serotonergic neurons that do not express the 5-HT1A autoreceptor. ACS Chem Neurosci. 4(1):89-95.

Kiyasova, V., Fernandez, S. P., Laine, J., Stankovski, L., Muzerelle, A., Doly, S., and Gaspar, P. ( 2011). A Genetically Defined Morphologically and Functionally Unique Subset of 5-HT Neurons in the Mouse Raphe Nuclei. J. Neurosci. 31, 2756– 2768.

Klein, M.T., and Teitler, M. (2012). Distribution of 5-ht(1E) receptors in the mammalian brain and cerebral vasculature: an immunohistochemical and pharmacological study. Br J Pharmacol. 166(4):1290-302.

Krobert, K.A., and Levy, F.O. (2002). The human 5-HT7 serotonin receptor splice variants: constitutive activity and inverse agonist effects. Br J Pharmacol. 135(6):1563-71.

Krueger, K.C., and Deneris, E.S. (2008). Serotonergic transcription of human FEV reveals direct GATA factor interactions and fate of Pet-1-deficient serotonin neuron precursors. J Neurosci. 28(48):12748-58.

Kurrasch, D.M., Cheung, C.C., Lee, F.Y., Tran, P.V., Hata, K., and Ingraham, H.A. (2007). The neonatal ventromedial hypothalamus transcriptome reveals novel markers with spatially distinct patterning. J Neurosci. 27(50):13624-34.

Kursar, J.D., Nelson, D.L., Wainscott, D.B., and Baez, M. (1994). Molecular- cloning, functional expression, and messenger—RNA tissue distribution of the human 5-hydroxytryptamine(2b) receptor. Mol Pharmacol. 46:227–34.

Kursar, J.D., Nelson, D.L., Wainscott, D.B., Cohen, M.L., and Baez, M. (1992). Molecular-cloning, functional expression, and pharmacological characterization of a novel serotonin receptor (5-hydroxytryptamine2f) from rat stomach fundus. Mol Pharmacol. 42:549–57.

Laguna, A., Schintu, N., Nobre, A., Alvarsson, A., Volakakis, N., Jacobsen, J.K., et al (2015). Dopaminergic control of autophagic-lysosomal function implicates Lmx1b in Parkinson's disease. Nat Neurosci. 18:826-835.

213

Le Magueresse, C., and Monyer, H. (2013). GABAergic interneurons shape the functional maturation of the cortex. Neuron. 77:388-405.

Lemos J.C., Pan, Y.Z., Ma, X., Lamy, C., Akanwa, A.C., and Beck, S.G. (2006). Selective 5-HT receptor inhibition of glutamatergic and GABAergic synaptic activity in the rat dorsal and median raphe. Eur J Neurosci. 24:3415-3430.

Leonardo, E.D., and Hen, R. (2008). Anxiety as a developmental disorder. Neuropsychopharmacology. 33:134-140.

Leopoldo, M., Lacivita, E., Berardi, F., Perrone, R., and Hedlund, P.B.(2011). Serotonin 5-HT7 receptor agents: Structure-activity relationships and potential therapeutic applications in central nervous system disorders. Pharmacol Ther. 129(2):120-48.

Lerch-Haner, J.K. (2009). Pet-1/Fev transcriptional regulation of central and peripheral serotonergic traits and offspring survival. p151-154.

Lerch-Haner, J.K., Frierson, D., Crawford, L.K., Beck, S.G. and Deneris, E.S. (2008). Serotonergic transcriptional programming determines maternal behavior and offspring survival. Nat Neurosci. 11(9):1001-3.

Levine, E.S., and Jacobs, B.L. (1992). Neurochemical afferents controlling the activity of serotonergic neurons in the dorsal raphe nucleus: microiontophoretic studies in the awake cat. J Neurosci. 12(10):4037-44.

Levitt, P., Eagleson, K.L., and Powell, E.M. (2004). Regulation of neocortical interneuron development and the implications for neurodevelopmental disorders. Trends Neurosci. 27:400-406.

Li, H., and Durbin, R. (2009). Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 25:1754-1760.

Liang, K., and Keles, S. (2012). Normalization of ChIP-seq data with control. BMC bioinformatics. 13:199.

Li, J.Y.H., and Joyner, A.L. (2001). Otx2 and Gbx2 are required for refinement and not induction of midhindbrain gene expression. Development. 128, 4979-4991.

Li, S.B., Jones, J.R., and de Lecea, L. (2016). Hypocretins, Neural Systems, Physiology, and Psychiatric Disorders. Curr Psychiatry Rep. 18(1):7.

214

Lidov, H.G., and Molliver, M.E. (1982). An immunohistochemical study of serotonin neuron development in the rat: ascending pathways and terminal fields. Brain Res Bull. 8:389-430.

Lillesaar, C., Tannhauser, B., Stigloher, C., Kremmer, E., Bally-Cuif, L. (2007). The serotonergic phenotype is acquired by converging genetic mechanisms within the zebrafish central nervous system. Dev Dyn. 236(4):1072-84.

Lim, K.C., Lakshmanan, G., Crawford, S.E., Gu, Y., Grosveld, F., and Engel, J.D. (2000). Gata3 loss leads to embryonic lethality due to noradrenaline deficiency of the sympathetic nervous system. Nat Genet. 25(2):209-12.

Lima, F.B., Centeno, M.L., Costa, M.E., Reddy A.P., Cameron, J.L., and Bethea, C.L. (2009), Stress sensitive female macaques have decreased fifth Ewing variant (Fev) and serotonin-related gene expression that is not reversed by citalopram. Neuroscience. 164(2):676-91.

Lin, J.Y., Jiang, M.Y., Kan, Z.M., and Chu, Y. (2014). Influence of 5-HTR2A genetic polymorphisms on the efficacy of antidepressants in the treatment of major depressive disorder: a meta-analysis. J Affect Disord.168:430-8.

Lin, W., Metzakopian, E., Mavromatakis, Y.E., Gao, N., Balaskas, N., Sasaki, H., et al. (2009). Foxa1 and Foxa2 function both upstream of and cooperatively with Lmx1a and Lmx1b in a feedforward loop promoting mesodiencephalic dopaminergic neuron development. Dev Biol. 333(2):386-96.

Liu, A., and Joyner A.L. (2001). EN and GBX2 play essential roles downstream of FGF8 in patterning the mouse mid/hindbrain region. Development. 128(2):181-91.

Liu, C., Maejima, T., Wyler, S. C., Casadesus, G., Herlitze, S., and Deneris, E. S. (2010) Pet-1 is required across different stages of life to regulate serotonergic function. Nat. Neurosci 13, 1190–1198.

Liu, R.J., Lambe, E.K., and Aghajanian, G.K. (2005). Somatodendritic autoreceptor regulation of serotonergic neurons: dependence on L- tryptophan and tryptophan hydroxylase-activating kinases. Eur J Neurosci. 21:945-958.

Liu, R.J., van den Pol, A.N., and Aghajanian, G.K. (2002). Hypocretins (orexins) regulate serotonin neurons in the dorsal raphe nucleus by excitatory direct and inhibitory indirect actions. J Neurosci. 22(21):9453-64.

215

Llamosas, N., Bruzos-Cidon, C., Rodriguez, J.J., Ugedo, L., and Torrecilla, M. (2015). Deletion of GIRK2 Subunit of GIRK Channels Alters the 5-HT1A Receptor-Mediated Signaling and Results in a Depression-Resistant Behavior. Int J Neuropsychopharmacol. 18(11).

Loane, C., and Politis, M. (2012). Buspirone: what is it all about? Brain Res. 1461:111-8.

Lovenberg, T.W., Baron, B.M., Delecea, L., Miller, J.D., Prosser, R.A., Rea, M.A., et al. (1993). A novel adenylyl cyclase-activating serotonin receptor (5- Ht7) implicated in the regulation of mammalian circadian-rhythms. Neuron. 11:449–58.

Luscher, C., Jan, L.Y., Stoffel, M., Malenka, R.C., Nicoll, R.A. (1997). G protein- coupled inwardly rectifying K+ channels (GIRKs) mediate postsynaptic but not presynaptic transmitter actions in hippocampal neurons. Neuron. 19(3):687-95.

Ma, X., Maimaitirexiati, T., Zhang, R., Gui, X., Zhang, W., Xu, G., and Hu, G. (2014). HTR2C polymorphisms, olanzapine-induced weight gain and antipsychotic-induced metabolic syndrome in schizophrenia patients: a meta-analysis. Int J Psychiatry Clin Pract. 18(4):229-42.

Maden, M. (2006). Retinoids and spinal cord development. J Neurobiol. 66(7):726-38.

Maejima, T., Masseck, O.A., Mark, M.D., and Herlitze, S. (2013). Modulation of firing and synaptic transmission of serotonergic neurons by intrinsic G protein-coupled receptors and ion channels. Front Integr Neurosci. 7:40.

Maita, N., Hatakeyama, K., Okada, K., and Hakoshima, T. ( 2004). Structural basis of biopterin-induced inhibition of GTP cyclohydrolase I by GFRP, its feedback regulatory protein. J. Biol. Chem. 279, 51534–51540.

Marazziti, D., Baroni, S., Pirone, A., Giannaccini, G., Betti, L., Schmid, L., et al. (2012). Distribution of serotonin receptor of type 6 (5-HT ) in human brain post-mortem. A pharmacology, autoradiography and ₆ immunohistochemistry study. Neurochem Res. 37(5):920-7.

Marti, E., Takada, R., Bumcrot, D.A., Sasaki, H., and McMahon, A.P. (1995). Distribution of Sonic hedgehog peptides in the developing chick and mouse embryo. Development. 121(8):2537-47.

216

Martinez-Barbera, J.P., Signore, M., Boyl, P.P., Puelles, E., Acampora, D., Gogoi, R., et al. (2001). Regionalization of anterior neuroectoderm and its competence in responding to forebrain and midbrain inducing activities depend on mutual antagonism between OTX2 and GBX2. Development. 128(23):4789-800.

Matas-Rico, E., Garcia-Diaz, B., Llebrez-Zayas, P., Lopez-Barroso, D., Santin, L., Pedraza, C., et al.(2008). Deletion of lysophosphatidic acid receptor LPA1 reduces neurogenesis in the mouse dentate gyrus. Mol Cell Neurosci. 39(3):342-55.

Maurer, P., Rorive, S., de Kerchove d'Exaerde, A., Schiffmann, S.N., Salmon, I., de Launoit, Y. (2004). The Ets transcription factor Fev is specifically expressed in the human central serotonergic neurons. Neurosci Lett. 357:215–218.

Maurer, P., T'Sas, F., Coutte, L., Callens, N., Brenner, C., Van Lint, C., et al. (2003). FEV acts as a transcriptional repressor through its DNA-binding ETS domain and alanine-rich domain. Oncogene. 22:3319-3329.

Matise, M.P., Epstein, D.J., Park, H.L., Platt, K.A., and Joyner, A.L. (1998). Gli2 is required for induction of floor plate and adjacent cells, but not most ventral neurons in the mouse central nervous system. Development. 125(15):2759-70.

Mas, S., Pagerols, M., Gasso, P., Ortiz, A., Rodriguez, N., Morer, A., et al. (2014). Role of GAD2 and HTR1B genes in early-onset obsessive- compulsive disorder: results from transmission disequilibrium study. Genes, Brain and Behavior. 13: 409–417.

McMahon, A.P., and Bradley, A. (1990). The Wnt-1 (int-1) proto-oncogene is required for development of a large region of the mouse brain. Cell. 62(6):1073-85.

Meltzer, H. (2002). Mechanisms of action of atypical antipsychotic drugs. In: Neuropsychopharmacology the fifth generation of progress: an official publication of the American College of Neuropsychopharmacology. Lippincott Williams & Wilkins, Philadelphia.

Meredith, R.M., Dawitz, J., and Kramvis, I. (2012). Sensitive time-windows for susceptibility in neurodevelopmental disorders. Trends Neurosci. 35:335- 344.

217

Meyers, E.N., Lewandoski, M., and Martin, G.R. (1998). An Fgf8 mutant allelic series generated by Cre- and Flp-mediated recombination. Nat Genet. 18(2):136-41.

Mi. H, Muruganujan, A., Casagrande, J.T., Thomas, P.D. (2013). Large-scale gene function analysis with the PANTHER classification system. Nat Protoc. 8:1551-1566.

Mikoshiba, K. (1999). Mammalian neural induction and brain pattern formation. Keio J Med. 48(3):111-23.

Millen, K.J., Wurst, W., Herrup, K., and Joyner, A.L. (1994). Abnormal embryonic cerebellar development and patterning of postnatal foliation in two mouse Engrailed-2 mutants. Development. 120(3):695-706.

Millet, S., Campbell, K., Epstein, DJ., Losos, K., Harris, E. and Joyner, AL. (1999). A role for Gbx2 in repression of Otx2 and positioning the mid/hindbrain organizer. Nature 401, 161-164.

Miquel, M.C., Emerit, M.B., Nosjean, A., Simon, A., Rumajogee, P., Brisorgueil, M.J., et al. (2002). Differential subcellular localization of the 5-HT3-As receptor subunit in the rat central nervous system. Eur J Neurosci. 15(3):449-57.

Mitchell, E.S., McDevitt, R.A., and Neumaier, J.F. (2009). Adaptations in 5-HT receptor expression and function: implications for treatment of cognitive impairment in aging. J Neurosci Res. 87(12):2803-11.

Monsma, F.J. Jr., Shen, Y., Ward, R.P., Hamblin, M.W., and Sibley, D.R. (1993). Cloning and expression of a novel serotonin receptor with high affinity for tricyclic psychotropic drugs. Mol Pharmacol. 43(3):320-7.

Morabito, M.V., Abbas, A.I., Hood, J.L., Kesterson, R.A., Jacobs, M.M., Kump, D.S., et al. Mice with altered serotonin 2C receptor RNA editing display characteristics of Prader-Willi syndrome. (2010). Neurobiol Dis. 39(2):169- 80.

Morairty, S.R., Hedley, L., Flores, J., Martin, R., and Kilduff, T.S. (2008). Selective 5HT2A and 5HT6 receptor antagonists promote sleep in rats. Sleep. 31(1):34-44.

Murphy, D.L. and Lesch, K.P. ( 2008). Targeting the murine serotonin transporter: insights into human neurobiology. Nat. Rev. Neurosci. 9, 85– 96.

218

Muzerelle A, Scotto-Lomassese S, Bernard JF, Soiza-Reilly M, Gaspar P. (2014). Conditional anterograde tracing reveals distinct targeting of individual serotonin cell groups (B5-B9) to the forebrain and brainstem. Brain Struct Funct. [Epub ahead of print].

Nardelli, J., Thiesson, D., Fujiwara, Y., Tsai, F.Y., and Orkin, S.H. (1999). Expression and genetic interaction of transcription factors GATA-2 and GATA-3 during development of the mouse central nervous system. Dev Biol. 210(2):305-21.

Nebigil, C.G., Choi, D.S., Dierich, A., Hickel, P., Le Meur, M., Messaddeq, N., et al. (2000). Serotonin 2B receptor is required for heart development. Proc Natl Acad Sci USA. 97:9508–13.

Nebigil, C.G., Hickel, P., Messaddeq, N., Vonesch, J.L., Douchet, M.P., Monassier, L., et al. (2001). Ablation of serotonin 5-HT2B receptors in mice leads to abnormal cardiac structure and function. Circulation. 103:2973–9.

Nelson, D.L., Phebus, L.A., Johnson, K.W., Wainscott, D.B., Cohen, M.L., Calligaro, D.O., and Xu, Y.C. (2010). Preclinical pharmacological profile of the selective 5-HT1F receptor agonist lasmiditan. Cephalalgia. 30(10):1159-69.

Ni, J., Lu, W., Wu, Z., Chen, J., Yi, Z., and Zhang, C. (2013). T102C polymorphism of serotonin 2A type receptor gene confers susceptibility to (early onset) schizophrenia in Han Chinese: an association study and meta-analysis. Asia Pac Psychiatry. 5(1):24-30.

Nicholas, A.P. Pieribone, V.A., Elde, R., and Hokfelt T. (1991). Initial Observations on the Localization of mRNA for a and ,b Adrenergic Receptors in Brain and Peripheral Tissues of Rat Using in Situ Hybridization. Mol Cell Neurosci. 2, 344-350.

Niesler, B. (2011). 5-HT(3) receptors: potential of individual isoforms for personalised therapy. Curr Opin Pharmacol. 11(1):81-6.

Niesler, B., Frank, B., Kapeller, J., and Rappold, G.A. (2003) Cloning, physical mapping and expression analysis of the human 5-HT3 serotonin receptor- like genes HTR3C, HTR3D and HTR3E. Gene. 310:101–11.

Niesler, B., Kapeller, J., Hammer, C., and Rappold, G. (2008). Serotonin type 3 receptor genes: HTR3A, B, C, D, E. Pharmacogenomics. 9(5):501-4.

219

Niesler, B., Walstab, J., Combrink, S., Moller, D., Kapeller, J., Rietdorf, J., et al. (2007). Characterization of the novel human serotonin receptor subunits 5-HT3C, 5-HT3D, and 5-HT3E. Mol Pharmacol. 72:8–17.

Noam,Y., Wadman, W.J., and van Hooft,J.A. (2008). On the voltage- dependent Ca2+ block of serotonin 5-HT3 receptors: a critical role of intracellular phosphates. J. Physiol. 586, 3629–3638.

Ohta, Y, Kosaka Y, Kishimoto N, Wang J, Smith SB, Honig G, et al. (2011). Convergence of the insulin and serotonin programs in the pancreatic β- cell. Diabetes. 60(12):3208-16.

Oikawa, T., and Yamada, T. (2003). Molecular biology of the Ets family of transcription factors. Gene 303:11–34.

Okaty, B.W., Miller, M.N., Sugino, K., Hempel, C.M., and Nelson, S.B. (2009). Transcriptional and electrophysiological maturation of neocortical fast- spiking GABAergic interneurons. J. Neurosci. 29:7040-7052.

Oliver, K.R., Kinsey, A.M., Wainwright, A., and Sirinathsinghji, D.J.S. ( 2000). Localization of 5-HT5A receptor-like immunoreactivity in the rat brain.Brain Res 867, 131−142.

Olsen, M.A., Nawoschik, S.P., Schurman, B.R., Schmitt, H.L., Burno, M., Smith, D.L., and Schechter, L.E. (1999). Identification of a human 5-HT6 receptor variant produced by alternative splicing. Brain Res Mol Brain Res. 64(2):255-63.

O'Neil, R.T., and Emeson, R.B. (2012). Quantitative analysis of 5HT(2C) receptor RNA editing patterns in psychiatric disorders. Neurobiol Dis. 45(1):8-13.

Oosterwegel, M., Timmerman, J., Leiden, J., and Hans Clevers, H. (1992). Expression of GATA-3 During Lymphocyte Differentiation and Mouse Embryogenesis. Dev Immunol. 3(1): 1–11.

Orvis, G.D., Hartzell, A.L., Smith, J.B., Barraza, L.H., Wilson, S.L., Szulc, K.U., et al. (2012). The engrailed homeobox genes are required in multiple cell lineages to coordinate sequential formation of fissures and growth of the cerebellum. Dev Biol. 367(1):25-39.

Pandolfi, P.P., Roth, M.E., Karis, A., Leonard, M.W., Dzierzak, E., Grosveld, F.G., et al. (1995). Targeted disruption of the GATA3 gene causes severe abnormalities in the nervous system and in fetal liver haematopoiesis. Nat Genet. 11(1):40-4.

220

Panman, L, Papathanou, M, Laguna, A, Oosterveen, T, Volakakis, N, Acampora D, et al. (2014). Sox6 and Otx2 control the specification of substantia nigra and ventral tegmental area dopamine neurons. Cell Rep. 8(4):1018-25.

Parks, C.L., Robinson, P.S., Sibille, E., Shenk, T., and Toth, M. (1998). Increased anxiety of mice lacking the serotonin1A receptor. Proc Natl Acad Sci USA. 95:10734–10739.

Pasqualetti, M., Ori, M., Castagna, M., Marazziti, D., Cassano, G.B., and Nardi, I. (1999). Distribution and cellular localization of the serotonin type 2C receptor messenger RNA in human brain. Neuroscience. 92(2):601-11.

Pasqualetti, M., Ori, M., Nardi, I., Castagna, M., Cassano, G.B., and Marazziti, D. (1998). Distribution of the 5-HT5A serotonin receptor mRNA in the human brain. Mol Brain Res. 56:1–8.

Passie, T., Halpern, J.H., Stichtenoth, D.O., Emrich, H.M., Hintzen A. et al. (2008). The pharmacology of lysergic acid diethylamide: a review. CNS Neurosci Ther. 14(4):295-314.

Pattyn, A., Simplicio, N., Van Doorninck, J. H., Goridis, C., Guillemot, F., and Brunet, J. F. (2004). Ascl1/Mash1 is required for the development of central serotonergic neurons. Nat. Neurosci. 7, 589–595.

Pattyn, A., Vallstedt, A., Dias, J.M., Samad, O.A., Krumlauf, R., Rijli, F.M., et al (2003). Coordinated temporal and spatial control of motor neuron and serotonergic neuron generation from a common pool of CNS progenitors. Genes Dev. 17:729-737.

Pattyn, A., Vallstedt, A., Dias, J.M., Sander, M., and Ericson, J. (2003). Complementary roles for Nkx6 and Nkx2 class proteins in the establishment of motoneuron identity in the hindbrain. Development. 130(17):4149-59.

Pelosi, B., Migliarini, S., Pacini, G., Pratelli, M., and Pasqualetti, M. (2014). Generation of Pet1 210-Cre transgenic mouse line reveals non- serotonergic expression domains of Pet1 both in CNS and periphery. PLoS One. 9(8).

Peters, J.A., Cooper, M.A., Carland, J.E., Livesey, M.R., Hales, T.G., and Lambert, J.J. (2010). Novel structural determinants of single channel conductance and ion selectivity in 5-hydroxytryptamine type 3 and nicotinic acetylcholine receptors. J Physiol. 588(Pt 4):587-96.

221

Peyron, C., Tighe, D.K., van den Pol, A.N., de Lecea, L., Heller, H.C, Sutcliffe, J.G., and Kilduff, T.S. (1998). Neurons containing hypocretin (orexin) project to multiple neuronal systems. J Neurosci. 18(23):9996-10015.

Philippidou, P., and Dasen, J.S. (2013). Hox genes: choreographers in neural development, architects of circuit organization. Neuron. 80:12-34.

Piszczek, L., Piszczek, A., Kuczmanska, J, Audero, E., and Gross, C.T. (2015). Modulation of anxiety by cortical serotonin 1A receptors. Front Behav Neurosci. 9:48.

Piszczek, L., Schlax, K., Wyrzykowska, A., Piszczek, A., Audero, E., and Thilo Gross, C. (2013). Serotonin 1A auto-receptors are not sufficient to modulate anxiety in mice. Eur J Neurosci. 38(4):2621-7.

Pitychoutis, P.M., Belmer, A., Moutkine, I., Adrien, J., and Maroteaux, L. (2015). Mice Lacking the Serotonin Htr2B Receptor Gene Present an Antipsychotic-Sensitive Schizophrenic-Like Phenotype. Neuropsychopharmacology. 40(12):2764-73.

Pompeiano, M., Palacios, J.M., and Mengod, G. (1994). Distribution of the serotonin 5-HT2 receptor family mRNAs: comparison between 5-HT2A and 5-HT2C receptors. Brain Res Mol Brain Res. 23(1-2):163-78.

Portas, C.M., Bjorvatn, B., and Ursin, R. (2000). Serotonin and the sleep/wake cycle: special emphasis on microdialysis studies. Prog Neurobiol. 60(1):13-35.

Price, M., Lazzaro, D., Pohl, T., Mattei, M.G., Ruther, U., Olivo, J.C., et al. (1992). Regional expression of the homeobox gene Nkx-2.2 in the developing mammalian forebrain. Neuron. 8(2):241-55.

Pristera, A., Lin, W., Kaufmann, A.K., Brimblecombe, K.R., Threlfell, S., Dodson, P.D., et al. (2015). Transcription factors FOXA1 and FOXA2 maintain dopaminergic neuronal properties and control feeding behavior in adult mice. Proc Natl Acad Sci USA. 112(35):E4929-38.

Ramboz, S., Oosting, R., Amara, D.A., Kung, H.F., Blier, P., Mendelsohn, M. et al. (1998). Serotonin receptor 1A knockout: an animal model of anxiety- related disorder. Proc Natl Acad Sci USA. 95: 14476–14481

Rayen, I., van den Hove, D.L., Prickaerts, J., Steinbusch, H.W., and Pawluski, J.L. Fluoxetine during development reverses the effects of prenatal stress on depressive- like behavior and hippocampal neurogenesis in adolescence. PLoS One .6(9):e24003.

222

Rebello, T.J., Yu, Q., Goodfellow, N.M., Caffrey Cagliostro, M.K., Teissier, A., Morelli, E., et al. (2014). Postnatal day 2 to 11 constitutes a 5-HT-sensitive period impacting adult mPFC function. J. Neurosci. 34:12379-12393.

Rekaik, H., Blaudin de The, F.X., prochiantz, A., Fuchs, J., and Joshi, R.L. (2015). Dissecting the role of Engrailed in adult dopaminergic neurons - Insights into Parkinson disease pathogenesis. FEBS Lett. 589(24 Pt A):3786-94.

Reuter, U., Israel, H., and Neeb, L. (2015). The pharmacological profile and clinical prospects of the oral 5-HT1F receptor agonist lasmiditan in the acute treatment of migraine. Ther Adv Neurol Disord. 8(1):46-54.

Rex, A., Voigt JP, Wicke, K.M., and Fink, H. (2008). In vivo/ex vivo and behavioural study on central effects of 5-HT1B/1D and 5-HT1A antagonists in guinea pigs. Pharmacol Biochem Behav. 88(3):196-204.

Rhead, B., Karolchik, D., Kuhn, R.M, Hinrichs, A.S., Zweig, A.S., Fujita, P.A., et al. (2010) The UCSC Genome Browser database: update 2010. Nucleic Acids Res. 38 D613-9.

Riad, M., Garcia, S., Watkins, K.C., Jodoin, N., Doucet, E., et al. (2000). Somatodendritic localization of 5-HT1A and preterminal axonal localization of 5-HT1B serotonin receptors in adult rat brain. J Comp Neurol. 417: 181- 94.

Richardson-Jones, J.W., Craige, C.P., Guiard, B.P., Stephen, A., Metzger, K.L., Kung, H.F., et al. (2010). 5-HT1A autoreceptor levels determine vulnerability to stress and response to antidepressants. Neuron. 65(1):40- 52.

Richardson-Jones, J.W., Craige, C.P., Nguyen, T.H., Kung, H.F., Gardier, A.M., Dranovsky, A., et al. (2011). Serotonin-1A autoreceptors are necessary and sufficient for the normal formation of circuits underlying innate anxiety. J Neurosci. 31(16):6008-18.

Richtand, N.M., Welge, J.A., Logue, A.D., Keck, P.E., Jr, Strakowski, S.M., and McNamara, R.K. (2008). Role of serotonin and dopamine receptor binding in antipsychotic efficacy. Prog Brain Res. 172:155-75.

Roberts, A.J., and Hedlund, P.B. (2012). The 5-HT(7) receptor in learning and memory. Hippocampus. 22(4):762-71.

Rood, B.D., Calizo, L.H., Piel, D., Spangler, Z.P., Campbell, K., and Beck, S.G. (2014). Dorsal raphe serotonin neurons in mice: immature hyperexcitability transitions to adult state during first three postnatal weeks

223

suggesting sensitive period for environmental perturbation. J. Neurosci. 34:4809-4821.

Roth, B.L., Berry, S.A., Kroeze, W.K., Willins, D.L., Kristiansen, K. (1998). Serotonin 5-HT2A receptors: molecular biology and mechanisms of regulation. Crit Rev Neurobiol. 12(4):319-38.

Rothman, R.B., and Baumann, M.H. (2009). Serotonergic drugs and valvular heart disease. Expert Opin Drug Saf. 8(3):317-29.

Rowitch, D.H., and McMahon, A.P. (1995). Pax-2 expression in the murine neural plate precedes and encompasses the expression domains of Wnt-1 and En-1. Mech Dev. 52(1):3-8.

Ruat, M., Traiffort, E., Leurs, R., Tardivel-Lacombe, J., Diaz, J., Arrang, J.M., Schwartz, J.C. (1993). Molecular cloning, characterization, and localization of a high-affinity serotonin receptor (5-HT7) activating cAMP formation. Proc Nat Acad Sci USA. 90:8547– 51.

Sakurai, Y., Kurokawa, D., Kiyonari, H., Kajikawa, E., Suda, Y., and Aizawa, S. (2010). Otx2 and Otx1 protect diencephalon and mesencephalon from caudalization into metencephalon during early brain regionalization. Dev Biol.347(2):392-403.

Sato, T., and Joyner, A.L. (2009). The duration of Fgf8 isthmic organizer expression is key to patterning different tectal-isthmo-cerebellum structures. Development. 136(21):3617-26.

Sari, Y. (2004). Serotonin1B receptors: from protein to physiological function and behavior. Neuroscience and biobehavioral reviews. 28: 565-82.

Saudou, F., Amara, D.A., Dierich, A., Lemeur, M., Ramboz, S., Segu, L., et al. (1994). Enhanced aggressive-behavior in mice lacking 5-Ht1b receptor. Science 265:1875-8.

Scheinin, M. Lomasney J.W. Hayden-Hixson, D.M. Schambra, U.B. Caron, M.G. Lefkowitz, R.J. and Fremeau, R.T. (1994). Distribution of a2-adrenergic receptor subtype gene expression in rat brain. Molecular Brain Research. 21 133-149.

Schmidt, C., and Hollmann, M. (2008). Apparent homomeric NR1 currents observed in Xenopus oocytes are caused by an endogenous NR2 subunit. J Mol

Schwarz, M., Alvarez-Bolado, G., Urbanek, P., Busslinger, M., and Gruss, P. (1997). Conserved biological function between Pax-2 and Pax-5 in

224

midbrain and cerebellum development: evidence from targeted mutations. Proc. Natl. Acad. Sci. USA. Vol. 94, pp. 14518–14523.

Scott, M.M., Krueger, K. C., and Deneris, E. S. (2005). A differentially autoregulated Pet-1 enhancer region is a critical target of the transcriptional cascade that governs serotonin neuron development. J. Neurosci. 25, 2628–2636.

Scott, M.M., Marcus, J.N., Pettersen, A., Birnbaum, S.G., Mochizuki, T., Scammell, T.E., et al. (2011). Hcrtr1 and 2 signaling differentially regulates depression-like behaviors. Behav Brain Res. 222(2):289-94.

Serrano-Saiz, E., Poole, R. J., Felton, T., Zhang, F., De La Cruz, E. D., and Hobert, O. (2013). Modular control of glutamatergic neuronal identity in C. elegans by distinct homeodomain proteins. Cell. 155, 659-673.

Sheng, X., Yung, Y.C., Chen, A., and Chun, J. (2015). Lysophosphatidic acid signalling in development. Development. 142(8):1390-5.

Shirasaki, R., and Pfaff, S.L. (2002). Transcriptional codes and the control of neuronal identity. Annu Rev Neurosci. 25:251-281.

Shleper, M., Kartvelishvily, E., and Wolosker, H. (2005). D-serine is the dominant endogenous coagonist for NMDA receptor neurotoxicity in organotypic hippocampal slices. J Neurosci. 25(41):9413-7.

Simon, H.H., Scholz, C., and O'Leary, D.D. (2005). Engrailed genes control developmental fate of serotonergic and noradrenergic neurons in mid- and hindbrain in a gene dose-dependent manner. Mol Cell Neurosci. 28(1):96- 105.

Smidt, M.P., and Burbach, J.P. (2007). How to make a mesodiencephalic dopaminergic neuron. Nat Rev Neurosci. 8:21-32.

Smith, R.M., Papp, A.C., Webb, A., Ruble, C.L., Munsie, L.M., Nisenbaum, L.K., et al. (2013). Multiple regulatory variants modulate expression of 5- hydroxytryptamine 2A receptors in human cortex. Biol Psychiatry. 73(6):546-54.

Soiza-Reilly, M., and Commons, K.G. (2011). Glutamatergic drive of the dorsal raphe nucleus. J Chem Neuroanat. 41(4):247-55.

Song, D.L., Chalepakis, G., Gruss, P., and Joyner, A.L. (1996). Two Pax-binding sites are required for early embryonic brain expression of an Engrailed-2 transgene. Development.122(2):627-35.

225

Song, N.N., Xiu, J.B., Huang, Y., Chen, J.Y., Zhang, L., Gutknecht, L., et al. (2011). Adult raphe-specific deletion of lmx1b leads to central serotonin deficiency. PLoS ONE 6(1).

Spaethling, J.M., Piel, D., Dueck, H., Buckley, P.T., Morris, J.F., Fisher, S.A., et al. (2014). Serotonergic neuron regulation informed by in vivo single-cell transcriptomics. FASEB J. 28(2):771-80.

Stott, S.R., Metzakopian, E., Lin, W., Kaestner, K.H., Hen, R., and Ang, S.L. (2013). Foxa1 and foxa2 are required for the maintenance of dopaminergic properties in ventral midbrain neurons at late embryonic stages. Neurosci. 33(18):8022-34.

Sujitha, S.P., Nair, A., Banerjee, M., Lakshmanan, S., Harshavaradhan, S., Gunasekaran, S., and Gopinathan, A. (2014). 5-Hydroxytryptamine (serotonin) 2A receptor gene polymorphism is associated with schizophrenia. Indian J Med Res. 140(6):736-43.

Sundstrom, E., Kolare, S., Souverbic, F., Samuelsson, E.B., Pschera, H., Lunell, N.O., et al. (1993). Neurochemical differentiation of human bulbospinal monoaminergic neurons during the first trimester. Dev Brain Res. 75(1):1- 12.

Sunmonu, N.A., Li, K., Guo, Q., and Li, J.Y.H. (2011). Gbx2 and Fgf8 are sequentially required for formation of the midbrain-hindbrain compartment boundary. Development. 138:725-34.

Swaroop, A., Kim, D. and Forrest, D. (2010). Transcriptional regulation of photoreceptor development and homeostasis in the mammalian retina. Nat Rev Neurosci. (8):563-76.

Tallafuss, A., Kelly, M., Gay, L., Gibson, D., Batzel, P., Karfilis, K.V., et al., (2015). Transcriptomes of post-mitotic neurons identify the usage of alternative pathways during adult and embryonic neuronal differentiation. BMC Genomics. 16(1):1100.

Tanaka, K.F., Samuels, B.A., and Hen, R. (2012). Serotonin receptor expression along the dorsal-ventral axis of mouse hippocampus. Philos Trans R Soc Lond B Biol Sci. 367(1601):2395-401.

Tebbenkamp, A.T., Willsey, A.J., State, M.W., and Sestan, N. (2014). The developmental transcriptome of the human brain: implications for neurodevelopmental disorders. Curr Opin Neurol. 27:149-156.

226

Tecott, L.H., Sun, L.M., Akana, S.F., Strack, A.M., Lowenstein D.H., Dallman, M.F., et al. (1995). Eating disorder and epilepsy in mice lacking 5-Ht2c serotonin receptors. Nature. 374:542–6.

Templin, J.S., Bang, S.J., Soiza-Reilly, M., Berde, C.B., and Commons, K.G. (2012). Patterned expression of ion channel genes in mouse dorsal raphe nucleus determined with the Allen Mouse Brain Atlas. Brain Res. 1457:1- 12.

Thomas, D.R., Larminie, C.G., Lyons, H.R., Fosberry, A., Hill, M.J., and Hayes, P.D. (2004). Cloning and pharmacological characterisation of the guinea pig 5-ht5A receptor. Eur J Pharmacol. 494, 91−99.

Thomas, K.R., and Capecchi, M.R. (1990). Targeted disruption of the murine int- 1 proto-oncogene resulting in severe abnormalities in midbrain and cerebellar development. Nature. 346(6287):847-50.

Thomsen, W.J., Grottick, A.J., Menzaghi, F., Reyes-Saldana, H., Espitia, S., Yuskin, D., et al. (2008). Lorcaserin, a novel selective human 5- hydroxytryptamine 2C agonist: in vitro and in vivo pharmacological characterization. J Pharmacol Exp Ther. 325(2):577-87.

Thony, B. and Blau, N. (2006). Mutations in the BH4-metabolizing genes GTP cyclohydrolase I, 6-pyruvoyl-tetrahydropterin synthase, sepiapterin reductase, carbinolamine-4a-dehydratase, and dihydropteridine reductase. Hum. Mutat. 27, 870–878.

Tietz, A., Lindberg, M., and Kennedy, E.P. (1964). A New Pteridine-Requiring Enzyme System for the Oxidation of Glyceryl Ethers. J. Biol. Chem. 239, 4081– 4090.

Tokumura, A., Yotsumoto, T., Masuda, Y., and Tanaka, S. (1995). Vasopressor effect of lysophosphatidic acid on spontaneously hypertensive rats and Wistar Kyoto rats. Res Commun Mol Pathol Pharmacol. 90(1):96-102.

Tootle, T.L., and Rebay, I. (2005). Post-translational modifcations influence transcription facto activity: a view from the ETS superfamily. Bioessays. 27(3):285-98.

Torres, M., Gomez-Pardo, E., and Gruss, P. (1996). Pax2 contributes to inner ear patterning and optic nerve trajectory. Development. 122(11):3381-91.

Traynelis SF, Wollmuth LP, McBain CJ, Menniti FS, Vance KM, Ogden KK, et al. (2010). Glutamate receptor ion channels: structure, regulation, and function. Pharmacol Rev. 62(3):405-96.

227

Tsai, F.Y., Keller, G., Kuo, F.C., Weiss, M., Chen, J., Rosenblatt, M., et al. (1994). An early haematopoietic defect in mice lacking the transcription factor GATA-2. Nature. 371(6494):221-6.

Tsujino, N. and Sakurai, T. (2013). Role of orexin in modulating arousal, feeding, and motivation. Front Behav Neurosci. 7:28

Tumpel, S., Wiedemann, L.M., and Krumlauf, R. (2009). Hox genes and segmentation of the vertebrate hindbrain. Curr Top Dev Biol. 88:103-37. van Doorninck, J.H., van Der Wees, J., Karis, A., Goedknegt, E., Engel, J.D., Coesmans, M., et al. (1999). GATA-3 is involved in the development of serotonergic neurons in the caudal raphe nuclei. J Neurosci. 19(12):RC12.

Vandermaelen, C.P., and Aghajanian, G.K. (1983). Electrophysiological and pharmacological characterization of serotonergic dorsal raphe neurons recorded extracellularly and intracellularly in rat brain slices. Brain Res. 289:109-119.

Vanhoenacker, P., Haegeman, G., and Leysen, J.E. (2000). 5-HT7 receptors: current knowledge and future prospects. Trends Pharmacol Sci. 21(2):70– 77.

Vialou, V., Balasse, L., Callebert, J., Launay, J. M., Giros, B., and Gautron, S. (2008). Altered aminergic neurotransmission in the brain of organic cation transporter 3-deficient mice J. Neurochem. 106, 1471–1482.

Vilaro, M.T., Domenech, T., Palacios, J.M., and Mengod, G. (2002). Cloning and characterization of a novel human 5-HT4 receptor variant that lacks the alternatively spliced carboxy terminal exon. RT-PCR distribution in human brain and periphery of multiple 5-HT4 receptor variants. Neuropharmacology. 42(1):60-73.

Voigt, M.M., Laurie, D.J., Seeburg, P.H., and Bach, A. (1991). Molecular cloning and characterization of a rat brain cDNA encoding a 5-hydroxytryptamine 1B receptor. The EMBO journal 10: 4017-23.

Voigt, J.P., and Fink, H., (2015). Serotonin controlling feeding and satiety. Behav Brain Res. 15;277:14-31.

Vokes, S.A., Ji, H., McCuine, S., Tenzen, T., Giles, S., Zhong, S., et al (2007). Genomic characterization of Gli-activator targets in sonic hedgehog- mediated neural patterning. Development. 134(10):1977-89.

228

Voronova, A., Fischer, A., Ryan, T., Al Madhoun, A., and Skerjanc, I.S. (2011). Ascl1/Mash1 is a novel target of Gli2 during Gli2-induced neurogenesis in P19 EC cells. PLoS One. 6(4):e19174.

Walstab, J., Rappold, G., and Niesler, B. (2010). 5-HT3 receptors: Role in disease and target of drugs. Pharmacology & Therapeutics. 128 146–169.

Wang, L., Liu, T., Xu, L., Gao, Y., Wei, Y., Duan, C., et al. (2013). Fev regulates hematopoietic stem cell development via ERK signaling. Blood. 122:367- 375.

Wang, Q.P., Koyama, Y., Guan, J.L., Takahashi, K., Kayama, Y., and Shioda, S. (2005). The orexinergic synaptic innervation of serotonin- and orexin 1- receptor-containing neurons in the dorsal raphe nucleus. Regul Pept. 126(1-2):35-42.

Wang, Y.C., Zuraek, M.B., Kosaka, Y., Ota, Y., German, M.S., Deneris, E.S., et al. (2010). The ETS oncogene family transcription factor FEV identifies serotonin-producing cells in normal and neoplastic small intestine. Endocr Relat Cancer. 17(1):283-91.

Wassarman, K.M., Lewandoski, M., Campbell, K., Joyner, A.L., Rubenstein, J.L., Martinez, S. and Martin, G.R. (1997). Specification of the anterior hindbrain and establishment of a normal mid/hindbrain organizer is dependent on Gbx2 gene function. Development. 124, 2923-2924.

Watschinger, K., Keller, M.A., Golderer, G., Hermann, M., Maglione, M., Sarg, B., et al. (2010) Identification of the gene encoding alkylglycerol monooxygenase defines a third class of tetrahydrobiopterin-dependent enzymes. Proc. Natl. Acad. Sci. USA. 107, 13672–13677.

Weber, T., Vogt, M.A., Gartside, S.E., Berger, S.M., Lujan, R., and Lau, T., et al. (2015). Adult AMPA GLUA1 receptor subunit loss in 5-HT neurons results in a specific anxiety-phenotype with evidence for dysregulation of 5-HT neuronal activity. Neuropsychopharmacology. 40(6):1471-84.

Wei, G.H., Badis, G., Berger, M.F., Kivioja, T., Palin, K., Enge, M., et al. (2010) Genome-wide analysis of ETS-family DNA-binding in vitro and in vivo. EMBO J 29:2147-2160.

Weisstaub, N.V., Zhou, M., Lira, A., Lambe, E., Gonzalez-Maeso, J., Hornung, J.P., et al. (2006). Cortical 5-HT2A receptor signaling modulates anxiety- like behaviors in mice. Science. 313(5786):536-40.

229

Wenick, A.S. and Hobert, O. (2004) Genomic cis-regulatory architecture and trans-acting regulators of a single interneuron-specific gene battery in C. elegans. Dev. Cell. 6, 757–770.

Werner, E.R., Blau, N., and Thony, B. (2011). Tetrahydrobiopterin: biochemistry and pathophysiology Biochem. J. 438, 397– 414.

Wilkinson, D.G., Bailes, J.A., McMahon, A.P. (1987). Expression of the proto- oncogene int-1 is restricted to specific neural cells in the developing mouse embryo. Cell. 50(1):79-88.

Wurst, W., Auerbach, A.B., and Joyner, A.L. (1994). Multiple developmental defects in Engrailed-1 mutant mice: an early mid-hindbrain deletion and patterning defects in forelimbs and sternum. Development. 120(7):2065- 75.

Wurst, W., and Bally-Cuif, L. (2001). Neural plate patterning: upstream and downstream of the isthmic organizer. Nat Rev Neurosci. 2(2):99-108.

Wyler, S.C., Donovan. L.J., Yeager, M., and Deneris, E. (2015). Pet-1 Controls Tetrahydrobiopterin Pathway and Slc22a3 Transporter Genes in Serotonin Neurons. ACS Chem Neurosci. 15;6(7):1198-205.

Wylie, C. J., Hendricks, T. J., Zhang, B., Wang, L., Lu, P., Leahy, P., et al. (2010) Distinct transcriptomes define rostral and caudal serotonin neurons J. Neurosci. 30, 670– 684.

Yamazaki, M., Okabe, M., Yamamoto, N., Yarimizu, J., and Harada, K. (2015). Novel 5-HT5A receptor antagonists ameliorate scopolamine-induced working memory deficit in mice and reference memory impairment in aged rats. J Pharmacol Sci. 127(3):362-9.

Yan, R., Huang, T., Xie, Z., Xia, G., Qian, H., Zhao, X., and Cheng, L. (2013). Lmx1b controls peptide phenotypes in serotonergic and dopaminergic neurons. Acta Biochim Biophys Sin (Shanghai). 45(5):345-52.

Ye, W., Bouchard, M., Stone, D., Liu, X., Vella, F., Lee, J., et al. (2001). Distinct regulators control the expression of the mid-hindbrain organizer signal FGF8. Nat. Neurosci. 4, 1175-1181.

Ye, W., Shimamura, K., Rubenstein, J.L., Hynes, M.A., and Rosenthal, A. (1998). FGF and Shh signals control dopaminergic and serotonergic cell fate in the anterior neural plate. Cell. 93(5):755-66.

230

Yildiz, S.H., Akilli, A., Bagcioglu, E., Ozdemir Erdogan, M., Coskun, K.S., Alpaslan, A.H., et al. (2013). Association of schizophrenia with T102C (rs6313) and 1438 A/G (rs6311) polymorphisms of HTR2A gene. Acta Neuropsychiatr. 25(6):342-8.

Yoneyama, T. and Hatakeyama, K. (1998). Decameric GTP cyclohydrolase I forms complexes with two pentameric GTP cyclohydrolase I feedback regulatory proteins in the presence of phenylalanine or of a combination of tetrahydrobiopterin and GTP. J. Biol. Chem. 273, 20102– 20108.

Yordy, J.S., Muise-Helmericks, R.C. (2000). Signal transduction and the Ets family of transcription factors. Oncogene. 19(55):6503-13.

Yosifova, A., Mushiroda, T., Stoianov, D., Vazharova, R., Dimova, I., Karachanak, S., et al. (2009). Case-control association study of 65 candidate genes revealed a possible association of a SNP of HTR5A to be a factor susceptible to bipolar disease in Bulgarian population. J Affect Disord. 117(1-2):87-97.

Yung, Y.C., Stoddard, N.C., Mirendil, H., and Chun, J. (2015). Lysophosphatidic Acid Signaling in the Nervous System. Neuron. 85:669-682.

Zhang, B., Kirov, S., and Snoddy, J. (2005). WebGestalt: an integrated system for exploring gene sets in various biological contexts. Nucleic Acids Res. 33:W741-748.

Zheng, M., Zhu, W., Han, Q., and Xiao, R.P. (2005). Emerging concepts and therapeutic implications of beta-adrenergic receptor subtype signaling. Pharmacol Ther. 108(3):257-68.

Zhang, Y., Liu, T., Meyer, C.A., Eeckhoute, J., Johnson, D.S., Bernstein, B.E., et al. (2008). Model-based analysis of ChIP-Seq (MACS). Genome Biol. 9:R137.

Zhao, X., Sun, L., Sun, Y.H., Ren, C., Chen, J., Wu, Z.Q., et al. (2014). Association of HTR2A T102C and A-1438G polymorphisms with susceptibility to major depressive disorder: a meta-analysis. Neurol Sci. 35(12):1857-66.

Zhao, Z.Q., Scott, M., Chiechio, S., Wang, J.S., Renner, K.J., Gereau, R.W. 4th, et. al. (2006). Lmx1b is required for maintenance of central serotonergic neurons and mice lacking central serotonergic system exhibit normal locomotor activity. J Neurosci. 26(49):12781-8.

231

Zhuang, X., Gross, C., Santarelli, L., Compan, V., Trillat, A.C., and Hen, R. (1999). Altered emotional states in knockout mice lacking 5-HT1A or 5- HT1B receptors. Neuropsychopharmacology. 21(2 Suppl):52S-60S.

Zong, H., Espinosa, J.S., Su, H.H., Muzumdar, M.D., and Luo, L. (2005). Mosaic analysis with double markers in mice. Cell. 121(3):479-92.

232