Impairment of Iron Homeostasis and Lipid Metabolism in Hemojuvelin

Impairment of iron homeostasis and lipid metabolism in Hemojuvelin

knockout (Hjv-/-) mice in response to high fat diet

Ranjit Singh Padda

Department of Microbiology and Immunology

Faculty of Medicine

McGill University

Montreal, Quebec, Canada

June 2013

A thesis submitted to the Faculty of Graduate Studies and Research in partial fulfillment of the requirements for the degree of Master of science

Contents

Abstract 3-4 Acknowledgement 5 Introduction 6-7 Review of Literature 1. Body Iron metabolism 8 1.1.Dietary iron Absorption 8 1.2. Iron delivery and utilization 8 1.3. Iron Recycling 9 2. Systemic Iron Homeostasis 9 2.1.Iron Deficiency 10 2.2.Iron overload 10 2.2.1. Role of Hemochromatosis protein (HFE) 10 2.2.2. Role of Hemojuvelin (HJV) 11 2.2.3. Role of Transferrin receptor 2 (TfR2) 12 2.3.Consequences of liver iron overload 12-13 2.3.1. Development of NAFLD/NASH 13 2.3.2. Development of Fibrosis, Cirrhosis and Hepatocellular carcinoma (HCC) 13 2.3.2.1.Mice models for iron induced liver injury 14 2.3.3. Development of alterations in lipid metabolism 15

Hypothesis and objectives 16 Materials and methods 17-19 Results and Discussion 20-24 Conclusion 25-26 FIGURE LEGENDS 27-45 REFERENCES 46-51 ABREVATIONS 52-53

Abstract

Hemojuvelin (HJV) is a membrane protein that controls the body iron metabolism. HJV mutations lead to juvenile hemochromatosis (JH), which arises from uncontrolled absorption of dietary iron from intestine and deposition of the metal into liver parenchymal cells. Hepatic iron overload progressively leads to inflammation, fibrosis or hepatocellular carcinoma. The molecular mechanisms responsible for iron induced liver injury are not fully characterized. Here, we investigated the potential contribution of hemojuvelin ablation to hepatic iron, lipid metabolism and its role in the pathogenesis of liver fibrosis. Wild-type (WT) and Hemojuvelin knockout mice (Hjv-/-) on C57BL/6J background were fed either a standard chow, a high fat, or a high-fat with 2% supplemented iron diet (HFD + Fe) for a time course experiment (0, 3, 6, 9,

12 weeks). Comparatively, Hjv-/- animals developed higher serum iron indices, liver iron deposition, and diminished hepcidin levels. Likewise, dramatic changes were observed between levels of iron uptake protein TfR1 and iron storage protein ferritin. Interestingly, HFD + Fe group showed significant reduction in body weight irrespective of genotype. Further, qPCR data revealed significant downregulation of Adiponectin receptor 2 (AdipoR2) in this group, in addition to upregulation of cholesterol biosynthesis with excess iron. Hjv-/- animals also develop higher serum titer for transaminases (ALT, AST), common markers of liver injury. However, animals failed to develop liver fibrosis. We speculate that this is related to the strain of the mice, which is genetically resistant to liver injury.

Résumé

L'hémojuvéline (HJV) est une protéine membranaire qui contrôle le métabolisme systémique du fer. Les mutations de HJV conduisent à l'hémochromatose juvéline, qui découle de l'absorption incontrôlée du fer de l'alimentation et des dépots de ce métal dans les cellules parenchymateuses du foie. La surcharge hépatique en fer mène progressivement à l'inflammation, la fibrose et le carcinome hépatocellulaire. Les mécanismes moléculaires responsables des dommages au foie qui sont attribuables au fer ne sont pas entièrement caractérisés. Nous avons donc étudié la contribution potentielle de l'ablation de HJV sur le fer hépatique, le métabolisme des lipides et son rôle dans la pathogénèse de la fibrose hépatique. Des souris de type sauvage (WT) et déficiente pour HJV (Hjv-/-) dans la souche C57BL/6J ont été nourries avec un régime normal, riche en gras ou riche en gras et supplementé en fer (HFD + Fe) pour différentes périodes (0, 3,

6, 9, 12 semaines). Comparativement, les animaux Hjv-/- développent des indices de fer sérique plus élevés, des dépots de fer dans le foie, et une diminution de niveaux de hepcidine. Des changements dramatiques sont également observés entre les niveaux de la protéine de capture du fer, TfR1, et la protéine de stokage du fer, la ferritine. De manière intéressante, le groupe HFD+

Fe montre une réduction significative de la masse corporelle des animaux quel que soit leur génotype. De plus, les données de qPCR revèlent la régulation à la baisse significative du récepteur 2 de l'adiponectine (AdipoR2) dans ce groupe, en plus de la régulation à la hausse de la biosynthèse de cholestérol avec un excès de fer. Les animaux Hjv-/- montrent un titre sérique plus élevé de transaminases (ALT, AST), marqueurs communs de dommages du foie, bien que les animaux ne développent pas la fibrose hépatique. Nous spéculons que ceci est dû à la souche des souris qui est résistante aux dommages du foie.

Acknowledgement

On September 2011, for the first time I got out of my cocoon by travelling from a small town in north India to the beautiful Montreal, to pursue my studies under the supervision of Dr.

Kostas Pantopoulos. I offer my most sincere gratitude to him for supporting me throughout my thesis with his knowledge. Along with his friendly and calm nature, I greatly appreciate him for scientific discussions, letting me to think more critically and innovatively towards research.

I also want to thank my lab members, John Wagner, Dr. Carine Filibeen, Nicole

Wilkinson, Dr. Kostas Gkouvatsos, Dr. Marco Constante and Patricia Kent for their friendly companionship, for experiment troubleshooting and for their assistance in lab work. I will never forget our conversations during lunch and coffee time, humorous talks and funny moments.

I am also grateful to our neighbouring labs of Dr. Ponka and Dr. Lipman for assisting us with lab equipment. Moreover, I appreciate Dr. Sabah Hussain and Dr. Koren Mann for their comments and suggestions during my committee meetings.

Last but not least, I would like to make a dedication to my parents instead of acknowledgement. No words can ever express what their constant undemanding love, sacrifices, dedication and prayers have done to help me achieve what I am today. I am deeply indebted to my parents for their love, cooperation and unflinching support.

Introduction

Body iron homeostasis is crucial for systemic and cellular iron metabolism. Its disturbances can lead to iron deficiency or iron overload conditions, which ends up in either anemia or hemochromatosis respectively. Different from all other forms of iron overload disorders, juvenile hemochromatosis is a severe form of early onset iron overload syndrome, caused by autosomal recessive mutation in hemojuvelin protein (Table 1). Hemojuvelin (HJV) is a crucial regulator of the liver derived peptide hepcidin, the master regulator of body iron homeostasis, which controls nutritional iron fluxes from upper part of the intestine (duodenum) by binding to and promoting degradation of the iron exporter ferroportin (Fig.1, 2).

The liver is a major site for the storage of iron and the metabolism of lipids and is therefore an important site for interaction between these two metabolic pathways. Hepatic lipid accumulation is frequently associated with iron overload, which progresses to non-alcoholic fatty liver disease and non-alcoholic steatohepatitis (NAFLD/NASH). Moreover, hepatic iron overload in hemochromatosis patients itself predisposes to liver fibrosis, cirrhosis and hepatocellular carcinoma (1). The most acceptable hypothesis for iron induced liver injury is that it arises from free radical production due to the excess amount of toxic un-shielded free iron (or non-transferrin bound iron, NTBI). However, recent studies suggest that in addition to reactive oxygen species (ROS) formation, iron may participate in a variety of other pathogenic mechanisms, such as altered insulin signaling and lipid metabolism, thus contributing not only to

NASH progression, but also to the initial development of steatosis (50). However, previous studies do not address the effects of HJV mutations alone. At present, the effects of a loss of HJV function on hepatic injury or lipid metabolism remain unclear.

Here we investigated the alterations of iron and lipid metabolism in absence of hemojuvelin, and role of iron overload in the pathogenesis of liver fibrosis. Hemojuvelin knockout (Hjv-/-) animals were used as model for juvenile hemochromatosis, with hereditary liver iron overload as a ‘first hit’ for liver injury. In addition, animals were given a ‘second hit’ of either high fat diet or high fat with supplemented iron diet. Unlike wild type control animals,

Hjv knockout mice developed severe changes in iron homeostasis, as expected. Moreover, iron overloaded also affected adiponectin signalling, with downregulation of adiponectin receptor 2

(AdipoR2), and higher levels of cholesterol biosynthesis, indicated impairment of normal lipid metabolism. However, there was absence of significant signs of hepatic injury, highlighting that

C57BL/6J mice strain is ‘low iron’ and genetically resistant to iron induced toxicity as shown earlier (33-36).

Review of Literature

1. Body Iron Metabolism

Iron is essential for fundamental biochemical activities of the living cell, such as oxygen transport, energy metabolism and DNA synthesis. Iron has the ability to shift between a ferrous

(Fe (II)) (soluble) to ferric (Fe (III)) (insoluble) state by either oxidation or reduction respectively. Soluble ferrous form is toxic, having the ability to generate reactive oxygen species through Fenton’s chemistry. Free iron induced oxidative stress damage cellular macromolecules, causes tissue injury and disease (1).

1.1 Dietary Iron Absorption

Absorption of iron varies as per body requirements, in response to higher or lower needs.

Dietary iron is absorbed (1-2 mg/day) at the brush border of duodenal enterocytes. Iron uptake involves reduction of Fe(III) in the intestinal lumen by ferric reductases such as Dcytb (duodenal cytochrome b) and the subsequent transport of Fe (II) across the apical membrane of enterocytes by DMT1 (divalent metal transporter 1). Eventually, ferrous iron (Fe (II)) is exported across the basolateral membrane into the bloodstream via the only known cellular iron exporter, ferroportin

(2).

1.2 Iron Delivery and Utilization

Exported iron is scavenged by glycoprotein Tf (transferrin) and delivered to the tissues.

Fe (III) circulates in plasma bound to the two high affinity binding sites on transferrin, which maintains iron in a soluble form and inhibits free iron induced toxic radicals production. Iron- loaded holo-Tf binds with high affinity to TfR1 (Transferrin receptor 1) on the surface of cells

(3), and the complex undergoes endocytosis. In subsequent steps, on acidification of the endosomes, iron get released from transferrin and eventually exported by the transporter DMT1

(divalent metal transporter 1). Further as per cell requirements, iron is either stored as ferritin, is freely available in the labile iron pool (LIP), or enters mitochondria for heme biosynthesis. The majority of iron (~25mg/day) is dedicated to hemoglobin synthesis. Erythroid precursors are the major site for iron utilization, with higher expression of TfR1 for entry of iron loaded transferrin into recycling endosomes (4)

1.3. Iron Recycling

Only less than 10% of daily iron needs are met by intestinal absorption, the rest is covered by macrophages that recycle iron internally. Reticuloendothelial macrophages phagocytose aged or damaged erythrocytes and catabolize heme using Heme Oxygenase 1 (HO-1). Ferrous iron is exported from macrophages via the transporter ferroportin (4).

2. Systemic Iron Homeostasis

Hepcidin is known as the master regulator of systemic iron homeostasis. It was purified from plasma and urine on the basis of its antimicrobial activity (5). The bioactive, mature 25 amino acid peptide is generated from an 84 amino acid prepropeptide by furin cleavage. Hepcidin regulates plasma iron levels, by its binding to the iron transporter ferroportin on the plasma membrane of enterocytes, macrophages, hepatocytes, and other cells, promoting its Jak- dependent phosphorylation and internalization that leads to its lysosomal degradation (6).

Further, the production of hepcidin is regulated by iron, so that more hepcidin is produced by hepatocytes when iron is abundant, limiting further iron absorption and release from stores.

When iron is deficient, hepatocytes produce less or no hepcidin, allowing more iron to enter the

9 plasma. In addition, hepcidin is also homeostatically regulated by the erythropoietic requirement for iron. During elevated erythropoiesis, liver iron modulates hepcidin production and hence making more iron available for hemoglobin synthesis (56).

2.1. Iron Deficiency

Iron (blood) losses, low iron diet or insufficient iron intake/absorption from dietary sources can cause iron deficiency e.g. microcytic anemia. Likewise, inappropriately high hepcidin expression lowers plasma iron levels (due to diminished iron release by macrophages and lower iron absorption) and causes anemia e.g. the common acquired anemia of chronic diseases (ACD) and the genetic iron-refractory iron deficiency anemia (IRIDA). Moreover, inflammatory cytokines like IL-6 also triggers hepcidin expression during infections, malignancies, chronic kidney diseases, or any type of inflammation.

2.2. Iron Overload

Iron overload syndromes can be classified on the basis of origin- Primary iron overload

(genetic and inherited), secondary iron overload (non-inherited and environmental). Hepcidin is inappropriately lower in the primary iron overload condition known as hemochromatosis, which leads to unregulated absorption of iron from intestine and its deposition mainly in the liver and also in heart, pancreas and kidneys over time, which eventually leads to organ failure and other metabolic complications.

2.2.1. Role of Hemochromatosis protein (HFE)

The hemochromatosis protein HFE is encoded by the HFE gene. Its mutation leads to the most common form of hemochromatosis (type I HH) which is widespread and especially

10 frequent in people of North European descent (1:300). Family studies implicate four genes in the disorder: the most common type, which has a carrier frequency of 1:8 in Caucasian populations, is due to a homozygous missense mutation of the HFE gene (C282Y) (7). HFE binds to the transferrin receptor 1 (TfR1) (8) and Fe2-Tf competes with HFE for binding to TfR1 due to overlapping binding sites on TfR1. If serum Fe2-Tf levels increase, HFE is displaced from

TfR1 to permit its interaction with TfR2 to form a complex for hepcidin expression (9)

2.2.2. Role of Hemojuvelin (HJV)

Hemojuvelin (HJV) is a glycosylphosphatidylinositol-linked membrane bound protein, a member of the repulsive guidance molecule family and also known as RGMc, and is encoded by the HFE2 gene (10). It is mainly expressed in the liver, heart and skeletal muscle (11) with un- known functions in heart and skeletal muscles. Muscle hemojuvelin is dispensable for iron metabolism (12), which may be due to differential glycosylation of muscle and liver hemojuvelin protein, which contributes different functions to HJV in two tissues (13). In the liver, HJV acts as a BMP6 (Bone Morphogenetic Protein 6) co-receptor to signal for hepcidin transcription via

SMAD proteins (14). In vitro data also revealed presence of soluble hemojuvelin (sHJV), whose endogenous source and function is still controversial (15).

Rare genetic mutation in HJV leads to early onset severe iron overload disorder juvenile hereditary hemochromatosis (type II HH), with irreversible hypogonadism, refractory heart failure, and even death in second to third decades of life. Patients with HAMP (encodes hepcidin) or HJV mutations are phenotypically similar with virtually undetectable hepcidin levels, showing the importance of hemojuvelin for hepcidin expression. Nevertheless, HJV is not the limiting step in controlling HAMP gene expression, in vivo substantial changes occur in

Hamp mRNA without noticeable changes in membrane HJV content (16)

Hemojuvelin is further regulated by the membrane-associated protease TMPRSS6

(Matriptase-2, MT2) which regulates HJV levels by cleaving (17). TMPRSS6 is taken as a novel potential therapeutic target for therapies to treat clinical conditions such as hereditary hemochromatosis and β-thalassemia (18). HJV also interacts with neogenin, a ubiquitously expressed transmembrane protein with multiple functions. Neogenin interacts with MT2 as well as with HJV to form a ternary complex and facilitate the cleavage of HJV by MT2. However, neogenin is not cleaved by MT2, indicating some degree of specificity by MT2 (19) (Fig.2)

2.2.3. Role of Transferrin Receptor 2 (TfR2)

Transferrin receptor 2 is a type II transmembrane protein encoded by the TFR2 gene in humans.

TfR2 is a homologue of TfR1 that is predominantly expressed in hepatocytes and erythroid precursors (20). TfR2 binds Fe2-Tf with low affinity (21), and unlike TfR1, it can interact with both HFE and Fe2-Tf simultaneously (9). Furthermore, the TfR2 protein is stabilized in response to increasing iron levels (22) and acts as a sensor for iron saturation of transferrin in the serum downstream hepcidin signaling accordingly. TfR2 mutations are responsible for type 3 HH, with similar iron overload phenotype as that of type I HH.

D’Alessio F et al. 2012 uncovered the latest model for hepcidin regulatory proteins, with

HFE, TfR2 and HJV forming a multi-protein membrane complex, and implicated the residues

120-139 of the TfR2 extra-cellular domain as the critical amino acids required for the binding of both HFE and HJV (23)

2.3. Consequences of Liver Iron Overload

Despite recent advances in the understanding of normal and abnormal iron metabolism, hemochromatosis remains an enigmatic disease. Liver iron overload is often accompanied with

12 fibrosis, cirrhosis and hepatocellular carcinoma in hemochromatosis patients. However, hemochromatosis is a common genetic condition with a high degree of phenotypic variability. In a large, longitudinal study of C282Y homozygote subjects it was shown that the risk of hepatic fibrosis and cirrhosis in males is at least 14% and 3%, respectively, with much lower rates seen in females (24). It has been established that males have a greater risk of hepatic fibrosis and that this process is accelerated by comorbidities such as chronic viral hepatitis C, alcoholic liver disease, insulin resistance, non-alcoholic steatohepatitis (NASH).

2.3.1. Development of NAFLD/NASH

Non-alcoholic fatty liver disease (NAFLD) is characterized by accumulation of fat in the hepatocytes (steatosis); which is frequent and probably completely benign. Iron act as a catalyst to produce reactive oxygen species (ROS) which may initiate oxidative stress and cellular lipid peroxidation. It leads to mitochondrial dysfunction, a precursor of impaired fatty acid oxidation and subsequent development of steatosis (25). If steatosis is associated with inflammation, mallory bodies and signs of impending cell death such as ballooning, the entity is termed non-alcoholic steatohepatitis (NASH). However, no therapeutic trial has yielded convincing results in the progression of liver damage (26), and no pharmacologic therapy is yet approved for NASH. Recently, hyperferritinemia has been shown to be associated with hepatic iron deposition and worsened histological activity in NAFLD and it is a useful marker to identify

NAFLD patients at risk of NASH and advanced fibrosis (27).

2.3.2. Development of Fibrosis, Cirrhosis and Hepatocellular carcinoma (HCC)

NASH can lead to fibrosis, cirrhosis and even hepatocellular cancer. Studies have shown that when hepatic iron concentration exceeds 60µmol/g, hepatic stellate cells begin to exhibit

13 early signs of activation, an integral event in the initiation of hepatic fibrosis (28). As hepatic iron levels increase further, the risk of significant liver fibrosis and ultimately cirrhosis increases (29). In recent years, NASH has also been found in with male, non-obese, non-diabetic patients and is associated with liver iron overload; that led to the hypothesis that iron plays a role in NASH pathogenesis through a second hit. Histological evidence of hepatic iron accumulation has been associated with an increased risk of fibrosis in large multicenter studies in patients with

NAFLD both from Europe and the NASH Clinical Research Network (NASH-CRN) in the

United States (30), whereas beta globin mutations, the best predictor of parenchymal iron overload in the Mediterranean area, were associated with almost the double of risk of severe fibrosis (31). Furthermore, iron overload has also been associated with HCC in Italian patients with NASH-related cirrhosis (32).

2.3.2.1. Mouse Models for Iron-induced Liver Injury

To examine the role of iron in the pathogenesis of liver injury, hemochromatosis mouse models are available, which have an iron overload phenotype. However, despite of matching disturbances in iron absorption and segregation, elevation of serum iron indices and liver iron, mouse models for hemochromatosis never recapitulate all symptoms of actual patients. Unlike patients, mice do not develop severe markers of liver injury, insulin resistance and cardiac pathology even for long term (33). This suggests that only iron overload per se does not suffice to cause liver fibrosis in mice, and there is the need of a ‘second hit’ to get a relevant phenotype

(34). For research experiments, most common hepatic risk factors e.g. high fat diet, alcohol, chemicals (Ccl4) are used as ‘second hit’. Furthermore, interestingly, iron induced liver injury is strain-specific in mice (33-36).

2.3.3. Development of Alterations in Lipid Metabolism

There is a growing body of evidence that iron may alter lipid metabolism, possibly via hepcidin. Two studies revealed a positive association between hepatic hepcidin expression and levels of serum total cholesterol and triglycerides or LDL in NAFLD subjects (37). Conflicting reports also showed that iron overload either up regulates (38) or down regulates (39) cholesterol biosynthesis. Further, an in vitro study showing inhibition of secretion of apolipoprotein B by ferritin revealed a potential mechanism by which iron and lipid metabolism may be connected

(40). Recent studies have also found a negative correlation between serum ferritin and the insulin-sensitizing adipokine, adiponectin (42). Adiponectin is a hormone cytokine secreted by adipose tissue and have protective role against steatosis via effects on two major receptors,

AdipoR1 and AdipoR2, which are predominantly expressed in the muscle and liver, respectively (41). AdipoR2 has been shown to inhibit lipogenesis as well as activate

PPAR-α and fatty acid oxidation genes. Targeted disruption of AdipoR2 has been linked to obesity, steatosis and increased hepatic oxidative stress (49). Likewise, it has been reported that iron stores in adipocytes regulates adiponectin, and hence insulin sensitivity (42) More research needs to be done in this area to further elucidate the relationship between iron and lipid metabolism in the context of NAFLD and progression to NASH.

Study Hypothesis

Iron overload can become a potent hepatotoxin in combination with high fat diet, can cause severe alterations of normal liver functioning by disturbing systemic iron homeostasis or lipid metabolism and can lead to fibrosis, with ‘double hit’ of iron and high fat.

Objectives

1) To investigate the alteration in iron homeostasis in Hjv-/- animals upon a high fat diet

(HFD) and a high fat with supplemented iron diet (HFD +Fe)

2) To determine disturbances in lipid metabolism due to high fat in the absence of

hemojuvelin using Hjv-/- animals

3) To study the development of potential liver injury by combination of high fat and iron,

upon feeding Hjv-/- animals with a high fat and a high fat with supplemented iron diets

Materials and methods

1. Animal Experiments

All animals received humane care under the guidelines and approval of the Animal care committee of McGill University (protocol 4966). For experiment design, ten-week old wild- type (WT) and HJV-/- mice (on a C57BL/6J background), originally supplied by Dr.

Nancy Andrews (Duke University), all of equivalent baseline body weights, were randomly assigned to one of three different dietary groups (n=5-6 per group). Mice were either fed on standard laboratory chow (normal diet, ND), high fat diet (HFD), or high fat diet with 2% supplemented carbonyl iron (HFD + Fe) (Fig.3). The fat-derived caloric contribution for chow,

HFD was 6%, 42% respectively. Mice were housed in a temperature-controlled environment (22

± 10C, 60 ± 5% humidity), with a 12-hour light/dark cycle and allowed ad libitum access to diets and drinking water. After 0, 3, 6, 9, 12 weeks of dietary treatment, mice weight was noticed and animals were sacrificed under general anesthesia. Serum was obtained by cardiac puncture and stored at -80°C. Livers were rapidly excised and tissue portions were either snap frozen in liquid nitrogen, or fixed in 10% neutral-buffered formalin and embedded in paraffin for histological assessment.

2. Serum Biochemistry

Transferrin saturation, total iron binding capacity (TIBC), serum iron, ferritin, transaminases

(ALT, AST), cholesterol, triglycerides, glucose were measured with a Roche Hitachi 917

Chemistry Analyzer at the Biochemistry Department of the Jewish General Hospital.

3. Quantification of Non-heme iron

Hepatic non-heme iron was measured by the ferrozine assay, as described (43, 44)

Results are expressed as micrograms of iron per gram of dry tissue weight.

4. Histological Analysis

Tissue specimens were fixed in 10% buffered formalin and embedded in paraffin. To visualize ferric iron deposits, deparaffinized tissue sections were stained with Perls’ Prussian blue. To ascertain the presence of steatosis and steatohepatitis, hematoxylin and eosin (H&E) staining was performed and slides graded according to currently accepted criteria (45).

Fibrosis was assessed following Sirius red staining.

5. Quantitative Real-Time PCR (qPCR)

Total RNA was isolated from frozen liver tissues using the RNeasy Mini kit (Qiagen), and quality was assessed by determining the 260/280 nm absorbance ratios and by agarose gel electrophoresis. qPCR was performed by using gene-specific primers (Table 2), as described (46) with ribosomal protein 18S (r18S) as housekeeping genes for normalization.

6. Western Blotting

Liver tissues protein lysates were prepared as described (41) and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 10% gel; the samples

(30 µg of protein) containing β-mercaptoethanol as a reducing agent. Following transfer of the proteins onto nitrocellulose filters (BioRad), the blots were saturated with 5% nonfat milk in Tris-buffered saline (TBS) containing 0.1% (v/v) Tween-20 (TBS-T) and probed with a

1:1,000 diluted ferritin and transferrin receptor 1 antibody. After three washes with TBS-T,

18 the blots were incubated with 1:5,000 diluted peroxidase-coupled goat antirabbit IgG

(Sigma). The peroxidase signal was detected by enhanced chemiluminescence with the

Western Lightning ECL kit (Perkin Elmer).

7. Statistical Analysis

Quantitative data are expressed as mean ± standard deviation (SD). Statistical analysis was performed using either one way or two way Anova, with GraphPad Prism software (v.

5.0d). A probability value P < 0.05 was considered statistically significant.

Results and Discussion

1. Effect on Body Weight

Mice on high fat showed significantly higher weight compared to all other groups.

Interestingly, iron overload significantly reduces mice body weight, and Hjv-/- mice showed comparatively slightly less body weight on different diets. Surprisingly, animals on HFD + Fe diet showed ~30% reduction in mice weight compared to mice on HFD, and phenotype were same irrespective of mice genotype (Fig. 4A, 4B). Under iron overload conditions, the variations in mice body weight and potential role of iron in this mechanism is still not elucidated. Even we did not measure the exact amount of food intake by mice; still there did not seem to be much difference in total leftover food consumed for the experiment.

2. Effect on Serum Indices

Hjv-/- animals build up excessive serum iron, Tf saturation and ferritin levels in all groups

(Fig. 5A, 5B, 5C), because of low levels of hepcidin, which causes un-regulated absorption and entrance of iron into the blood circulation. Surprisingly, Hjv-/- animals on HFD showed sharp non-significant decrease in serum iron (~50%), ferritin (~32%), Tf saturation (~50%) on week 9, which continues with slight increase to week 12. As it has been shown in vitro that higher glucose levels can trigger hepcidin secretion with pancreatic origin to regulate serum iron (47) and the high fat fed animals group were in similar conditions, we decided to examine HAMP mRNA in the pancreas, but not all pancreatic samples expressed hepcidin which made it difficult to quantify.

Serum transaminases are considered an initial marker for liver injury. Hjv-/- animals also build up high levels of serum transaminases (ALT, AST) on standard chow, high fat (some fluctuations) and high fat + iron diet (Fig. 5D, 5E). We also assessed serum glucose, cholesterol, triglycerides, but those parameters did not show variations in either genotype (not shown).

3. Effect on Hepatic Iron Content

Hepatic non-heme iron was measured with the ferrozine assay, which expresses results in micrograms of iron per gram of dry tissue weight. As a perfect mouse model for hemochromatosis, Hjv-/- mice develop severe iron overload compared with WT counterparts (14 to 18 fold higher on standard chow on different weeks) (Fig. 6A). Interestingly, the high fat group showed less liver iron than the normal diet group (1.5 to 2 fold less than standard chow group on different weeks), which is consistent with previous reports (Fig. 6B) (48).The mouse group on high fat and 2% supplemented iron diet developed the highest liver iron deposition on different time intervals. Surprisingly, on HFD+ Fe intake, even WT animal built up enormous liver iron levels and their difference from Hjv-/- mice in group became quite less compared to standard chow difference (~1.5 to ~1.9 fold, except on week 3 with ~3 fold difference) (Fig. 6C).

Most probably the interaction of high fat with iron is causing variations at iron absorption level which would be interesting to follow up in future experiments.

4. More Iron, Less Steatosis and No Fibrosis in C57BL/6J Hjv-/- mice

Pearl’s iron staining was performed to grade for hepatic iron deposits from 0 to 4 (0= absent;

1= minimal; 2= mild; 3= moderate; 4= heavy). In consistent with ferrozine assay data, we found absence of iron staining in WT animals on standard chow and high fat diet, and presence of blue area in Hjv-/- animals, which was highest in HFD + Fe group and lowest in HFD group.

Interestingly, after week 3 irrespective of genotype all animals on HFD + Fe showed maximum positive area for iron staining, with grade 4 (Fig. 6D).

H & E staining was done to determine necroinflammation, portal inflammation, steatosis score and fibrosis stage. Steatosis, which is accumulation of fat in hepatocytes, was found to be completely absent in standard chow group. The HFD group developed very severe steatosis (with

>30% of hepatocytes affected), involving 100% of WT animals after week 6, and 60%, 80%,

100% of Hjv-/- counterparts on week 6, 9, 12 respectively. Surprisingly, HFD + Fe group showed severe steatosis only at week 12 involving all animals, before it was slight or moderate, and Hjv-/- animals showed even less steatosis than WT involving only 40% animals in severe steatosis grade on week 12 (Fig. 7A, 7B) . For less fat accumulation in Hjv-/- animals, we were assuming that it could be because of their progression to steatohepatitis, in which hepatocytes start losing fat accompanied by tissue inflammation. It could also explain the lower weight in iron overloaded mice on HFD + Fe, because excessive iron may not let fat to accumulate in hepatocytes. However, there was not much difference in inflammation score. Furthermore, H &

E and Sirius red staining confirmed the absence of fibrosis in experimental mice groups.

Consistently, there was absence of expression of profibrogenic gene markers in the experimental mice group- Collagen 1(Colla1), Transforming growth factor (TGF-β), Platelet derived growth factor (PDGF) and Endothelin 1 (ET-1). This could be because of the ‘low iron’ mice C57BL/6J strain used in this study, which is genetically resistant to liver injury (33-36).

Absence of hemojuvelin diminished the expression of hepcidin mRNA in Hjv-/- animals.

Interestingly, compared to the other two dietary groups, high fat group showed lowest hepcidin levels (1 to 3 fold) irrespective of mice genotype. HFD + Fe group showed highest levels of hepcidin in all three groups, to control further absorption of iron by targeting iron exporter

22 ferroportin in duodenum. Even then, HFD + Fe group built up enormous liver iron deposition, confirmed by ferrozine assay and iron staining (Fig. 6E, 6F). It is either because hepcidin failed to completely limit absorption of iron or hepcidin sequestered already absorbed iron in hepatocytes by targeting ferroportin on hepatocytes.

5. Effect on TfR1 and Ferritin Expression, α-SMA Activation

Transferrin receptor 1 (TfR1) and ferritin protein expression was determined by Western blots. TfR1 acts as an iron receptor, to which diferric-transferrin binds and subsequently Fe is delivered inside the cell to complete cellular iron requirements. It is more expressed in iron deficient hepatocytes, and disappears under iron overloaded conditions. Ferritin, the iron storage protein that sequesters the metal in a non-toxic form, has an opposite expression profile to TfR1.

On normal and high fat diet, TfR1 expression was observed only in WT and almost diminished in Hjv-/- animals, revealing iron requirements in both genotypes. Likewise, ferritin had the opposite expression profile to TfR1, being absent in WT mice (Fig. 8A, 8B). Interestingly,

HFD+ Fe group lost their TfR1 protein expression irrespective of the mouse genotype, and for ferritin expression, WT mice showed time dependent increase whereas Hjv-/- animals showed fully saturated protein levels for all time points (Fig. 8C).

To determine activation of hepatic stellate cells as an early sign of liver injury, α-SMA western blots were performed. But we did not get a clear expression for α-SMA; it showed either irregular expression or no expression at all, which is inconclusive. Upon comparison of experimental samples, after 12 weeks of dietary intake, and the positive control samples from

129S6/SvEvTac background mice (only baseline) (Fig. 7C); we come to know that the C57BL/6J strain is resistant to iron induced liver injury, with insufficient activation of α-SMA. It further

23 validates that strain background has had a pro-found effect on the iron status of mice and the

129S6/SvEvTac, AKR strains which can store significantly more iron than the C57BL/6J strain are more prone to iron induced toxicity (33-34).

6. Liver Iron Overload Impairs Lipid Metabolic Pathway

Reduction of body weight with high iron diet has been previously reported, and down regulation of adiponectin is considered as a potential mechanism (42). We looked for expression of adipoR2 (adiponectin binding receptor on hepatocytes) and found dramatic reduction in adipoR2 mRNA expression on the hepatocytes (Fig. 9A) which seems dependent on amount of iron overload. So, we are hypothesizing, reduction of adipoR2 would affect binding on adiponectin to its receptor and this could lead to impairment of downstream lipid oxidation signaling. Further, we also observed upregulation of the rate limiting enzyme of cholesterol biosynthesis Hmgrc (3-hydroxy-3-methylglutarate-coenzyme A reductase) under dietary iron overload condition in WT on HFD + Fe group (Fig. 9B). In contrast, this enzyme did not respond as dramatically in Hjv-/- on HFD + Fe group, leading us to believe its differential regulation with dietary and hereditary iron overload. However, it would be interesting to compare levels of

Hmgrc on low iron, normal iron and high iron diet samples for clear comparison.

Conclusion

This study again demonstrated the importance of hemojuvelin as a crucial regulator for hepcidin signalling. Absence of hemojuvelin systematically disturbs iron homeostasis, with inappropriately diminished hepcidin levels. However, it is the first report to show the phenotype of Hjv-/- animals on HFD + Fe diet, animals having inherited iron overload fed on high fat with supplemented iron diet. Interesting enough, animals on HFD + Fe diet showed symptoms of sickness, abnormal behaviour, reduction of body weight and matching hepatic deposits irrespective of mice genotype. So presumably, interaction of the high fat diet with dietary iron is affecting iron at absorption level, and it would be stimulating to compare for any variations in iron transporters (ferroportin, DMT1, ferroxidases) within this group. In addition, it’s important to scrutinize animal’s phenotype on HFD + Fe diet in more detail, by examining serum adiponectin, adiponectin mRNA levels, presence of muscle atrophy etc. We also observed differential expression of rate limiting enzyme of cholesterol biosynthesis (Hmgrc) on dietary iron and hereditary iron. In contrast, Adiponectin Receptor 2 (adipoR2) expressed in iron dependent manner irrespective of dietary or hereditary. However for clearer inference, it is important to compare only for high dietary iron (without fat). We are assuming that changes in adipoR2 and Hmgrc are specifying iron induce disturbances in hepatic lipid metabolic pathways.

In contrast, despite of metabolic changes and severe iron overload animals did not show signs of liver damage, which could be because of three reasons. First, the ‘low iron’ C57BL/6J mouse strain used in this study is genetically resistant to iron induced organ injury as reported before (33-36). Second, the short time period for experimental design (upto 12 weeks) may not be reasonable time intervals for development of hepatic fibrosis in mice. So for severe liver

25 injury, it’s crucial to extend experiment duration for longer time, months instead of weeks. Third, need of modified high fat diet, we used exact high fat diet with matching caloric content to western fat diet (42% from fat), which appears to be insufficient for liver injury. However, it is reported that modified high fat can trigger earlier fibrosis in Hfe-/- animals on C57BL/6J background within short interval. Despite this, the authors argued that liver injury is not due to iron, but because of absence of intact Hfe protein, because Hfe-/- animals develop very little iron overload (41). Hence, the role of iron in promoting fibrosis is ambiguous in this report.

Overall, our data is supporting the assumption that excess iron has key role in the disturbance of systemic iron homeostasis and hence lipid metabolism. However, we did not find any sign of fibrosis even in Hjv-/- on HFD + Fe, animals under combined toxic effect of both dietary and hereditary iron overload together. We were supposing severe liver damage in this group, but it not happen. Nevertheless, it supports the notion that iron induced liver injury is mice strain specific. Undoubtedly, there is need for further research to define role of iron in the pathogenesis of liver fibrosis and pathways involved in the mechanism; nevertheless our study is one step towards it.

Figure Legends

Fig.1. Systemic iron homeostasis. Hepcidin targets ferroportin, and hence hepcidin–ferroportin interactions regulates the release of iron from macrophages that recycle iron in the spleen and other organs, dietary iron absorption in the duodenum, and the release of iron from storage in hepatocytes. The feedback stimulation of hepcidin by plasma iron saturation and iron stores ensures that extracellular iron concentration and iron stores stay within normal limits (57)

Fig.2. Regulation of Hepcidin expression. A) High iron conditions, iron loaded Tf stabilizes

TfR2, disrupts the HFE-TfR1 interaction, and induces BMP6 secretion from the nonparenchymal cells of the liver, which facilitates the formation of a complex consisting of the BMP receptor/BMP6/HJV/neogenin/TfR2/HFE to induce hepcidin expression. B) Low iron conditions increase MT2, which induces the cleavage of hepatic HJV. Decreased Tf saturation in the circulation destabilizes TfR2 protein and facilitates the HFE-TfR1 interaction. Low iron levels in the liver reduce BMP6 secretion from the nonparenchymal cells, consequently blunting BMP signaling and lowering hepcidin expression. C) Inflammation induces the expression of IL-6 and activin B in the liver, which activates the transcription of hepcidin via the STAT3/JAK2 pathway and the BMP signaling pathway, respectively (58)

Fig.3. Experimental design. WT (wild type) and HJV-/- (Hemojuvelin knockout) animals were divided into three dietary groups: Normal Diet, High fat diet, High Fat + iron diet; for time course of experiment (0, 3, 6, 9, 12 weeks), on an average 5-6 male animals were taken in each

27 group on C57BL/6J background (data for HJV-/- on ND for week 9 is absent due to availability of animals (in red), but it will not affect general interpretation).

Fig.4. Difference in mice body weight. A) Comparing three different dietary groups, WT (wild type) and HJV-/- (hemojuvelin knockout) animals on HFD (high fat diet) group showed highest and HDF + Fe (High fat diet with supplemented iron diet) showed lowest body weight. ***P <

0.001, **P < 0.01 B) HFD + Fe group phenotype, After 12 weeks of dietary intake, wild type animals on HFD (right) and HFD + Fe (left), also same for HJV-/- animals.

Fig.5. Serum iron parameters in three dietary groups. ND (Normal diet), HFD (High fat diet), HFD + Fe (High fat diet with 2% carbonyl iron) for time course A) Serum iron B) Serum transferrin saturation C) Serum ferritin D) Serum ALT (Alanine aminotransferase) E) Serum

AST (Aspartate aminotransferase) (**P < 0.01, ***P < 0.001, ****P < 0.0001 between genotypes)

Fig.6. HIC (Hepatic iron concentration) and Hepcidin regulation A) Liver iron for normal diet B) Liver iron for high fat diet C) Liver iron for high fat + Fe diet group D) Grading for perl’s iron staining from 0 to 4 (0= absent; 1= minimal; 2= mild; 3= moderate; 4= heavy) for different mice groups, showing average number of animals with particular grade E) Perls’ staining of liver sections (original magnification 20x) F) Hepcidin expression (Hamp mRNA)

28 between different diets and mice genotypes (**P < 0.01, ***P < 0.001 between diets and genotypes)

Fig.7. Liver steatosis and absence of fibrosis A) Representative liver histology stained with H

& E on paraffin-embedded sections (original magnification 20x) B) Percent of animals with severe steatosis (Grade 3) C) Activation of α-smooth muscle actin (marker of liver fibrosis), positive control samples in first two lanes from 129S6/SvEvTac strain (baseline, no treatment) compared with C57BL/6J mice samples (after 12 weeks on different dietary treatment). (Not so clear blots, because of limitation of positive control sample experiment could not repeated)

Fig.8. Expression of Transferrin receptor 1, TfR1 and Ferritin A) Normal diet B) High fat diet C) High fat with 2% carbonyl iron diet

Fig.9. Iron overload impairs lipid pathway A) Effect on Adiponectin receptor 2, adipoR2 mRNA levels in different mice groups B) Effect on Hmgrc mRNA (3-hydroxy-3- methylglutarate-coenzyme A reductase), encodes rate limiting enzyme for cholesterol biosynthesis. (*P < 0.05, **P < 0.01 between different diets, different genotypes)

Fig. 1

Fig.2

Fig.3

** ***

*** 50

Mice Body weight (gm) weight Body Mice 10

0 WT HJV-/- WT HJV/- WT HJV-/-

Normal diet High fat diet High fat with iron diet

Fig. 4A

Fig. 4B

Serum Iron ND P < 0.0001 60 WT on ND HJV-/- on ND

40 umol/L 20

0 0 3 6 9 12

Time (weeks)

Serum Iron HFD Serum Iron HFD + Fe P < 0.0001 60 150 WT on HFD HJV-/- on HFD +Fe HJV-/- on HFD WT on HFD +Fe **

40 100

umol/L umol/L 20 50

0 0 0 3 6 9 12 0 3 6 9 12 Time (weeks) Time (weeks)

Fig.5A

Tf Saturation on ND P < 0.0001 1.0 WT on ND 0.8 HJV-/- on ND

0.6 % 0.4

0.2

0.0 0 3 6 9 12

Tf Saturation on HFD Tf Saturation on HFD + Fe 1.0 **** 1.5 **** WT on HFD WT on HFD + Fe 0.8 HJV-/- on HFD HJV-/- on HFD +Fe 1.0 ****

0.6

% % 0.4 0.5 0.2

0.0 0.0 0 3 6 9 12 0 3 6 9 12

Fig. 5B

Ferritin ND P < 0.0001 600 WT on ND HJV-/- on ND

400 ug/L 200

0 0 3 6 9 12 Time (weeks)

Ferritin HFD P < 0.001 Ferritin HFD +Fe 800 WT on HFD 1000 WT on HFD + Fe HJV-/- on HFD HJV-/- on HFD +Fe 600 800 **** ****

600

400 ug/L

ug/L *** 400 200 200

0 0 0 3 6 9 12 0 3 6 9 12 Time (weeks) Time (weeks)

Fig. 5C

ALT on ND 80 WT on ND HJV-/- on ND 60

40 U/L

0 0 3 6 9 12 Weeks

ALT on HFD ALT on HFD + Fe 150 WT on HFD 80 * WT on HFD +Fe HJV-/- on HFD ** HJV-/- on HFD +Fe 60 100

U/L 40 U/L 50 20

0 0 0 3 6 9 12 0 3 6 9 12 Weeks Weeks

Fig.5D

AST on ND 200 WT on ND HJV-/- on ND 150

100 IU/L

0 0 3 6 9 12 Time (weeks)

AST on HFD AST on HFD + Fe 150 250 WT on HFD * * WT on HFD + Fe HJV-/- on HFD 200 HJV-/- on HFD + Fe 100

150 IU/L IU/L 100 50 50

0 0 0 3 6 9 12 0 3 6 9 12 Time (weeks) Time (weeks)

Fig.5E

Fig. 6A

Fig. 6B

Fig. 6C

4.5

3.5

3 Week 0 2.5 Week 3 2 Week 6 Week 9

1.5 Week 12 Perl's Iron Grade Iron Perl's 1

0.5

0 WT on ND HJV-/- on ND WT on HFD HJV-/- on HFD WT on HFD+FE HJV-/- on HFD +Fe

Fig. 6D

WT (Wild type) Hjv-/- (Hemojuvelin Knockout)

Baseline (Week 0)

Normal Diet (Week 12)

High fat diet (Week 12)

High fat with iron diet (Week 12)

d) Fig. 6E

***

10 ***

Hamp/ r18S mRNA r18S Hamp/ 2

(Fold induction relative to control) relative to induction (Fold WT HJV-/- WT HJV-/- WT HJV-/-

Normal diet High fat diet High fat with iron diet

Fig.6F

WT (Wild type) Hjv-/- (Hemojuvelin Knockout)

Baseline (Week 0)

Normal diet (Week 12)

High fat diet (Week 12)

High fat with iron diet (Week 12)

d) Fig. 7A

120

100

80 Week 0 Week 3 60 Week 6 Week 9 Week 12 40

20 Percent of mice Percent mice ofwith severe steatosis 0 WT on ND HJV-/- on ND WT on HFD HJV-/- on HFD WT on HFD+FE HJV-/- on HFD +Fe

Fig. 7B

Fig. 7C

Normal Diet High Fat Diet

Fig. 8A Fig. 8B

High fat with supplemented iron diet

Fig. 8C

* 3 * ** * 2

1 AdipoR2/ r18S mRNA r18S AdipoR2/

(Fold induction relative to control) relative to induction (Fold WT HJV-/- WT HJV-/- WT HJV-/-

Normal diet High fat diet High fat with Iron diet

Fig.9A

* * * 4

1 Hmgrc/ r18S RNA r18S Hmgrc/

(Fold induction relativecontrol) to induction (Fold WT HJV-/- WT HJV-/- WT HJV-/-

Normal diet High fat diet High fat with iron diet

Fig.9B

Table 1. Major genetic iron overload disorders

Type of Hereditary Hemochromatosis Inheritance Gene Protein Hepcidin Levels Phenotype References (HH) Decreased/Inapprop Moderate iron HH type 1 AR HFE Hfe Pietrangelo 2007 riate overload Severe Gkouvatsos K HH type 2 AR HJV Hemojuvelin Low/undetectable systemic iron et al. 2011 overload Severe Lesbordes-Brion JC HH type 2 AR HAMP Hepcidin Absent systemic iron et al. 2006 overload Hepatocyte Transferrin Kawabata H HH type 3 AR TFR2 Low iron overload receptor 2 et al. 2005 prevalent AD SLC40A1 Ferroportin Normal Macrophage iron overload Zohn IE et al. 2007 HH type 4 Ferroportin Donovan A et al. (hepcidin High Hepatocyte 2005 resistant) iron overload

HH = hereditary hemochromatosis, AR = autosomal recessive, AD = autosomal dominant

Table 1. Mouse primer sequences for genes used in RT-PCR

Gene Accession number Forward primer Reverse Primer

r18S NR_003278 GAATAATGGAATAGGACCGCGG GGAACTACGACGGTATCTGATC

Hepcidin NM_032541 AAGCAGGGCAGACATTGCGAT CAGGAT GTGGCTCTAGGCTATGT

α1-(I)-collagen NM_007742 CCAAGGGTAACAGCGGTGAA CCTCGTTTTCCTTCTTCTCCG

TGF-β1 NM_011577 GGTTCATGTCATGGATGGTGC TGACGTCACTGGAGTTGTACGG

Endothelin-1 NM_010104 GAAACAGCTGTCTTGGGAGC AGTTCTTTTCCTGCTTGGCA

PDGF-D NM_027924 ACTCTCACTGCTGATGCCCT GACTGCATTGGTCAGCTTCA

AdipoR2 NM_197985 GGCAGATAGGCTGGCTAATGC GGAAGAGCTGATGAGAGTGAAACC

PPAR-Alpha NM_011144.6 CATGTGAAGGCTGTAAGGGCTT TCTTGCAGCTCCGATCACACT

FAS NM_007988.3 TCCTGGAACGAGAACACGATCT GAGACGTGTCACTCCTGGACTTG

CATGGTTCACAACAGATCAAAGATAA Hmgcr NM_008255.2 TGCCTTCTTGGTGCACGTT AT

References

1. Galaris D and Pantopoulos K (2008) Oxidative stress and iron Homeostasis: mechanistic

and health aspects. Crit. Rev. Clin. Lab. Sci. 45, 1–23.

2. Wang J and Pantopoulos K (2011) Regulation of cellular iron metabolism. Biochem. J.

434, 365–381.

3. Ponka P, Beaumont C and Richardson DR (1998) Function and regulation of transferrin

and ferritin. Semin. Hematol. 35, 35–54.

4. Fleming RE, Ponka P (2012) Iron overload in human disease. N. Engl. J. Med. 366, 348-

59.

5. Park CH, Valore EV et al. (2001) Hepcidin, a urinary antimicrobial peptide synthesized

in the liver. J. Biol. Chem. 276, 7806−7810.

6. Nemeth E, Tuttle MS, Powelson J et al. (2004) Hepcidin regulates cellular iron effux by

binding to ferroportin and inducing its internalization. Sci. 306, 2090−2093.

7. Feder JN, Gnirke A, Thomas W et al. (1996) A novel MHC class I-like gene is mutated

in patients with hereditary haemochromatosis. Nat. Genet. 13, 399–408.

8. Lebron JA, West AP Jr, Bjorkman PJ (1999) The hemochromatosis protein HFE

competes with transferrin for binding to the transferrin receptor. J. Mol. Biol. 294, 239-

245.

9. Gao J, Chen J, Kramer M. et al. (2009) Interaction of the hereditary hemochromatosis

protein HFE with transferrin receptor 2 is required for transferrin-induced hepcidin

expression. Cell. Met. 9, 217–227.

10. Papanikolaou G, Samuels ME, Ludwig EH et al. (2004) Mutations in HFE2 cause iron

overload in chromosome 1q-linked juvenile hemochromatosis. Nat. Genet. 36,77-82.

11. Rodriguez Martinez A, Niemela O et al. (2004) Hepatic and extrahepatic expression of

the new iron regulatory protein hemojuvelin. Haematologica. 89(12), 1441-1445.

12. Gkouvatsos K, Wagner J, Papanikolaou G et al. (2011) Conditional disruption of mouse

Hfe2 gene: maintenance of systemic iron homeostasis requires hepatic but not skeletal

muscle hemojuvelin. Hepat. 54,1800-1807.

13. Fujikura Y, Krijt J and Nečas E (2011) Liver and muscle hemojuvelin are differently

glycosylated. BMC Biochem. 12, 1471-2091.

14. Babitt JL, Huang FW, Wrighting DM et al. (2006). Bone morphogenetic protein

signaling by hemojuvelin regulates hepcidin expression. Nat. Genet. 38, 531–539.

15. Chen W, Sun CC et al. (2013) A novel validated enzyme-linked immunosorbent assay to

quantify soluble hemojuvelin in mouse serum. Haematologica. 98(2), 296-304.

16. Krijt J, Frýdlová J, Kukačková L et al. (2012) Effect of iron overload and iron deficiency

on liver hemojuvelin protein. PLoS One, 7(5):e37391

17. Silvestri L, Pagani A, Nai A et al. (2008a) The serine protease matriptase-2 (TMPRSS6)

inhibits hepcidin activation by cleaving membrane hemojuvelin. Cell Metab. 8, 502–511.

18. Guo S, Casu C, Gardenghi S et al. (2013) Reducing TMPRSS6 ameliorates

hemochromatosis and β-thalassemia in mice. J. Clin. Invest. 123, 1531–1541.

19. Enns CA, Ahmed R and Zhang AS (2012) Neogenin interacts with matriptase-2 to

facilitate hemojuvelin cleavage. J. of Bio. Chem. 287 (42), 35104–35117.

20. Kawabata H, Germain RS, Ikezoe T et al. (2001) Regulation of expression of murine

transferrin receptor 2. Blood. 98, 1949-1954.

21. West AP Jr., Bennett MJ, Sellers VM et al. (2000) Comparison of the interactions

of transferrin receptor and transferrin receptor 2 with transferrin and the hereditary

hemochromatosis protein HFE. J. Biol. Chem. 275, 38135-38138.

22. Johnson MB, Enns CA (2004) Diferric transferrin regulates transferrin receptor 2 protein

stability. Blood. 104, 4287-4293.

23. D’Alessio F, Hentze MW, Muckenthaler MU (2012) The hemochromatosis proteins hfe,

tfr2 and Hjv form a membrane-associated protein complex for hepcidin regulation. J

Hepatol. 57(5), 1052- 1060

24. Allen KJ, Gurrin LC, Constantine CC et al. (2008) Iron Overload Related Disease in HFE

Hereditary Hemochromatosis. N. Engl. J. Med. 358, 221-230.

25. Rector RS, Thyfault JP et al. (2010) Mitochondrial dysfunction precedes insulin

resistance and hepatic steatosis and contributes to the natural history of non-alcoholic

fatty liver disease in an obese rodent model. J. Hepatol. 52(5), 727-736.

26. Musso G, Gambino R, Cassader M et al. (2010) A meta-analysis of randomized trials for

the treatment of non-alcoholic fatty liver disease. Hepat. 52, 79-104

27. Valenti L, Dongiovanni P, Fargion S (2012) Diagnostic and therapeutic implications of

the association between ferritin level and severity of nonalcoholic fatty liver disease.

World J. Gastroenterol. 18(29), 3782-3786.

28. Ramm GA, Crawford DH, Powell LW et al. (1997) Hepatic stellate cell activation in

genetic haemochromatosis. Lobular distribution, effect of increasing hepatic iron and

response to phlebotomy. J Hepatol. 26, 584-592.

29. Adams PC (2001) Is there a threshold of hepatic iron concentration that leads to cirrhosis

in C282Y hemochromatosis? Am J. Gastroenterol. 96, 567-569.

30. Nelson JE, Wilson L, Brunt EM et al. (2011) Relationship between the pattern of hepatic

iron deposition and histological severity in nonalcoholic fatty liver disease. Hepatol. 53,

448-457.

31. Valenti L, Canavesi E, Galmozzi E et al. (2010) Betaglobin mutations are associated with

parenchymal siderosis and fibrosis in patients with non-alcoholic fatty liver disease. J.

Hepatol. 53, 927-933.

32. Sorrentino P, D’Angelo S et al. (2009) Liver iron excess in patients with hepatocellular

carcinoma developed on non-alcoholic steato-hepatitis. J. Hepatol. 50, 351-357.

33. Subramaniam VN, McDonald CJ, Ostini L (2012) Hepatic iron deposition does not

predict extrahepatic iron loading in mouse models of hereditary hemochromatosis. Am. J.

Pathol. 18, 1173–1179.

34. Sebastiani G, Gkouvatsos K, Maffettone C et al. (2011) Accelerated CCl4-induced liver

fibrosis in Hjv-/- mice, associated with an oxidative burst and precocious profibrogenic

gene expression. 6(9), e25138

35. Delima RD, Chua ACG et al. (2012) Disruption of hemochromatosis protein and

transferrin receptor 2 causes iron-induced liver injury in mice Hepatol. 56, 585-593.

36. Wang F, Paradkar PN et al. (2007) Genetic variation in Mon1a affects protein trafficking

and modifies macrophage iron loading in mice. Nat. Gen. 39(8), 1025-1032.

37. Barisani D, Pelucchi S, Mariani R, et al. (2008) Hepcidin and iron-related gene

expression in subjects with dysmetabolic hepatic iron overload. J. Hepatol. 49, 123–133.

38. Graham RM, Chua AC, Carter KW et al. (2010) Hepatic iron loading in mice increases

cholesterol biosynthesis. Hepatol. 52, 462–71.

39. Petrak J, Myslivcova D et al. (2007) Proteomic analysis of hepatic iron overload in mice

suggests dysregulation of urea cycle, impairment of fatty acid oxidation, and changes in

the methylation cycle. Am. J. Physiol. Gastrointest. Liver Physiol. 292, G1490– 1498.

40. Hevi S, Chuck SL (2003) Ferritins can regulate the secretion of apolipoprotein B. J. Biol.

Chem. 278, 31924–1929.

41. Tan TCH, Crawford DHG, Jaskowski LA et al. (2011) Altered lipid metabolism in Hfe-

knockout mice promotes severe NAFLD and early fibrosis. Am. J. Physiol. Gastrointest.

Liver Physiol.301, G865-G876.

42. Gabrielsen JS, Gao Y, Simcox JA et al. (2012) Adipocyte iron regulates adiponectin and

insulin sensitivity. J. Clin. Invest.122 (10), 3529–3540.

43. Riemer J, Hoepken HH, Czerwinska H et al. (2004) Colorimetric ferrozine-based assay

for the quantitation of iron in cultured cells. Anal. Biochem. 331, 370-375.

44. Zhang AS, Gao J, Koeberl DD et al. (2010) The role of hepatocyte hemojuvelin in the

regulation of bone morphogenic protein-6 and hepcidin expression in vivo. J. Biol. Chem.

285, 16416-16423.

45. Kleiner DE, Brunt EM et al. (2005) Design and validation of a histological scoring

system for nonalcoholic fatty liver disease. Hepatol. 41(6), 1313-1321.

46. Maffettone C, Chen G et al. (2010) Tumorigenic properties of iron regulatory protein 2

(IRP2) mediated by its specific 73-amino acids insert. PLoS One. 5:e10163.

47. Aignera E, Felder TK et al. (2013) Glucose acts as a regulator of serum iron by

increasing serum hepcidin concentrations. J. of Nutr. Biochem. 24(1), 112-117

48. Chung J, Kim MS, Han SN. (2011) Diet-induced obesity leads to decreased hepatic iron

storage in mice. Nut. Res. 31, 915–921.

49. Yamauchi T, Nio Y, Maki T et al. (2007) Targeted disruption of AdipoR1 and

AdipoR2 causes abrogation of adiponectin binding and metabolic actions. Nat. Med.

13(3), 332-339.

50. Silva M, Silva ME et al. (2008) Iron overload alters glucose homeostasis, causes liver

steatosis, and increases serum triacylglycerols in rats. Nutr. Res. 28(6), 391-398.

51. Pietrangelo A. (2007) Hemochromatosis: an endocrine liver disease. Hepatol. 46:1291-

301.

52. Lesbordes-Brion JC, Viatte L et al. (2006) Targeted disruption of the hepcidin 1 gene

results in severe hemochromatosis. Blood, 108: 1402-5.

53. Kawabata H, Fleming RE et al. (2005) Expression of hepcidin is down-regulated in TfR2

mutant mice manifesting a phenotype of hereditary hemochromatosis. Blood, 105:376-

81.

54. Zohn IE, De Domenico I et al. (2007) The flatiron mutation in mouse ferroportin acts as a

dominant negative to cause ferroportin disease. Blood, 109:4174-80.

55. Donovan A, Lima CA et al. (2005) The iron exporter ferroportin/Slc40a1 is essential for

iron homeostasis. Cell Metab. 1:191-200.

56. Díaz V, Gammella E et al. (2013) Liver iron modulates hepcidin expression during

chronically elevated erythropoiesis in mice. Hepatol. 57 (6): 1-35.

57. Ganz T. (2007) Molecular Control of Iron Transport. J Am Soc Nephrol. 18: 394–400.

58. Zhao N, Zhang AS et al. (2013) Iron regulation by hepcidin. J Clin Invest.123 (6):2337–

2343.

ABREVATIONS

ACD Anemia of chronic disease AdipoR2 Adiponectin Receptor 2 ALT Alanine aminotransferase ANOVA Analysis of variance AST Aspartate aminotransferase Coll-1a Collagen 1a DMT1 Divalent metal transporter 1 GPI Glycosylphosphatidylinositol ET-1 Endothelin-1 HCC Hepatocellular Carcinoma HFD High Fat Diet HFD + Fe High Fat with 2% carbonyl iron Diet HJV Hemojuvelin HH Hereditary hemochromatosis HMGRC 3-hydroxy-3-methylglutarate-coenzyme A reductase HO-1 Hemeoxygenase-1 HFE Hemochromatosis gene or protein IRIDA Iron-refractory iron deficiency anemia IL-6 Interlukein -6 JH Juvenile Hemochromatosis LIP Labile Iron pool MT-2 Matriptase-2 NAFLD Non-Alcoholic fatty liver disease NASH Non-Alcoholic steatohepatitis ND Normal Diet PDGF Platelet derived growth factor PPRA-α Peroxisome proliferator activated receptor-alpha Q-PCR Quantitative Real Time PCR

ROS Reactive oxygen Species RGMc Repulsive Guidance Molecule C α-SMA Alpha smooth muscle actin SDS-PAGE Sodium dodecyl sulfate-polyacrylamide gel electrophoresis SD Standard Deviation TBS Tris Buffered saline TIBC Total iron binding capacity Tf Transferrin TfR1/TfR2 Trasferrin receptor 1/ Transferrin receptor 2 WT Wild Type