A Mathematical Model of the Genetic Code, the Origin of Protein Coding, and the Ribosome As a Dynamical Molecular Machine

Total Page:16

File Type:pdf, Size:1020Kb

Load more

A Mathematical Model of the Genetic Code, the Origin of Protein Coding, and the Ribosome as a Dynamical Molecular Machine Diego L. Gonzalez CNR-IMM Dipar)mento Is)tuto per la di Stas)ca Microele4ronica Università di e i Microsistemi Bologna Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 1 The Origin of the Genetic code and Protein Coding • “The origin of the code is perhaps the most perplexing problem in evolutionary biology. The existing translation machinery is at the same time so complex, so universal and so essential that is hard to see how it could have come into existence, or how life could have existed without it” Smith and Szathmary, “The Major Transitions in Evolution” Oxford university Press, New York (1995). • Is it possible to obtain new insight on this problem on a first principles basis? • “The genetic code is not immediately dictated by any known physics or chemistry…it evokes the scary spectra of irreducible complexity” Wolf and Kooning, “On the origin of the translation system and the genetic code…”, Biol Direct 2, 14 (2007). • We present here a mathematical model of the genetic code that furnishes new first principles insight on the origin of the genetic code and protein coding • The main motivation of our model is the search for error detection/correction mechanisms that should use the redundancy of genetic information Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 2 Fundamental Dogma of Molecular Biology DNA molecules GENETIC CODE PROTEIN Messenger RNA Thymine (T) Uracil (U) Protein Synthesis Adenine, Thymine, Guanine, Cytosine REPLICATION TRANSCRIPTION TRANSLATION Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 3 Symbolic Coding of Genetic Information DNA (T,C,A,G) TACGGCATGGTGATAGCCCTTA ATGCCGTACCACTATCGGGAAT Thymine » Uracil TRANSCRIPTION (mRNA Synthesis) mRNA (U,C,A,G) AUGCCGUACCACUAUCGGGAAU Three-letter groups Codons AUG CCG UAC CAC UAU CGG GAA U Amino acids Met Pro Tyr Gln Tyr Arg Stop TRANSLATION (Protein Synthesis) Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 4 Protein Synthesis Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 5 The Nuclear Genetic Code Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 6 The Genetic Code as a Mapping 64 codons; 4x4x4 = 64 (Words of three letters from an alphabet of four, i.e., A, T, C, G) 20 amino acids + Stop codon (Methyonine represents also the synthesis start signal) Redundancy and Degeneracy follow Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 7 Degeneracy Distribution of the Genetic Code Degeneracy distribu)on inside quartets Cys Euplotes nuclear gene)c code Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 8 Outline 1. Description of the degeneracy distribution of the Euplotes nuclear genetic code with a redundant integer number representation system 2. Isomorphisms and models, the role of symmetries in the construction of a non-power model of the Euplotes nuclear genetic code 3. Modelling of the vertebrate mitochondrial genetic code and the origin of degeneracy in amino acid’s coding Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 9 Outline 1. Description of the degeneracy distribution of the Euplotes nuclear genetic code with a redundant integer number representation system 2. Isomorphisms and models, the role of symmetries in the construction of a non-power model of the Euplotes nuclear genetic code 3. Modelling of the vertebrate mitochondrial genetic code and the origin of degeneracy in amino acid’s coding Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 10 Outline 1. Description of the degeneracy distribution of the Euplotes nuclear genetic code with a redundant integer number representation system 2. Isomorphisms and models, the role of symmetries in the construction of a non-power model of the Euplotes nuclear genetic code 3. Modelling of the vertebrate mitochondrial genetic code and the origin of degeneracy in amino acid’s coding Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 11 Outline 1. Description of the degeneracy distribution of the Euplotes nuclear genetic code with a redundant integer number representation system 2. Isomorphisms and models, the role of symmetries in the construction of a non-power model of the Euplotes nuclear genetic code 3. Modelling of the vertebrate mitochondrial genetic code and the origin of degeneracy in amino acid’s coding Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 12 Mathematical model: integer number representation systems Usual positional notation – power representation systems – base k d5 d4 d3 d2 d1 d0 Digits: di (0, (k-1)) k5 k4 k3 k2 k1 k0 5 4 3 2 1 0 R (integer) = d5k + d4k + d3k + d2k + d1k + d0k m Univocity condition: (k −1)∑k n = k m+1 −1 n=0 Example 1: k=10; decimal system Digits: di (0, 9) 0 0 0 0 1 9 105 104 103 102 101 100 R = 1.101 + 9.100 = 19 Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 13 Redundant representation systems Example 2: Binary power system Digits: di (0, 1) 0 1 0 0 1 1 25 24 23 22 21 20 R = 0.25 + 1.24 + 0.23 + 0.22 + 1.21 + 1.20 = 19 Redundant Power Representations Using Out-of-Range Digits Example 3: Binary signed digits with three possible values: -1, 0, 1 1 -1 0 0 1 1 25 24 23 22 21 20 R = 1.25 + 0.24 - 1.23 + 0.22 + 1.21 - 1.20 = 19 Redundant Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 14 Non-power redundant representation systems posi)onal bases grow slowly than the powers of k Example 4: k=2; Fibonacci system 1 1 1 1 0 1 Digits: di (0, 1) 8 5 3 2 1 1 R = 1.8 + 1.5 + 1.3 + 1.2 + 0.1 + 1.1 = 19 Non-power representation systems are redundant, for example, the number 19 can be represented in the Fibonacci system in another alternative way: Maya 1 1 1 1 1 0 serpent numbers 8 5 3 2 1 1 R = 1.8 + 1.5 + 1.3 + 1.2 + 1.1 + 0.1 = 19 Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 15 Fibonacci’s non-power representation system Degeneracy Number Signed Binary 1 5 2 3 3 4 4 2 5 2 Fibonacci System 1 2 2 4 3 8 4 5 5 2 Genetic Code 1 2 2 12 3 2 4 8 Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 16 Non-power representation system 1,1,2,4,7,8 Represented) Length 6 binary strings Degeneracy distribution number! Non-power representation system ) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) 1,1,2,4,7,8 0) ) 0) 0) 0) 0) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) # of integer Degeneracy 1) ) 0) 0) 0) 0) 0) 1) ) 0) 0) 0) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) numbers 2) ) 0) 0) 0) 0) 1) 1) ) 0) 0) 0) 1) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 2 1 3) ) 0) 0) 0) 1) 0) 1) ) 0) 0) 0) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 4) ) 0) 0) 1) 0) 0) 0) ) 0) 0) 0) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 12 2 5) ) 0) 0) 1) 0) 0) 1) ) 0) 0) 1) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 2 3 6) ) 0) 0) 1) 1) 0) 0) ) 0) 0) 1) 0) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 8 4 7) ) 0) 0) 1) 1) 0) 1) ) 0) 0) 1) 1) 1) 0) ) 0) 1) 0) 0) 0 ) 0) ) ) ) ) ) ) ) 8) ) 0) 1) 0) 0) 0) 1) ) 0) 1) 0) 0) 1) 0) ) 1) 0) 0) 0) 0) 0) ) 0) 0) 1) 1) 1) 1) Unique solution 1,1,2,4,7,8 9) ) 1) 0) 0) 0) 0) 1) ) 1) 0) 0) 0) 1) 0) ) 0) 1) 0) 1) 0) 0) ) 0) 1) 0) 0) 1) 1) 10) ) 0) 1) 0) 1) 0) 1) ) 0) 1) 0) 1) 1) 0) ) 1) 0) 0) 1) 0) 0) ) 1) 0) 0) 0) 1) 1) 11) ) 1) 0) 0) 1) 0) 1) ) 1) 0) 0) 1) 1) 0) ) 0) 1) 1) 0) 0) 0) ) 0) 1) 0) 1) 1) 1) 12) ) 0) 1) 1) 0) 0) 1) ) 0) 1) 1) 0) 1) 0) ) 1) 0) 1) 0) 0) 0) ) 1) 0) 0) 1) 1) 1) 13) ) 1) 0) 1) 0) 0) 1) ) 1) 0) 1) 0) 1) 0) ) 0) 1) 1) 1) 0) 0) ) 0) 1) 1) 0) 1) 1) 14) ) 0) 1) 1) 1) 0) 1) ) 0) 1) 1) 1) 1) 0) ) 1) 0) 1) 1) 0) 0) ) 1) 0) 1) 0) 1) 1) 15) ) 1) 0) 1) 1) 0) 1) ) 1) 0) 1) 1) 1) 0) ) 1) 1) 0) 0) 0) 0) ) 0) 1) 1) 1) 1) 1) Degeneracy distribution 16) ) 1) 1) 0) 0) 0) 1) ) 1) 1) 0) 0) 1) 0) ) 1) 0) 1) 1) 1) 1) ) ) ) ) ) ) ) Euplotes nuclear genetic code 17) ) 1) 1) 0) 0) 1) 1) ) 1) 1) 0) 1) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) # of amino acids Degeneracy 18) ) 1) 1) 0) 1) 0) 1) ) 1) 1) 0) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 19) ) 1) 1) 1) 0) 1) 1) ) 1) 1) 0) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 2 1 20) ) 1) 1) 1) 0) 0) 1) ) 1) 1) 1) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 12 2 21) ) 1) 1) 1) 1) 0) 0) ) 1) 1) 1) 0) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 2 3 22) ) 1) 1) 1) 1) 0) 1) ) 1) 1) 1) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 23) ) 1) 1) 1) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 8 4 ! Workshop on Dynamical Systems and Applicaons BCAM 10-11 December 2013 17 Outline 1.
Recommended publications
  • Recombination and the Evolution of Mutational Robustness

    Recombination and the Evolution of Mutational Robustness

    ARTICLE IN PRESS Journal of Theoretical Biology 241 (2006) 707–715 www.elsevier.com/locate/yjtbi Recombination and the evolution of mutational robustness Andy Gardnera,b,c,Ã, Alex T. Kalinkaa aInstitute of Evolutionary Biology, University of Edinburgh, Edinburgh EH9 3JT, UK bDepartment of Mathematics & Statistics, Queen’s University, Kingston, Ont., Canada K7L 3N6 cDepartment of Biology, Queen’s University, Kingston, Ont., Canada K7L 3N6 Received 25 July 2005; received in revised form 8 December 2005; accepted 5 January 2006 Available online 20 February 2006 Abstract Mutational robustness is the degree to which a phenotype, such as fitness, is resistant to mutational perturbations. Since most of these perturbations will tend to reduce fitness, robustness provides an immediate benefit for the mutated individual. However, robust systems decay due to the accumulation of deleterious mutations that would otherwise have been cleared by selection. This decay has received very little theoretical attention. At equilibrium, a population or asexual lineage is expected to have a mutation load that is invariant with respect to the selection coefficient of deleterious alleles, so the benefit of robustness (at the level of the population or asexual lineage) is temporary. However, previous work has shown that robustness can be favoured when robustness loci segregate independently of the mutating loci they act upon. We examine a simple two-locus model that allows for intermediate rates of recombination and inbreeding to show that increasing the effective recombination rate allows for the evolution of greater mutational robustness. r 2006 Elsevier Ltd. All rights reserved. Keywords: Canalization; Epistasis; Linkage disequilibrium; Multilocus methodology; Mutation–selection balance 1.
  • Antigen-Receptor Degeneracy and Immunological Paradigms Irun R

    Antigen-Receptor Degeneracy and Immunological Paradigms Irun R

    Molecular Immunology 40 (2004) 993–996 Antigen-receptor degeneracy and immunological paradigms Irun R. Cohen a,∗, Uri Hershberg b, Sorin Solomon c a The Department of Immunology, The Weizmann Institute of Science, Rehovot, 76100 Israel b Interdisciplinary Center for Neuronal Computation, The Hebrew University of Jerusalem, Jerusalem, Israel c The Racah Institute of Physics, The Hebrew University of Jerusalem, Jerusalem, Israel Abstract This paper discusses some consequences of the discovery that antigen receptors are degenerate: Immune specificity, in contrast to the tenets of the clonal selection paradigm, must be generated by the immune response down-stream of initial antigen recognition; and specificity is a property of a collective of cells and not of single clones. © 2003 Elsevier Ltd. All rights reserved. Keywords: T cells; T-cell receptor; Inflammation; Specificity; Degeneracy; Clonal selection; Cognitive paradigm 1. Degeneracy problems characterized by extreme poly-clonality; in fact, most nat- ural T-cell responses are oligo-clonal (Douek et al., 2003). Degeneracy, in the present discourse, refers to the capac- So, there must be a mechanism or mechanisms that operate ity of any single antigen receptor to bind and respond to to restrict poly-clonality in wild-type adaptive immune sys- (recognize) many different ligands. The Oxford English Dic- tems. The inherent potential for extreme poly-clonality, in tionary (Second Edition, 1989) defines the primary meaning practice, may be tempered by clonal competition. Compe- of degeneracy as: tition among clones for access, energy or space will most likely reward the fast and the avid. Since the best clones Having lost the qualities proper to the race or kind; having should win, clonal competition does not threaten the logic declined from a higher to a lower type; hence, declined of the clonal selection theory (CST) of adaptive immunity.
  • Multiple Receptor Tyrosine Kinases Are Expressed in Adult Rat Retinal Ganglion Cells As Revealed by Single-Cell Degenerate Primer Polymerase Chain Reaction

    Multiple Receptor Tyrosine Kinases Are Expressed in Adult Rat Retinal Ganglion Cells As Revealed by Single-Cell Degenerate Primer Polymerase Chain Reaction

    Upsala Journal of Medical Sciences. 2010; 115: 65–80 ORIGINAL ARTICLE Multiple receptor tyrosine kinases are expressed in adult rat retinal ganglion cells as revealed by single-cell degenerate primer polymerase chain reaction NICLAS LINDQVIST1, ULRIKA LÖNNGREN1, MARTA AGUDO2,3, ULLA NÄPÄNKANGAS1, MANUEL VIDAL-SANZ2 & FINN HALLBÖÖK1 1Department of Neuroscience, Unit for Developmental Neuroscience, Biomedical Center, Uppsala University, 75123 Uppsala, Sweden, 2Departamento de Oftalmología, Facultad de Medicina, Universidad de Murcia, Murcia, Spain, and 3Fundación para la Formación e Investigación Sanitaria de la Región de Murcia, Hospital Universitario Virgen de la Arrixaca, Murcia, Spain Abstract Background. To achieve a better understanding of the repertoire of receptor tyrosine kinases (RTKs) in adult retinal ganglion cells (RGCs) we performed polymerase chain reaction (PCR), using degenerate primers directed towards conserved sequences in the tyrosine kinase domain, on cDNA from isolated single RGCs univocally identified by retrograde tracing from the superior colliculi. Results. All the PCR-amplified fragments of the expected sizes were sequenced, and 25% of them contained a tyrosine kinase domain. These were: Axl, Csf-1R, Eph A4, Pdgfrb, Ptk7, Ret, Ros, Sky, TrkB, TrkC, Vegfr-2, and Vegfr-3. Non-RTK sequences were Jak1 and 2. Retinal expression of Axl, Csf-1R, Pdgfrb, Ret, Sky, TrkB, TrkC, Vegfr-2, and Vegfr-3, as well as Jak1 and 2, was confirmed by PCR on total retina cDNA. Immunodetection of Csf-1R, Pdgfra/b, Ret, Sky, TrkB, and Vegfr-2 on retrogradely traced retinas demonstrated that they were expressed by RGCs. Co-localization of Vegfr-2 and Csf-1R, of Vegfr-2 and TrkB, and of Csf-1R and Ret in retrogradely labelled RGCs was shown.
  • Degeneracy in Hippocampal Physiology and Plasticity

    Degeneracy in Hippocampal Physiology and Plasticity

    bioRxiv preprint doi: https://doi.org/10.1101/203943; this version posted July 30, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Degeneracy in hippocampal physiology and plasticity * Rahul Kumar Rathour and Rishikesh Narayanan Cellular Neurophysiology Laboratory, Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India. * Corresponding Author Rishikesh Narayanan, Ph.D. Molecular Biophysics Unit Indian Institute of Science Bangalore 560 012, India. e-mail: [email protected] Phone: +91-80-22933372 Fax: +91-80-23600535 Abbreviated title: Degeneracy in the hippocampus Keywords: hippocampus; degeneracy; learning; memory; encoding; homeostasis; plasticity; physiology; causality; reductionism; holism; structure-function relationships; variability; compensation; intrinsic excitability 1 bioRxiv preprint doi: https://doi.org/10.1101/203943; this version posted July 30, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Degeneracy, defined as the ability of structurally disparate elements to perform analogous function, has largely been assessed from the perspective of maintaining robustness of physiology or plasticity. How does the framework of degeneracy assimilate into an encoding system where the ability to change is an essential ingredient for storing new incoming information? Could degeneracy maintain the balance between the apparently contradictory goals of the need to change for encoding and the need to resist change towards maintaining homeostasis? In this review, we explore these fundamental questions with the mammalian hippocampus as an example encoding system. We systematically catalog lines of evidence, spanning multiple scales of analysis, that demonstrate the expression of degeneracy in hippocampal physiology and plasticity.
  • An Interdisciplinary Perspective on Artificial Immune Systems

    An Interdisciplinary Perspective on Artificial Immune Systems

    Evol. Intel. (2008) 1:5–26 DOI 10.1007/s12065-007-0004-2 REVIEW ARTICLE An interdisciplinary perspective on artificial immune systems J. Timmis Æ P. Andrews Æ N. Owens Æ E. Clark Received: 7 September 2007 / Accepted: 11 October 2007 / Published online: 10 January 2008 Ó Springer-Verlag 2008 Abstract This review paper attempts to position the area 1 Introduction of Artificial Immune Systems (AIS) in a broader context of interdisciplinary research. We review AIS based on an Artificial Immune Systems (AIS) is a diverse area of established conceptual framework that encapsulates math- research that attempts to bridge the divide between ematical and computational modelling of immunology, immunology and engineering and are developed through abstraction and then development of engineered systems. the application of techniques such as mathematical and We argue that AIS are much more than engineered systems computational modelling of immunology, abstraction from inspired by the immune system and that there is a great those models into algorithm (and system) design and deal for both immunology and engineering to learn from implementation in the context of engineering. Over recent each other through working in an interdisciplinary manner. years there have been a number of review papers written on AIS with the first being [25] followed by a series of others Keywords Artificial immune systems Á that either review AIS in general, for example, [29, 30, 43, Immunological modelling Á Mathematical modelling Á 68, 103], or more specific aspects of AIS such as data Computational modelling Á mining [107], network security [71], applications of AIS Applications of artificial immune systems Á [58], theoretical aspects [103] and modelling in AIS [39].
  • Degeneracy and Genetic Assimilation in RNA Evolution Reza Rezazadegan1* and Christian Reidys1,2

    Degeneracy and Genetic Assimilation in RNA Evolution Reza Rezazadegan1* and Christian Reidys1,2

    Rezazadegan and Reidys BMC Bioinformatics (2018) 19:543 https://doi.org/10.1186/s12859-018-2497-3 RESEARCH ARTICLE Open Access Degeneracy and genetic assimilation in RNA evolution Reza Rezazadegan1* and Christian Reidys1,2 Abstract Background: The neutral theory of Motoo Kimura stipulates that evolution is mostly driven by neutral mutations. However adaptive pressure eventually leads to changes in phenotype that involve non-neutral mutations. The relation between neutrality and adaptation has been studied in the context of RNA before and here we further study transitional mutations in the context of degenerate (plastic) RNA sequences and genetic assimilation. We propose quasineutral mutations, i.e. mutations which preserve an element of the phenotype set, as minimal mutations and study their properties. We also propose a general probabilistic interpretation of genetic assimilation and specialize it to the Boltzmann ensemble of RNA sequences. Results: We show that degenerate sequences i.e. sequences with more than one structure at the MFE level have the highest evolvability among all sequences and are central to evolutionary innovation. Degenerate sequences also tend to cluster together in the sequence space. The selective pressure in an evolutionary simulation causes the population to move towards regions with more degenerate sequences, i.e. regions at the intersection of different neutral networks, and this causes the number of such sequences to increase well beyond the average percentage of degenerate sequences in the sequence space. We also observe that evolution by quasineutral mutations tends to conserve the number of base pairs in structures and thereby maintains structural integrity even in the presence of pressure to the contrary.
  • Tyrosine Kinases

    Tyrosine Kinases

    KEVANM SHOKAT MINIREVIEW Tyrosine kinases: modular signaling enzymes with tunable specificities Cytoplasmic tyrosine kinases are composed of modular domains; one (SHl) has catalytic activity, the other two (SH2 and SH3) do not. Kinase specificity is largely determined by the binding preferences of the SH2 domain. Attaching the SHl domain to a new SH2 domain, via protein-protein association or mutation, can thus dramatically change kinase function. Chemistry & Biology August 1995, 2:509-514 Protein kinases are one of the largest protein families identified, This is a result of the overlapping substrate identified to date; over 45 new members are identified specificities of many tyrosine kinases, which makes it each year. It is estimated that up to 4 % of vertebrate pro- difficult to dissect the individual signaling pathways by teins are protein kinases [l].The protein kinases are cate- scanning for unique target motifs [2]. gorized by their specificity for serineithreonine, tyrosine, or histidine residues. Protein tyrosine kinases account for The apparent promiscuity of individual tyrosine kinases roughly half of all kinases. They occur as membrane- is a result of their unique structural organization. bound receptors or cytoplasmic proteins and are involved Enzyme specificity is typically programmed by one in a wide variety of cellular functions, including cytokine binding site, which recognizes the substrate and also con- responses, antigen-dependent immune responses, cellular tains exquisitely oriented active-site functional groups transformation by RNA viruses, oncogenesis, regulation that help to lower the energy of the transition state for of the cell cycle, and modification of cell morphology the conversion of specific substrates to products.Tyrosine (Fig.
  • A Numerical Representation and Classification of Codons To

    A Numerical Representation and Classification of Codons To

    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.02.971036; this version posted March 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A Numerical Representation and Classication of Codons to Investigate Codon Alternation Patterns during Genetic Mutations on Disease Pathogenesis Antara Senguptaa, Pabitra Pal Choudhuryd, Subhadip Chakrabortyb,e, Swarup Royc,∗∗, Jayanta Kumar Dasd,∗, Ditipriya Mallicke, Siddhartha S Janae aDepartment of Master of Computer Applications, MCKV Institute of Engineering, Liluah, India bDepartment of Botany, Nabadwip Vidyasagar College, Nabadwip, India cDepartment of Computer Applications,Sikkim University, Gangtok, Sikkim, India dApplied Statistical Unit, Indian Statistical Institute, Kolkata, India eSchool of Biological Sciences, Indian Association for the Cultivation of Science, Kolkata, India 1. Introduction Genes are the functional units of heredity [4]. It is mainly responsible for the structural and functional changes and for the variation in organisms which could be good or bad. DNA (Deoxyribose Nucleic Acid) sequences build the genes of organisms which in turn encode for particular protein us- ing codon. Any uctuation in this sequence (codons), for example, mishaps during DNA transcription, might lead to a change in the genetic code which alter the protein synthesis. This change is called mutation. Mutation diers from Single Nucleotide Polymorphism(SNP) in many ways [23]. For instance, occurrence of mutation in a population should be less than 1% whereas SNP occurs with greater than 1%. Mutation always occurs in diseased group whereas SNP is occurs in both diseased and control population. Mutation is responsible for some disease phenotype but SNP may or may not be as- sociated with disease phenotype.
  • The Immune System in Pieces: Computational Lessons from Degeneracy in the Immune System (Special Session: Foundations of Artificial Immune Systems) M

    The Immune System in Pieces: Computational Lessons from Degeneracy in the Immune System (Special Session: Foundations of Artificial Immune Systems) M

    Proceedings of the 2007 IEEE Symposium on Foundations of Computational Intelligence (FOCI 2007) The Immune System in Pieces: Computational Lessons from Degeneracy in the Immune System (Special session: Foundations of Artificial Immune Systems) M. Mendao∗, J. Timmis∗†, P. S. Andrews∗ and M. Davies‡ ∗Department of Computer Science, University of York, Heslington, York, UK Email: [email protected] †Department of Electronics, University of York, Heslington, York, UK ‡Jenner Institute, University of Oxford. UK Abstract— The concept of degeneracy in biology, including the of the immune response. The next stage is to develop a high- immune system, is well accepted and has been demonstrated to level algorithm that is derived from the model. Independently, be present at many different levels. We explore this concept from recent work by Bersini [7] has highlighted the benefits of a computational point of view and demonstrate how we can use computational models of degeneracy to aid the development of adopting object orientated methodologies in the use of mod- more biologically plausible Artificial Immune Systems (AIS). The elling biological systems. In our work, we have made use of outcome of these models has lead us to perform an analysis of the the Unified Modelling language (UML), not only to represent receptor dynamics in the model and we discuss the computational our agent model, but also to aid the development of a high- implications of a “degenerate” repertoire. Through the use of level algorithm that we have derived from the model. It should the Unified Modelling language (UML) we have abstracted a high level immune inspire algorithm that will be used as part of be noted that the model we have developed and the high-level a larger project to develop an immune inspired bioinformatics algorithm that we have derived is only the first step towards the system.
  • Network, Degeneracy and Bow Tie. Integrating Paradigms And

    Network, Degeneracy and Bow Tie. Integrating Paradigms And

    Tieri et al. Theoretical Biology and Medical Modelling 2010, 7:32 http://www.tbiomed.com/content/7/1/32 RESEARCH Open Access Network, degeneracy and bow tie. Integrating paradigms and architectures to grasp the complexity of the immune system Paolo Tieri1,2*, Andrea Grignolio1, Alexey Zaikin3, Michele Mishto1,4, Daniel Remondini1, Gastone C Castellani1, Claudio Franceschi1,2 * Correspondence: [email protected] Abstract 1Interdept. Center “Luigi Galvani” for Bioinformatics, Biophysics and Recently, the network paradigm, an application of graph theory to biology, has pro- Biocomplexity (CIG), University of ven to be a powerful approach to gaining insights into biological complexity, and Bologna, Via F. Selmi 3, 40126 Bologna, Italy has catalyzed the advancement of systems biology. In this perspective and focusing on the immune system, we propose here a more comprehensive view to go beyond the concept of network. We start from the concept of degeneracy, one of the most prominent characteristic of biological complexity, defined as the ability of structurally different elements to perform the same function, and we show that degeneracy is highly intertwined with another recently-proposed organizational principle, i.e. ‘bow tie architecture’. The simultaneous consideration of concepts such as degeneracy, bow tie architecture and network results in a powerful new interpretative tool that takes into account the constructive role of noise (stochastic fluctuations) and is able to grasp the major characteristics of biological complexity, i.e. the capacity to turn an apparently chaotic and highly dynamic set of signals into functional information. Background - the complexity of the immune system The vertebrate immune system (IS) is the result of a long evolutionary history and has a fundamental role in host defence against bacteria, viruses and parasites.
  • Histone Methylation Regulation in Neurodegenerative Disorders

    Histone Methylation Regulation in Neurodegenerative Disorders

    International Journal of Molecular Sciences Review Histone Methylation Regulation in Neurodegenerative Disorders Balapal S. Basavarajappa 1,2,3,4,* and Shivakumar Subbanna 1 1 Division of Analytical Psychopharmacology, Nathan Kline Institute for Psychiatric Research, Orangeburg, NY 10962, USA; [email protected] 2 New York State Psychiatric Institute, New York, NY 10032, USA 3 Department of Psychiatry, College of Physicians & Surgeons, Columbia University, New York, NY 10032, USA 4 New York University Langone Medical Center, Department of Psychiatry, New York, NY 10016, USA * Correspondence: [email protected]; Tel.: +1-845-398-3234; Fax: +1-845-398-5451 Abstract: Advances achieved with molecular biology and genomics technologies have permitted investigators to discover epigenetic mechanisms, such as DNA methylation and histone posttransla- tional modifications, which are critical for gene expression in almost all tissues and in brain health and disease. These advances have influenced much interest in understanding the dysregulation of epigenetic mechanisms in neurodegenerative disorders. Although these disorders diverge in their fundamental causes and pathophysiology, several involve the dysregulation of histone methylation- mediated gene expression. Interestingly, epigenetic remodeling via histone methylation in specific brain regions has been suggested to play a critical function in the neurobiology of psychiatric disor- ders, including that related to neurodegenerative diseases. Prominently, epigenetic dysregulation currently brings considerable interest as an essential player in neurodegenerative disorders, such as Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease (HD), Amyotrophic lateral sclerosis (ALS) and drugs of abuse, including alcohol abuse disorder, where it may facilitate connections between genetic and environmental risk factors or directly influence disease-specific Citation: Basavarajappa, B.S.; Subbanna, S.
  • Human Epigenetic Aging Is Logarithmic with Time Across the Entire Lifespan

    Human Epigenetic Aging Is Logarithmic with Time Across the Entire Lifespan

    bioRxiv preprint doi: https://doi.org/10.1101/401992; this version posted August 29, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Human Epigenetic Aging is Logarithmic with Time across the Entire LifeSpan Sagi Snir1 and Matteo Pellegrini2z 1Dept. of Evolutionary Biology, University of Haifa, Israel; 2Dept. of Molecular, Cell and Developmental Biology; University of California, Los Angeles, CA 90095, USA; Abstract It is well established that organisms undergo epigenetic changes both during develop- ment and aging. Developmental changes have been extensively studied to characterize the differentiation of stem cells into diverse lineages. Epigenetic changes during aging have been characterized by multiple epigenetic clocks, that allow the prediction of chronolog- ical age based on methylation status. Despite their accuracy and utility, epigenetic age biomarkers leave many questions about epigenetic aging unanswered. Specifically, they do not permit the unbiased characterization of non-linear epigenetic aging trends across entire life spans, a critical question underlying this field of research. Here we a provide an integrated framework to address this question. Our model, inspired from evolutionary models, is able to account for acceleration/deceleration in epigenetic changes by fitting an individuals model age, the epigenetic age, which is related to chronological age in a non-linear fashion. We have devised a two stage procedure leveraging these model ages to infer aging trends over the entire lifespan of a population. Application of this procedure to real data measured across broad age ranges, from before birth to old age, and from two tissue types, suggests a universal logarithmic trend characterizes epigenetic aging across entire lifespans.