Pseudomonas Syringae Actinidiae, Xylella CPBF793 , Pv

National Institute for Agrarian and Veterinary Research (INIAV) (www.iniav.pt)

National Reference Laboratory for Plant Health UW175 UW070 UW167 1.00 UW9 Lab Main activities P3 332 I R633 LB1 NCPPB3987 Ant307 BS025 Research on quarantine and quality phytopathogenic PD1939 BR855 UW224 BR629 bacteria of national and regional interest (phenetic UW344 CPBF833 UW298 CPBF915 diversity, diagnosis and epidemiology) UW505 PD1100 JT516 CPBF568 CPBF785 Support to national phtyossanitary authority (definition of PD 1941 CPBF850 CPBF894 CPBF933 national control plans for quarantine bacteria, sampling1.00 CPBF836 BR113 CPBF914 BS048 procedures and diagnostics) UW365 UW51 WP306 BS024 Ralstonia solanacearum UW448 Analysis of Q-bacteria ( , MAFF301556 UW152 CPBF923 Clavibacter michiganensis sepedonicus Erwinia PD441 subsp. , CPBF869 UW296 CPBF917 amylovora Pseudomonas syringae actinidiae, Xylella CPBF793 , pv. CPBF759 UW72 AW fastidiosa; Huanlonbing UW134 ) ICMP7963 K60 0.99 CFBP2047 Phyl ICMP9600 Scientific and technical suport to official national/regional CPBF1192 CPBF674 bhr c BS095 UW469 laboratories (diagnostic procedures, training) DAR64836 CFBP715 CFBP712 BR574 Dissemination of knowledge to stakeholders and regional CFBP2958 inpectors (lectures and technical courses) Support to community (Plant Clinics)

Bacterial canker of kiwi caused by Pseudomonas syringae pv. actinidiae in Portugal – Disease Importance and pathogen characterization

Leonor Cruz1,3, Joana Cruz1,3, Camila Fernandes1,4, Gisela Chicau2, Rogério Tenreiro3

1 Instituto Nacional de Investigação Agrária e Veterinária, UEIS-SAFSV – Laboratório de Fitobacteriologia, Quinta do Marquês, Oeiras; 2 DRAPN –Divisão de Apoio ao Sector Agroalimentar, Senhora da Hora, Porto; 3Universidade de Lisboa, Faculdade de Ciências, Centro de Biodiversidade22/04/2013 Genómica Integrativa e Funcional (BioFiG); 4Universidade do Porto, Faculdades de Ciências, Campo Alegre, Porto. [email protected]

EAP Meeting - Copenhagen 23 October 2015  Symptoms

Leaves Branches

4  Symptoms Main risk factors in the area Flowers  Presence of high levels of

inoculum

 High number of orchards  Presence of very susceptible cultivars (A. chinensis)

 Temperature >15ºC during blooming

 Presence of polinators

 High HR

5  Bacterial canker of kiwi

Major and minor hosts

Actinidia chinensis Actinidia deliciosa (summer kiwi, (kiwi, Chinese Actinidia arguta Actinidia kolomikta chinese kiwi) gooseberry)

Bacteria Proteobacteria Gama-Proteobacteria Pseudomonadales Pseudomonadaceae Pseudomonas sp. Classified in to 4 biovars based on phenotipic and genomic characteristics

6  Portuguese situation

Reynaud (2011) EPPO PRA Portugal Balestra et al. 2010d: disease incidence as high as 30% was noted in 2010 and incidence has increased up to 80% in 2011 (Renzi et al., 2011).

ano 2010 2011 2012 2013

nº total 10 175 71 293 pos 6 15 30 140 % 60% 9% 42% 48%

Portuguese Control Plan P. syringae pv. actinidiae Progression of P. syringae pv. actinidiae infections in Latina (Vanneste et al. 2011b). (circulo = 1km)

7  Incidence

03/2010 – First identification (Santa Maria da Feira), in plant material imported sent by Direcção Regional de Agricultura do Norte (DRAPN)

2010-2012 Orchards Nurseries neg pos freq. rel neg pos freq. Rel TOTAL 44 42 48,84 156 6 3,70 Hayward 16 20 55,56 45 1 2,17 Bo Erica 4 0 0,00 15 0 0,00 Ciften 2 2 50,00 0 0 0,00 Summer kiwi 1 2 66,67 0 0 0,00 Tumori P1 3 2 40,00 38 2 5,00 p.e. D1 0 0 0,00 7 3 30,00 nd 18 16 47,06 7 0 0,00 Soreli 0 0 0,00 25 0 0,00 Belen 0 0 0,00 12 0 0,00 Tsechelidis 0 0 0,00 4 0 0,00

8  Portuguese situation

9  Sampling

 Kiwi area in north Portugal – 1500ha  Comission Decision n.º 2012/756/EU  Definition of portuguese contaminated and disease free areas  Definition of a sampling strategy  National Control Plan - surveillance of orchards, nurseries and garden centres  Training courses for farmers and inspectors  Research

10 IDiagnosis

Samples from orchards, nurseries and imported propagation materials aprox. 1000 (2010-2013)  84 selected isolates from North and Center regions  Diagnosis - internal method based on OEPP PM7/120(1)  Extraction from leaves, branches, fruits and roots  Isolation on KMB  Conventional PCR Scortichini et al., 2002 or Rees-Gerge et al., 2010 PAV 1 GGCGACGATCCGTAACTGGTCTGAGA 760 bp P 22 TTCCCGAAGGCACTCCTCTATCTCTAAAG Gallelli et al., 2011 KN-F (5’ – CACGATACATGGGCTTATGC – 3’) 492 bp KN-R (5’ – CTTTTCATCCACACACTCCG – 3’) AvrDdpx-F (5’ – TTTCGGTGGTAACGTTGGCA – 3’) 230 bp AvrDdpx-R (5’ – TTCCGCTAGGTGAAAAATGGG – 3’)

IIdentification

PCR Scor 760 bp

PCR Gal 492 bp 230 bp

PCR Gal Biovar symptoms esculin coronatin phaseolotoxin PCR Scor (bands)

1 ramos/folhas - - + + 2 2 ramos/folhas - + - + 2 3 ramos/folhas - - - + 2 4 folhas + - - + 1

12 IGenomic characterization

Bv1 Bv2 Bv3 Bv4

1Kb plus 1373 Psa 1374 Psa 1375 Psa 1416 Psa 1377 Psa 1393 Psa 1395 Psa 1396 Psa 1Kb plus

Psa 1372 Psa Psa 1371 Psa Psa 1370 Psa Psa 1369 Psa Psa 1368 Psa Psa 1367 Psa Psa 1366 Psa Psa 1365 Psa 1Kb plus – – – – – – – – –

– – – – – – – – – L10 L11 L12 L13 L14 L15 L16 L17 L18 L19 – L9 L8 L7 L6 L5 L4 L3 L2 L1

(Cunty et al., 2015

IGenomic characterization

box_todas (82 entries) Box 86 Box A1R 74 Lows et al. (1994)

70 72 69 69

85 70 83 64 71 67 68 62 68 85 91 61 64 71 60 59 92 77 67 91 68 74 76 75 96 80 80 70 75 77 72 59 55 96 94 75

59 87 58 95 59 72 58 51 88 100

Box

1396 1357 1436 1443 1442 1360 1359 1331 1356 1332 1330 1329 1322 1305 1328 1326 1327 1325 1371 1393 1395 1375 1373 1377 1372 1416 1374 1369 1365 1366 1367 1370 1368 1364 1362 1413 1405 1401 1400 1402 1399 1408 1406 1410 1407 1398 1397 1414 1411 1415 1412 1423 1422 1420 1419 1418 1421 1417 1437 1435 1439 1440 1438 1434 1449 1447 1450 1376 1424 1441 1444 1446 1445 1429 1428 1425 1427 1452 1430 1433 1432 1431 CPB

Guimarães Amarante Braga Anadia Amarante Amarante Vila Meã Lousada MariaSanta da Feira de Paiva Castelo Valongo Barcelos Arouca Arouca Maia de Paiva Castelo Felgueiras Arouca do Bairro Oliveira de Paiva Castelo de Paiva Castelo MariaSanta da Feira do Bairro Oliveira Maia Anadia Tinto Rio Felgueiras Braga Gondomar Maia Gondomar Maia Vila Verde Braga Vila Verde Vila Verde Guimarães Guimarães Felgueiras Felgueiras Felgueiras Felgueiras de Bastos Celorico de Bastos Celorico Felgueiras Felgueiras Felgueiras Felgueiras Felgueiras Amares do Lanhoso Póvoa Amares Amares Amares do Lanhoso Póvoa Águeda Cantanhede da Bairro Oliveira Arouca de Bastos Celorico Amarante Anadia da Bairro Oliveira Cantanhede Vila Verde Vila Verde Penafiel Penafiel Vagos Fafe do Lanhoso Póvoa de Lima Ponte de Lima Ponte Origin V Geographical

2013 2012 2013 2013 2013 2012 2012 2011 2012 2011 2011 2011 2011 2010 2011 2011 2011 2011 2012 2013 2013 2012 2012 2012 2012 2013 2012 2012 2012 2012 2012 2012 2012 2012 2012 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2012 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 2013 of Year

MW 1305 1322 1325 1326 1327 C- Pst Coronatin production

(Cfl) (Bereswill et al.,

1994) PCR Gal 492 bp

Lack of the specific band

for the 84 strains of 230 bp P. syringae pv. actinidiae tested Presence of strains from “biovar 4” C+ - Pst (CFBP 2212)

14 IDiagnosis

Decision scheme

1 . Sample preparation Orchard sub-samples of male and female plants 2 – Screening tests Isolation on KMB and conventional PCR (Scortichini et al 2002; Rees-George et al., 2010)

3 – Identification of colonies by Galleli et al. (2011)

4 – Confirmation by Real - time PCR (Gallelli et al., 2013) (EUPHRESCO II – PSADID)

IResearch

EUPHRESCO II - European Phytossanitary Research Coordination II

Partner Country

Development and harmonization of methods for diagnosis, detection and identification of Pseudomonas syringae pv. actinidiae (2013-2015) Resultados previstos:  Implementation of new tools for the diagnosis of Psa in symptomatic a asymptomatic plant material  Validation of a sampling protocol  Epidemiological knowledge of Pseudomonas syringae pv. actinidiae in distinct areas of Europe

I Phylogenetic Characterization

ICMP 19073 Biovar 2; Korea; 1998 CPBF 1428; Portugal; 2013 rpoD Neighbor-Joining phylogenetic tree using CFBP 7811 Biovar 3; New Zealand; 2010 CFBP 7287; Biovar 3; Italy; 2008 MEGA5 of 19 selected Portuguese isolates and CFBP 4909; Biovar 1; Japan; 1984 Italy 30 selected g worldwide strains according to NCPPB 3871; Biovar 1; Italy; 1992 CFBP 8052; Biovar 3; France; 2012 1st Focus – 1992 Parkinson et al. (2011). Bootstrap test (1000 CPBF 1439; Portugal; 2013 CPBF 1367; Portugal; 2012 2nd Focus – 2008 replicates) are shown next to the branches. CPBF 1447; Portugal; 2013 Evolutionary distances were computed using the CPBF 1364; Portugal; 2012 Estirpes com características CPBF 1433; Portugal; 2013 Jukes-Cantor method. CPBF 1411; Portugal; 2013 CPBF 1400; Portugal; 2013 fisiológicas (produção de CPBF 1329; Portugal; 2011 CPBF 1366; Portugal; 2012 faseolotoxina e coronatina) e Biovares 1, 2 e 3 ICMP 19439; Biovar 3; Chile; 2010 ICMP 19455; Biovar 3; Chile; 2010 genómicas distintas (genes CPBF 1371; Portugal; 2012 98 CPBF 1406; Portugal; 2013 constitutivos e de virulência) CPBF 1444; Portugal; 2013 CPBF 1442; Portugal; 2013 ICMP 19457; Biovar 3; Chile; 2010 ICMP 19456; Biovar 3; Chile; 2010 CRA-FRU 10.22; Biovar 3; Italy; 2008 Portugal ICMP 19076; Biovar 3; New Zealand; 2011 ICMP 19072; Biovar 2; Korea; 1997 1st Identification – 2010 ICMP 18743; Biovar 3; Italy; 2010 ICMP 9855; Biovar 1; Japan; 1984 Identification of the bacterium in ICMP 18744; Biovar 3; Italy; 2010 ICMP 18745; Biovar 3; Italy; 2010 ICMP 19071; Biovar 2; Korea; 1997 orchards with more than 10 years ICMP 19068; Biovar 1; Japan; 1988 ICMP 19070; Biovar 1; Japan; 1987 ICMP 19069; Biovar 1; Japan; 1984 CPBF 1414; Portugal; 2013 Sequenciação de 1 isolado CPBF 1372; Portugal; 2012 CPBF 1422; Portugal; 2013 Português obtido em 2010 CPBF 1421; Portugal; 2013 CPBF 1326; Portugal; 2011 ICMP 19440; Biovar 4; Australia; 2011 ICMP 19441; Biovar 4; Australia; 2011 ICMP 18882; Biovar 4; New Zealand; 2010 ICMP 19486; Biovar 4; Australia; 1990 87 CFBP 7905; Biovar 4; New Zealand; 2010 CFBP 8043; Biovar 4; France; 2011 Biovar 4 CFBP 8045; Biovar 4; Australia; 1990 CFBP 8046; Biovar 4; Australia 2011 CFBP2212 Pseudomonas syringae pv. tomato Pst type strain 0.002

17 IConclusions

 Between 2010 and 2013 more than 100 isolates of Pseudomonas syringae pv. actinidiae were collected from orchards nurseries and imported propagation materials.  The use of two conventional PCR protocols allowed identifying all known biovars of Pseudomonas syringae pv. actinidiae.  The use of primers directed to genes responsible for the production of the toxins coronatin (Cfl) and/or phaseolotoxin (argK) allow to exclude the presence of biovar 2 among Portuguese strains.  BOX PCR fingrprinting profiles were characteristic of biovar 3 for most of the strains tested  The phylogenetic tree generated by rpoD confirms the association of the selected strains as belonging to biovar 3.  The lack of avrD1 amplification indicates the presence of a small population of biovar 4 strains alocated recently to Pseudomonas syringae pv. actinidifoliorum.

18 Obrigada!

Instituto Nacional de Investigação Agrária e Veterinária, I.P. Av. da República, Quinta do Marquês, 2780-157 Oeiras, Portugal Tel: (+ 351) 21 440 35 00 - Fax: (+ 351) 21 440 36 66 www.iniav.pt