DAUGAVPILS UNIVERSITY INSTITUTE OF LIFE SCIENCES AND BIOTECHNOLOGY

Sanita Kecko

TRADE -OFFS BETWEEN GROWTH , IMMUNITY , FOOD QUALITY AND MICROBIOME SYMBIONTS IN THE LARVAE OF THE GREATER WAX MOTH (GALLERIA MELLONELLA )

KOMPROMISI STARP VASK A KOŽU (GALLERIA MELLONELLA ) KĀPURU AUGŠANU , IM ŪNSIST ĒMAS DARB ĪBA S EFEKTIVIT ĀTI , BAR ĪBAS KVALIT ĀTI UN MIKROBIOMA SIMBIONTI EM

Doctoral Thesis Submitted for the Degree of Doctor in Biology (Subfield: Ecology)

Scientific supervisor Indri ķis Krams, Dr. biol.

Daugavpils 2021

Department of Biotechnology, Institute of Life Sciences and Biotechnology, University of Daugavpils, Latvia.

Type of work: doctoral thesis (a set of publications) in biology, the branch of ecology.

The thesis was carried out at University of Daugavpils in 2014-2018.

Supervisor : Dr. biol. Indri ķis Krams (University of Daugavpils, Latvia)

Opponents: 1. 2. 3.

The Head of the Promotion Council : Dr. biol., Prof. Arv īds Barševskis

Commencement : ZOOM platform, University of Daugavpils, Daugavpils, on ______, 2021, at ______a.m.

The Doctoral Thesis and it`s summary are available at the library of University of Daugavpils, Par ādes iel ā 1, Daugavpils and DU website: ______

Comments are welcome. Send them to the secretary of the Promotion Council, Par ādes 1, Daugavpils, LV5401; mob. +37126002593; e-mail: [email protected].

Secretary of the Promotion Council: Dr. biol. Jana Paidere, researcher at University of Daugavpils.

SATURS

PUBLIK ĀCIJU SARAKSTS ...... 4 1. IEVADS ...... 5 1.1. Bar ība, augšana un dz īvības strat ēģ ijas ...... 5 1.2. Kompromiss starp im ūnsist ēmas darb ības efektivit āti un bar ības pieejam ību ...... 5 1.3. Resursi, kompens ējoš ā augšana un nepiln īga att īst ība ...... 6 1.4. Bar ības pieejam ība, nepietiekams uzturs un mikrobioms k ā im ūnsist ēmas sast āvda ļa ...... 7 1.5. Promocijas darba m ērķi un uzdevumi ...... 8 2. MATERI ĀLI UN METODES ...... 10 2.1.P ētījuma objekts ...... 10 2.2. Dzimuma noteikšana un sv ēršana ...... 10 2.3. Eksperiment ālās grupas un barošanas rež īmi ...... 10 2.4. Inkapsul ācijas stiprums ...... 11 2.6. Kvantitat īvā re āla laika P ĶR (III, IV)...... 11 2.7. 16S V3 rRNS gēna amplifik ācija un sekven ēšana (IV) ...... 12 2.8. Bakt ēriju kultiv ēšana (IV)...... 12 2.9. Zarnu mikrobiomaelimin ācija(IV) ...... 12 3. REZULT ĀTI ...... 13 3.1. Bar ības uzturv ērt ība, att īst ības laiks un inkapsul ācijas reakcijas stiprums(I)...... 13 3.2. Ar dzimumu saist īta kompens ējoš ā augšana (II) ...... 15 3.3. Bar ībasuzturv ērt ības un imunsist ēmas aktiviz ācijas ietekme uz antimikrobi ālo pept īdu g ēnu ekspresij ām (III) ...... 17 3.4. Bar ības uzturv ērt ība, antibiotikas un AMPg ēnu ekspresija (IV) ...... 20 3.5. 16S rRNA g ēna V3 rajona taksonomisk ā sast āva anal īze (IV) ...... 21 3.6. Enterococci kultiv ēšana (IV) ...... 21 4. DISKUSIJA ...... 23 4.1. Kompromisi starp dz īvības strat ēģ ijas paz īmēm un G. mellonella kāpuru att īst ību(I, II) ...... 23 4.2. G. mellonella kompens ējoš ā augšana(II) ...... 23 4.3. Infekciju un bar ības savstarp ējā ietekme uz AMP g ēnu ekspresiju (III) ...... 25 4.4. Mikrobioma un bar ības noz īme AMP aktiv ācij ā (IV) ...... 26 SECIN ĀJUMI ...... 28 KOPSAVILKUMS ...... 28 PATEIC ĪBAS ...... 30 TĒZES ANG ĻU VALOD Ā ...... 31 LITERAT ŪRAS SARAKSTS ...... 58 PUBLIK ĀCIJAS ...... 66

3

PUBLIKĀCIJU SARAKSTS/ LIST OF ORIGINAL PAPERS

Promocijas darbs ir veidots k ā publik āciju kopa. Atseviš ķas publik ācijas disert ācijas tekst ā ir apz īmētas ar romiešu cipariem. Ori ģin ālie raksti ir public ēti ar izd ēvēju at ļauj ām.

This thesis is based on the following papers referred to in the text by their Roman numerals. Original papers are reproduced with permissions from the publishers.

I. Krams, I., Kecko, S., Kangassalo, K., Moore, K.F., Jankevics, E., Inashkina, I., Krama, T., Lietuvietis, V., Meija, L., Rantala, MJ. 2015. Effects of food quality on trade-offs among growth, immunity and survival in the greater wax moth (Galleria mellonella ). Insect Science, 22: 431−439. II. Kecko, S., Mihailova, A., Kangassalo, K., Elferts, D., Krama, T., Krams, R., Luoto, S., Rantala, M.J. & Krams, I.A. 2017. Sex-specific compensatory growth in the larvae of the greater wax moth Galleria mellonella . Journal of Evolutionary Biology, 30: 1910−1918. III. Krams, I., Kecko, S., Inashkina, I., Trakimas, G., Krams, R., Elferts, D., Vrublevska, J., Jõers, P., Rantala, M.J., Luoto, S., Contreras-Garduño, J., Jankevica, L., Meija, L. and Krama, T. 2017. Food quality affects the expression of antimicrobial peptide genes upon simulated parasite attack in the larvae of greater wax moth. Entomologia Experimentalis et Applicata, 165: 129- 137. IV. Krams, I.A., Kecko, S., Jõers, P., Trakimas, G., Elferts, D., Krams, R., Daukšte, J., Luoto, S., Rantala, M.J., Inashkina, I., Gudr ā, D., Fridmanis, D., Contreras- Garduño, J., Granti ņa-Ievi ņa, L., Meija, L. & Krama, T. 2017. Microbiome symbionts and diet diversity incur costs on the immune system of insect larvae. Journal of Experimental Biology, 30:1910-1918.

Autora ieguld ījums pet ījumos/ The author`s contribution to the papers:

Autora piemin ēšanas k ārt ība publik ācij ā nor āda t ā ieguld ījumu p ētījuma veikšan ā.

The order of the authors` names reflects their involvement in the paper.

4 1. IEVADS

1.1. Bar ība, augšana un dz īvības strat ēģ ijas

Dz īvības strat ēģ ijuteorija nosaka, ka organisma dz īves ciklu fāzes un to ilgums ir dabisk ās atlases rezult āts, lai nodrošin ātu iesp ējamivisliel āko pēcn ācēju skaitu jeb maksim āli augstuindividu ālo ģen ētisko piel āgot ībuun summ āro ģen ētisko piel āgot ību, ko veido individu ālā ģen ētisk ā piel āgot ība un kop ējais indiv īda radinieku p ēcn ācēju skaits. Tom ēr vair ākas organisma dz īves cikla f āzes, tādas kā att īst ības ilgums, dzimumnobriešanas vecums, reprodukt īvais vecums,rad īto un izdz īvojušo pēcn ācēju skaits, vec āku r ūpes par p ēcn ācējiem, novecošana un n āve, ir atkar īgas no organisma fizisk ā st āvok ļa un ekolo ģisk ās (biotisk ās un abiotisk ās) vides, to skait ā patog ēniem un paraz ītiem. Tāpēc evol ūcijas gait ā organismi ir att īst ījuši daudzveid īgas dz īvības strat ēģ ijas: ir sugas, kur pieaugušie īpat ņi vien ā vairošan ās reiz ē rada t ūkstošiem oluun ner ūpējas par saviem p ēcn ācējiem, kā rezult ātā liel ākā da ļa p ēcn ācēju neizdz īvo, līdz cilv ēkiem, citiem prim ātiem un zilo ņiem, kas dažu desmitgažu laik ā rada vien dažus p ēcn ācējus un izdz īvot ība tiem ir ļoti augsta, ta čupēcn ācēji nevar att īstieties bez nep ārtrauktas vec āku apr ūpes un ir nepieciešami gadi l īdz tie sasniedz dzimumgatav ību.Ir sugas ar tiešo att īst ību onto ģen ēzes laik ā l īdz sug ām ar sarež ģī tu metamorfozi. Faktorus, kas kontrol ē procesu norisi ekolo ģiskaj ās sist ēmās, sauc par limit ējošiem faktoriem. Dz īvaj ās sist ēmās š ādi faktori iespaido augšanas procesus molekul āraj ā un indiv īdu līmen ī, ietekm ē indiv īdu sastopam ību un to izplat ību popul ācij ā, k ā ar ī ietekm ē ekosist ēmu sast āvu un darb ību. Pat nelielas limit ējošo faktoru vērt ību izmai ņas var rad īt noz īmīgas un paliekošas sekas dz īvaj ās sist ēmās. Lībiga minimuma likums (L ībiga likums vai Minimuma likums), ko izstr ādāja agrozin ātnieks Karls Spengels un v ēlāk populariz ēja Justs fon L ībigs, nosaka, ka augšanu regul ē nevis kop ējais visu pieejamo resursu daudzums, bet tas vien īgais resurss, kura pieejam ība ir ierobežota. Limit ējošie faktori pēc savas izcelsmes var b ūt gan abiotiski, gan biotiski, un bar ība/ener ģijas resursi ir viens no vissvar īgākajiem limit ējošiem faktoriem, kam mūsdien ās ekolo ģijas pētījumos tiek piev ērsta liela uzman ība. Bar ība ir noz īmīga ne tikai tāpēc, ka nodrošina organismu ar fiziolo ģiskajiem procesiem nepieciešamo ener ģiju, bet ar ī ar to, ka organisma bar ībupat ērē t ā paraz īti, simbionti un ener ģiju – paša oraganisma imunsist ēma. Dz īvnieku dz īves cikla galven ās f āzes ir augšana un vairošan ās. T ā k ā viena indiv īda dz īves cikl ā augšanas un vairošan ās fāzes parasti nep ārkl ājas, tās var tikt sa īsin ātas vai pagarin ātas uz citasf āzes rēķ ina. Š ādusvisu iesp ējamo veidu dz īves ciklus, torašan ās iemeslus un funkcijas p ēta dz īvības strat ēģ iju teorija, kas ir būtiska evolucion ārās biolo ģijas sada ļa.

1.2. Kompromiss starp im ūnsist ēmas darb ības efektivit āti un bar ības pieejam ību

Strauj āka att īst ība bieži vien ir saist īta ar t ādiem individu ālās ģen ētisk ās piel āgot ības ieguvumiem k ā lab āka izdz īvošana juven īlaj ā fāzē, agr āk uzs ākta vairošan ās unliel āks pēcn ācēju skaits. Tom ēr straujai att īst ībai ir konstat ēti ar ī negat īvi blakusefekti, jo augšanai tiek izmantoti ener ģijas resursi, kurus nav iesp ējams invest ēt cit ās noz īmīgās funkcij ās un paz īmēs. Pētījumos ir noskaidrots,ka im ūnsist ēmas att īst ība onto ģen ēzē, tās uztur ēšana un aktiv ēšana ir ener ģē tiski d ārgi

5 procesi, un t āpēc organismiem ir j ārod kompromiss starp im ūnsist ēmas darb ību un cit ām ar individu ālo ģen ētisko piel āgot ību saist ītām paz īmēm (Sheldon & Verhulst 1996;Norris & Evans 2000;Zuk & Stoehr 2002; van der Most et al. 2011; Schwenke et al. 2015; Flatt 2020). Turkl āt, im ūnsist ēmas pārm ērīga aktiv ācija saist īta ar risku, ka tās darb ība var rad īt boj ājumus organismam un sekm ēt autoim ūno slim ību att īst ību (Ricklefs & Wikelski 2002;Zuk & Stoehr 2002;Graham et al. 2005; Vojdani 2014; Wu et al. 2021). Šo iemeslu d ēļ im ūnsist ēmas atbildes reakciju stiprums ir j āoptimiz ē un j āmekl ē kompromiss starp im ūnsist ēmas funkciju un citu noz īmīgu organism ā notiekošo procesu nodrošin āšanu (Sheldon & Verhulst 1996;Zuk & Stoehr 2002; Rapkin 2018). Daudzu p ētījumu rezult āti liecina, ka organismu augšanas un vairošan ās posma laik ā veidojas l īdzsvars un kompromisi starp im ūnsist ēmu vai t ās atseviš ķu da ļu funkcij ām un vairošanos procesiem (Knowles et al. 2009; Tuller et al. 2018), starp rezistenci pret paraz ītiem un vairošan ās pan ākumiem (Greer 2008; Singh et al. 2020), starp im ūnsist ēmas darb ību un organisma augšanu (Rantala & Roff 2005;Cotter et al. 2008;Vijendravarma, Kraaijeveld & Godfray 2009; Lozano-Durán & Zipfel 2015). Ir pier ādīts, ka indiv īdi ar nepietiekamu uzturu ir uz ņē mīgāki pret slim ībām (Lochmiller et al. 1993;Birkhead et al. 1999;Moret & Schmid-Hempel 2000; Hoi- Leitner et al. 2001; McKay et al. 2016; Farhadi &Ovchinnikov 2018; Dinh 2020). Ierobežotu resursu apst ākļos var pasliktin āties ne tikai im ūnsist ēmas darb ība, bet ar ī var tikt ietekm ēta organisma augšana, kas nor āda uz komplic ēto meh ānismu balst ītu kompromisu starp š īm div ām dz īvības strat ēģ ijas paz īmēm (Klasing et al. 1987;Lochmiller & Deerenberg 2000;Hoi-Leitner et al. 2001; Cotter et al. 2010; Wilson et al. 2020). Nepietiekama uztura gad ījum ā augšana var ieilgt, un tieši im ūnsist ēmas darb ībai ir j ānodrošina papildus atbalsts organisma izdz īvošanai paildzin ātas att īst ības gad ījum ā.

1.3. Resursi, kompens ējoš ā augšana un nepiln īga att īst ība

Bar ības pieejam ība laik ā un telp ā nav vienm ērīga. Kad bar ība beidzas, organismiem tā ir j āmekl ē citur, vai ar ī j āgaida l īdz bar ība atkal k ļū st pieejama, vai, slikt ākā scen ārija gad ījum ā, organismiem ir jāiet boj ā. Kompens ējoš ā augšana jeb kompens ējošais ķerme ņa masas pieaugums ir neparasti strauja organisma att īst ība, kad organisms pa ātrina savu augšanu līdz t ādai pak āpei, ka t ā kompens ē iepriekš ējā laika posm ā radušos ķerme ņa masas pieauguma zudumu, audu un org ānu att īst ības trauc ējumus, kas var b ūt radušies bar ības tr ūkuma vai citu iemeslu rezult ātā (Leonard et al. 2002; Xu et al. 2014; Stumpf &López Greco 2015). Tiek uzskat īts, ka kompens ējošo augšanu ietekm ē t ādi faktori k ā uztura kvalit āte un daudzums, att īst ības posmi ar nepietiekamu uzturu vai piln īgu badu, organisma att īst ības stadija badošan ās perioda laik ā, sugas dzimumbriešanas relat īvais ātrums, pilnv ērt īga uztura pieejam ības atjaunošan ās (Wilson & Osborne 1960; Leonard et al. 2002; Steinberg 2018; Yuan et al. 2019). Tom ēr šo faktoru loma l īdz galam nav noskaidrota. Bar ības tr ūkums rada organisma att īst ības nepiln ības, jo organisms var nesasniegt sugai rakstur īgo ķerme ņa masu vai ķerme ņa izm ērus. Tiek uzskat īts, ka intens īvas augšanas rezult ātā organism ā uzkr ājas š ūnu membr ānu lip īdu un prote īnu, kā ar ī DNS boj ājumi (Metcalfe & Monaghan 2003; Mangel & Munch 2005; Abdel- Wareth et al. 2015), ko rada reakt īvie sk ābek ļa radik āļ i (ROS), t āpēc organisma augšanas procesi nenotiek maksim āli strauji (Finkel & Holbrook 2000; De Block & Stoks 2008a; Walsh et al. 2014). Pētījumos ir noskaidrots, ka daudzu sugu indiv īdiem

6 kompens ējoš ās augšanas rezult ātā samazin ās maksim ālais dz īves ilgums (Metcalfe & Monaghan 2003; Holden et l. 2019). Strauji augošas žurkas un cilv ēkibieži vien cieš no sirds slim ībām, diab ēta un aptaukošan ās probl ēmām (Cottrell & Ozanne 2008; Bol et al. 2009; Porrello et al. 2009; Zheng et al. 2018). Kompens ējoš ā augšana pēc nepietiekamas bar ības vai piln īga bada perioda dz īvniekiem ļauj sasniegt liel āku ķerme ņa izm ēru dzimumnobriešanas laik ā, lai ar ī ne katrs indiv īds to var at ļauties fiziolo ģisku un ekolo ģisku ierobežojumu d ēļ . Kompens ējoš ā augšana ir nov ērota mikroorganismiem (Mikola & Setala 1998), s ēnēm (Bretherton et al. 2006), augiem (Orcutt & Nilsen 2000; McNickle & Evans 2018), kukai ņiem (Dmitriew & Rowe 2004; De Block & 2008a,b,c; Xie et al. 2015), ziv īm (Turkmen & Serhat 2012; de Oliveira et al. 2020), r āpu ļiem (Radder et al. 2007; Wang et al. 2011), putniem (Hector & Nakagawa, 2012; de Morais e al. 2017) un z īdītājiem (Cottrell & Ozanne 2008; Menegat et al. 2020). Lai ar ī prec īzi kompens ējoš ās augšanas fiziolo ģiskie meh ānismi nav atkl āti, tom ēr ir noskaidrots, ka dažiem dz īvniekiem endokr īnā sist ēma ir saist īta ar metabolismu un bar ības elementu sadali audos (Scanes 2003; Johnsonet al. 2014; Bertucci et al. 2019). Ir zin āms, ka homeostatiskiem procesiem ir īstermi ņa, bet homeotermiskiem procesiem ir ilgtermi ņa ietekme uz organisma īpaši strauju augšanu un att īst ību (Leonard et al. 2002; van der Meer 2021). Tom ēr kompens ējoš ā augšana nav tik labi izp ētīta, lai t ās evolucion ārā noz īme būtu piln ībā izprasta. Lai spriestu par kompens ējoš ās augšanas evolucion āro un ekolo ģisko lomu un tās svar īgākajiem fiziolo ģiskajiem meh ānismiem, ir nepieciešams veikt vair āk p ētījumu par organismu kompens ējoš ās augšanas ietekmi uz organisma dz īves ciklu un dz īvības strat ēģ ij ām.

1.4. Bar ības pieejam ība, nepietiekams uzturs un mikrobioms k ā im ūnsist ēmas sast āvda ļa

Nepietiekama uztura apst ākļos pazemin ās organisma baz ālā vielmai ņa (Scanes 2003; Caudwell et al. 2013). Ja bads turpin ās, tam seko audu apjoma samazin āšan ās, ko nosaka galvenok ārt zarnu audu masas samazin ājums un to fiziolo ģisk ās aktivit ātes kritums. Pētījumos ir noskaidrots, ka uzturvielu tr ūkums samazina ener ģē tisko ieguld ījumu im ūnsist ēmas darb ībā (Lochmiller et al. 1993; Moret & Schmid-Hempel 2000; Alonso-Alvarez & Tella 2001; Hoi-Leitner et al. 2001; Krams et al. 2014; Mason et al. 2014; Childs et al. 2019), kas negat īvi ietekm ē simbiontu skaitu un mikrobiotas daudzveid ību (David et al. 2014; Mason & Raffa 2014; Carmody et al. 2015; Sonnenburg et al. 2016; Vernocchi et al. 2020). Tas liecina, ka bar ības daudzveid ība un kvalit āte ir noz īmīgs faktors, kas tieši ietekm ē zarnu mikrobiotu, un līdz ar to, gan tieši, gan netieši ar ī organisma augšanas un vairošan ās kompromisu evol ūciju (Lazzaro & Rolff 2011; Redmond et al. 2019). Pētījumos ir noskaidrots, ka zarnu mikrobioms ir noz īmīga im ūnsist ēmas da ļa, kas darbojas k ā ʽʽ sakaru centrs ʼʼ , apvienojot apk ārt ējās vides inform āciju par bar ības pieejam ību ar genoma un im ūnsist ēmas sign āliem. Piem ēram, vair āku zīdītāju im ūnsist ēmas darb ības parametru un funkciju att īst ība ir atkarīga no to mijiedarb ības ar mikrobiomu (Macpherson & Harris 2004; Ost & Round 2018).Vair ākām nespecifisk ās im ūnsist ēmas da ļā m ir konstat ēta b ūtiska loma saimnieka-mikrobioma mijiedarb ības regul ācij ā. Nespecifiskajai im ūnsist ēmai piem īt sp ēja sajust mikroorganismus, to metabol ītus un p ārv ērst šos sign ālus saimnieka fiziolo ģiskaj ās atbildes reakcij ās, kas ļauj regul ēt organisma mikrobioma sast āvu. Atgriezenisk ās reakcijas tr ūkums starp im ūnsist ēmu un zarnu mikrobiomu var izrais īt im ūnsist ēmas

7 pav ājin āšanos un izrais īt slim ības (Thaiss et al. 2016). Piem ēram, laboratorijas dz īvnieku, kas ir tur ēti vid ē bez mikrobiem, im ūnsist ēma tiek uzskat īta par nesagatavotu pret oport ūnistiskiem mikroorganismiem vai zarnu simbiontiem. Šo dz īvnieku zarnu limf ātiskiem audiem un cit ām limf ātisk ās sist ēmas da ļā m nov ēro kav ētu att īst ību un antivielu veidošanas trauc ējumus (Falk et al. 1998; Macpherson & Harris 2004; Round & Mazmaninan 2009; Lambring et al. 2019), k ā ar ī kav ētu daudzu zarnu trakta da ļu att īst ību un nobriešanu (e.g., Dannappel et al. 2014; Vlantis et al. 2015).P ētījumos ir noskaidrots, ka dz īvniekiem, kas tur ēti vid ē bez mikrobiem,zarnu epit ēlija š ūnās, kas izkl āj zarnas un veido fizisku barjeru starp zarnu saturu (ieskaitot mikrobiomu) un im ūnsist ēmas pamat ā esošaj ām š ūnām, ir trauc ēta mikrob ārksti ņu veidošan ās un l ēnāka š ūnu nomai ņa, sal īdzinot ar dz īvniekiem ar norm ālu zarnu mikrofloru (Dannappel et al. 2014). Mijiedarb ībai starp simpatriski dz īvojoš ām sug ām ir ietekme uz abu sugu mikrobioma veidošanos un im ūnsist ēmas darb ību. Ir noskaidrots, ka Gram-negat īvā bakt ērija Bacteroides thetaiotaomicron induc ē antimikrobi ālā pept īdaRegIII γ ekspresiju zarnu epit ēlija š ūnās, ko sauc par Peneta š ūnām (Cash et al. 2006; Sonnenburg et al. 2006). Savukārt, Gram-pozit īvā bakt ērija Bifidobacterium longum neizraisa š ādu reakciju . RegIII γ antimikrobi ālā aktivit āte ir v ērsta pret noteikt ām Gram-pozit īvām bakt ērij ām, kas nor āda, ka B.thetaiotaomicron nosaka zarnu trakta nespecifisk ās imunit ātes reakcijas, kas pasarg ā apk ārt ējo vidi pret tokonkurentiem Gram-pozit īvaj ām bakt ērij ām. Atš ķir ībā no oport ūniskajiem patog ēniem, kas izraisa im ūnsist ēmas atbildes reakcijas un infekcijas laik ā var boj āt audus, simbiotisk ās zarnu bakt ērijas sniedz saimniekorganismam daž ādus labumus. Piem ēram, zarnu mikrosimbionti nodrošina saimnieka organismu ar nepieciešam ām bar ības viel ām, metaboliz ē cit ādi nesagremojamus savienojumus, aizsarg ā pret oport ūniskiem patog ēniem un veicina zarnu morfolo ģijas un funkciju att īst ību (Macpherson & Harris 2004; Round& Mazmanian 2009; Belkaid & Hand 2014; Gouba et al. 2019; Martin et al. 2019; Zheng et al. 2020). Tom ēr simbiotisk ā mikrobioma sast āvā ir ar ī t ādi mikroorganismi, kas noteiktos apst ākļos var izrais īt iekaisuma procesus. L īdz ar to mikrobioms var izrais īt un ietekm ēt gan iekaisuma, gan pretiekaisuma reakcijas, bet zarnu bakt ēriju sabiedr ību sast āvs un līdzsvars starp daž ādiem mikroorganismiem var b ūt cieši saist īts ar im ūnsist ēmas darb ību. Š āda veida ekolo ģisk ā izmaksu-ieguvumu mijiedarb ība un līdzsvara meh ānismi nekad iepriekš nav p ētīti nepast āvīgas bar ības pieejam ības apst ākļos.

1.5. Promocijas darba m ērķi un uzdevumi

Promocijas darba galvenais m ērķis bija noskaidrot, k ā bar ības kvalit āte un pieejam ība ietekm ē liel ās vaska kodes ( Galleria mellonella ) k āpuru augšanas ātrumu un veidu, un k ādi ir kompromisi starp k āpuru att īst ību, cit ām dz īvības strat ēģ ijas paz īmēm un t ādiem ekolo ģiskiem un fiziolo ģiskiem faktoriem/parametriem k ā imunit āte un zarnu mikrobioms. Pirmais promocijas darba uzdevums bija p ārbaud īt, vai nepietiekamas bar ības apst ākļos k āpuri invest ēs ener ģē tiskos resursus im ūnsist ēmā, nevis augšan ā. Tam t ā būtu jānotiek, jo, lai izdz īvotu un nodrošin ātu ilg āku augšanas periodu, im ūnsist ēmai ir j āfunkcion ē pilnv ērt īgi. Lai to p ārbaud ītu, vienai lielo vaska kožu k āpuru grupai to att īst ības laik ā bija br īvi pieejama augstv ērt īga bar ība, otr ā kožu k āpuru grupa sa ņē ma vid ējas kvalit ātes bar ību, bet treš ā grupa – bar ību ar zemu uzturv ērt ību ( I). Im ūnsist ēmas reakcijas stipruma m ērīšanai izmantota neilona implanta inkapsul ācijas

8 metode. Tika pie ņemts, ka visstrauj ākā augšana un zem ākā imunit āte b ūs k āpuriem, kam pieejama bar ība ar augstu uzturv ērt ību. K āpuriem, kam bija pieejama bar ība ar zemu uzturv ērt ību, prognoz ēju visl ēnāko augšanu un stipr āko imunit āti. P ēc im ūnsist ēmas aktiv ācijas, augst āka mirst ība un maz āk veiksm īga iek ūņ ošan ās tika paredz ēta k āpuriem, kam bija pieejama bar ība ar augstu uzturv ērt ību, savuk ārt kāpuriem, kam bija pieejama bar ība ar zemu uzturv ērt ību, es paredz ēju ilg āku att īst ības laiku. Daudzi dz īvnieki p ēc l ēnākas att īst ības perioda, ko izrais ījis bar ības tr ūkums, palielina augšanas ātrumu (Bohman 1955; Metcalfe & Monaghan 2001; De Block et al. 2008). Otrs promocijas darba uzdevums bija noskaidrot, vai lielo vaska kožu ( G. mellonella ) k āpuri rea ģē uz ierobežotas bar ības periodiem augot l ēnāk/ilg āk, vai p ēc ierobežotas bar ības perioda tiem var nov ērot kompens ējošo augšanu ( II ), un, vai starp dzimumiem past āv atš ķir ības augšanas kompens ācijas veidos. Līdz šim p ētījumos ir noskaidrots, ka m ātītes ierobežotas bar ības apst ākļos pa ātrina augšanu, jo to individu ālā ģen ētisk ā piel āgot ība ir atkar īga no ķerme ņa izm ēriem vairošan ās fāzes laik ā. Savuk ārt t ēvi ņu individu ālā ģen ētisk ā piel āgot ība palielin ās, tiem izaugot ātr āk, jo tad tie var agr āk un vair āk invest ētsav ā imunit ātē un izdz īvošan ā, kas uzlabo vairošan ās sekmes (Kelly et al. 2014). Kukai ņiem inkapsul ācijas reakcija ir saist īta ar vis ām im ūnsist ēmas sign ālkask ādēm (Lemaitre & Hoffmann 2007), t ās stiprums ir atkar īgs no bar ības pieejam ības un uzturv ērt ības (Krams et al. 2014). Šī saist ībarada gr ūtības paredz ēt inkapsul ācijas reakciju stiprumu un daž ādos p ētījumos ieg ūto rezult ātu sal īdzin āšanu. Trešais promocijas darba uzdevums bija izp ētīt, kā atš ķiras ar imunit āti saist īto antimikrobi ālo pept īdu (AMP) g ēnu ekspresija (III) , ja lielo vaska kožu k āpuri ir baroti ar augstv ērt īgo vai zemas uzturv ērt ības bar ību. AMP ir nespecifisk ās im ūnsist ēmas ātr ās rea ģē šanas sist ēmas sat āvda ļa, kas darbojas bakt ēriju un s ēnīšu infekciju gad ījum ā. AMP funkcion ē k ā antibiotikas (Brogden 2005; Brown et al. 2009; Mylonakis et al. 2016), un to darb ība pazemina patog ēnu slodzi saimniekorganism ā (Kaneko et al. 2007). Uzs ākot p ētījumu, tika pie ņemts, ka AMP gēnu ekspresija b ūs augst āka tiem kāpuriem, kam ir aktiv ēta im ūnsist ēma un kam pieejama augstv ērt īga bar ība, nek ā kāpuriem, kam dota zemas uzturvērt ības bar ība. Ceturtais promocijas darba uzdevums bija p ārbaud īt, vai G. melonella kāpuru AMP g ēnu ekspresija ir saist īta ar zarnu trakta mikroorganismu taksonomisko sastāvu, un vai to ietekm ēbar ības uzturv ērt ība (IV ). Tika pie ņemts, ka kāpuru zarnu traktā domin ējoš ā bakt ēriju suga ir Enterococci mundtii (Jarosz 1979; Johnston & Rolff 2015), un ka AMP g ēnu ekspresija b ūs zem āka kāpuriem, kas baroti ar zemas uzturv ērt ības bar ību. Turkl āt k āpuri tika baroti ar antibiotiku mais ījumu, lai izn īcin ātu to mikrobiomu un noskaidrotu, vai AMP gēnu ekspresija disbakteriozes gad ījum ā ir līdz īga AMP g ēnu ekspresijai tiem kāpuriem, kam dota vienk ārša bar ība ar zemu uzturv ērt ību. Lai noskaidrotu zarnu mikroorganismu taksonomisko sast āvu, tika veikta 16S V3 rRNA gēnu anal īze. Izvirz āmās t ēzes: visstrauj ākā augšana un zem ākā imunit āte b ūs kāpuriem,kam pieejama bar ība ar augstu uzturv ērt ību, P ēc im ūnsist ēmas aktiv ācijas, augst āka mirst ība un maz āk veiksm īga iek ūņ ošan ās paredz ēta k āpuriem, kam bija pieejama bar ība ar augstu uzturv ērt ību, savuk ārt k āpuriem, kam bija pieejama bar ība ar zemu uzturv ērt ību, paredz ēts ilg āks att īst ības laiks.

9 2. MATERIĀLI UN METODES

2.1.Pētījuma objekts

Vaska kodes G.mellonella pieder pie zv īņ sp ārņu jeb tauri ņu k ārtas svi ļņ u( Pyralidae )dzimtasun ir sastopamas gandr īz vis ā pasaul ē. Vaska kožuk āpuri galvenok ārt mitin ās bišu stropos, kur barojas ar putekš ņiem un medu.Vaska kodes tiek uzskat ītas par biškop ības kait ēkļiem (Warren & Huddleston 1962). Pētījumos ir apstiprin āts, ka vaska kodes k āpuri strauji aug, ja tiem past āvīgi ir pieejama pilnv ērt īga bar ību, kurai ir augsta uzturv ērt ība. Š ādos apst ākļos vaska kožu k āpuri iek ūņ ojasjau 28. dien ā, ta ču, ja barībā ir maz uzturvielu un kaloriju, kāpuru att īst ības stadija var ieilgt līdz pat 6 m ēnešiem (Marston et al. 1975). Vaska kožu k āpuriir atdz īti par vienu no lab ākiem pētījuma mode ļiem ģen ētik ā, ekolo ģij ā, imunolo ģij ā, un tos izmanto ar ī farmakolo ģijas p ētījumos jaunu molekulu un vielu patogenit ātes nov ērt ēšanai. Iesp ējams nākotn ē pētījumos šī mode ļsuga aizvietos žurkas, peles un citus z īdītājus (Harding et al. 2014). Šaj ā promocijas darb ā tika p ētītas G. Mellonella (k āpuri un kodes),kas iev āktas dab ā2014.gad ā Igaunij ā un Latvij ā. Vaska kodes tika audz ētas 2,4 l plastmasas kast ēs 28-30°C temperat ūrā Sanyo MIR-253 inkubator ā, kur t ās dz īvoja tums ā. Pētījumu laik ā katrs k āpurs tika ievietots atseviš ķā plastmasas trauk ā, kuru sedza v āks ar sieti ņu, kas nodrošin āja gaisa piek ļuvi un ne ļā va kāpurama izb ēgt.

2.2. Dzimuma noteikšana un sv ēršana

Kāpuru sv ēršanapirmo reizi tika veiktakāpuru stadijas 14. dien ā(II, III ) vai 15. dien ā (I) un atk ārtota katru dienuvienreiz dien ā l īdz k āpuri iek ūņ oj ās. K āpura ķerme ņa masas v ērt ība tika noapa ļota l īdz 0.01 mg. Sv ēršanai tika izmantoti Kern anal ītiskie svari (Kern & Sohn GmbH, Balingen, Vācija). Katr ā p ētījum ā tika uztur ēta atseviš ķa kāpuru grupa,lai izv ērt ētu izdz īvošanu kāpuru un k ūni ņu stadij ā, iek ūņ ošan ās ātrumu. Š ī grupa netika izmantota inkapsul ācijas mērījumiem. Dzimums tika noteiks k ūni ņas vai pieaugušas kodes stadij ā (Ellis et al. 2013) ( IV ).

2.3. Eksperiment ālās grupas un barošanas rež īmi

Lai izp ētītu saist ības starp augšanu (I), bar ības kvalit āti un imunit āti, k āpuri tika sadal īti tr īs grup ās: (i) grupa ad libitum tika nodrošin āta ar augstv ērt īgu bar ību līdz kāpura stadijas 30. dienai; (ii) grupa ar jauktu barošan ās rež īmu, kad k āpuriem 2 dienas ad libitum tika nodrošin āta augstv ērt īga bar ība un 2 dienas pieejama tikai bar ība ar zemu uzturv ērt ību,līdz k āpura stadijas beig ām; (iii) grupa, kas sa ņē ma ad libitum zemas uzturv ērt ības bar ību l īdz k āpura stadijas beig ām. Lai noskaidrotu badošan ās ietekmi uz G. mellonella kāpuru iesp ējamo kompens ējošo augšanu, k āpuri pēc nejauš ības principa tika sadal īti tr īs eksperiment ālaj ās grup ās un kontroles grup ā (II ). Eksperimant ālaj ās grup ās kāpuriem bar ība tika no ņemta uz 12, 24 un 72 stund ām, savuk ārt kontroles grupas k āpuriem bija neierobežota piek ļuve bar ībai. AMP ekspresijas izp ētei (III )kāpuri tika sadal īti sekojoši:(i) „augstv ērt īgas bar ības/aktiv ētas im ūnsist ēmas” grupa, (ii) „augstv ērt īgas bar ības/ kontroles grupa”,

10 (iii) „vienk āršas bar ības/aktiv ētas im ūnsist ēmas” grupa un (iv) „zemas uzturv ērt ības bar ības/kontroles grupa”. Pētījum ā, kur bar ības ener ģē tisk ā v ērt ība kombin ēta ar antibiotiku lietošanu (IV ),kāpuri l īdz kāpura stadijas 25.dienai„augstv ērt īgs bar ības” grup ā tika nodrošin āti ar augstv ērt īgu bar ību ad libitum „zemas uzturv ērt ības bar ības” grup ā kāpuriem ad libitum tika nodrošin āta bar ība ar zemu uzturv ērt ību. Augstv ērt īga bar ība ar ener ģē tiski augstu uzturv ērt ību tika gatavota no medus, glicer īna, bišu vaska, saus ā piena, saus ā rauga, kviešu miltu undestil ēta ūdens vien āda apjoma da ļā m un no div ām da ļā m kukur ūzas miltu. Ener ģijas daudzums, ko nodrošina šāds bar ības mais ījums, tika mērīts ar kalorimetru. Augstv ērt īgās bar ības ener ģē tisk ā vērt ība bija aptuveni 17.00 kJ/g, zemas uzturvert ības bar ībai ener ģē tisk ā vērt ība bija aptuveni 3.03 kJ/g(IKA ®-Werke GmbH & Co. KG, Vācija) (I, II, III, IV ). Badošan ās laik ā k āpuriem bija pieejams tikai ūdens (II ).

2.4. Inkapsul ācijas stiprums

Inkapsul ācijas reakcijas stiprums tika mērīts, izmantojot neilona monofilamentus. K āpura kutikula tika pārdurta ar sterilu adatu, tad tika ievietots sterils neilona implants, ap kuru s āka veidoties to iekapsul ējošo š ūnu sl ānis. P ēc implanta izņemšanas tas tika žāvēts un tad tika izv ērt ētakatra implanta inkapsul ācijas pak āpe (I). Kukai ņu im ūnsist ēma rea ģē uz neilona implanta ievietošanu k ā uz sveša organisma iebrukumu, m ēģ inot iekapsul ēt svešo organismu ar š ūnām un specifisk ām ķī misk ām viel ām (Rantala et al. 2000). Reakcijas beig ās veidojas melaniz ēta kapsula (Ratcliffe et al. 1985). Jo stipr āka ir atbildes reakcija, jo tumš āks ir implants (Yourth et al. 2001; Krams et al. 2013a,b). Implanti tika fotograf ēti nodiv ām vai tr īs pus ēm konstanta apgaismojumaapst ākļos ar Zeiss Lumar V12 Stereo (Carl Zeiss, Jena, Germany) mikroskopa pal īdz ību. Digit ālas fotogr āfijas, lai nov ērt ētu implanta melaniz ētās kapsulas kr āsas intensit āti, tika analiz ētas ar programmu Image J (http://rsbweb.nih.gov/ij/; Abramoff et al. 2004).

2.5. RNS izdal īšana (III, IV)

Pirms proced ūras k āpuri tika atdzes ēti 15 min ūtes, tos turot uz ledus. Tad to virsma tika steriliz ēta ar 70% etanolu. P ēc tam k āpuri tika ievietoti šķidraj ā sl āpekl ī, kur tos saberza ar piestas pal īdz ību (III, IV ). RNS kop ējais paraugs ieg ūts, apvienojot biolo ģisko materi ālu no sešiemkāpuriem ar tr īs atk ārtojumiem katr ā p ētāmaj ā grup ā. Paraugus homogeniz ēja ar 1 ml Trizol rea ģenta pal īdz ību un RNS no biolo ģisk ā materi āla tika izdal īts saska ņā ar ražot āja instrukcij ām. RNS kl ātb ūtne paraugos tika apstiprin ātaar et īdija brom īda iekr āsota gēla pal īdz ību, bet kvantit āte tika nov ērt ēta spektrofotometriski.

2.6. Kvantitat īvā re āla laika P ĶR (III, IV)

kDNS transkripcijas l īmenis paraugos tika noteikts, izmantojot re ālā laika kvantitat īvo PĶR (RT-qPCR) metodes Ct protokolu. RT-qPCR anal īzei izmantota iek ārta 7500 Real-Time PCR System (Applied Biosystems) un SYBR Green PCR mais ījums standarta apst ākļos (Qiagen). Ieg ūtie rezult āti izteikti attiec ībā pret diviem references gēniem: 18S rRNA un translation elongation factor 1-alpha . Tika analiz ēti seši g ēni,

11 kas kod ē AMP: Gloverin , Gallerimycin , 6-tox , Galiomicin , Cecropin D un Toll-like receptor 18-Wheeler (III, IV ).

2.7. 16S V3 rRNS gēna amplifik ācija un sekven ēšana (IV)

rRNA V3 re ģions tika amplific ēts atseviš ķi ar tiešiem un reversiem praimeriem (Milani et al. 2013). Amplifik ācija tika veikta ar iek ārtu GeneAmp® PCR System 9700 (Thermo Fisher Scientific, ASV). Ieg ūtie 16S rRNA PĶR produkti kvantific ēti, apvienoti kop ējā paraug ā un att īrīti ( IV ). Pirms klon ālās amplifik ācijas, 16S rRNA PĶR produktu bibliot ēkas tika atš ķaid ītas. Parauga PĶR produktu emulsija, emulsijas sagraušana un bag ātin āšana tika veikta, izmantojot rea ģentu komplektu Ion PI TM Hi-QTM OT2 Kit (Life Technologies, ASV), iev ērojot ražot āja nor ādījumus. Gatavie paraugi ievad īti čip ā PI TM chip v3 un anal īzēti ar iek ārtas Ion Proton TM Semiconductor pal īdz ību, izejot 520 ciklus un izmantojot rea ģentu komplektu Ion PI TM Hi-QTM Sequencing 200 Kit . Veikta divu virzienu sekven ēšana. Sekven ču nolas ījumi p ēc sekven ēšanas proced ūras pabeigšanas netika sak ārtoti pa p āriem, tika filtr ēti individu ālie nolas ījumi, izmantojot Proton programmat ūru, lai atbr īvotos no zemas kvalit ātes variantiem. Sec ības, kas atbilst Proton 3 adapteriem tika autom ātiski nogrieztas. Visi atbilstoš ās kvalit ātes dati eksport ēti bam failu form ātā. Sekven ēšanas datu anal īze veikta, izmantojot QIIME v.1.8.0. un UPARSE v.7.0.1001. algoritmu, lai filtr ētu un sagrup ētu 16S rRNA amplikonu sekvences (Pylro et al. 2014). P ēc kvalit ātes kontroles, tikai sekvences ar vid ējo sekvences kvalit ātes vērt ējumu >20 tika izmantotas turpm ākai anal īzei. Lai raksturotu paraugu taksonomisko strukt ūru, sekvences tika sak ārtotas operat īvās taksonomisk ās vien ībās (OTU) ar 97% identit ātes l īmeni (Edgar 2010). Taksonomijas noteikšana tika veikta ar RDP (Wang et al. 2007), izmantojot Greengenes (DeSantis et al. 2006) (http://greengenes.secondgenome.com) references datu kopas (gg_otus-13_8 release). Alfa daudzveid ības indikators − Šenona indekss tika apr ēķ in āts ar QIIME programmat ūras pal īdz ību.

2.8. Bakt ēriju kultiv ēšana (IV)

Mikrobiolo ģiskaj ām anal īzēm tika izmantoti sec ēti kāpuru zarnu trakti (IV ). Tika pagatavoti zarnu homogen ātu sēriju atš ķaid ījumi, izmantojot ster īlu peptona ūdeni. Paraugi tika uzs ēti divos atk ārtojumos uz kontaktpl ātēm ar selekt īvo Enterococcus agaru – Bile Esculin Azide Agar (Sigma-Aldrich, ASV). Enterococci vēlāk tika apstiprin āti, izmantojot Gram-pozitīvo bakt ēriju noteikšanas komplektu BBL Crystal Identification Systems Gram-positive ID KIT (Becton, Dickinson and Company, ASV) (e.g., Von Baum et al., 1998).

2.9. Zarnu mikrobiomaelimin ācija(IV)

Kāpuru zarnu trakta att īrīšana no tajos esoš ās mikrofloras tika sasniegta, ievadot antibiotiku un prets ēnīšu l īdzek ļu mais ījumaš ķī dumu kāpuru zarnu trakt ā. Kāpuri piespiedu k ārt ā tika baroti ar antibiotiku mais ījumu, kura sast āvā bija ūden ī šķī stošas ampicil īna, eritromic īna, gentamic īna, kanamic īna un ketokonazola formas (IV ).

12 3. REZULTĀTI

3.1. Bar ības uzturv ērt ī ba, att īst ības laiks un inkapsul ācijas reakcijas stiprums (I)

Visi vaska kožuk āpuri, kas sa ņē ma augstv ērt īgu bar ību vai auga jauktas barošan ās rež īmā, izdz īvoja līdz 30. dienai p ēc iz šķilšan ās no ol ām.Savuk ārt z emas uzturv ērt ības bar ības grup ā līdz 30. dienai p ēc izšķilšan ās no olas izdz īvoja tikai 30 no 50 kāpuriem (Fišera prec īzais tests : P = 0.0001). Kāpura stadijas ilgums – kūni ņas stadijas s ākums būtiski atš ķī rās starp grup ām (vienfaktora dispersijas anal īze : F 2,87 = 1765.60, P< 0.0001, 1. a tt ēls), un būtiskas atš ķir ības tika konstat ētas starp vis ām grup ām (Tūkija aposteriorais tests : P< 0.001, 1. att ēls).

1. att ēls. Bar ības uzturv ērt ības ietekme uz G. mellonella kāpura stadijas ilgumu . Stabi ņi apz īmē vid ējās v ērt ī bas ± SE.

Būtiskas k āpuru ķerme ņa masa s atš ķir ības bija nov ērojamas 30. dien ā pēc izšķilšan ās(vienfaktora dispersijas anal īze : F 2,87 = 26.40, P < 0.0001 , 2. att ēls). Vislie lākā ķerme ņa masa bija k āpuriem, kam past āvīgi bija pieejamaaugstv ērt īga bar ība. Jaukta barošan ās rež īma k āpuru grupai ķerme ņa svars bija liel āks nek ā kāpuriem no grupas, kam bij a pieejama zemas uzturv ērt ī basbar ība (Tūkija aposteriorais tests: visi P< 0.001, 2 . att ēls).

13 2. att ēls. Bar ības uzturv ērt ības ietekme uz G.mellonella kāpuru ķerme ņa svaru pirms iek ūņ ošan ās. Stabi ņi apz ī mē vid ējās v ērt ības ± SE.

Inkapsul ācijas reakcija kāpuru stadijas 30 . dien ā būtiski atš ķī rā s starp vis ām k āpuru grup ām (vienfaktora dispersijas anal īze : F2,87 = 62.32, P < 0.0 001; 3 . att ēls). Inkapsul ācijas intensit āte bija b ūtiski vājāka grup ā, kam bija pieejama augstv ērt īga bar ība, bet visintens īvā kā inkapsul ācijas reakcija tika konstat ēta kāpuru grup ā, kas bija barota ar zemas uztu rv ērt ības bar ību (Tūkija aposteriorais tests: visi P< 0.0001, 3. att ēls).

3. att ēls. Bar ības uzturv ērt ī bas ietekme uz G.mellonella kāpuru inkapsul ācijas reakcijas intensit āti. Stabi ņi apz īmē vid ējās v ērt ības ± SE.

Grup ā, kas sa ņē ma augstv ērt īgu bar ību, trešaj ā dien ā pēc implant ācijas proced ūras, izdz īvoja un ie kūņ oj ās14 no 30 k āpuriem. Visvair āk izdz īvojušo k āpuru (26 no 30) bija grup ā ar jauktas barošan ās rež īmu (Fišera prec īzais tests : P = 0.002) un grup ā, kas sa ņē ma zemas uzturv ērt ības bar ību (28 no 30) ( Fišera prec īzais tests : P = 0.0001) Izdz īvošanas rādī tāji starp š īm div ām grup ām būtiski neatš ķī rās (Fišera prec īzais tests: P = 0.67). 2 Multipl ās line ārās regresijas anal īze (adjusted R = 0.57, F 2,87 = 55.32, P< 0.0001) par ādīja, ka k āpuru inkapsul ācijas reakcijas intensit āte bija atkar īga no barošan ās rež īma (β = -0.75, P< 0.0001), savuk ārt ķerme ņa masa (β = -0.01, P = 0.87) neietekm ēja inkapsul ācijas intensit āti, par ko liecina v ājāka inkapsul ācijas intensit āte kāpuru grup ā, kas tika nodrošin āti ar augstas uzturv ērt ības bar ību. Mijiedarb ība starp ķerme ņa masu un bar ības uzturv ērt ību netika konstat ēta, kas liecina par bar ības kvalit ātestiešo ietekmi uz G. mellonella kāpuru inkapsul ācijas reakcijas intensit āti. 2 Multipl ās line ārās regresijas anal īzes rezult āti (adjusted R = 0.80, F 2,87 = 181.02, P< 0.0001) liecina , ka k āpuru att īst ības laiks nebija atkar īgs no inkapsul ācijas reakcijas intensit ātes (β = 0.09, P< 0.24), savuk ārt to ietekm ēja bar ības uzturv ērt ība (β = -0.83, P< 0.001). Tas noz īmē, ka zemas uzturv ērt ības bar ības pagarin āja G.mellonella kāpuru att īst ība s stadiju. Inkapsul ācijas intensit āte s negat īva korel ācija ar ķerme ņa masu atkl āta tikai kāpuru grup ā ar augstvērt īgu bar ību (r = -0.44, P = 0.015 augstv ērt īgas bar ības grup ā; r = -0.05, P = 0.78 jaukta s barošan ās rež īma grup ā un r = 0.18, P = 0.35 zema s uzturv ērt ības bar ības grup ā).

14 3.2. Ar dzimumu saist īta kompens ējoš ā augšana (II)

Augšanas ātrums p ēc badošan ās perioda būtiski atš ķī rās starp grup ām (F = 367.138, df = 3, P< 0.0001 ) un ar ī starp dzimumiem (F = 66.656, df = 1, P< 0.0001). Mijiedarb ība starp dzimumu un badošan ās ilgumu bija b ūtiska (F = 10.231, df = 3, P< 0.0001),m ātītēm kāpura stadijas beig ās vienm ēr bija liel āks ķerme ņ a svars .Ir svar īgi uzsv ērt , ka m ātīšu un t ēvi ņu ķ erme ņa svara pieaugums grup ās ar badošan ās ilgumu 24 un 7 2 stundas bijamaz āks nek ākontroles grup ā un grup ā ar 12 stundubadošan āsperiodu (4. att ēls ). Tom ēr grup ā ar 12 stundu badošan āsperiodu svara pieauguma tendence nebija vien āda visiem mātīšu kāpuriem – da ļa m ātīšu k āpura stadij ā (n = 19) pēc badošan ās perioda auga l ēni un nesasniedza pat kontrolgrupas mātīšu ķerme ņa masu (P< 0.0001), s avuk ārt 15 m ātītes auga daudz strauj āk par kontroles grupas m ātītēm (P< 0.0001) (4., 5. att ēls). Šīs m ātītes (n = 15) kompens ēja savu ķerme ņa masas svaru un pat izauga daudz liel ākas un smag ākas par kontroles grupas mātītēm.

4. att ēls. Kop ējais ķerme ņa masas pieaugums kāpuru kontroles grup ā un tr īs grup ās ar badošan ās periodu 12 , 24, 72 stundas.

5. att ēls. Kāpuru ķerme ņa svaradinamikakontroles grup ā un grup ās ar badošan ās periodu kāpuru 18 att īst ī bas dien ā 12, 24 un 72 stundas.

Svara pieauguma trajektorija pēcbadošan ās strauji augošaj ām mātītēm bija iev ērojami st āvāka nek ā citu grupu kāpuriem (P< 0.0001). Svara pieauguma trajektorija kontroles grupas kāpuriem bija st āvāka (5. att ēls) nek ā vis ām mātītēm un tēvi ņiem grup ās ar badošan ās perioda ilgumu 12, 24 un 72 stundas (P<0.0001). Iek ūņ ošan ās stadija s s ākumu b ūtiski ietekm ēja badošan ās perioda ilgums (F = 493.20, df = 3, P< 0.0001) , k ā ar ī dzimuma un badošan ās perioda ilguma mijiedarb ība

15 (F = 4.40, df = 3, P = 0.0053) ( 6. att ēls). Iek ūņ ošan ās stadijas s ākums b ūtiski atš ķir ās mātītēm no grupas ar badošan ās periodu 12 stundas , tāstika iedal ītas div ās atseviš ķā s apakšgrup ās (tipiski augoš ās m ātītes un m ātītes ar strauju svara pieaugumu : 28.95 ± 1.31 un 27.13 ± 0.35 dienas , vid ējais ± SD, P< 0.0001) (6. att ēls ). Jo ilg āks bija badošan ās periods, jo ilg āka k āpura augšanas stadija un vēlā k iest ājās iek ūņ ošan ās stadija gan m ātītēm, gan t ēvi ņiem. Grup ā ar badošan ās periodu 72 stundas nov ērota visilg ākā k āpura augšana (t ēvi ņiem 32.083 ± 0.282 dienas, vid ējais ± SDun m ātītēm 32.143 ± 0.359 dienas , vid ējais ± SD) un tie iek ūņ ojās visv ēlāk (6. att ēls ). Tēvi ņi un mātītes ar tipisku svara pieaugumu grup ā ar 12 stundu badošan ās periodu iek ūņ ošan ās stadiju sasniedza būtiski vēlāk kā kontrolgrupas tēvi ņi un m ātītes (visi P< 0.05), savuk ārt strauji augošo mātī šu iek ūņ ošan ās laiks b ūtiski neatš ķī rās no kontrolg rupas kāpuriem (P> 0.05). Grup ās ar 24 un 72 stundu badošan ās periodu netika konstat ētas nek ādas ar dzimum u saist ītas atš ķir ības (P> 0.05).

6. att ēls.Kāpura stadijas ilgums kontroles un grup ās ar badošan ās periodu 12, 24, 72 stundas.

Inkapsul ācijas intensit āte bija atkar īga no badošan āsilguma (F = 217.003, df = 3, P< 0.0001), no dzimuma un badošan ās perioda ilguma mijiedarb ības (F = 27.457, df = 3, P< 0.0001), bet t ā nebija atkar īga no dzimuma (F = 0.304, df = 1, P = 0.582). Inkapsul ācijas intensit āte strauji augošaj ām m ātēm no grupas ar badošan ās periodu 12 stundas bija v ājāka nek ā mātītēm ar tipisku ķerme ņa masas pieaugum u (7. att ēls), k ā ar ī būtiski vājāka nek ā t ē vi ņiem no t ās pašas grupas. Grupas ar badošan ās periodu 72 stundas m ātītēm in kapsul ācijas reakcijas intensit āte bija b ūtiski sp ēcī gāka kā t ēvi ņiem (P< 0.001, 7. att ēls).

7. att ēls. Inkapsul ācijas reakcijas intensit āte G. Mellonella kāpuriem kontrolgrup ā un grup ās ar badošan ās periodu 12, 24 un72 stundas.

16 Pieaugušo vaska k ožu dz īves ilgums bija atkar īgs no badošan ās perioda ilguma (F = 49.439, df = 3, P< 0.0001), dzimuma (F = 1876.305, df = 1, P<0.0001) un šo divu paz īmju mijiedarb ības (F = 4.955, df = 3, P = 0.003) (8 . att ēls ). Pieaugušo vaska kožu dz īves ilgums pak āpeniski samazin ājās:visilg āk dz īvoja m ātī tes un t ēvi ņi no kontrolgrupas, bet vis īsā ka is dz īves ilgums nov ērots mātītēm un tēvi ņiem no grupas ar 72 stundu badošan ās periodu.

8. att ēls. Pieaugušo G. Mellonella tēvi ņu un m ātīšudz īves ilgums kontrolgrup ā un grup ās ar badošan ās periodu 12, 24 un72 stundas.

Vis īsākais pieaugušo vaska kožu dz īves ilgums tika konstat ēts ātri augošaj ām mātītēm no grupas ar 12 stundu badošan ās periodu. Šo kožu dz īves ilgums noz īmīgi atš ķī rās no m ātīšu un t ēvi ņu dz īves ilguma vis ās p ārējās grup ās (visi P> 0.0001), iz ņemot vaska kožu mātīšu dz īves ilguma grup ā ar 72 s tundu badošan ās periodu (P<0.05, 8. att ēls). Pieaugušie t ēvi ņi dz īvoja ilg āk kā m ātītes vis ās grup ās (visi P< 0.001, 8. att ēls).

3.3. Bar ības uzturv ērt ības un imunsist ēmas aktiviz ācijas ietekme uz antimikrobi ālo pept īdu gēnu ekspresij ām (III)

Starp četr ām bar ības uzturv ērt ības/imunsist ēmas aktiv ācijas gr up ām atkl ātas būtiskas vari ācijas šādu AMPgēnu ekspresijai: Gallerimycin , Gloverin , Cecropin- Dun 6-tox (Kruskola-Volisa hi kvadr āta tests , visi P< 0.025). Savuk ārt Galiomicin un Toll-like receptor 18 -Wheeler gēnu ekspresija starp grup ām b ūtiski neatš ķī rās(visi P> 0.05). Gallerimycin gēna ekspresija bija iev ērojami augst āka „augstv ērt īgas bar ības/kontroles” grup ākā „zemas uzturv ērt ības bar ības/kontroles” grup ā (T ūkija tests: P = 0.002), kā ar ī augst āka „augstv ērt īgas bar ības/kontroles” grup ā k ā „augstv ērt īgas bar ības/ aktiv ētas im ūnist ēmas” grup ā (P = 0.005) un „zemas uzturv ērt ības bar ības/aktiv ētas im ūnist ēmas ” grup ā (P = 0.003). Būtiskas atš ķir ības netika nov ērotas starp „zemas uzturv ērt ības bar ības/ kontroles” un „augstv ērt īgas bar ības/aktiv ētas im ūnsist ēmas” grup ām, k ā ar ī starp „zemas uzturv ērt ī bas bar ības/ aktiv ētas im ūnsist ēmas” un „augstv ērt īgas bar ības/ aktiv ētas im ūnsist ēmas” grup ām. Būtiskas atš ķir ības Gallerimycin gēna ekspresijai netika konstat ētas ar ī starp „zemas uzturv ērt ības bar ības/kontroles” un „zemas uzturv ērt ības bar ības/ aktiv ētas im ūnsist ēmas” grup ām (visi P > 0.05) (9. att ēls).

17

9. att ēls. AMP Gallerimycin gēna mRNS ekspresijas l īme ņa izmai ņas (kārtu skaits ± SEM), visa k āpura ķerme ņakopparaugos. K āpuri baroti vai nu ar augstv ērt īgu vai zemas uzturv ērt ības bar ību un to im ūnsist ēma tika vai nu aktiv ēta, veicot kutikulas pārduršanu ar neilona implant u, vai neaktiv ēta. Burti „a”un „b” apz īmē b ūtiskas atš ķir ības posteriorajos testos: ja izmantoti atš ķir īgi burti, tad atš ķir ības ir statistiski būtiskas P< 0.05.

AMP Gloverin gēna ekspresija bija b ūtiski augst āka „zemas uzturv ērt ības bar ības/akti vētas im ūnsist ēmas” grup ā nek ā „zemas uzturv ērt ības bar ības/kontroles” grup ā (P< 0.001) , augst āka eksperesija konsta tēta „zemas uzturv ērt ības bar ības/ aktiv ētas im ūnsist ēmas” grup ā nek ā „augstv ērt īgas bar ības/ kontroles” (P< 0.001) un „augstv ērt ī gas bar ības/ aktiv ētas im ūnsist ēmas” grup ā (P< 0.001). Gloverin gēna ekspresija būtiski neatš ķī rās starp „augstv ērt ī gas bar ības/ aktiv ētas im ūnsist ēmas” un „zemas uzturv ērt ības bar ības/kontroles” un „augstv ērt īgas bar ības/ kontroles” grup ām (visi P > 0.05) (10. att ēls).

10. att ēls. AMP Gloverin gēna mRNS ekspresijas l īme ņa izmai ņas (k ārtu skaits ± SEM) visa k āpura ķerme ņa paraugos. K āpuri baroti vai nu ar augstv ērt īgu vai zemas uzturv ērt ības bar ību un to im ūnsist ēma tika vai nu aktiv ēta, veicot kutikulas pārduršanu ar neilona implantu , vai neaktiv ēta. Burti „a” un „b” apz īmē b ūtiskas atš ķir ības posteriorajos testos: ja izmantoti atš ķir īgi burti, tad atš ķir ības ir statistiski būtiskas P< 0.05.

AMP Cecropin-D gēna ekspresija bija daudzk ārt augst āka „augstv ērt īgas bar ības/ kontroles” grup ā nek ā „zemas uzturv ērt ības bar ības/ kontroles” grup ā (P = 0.001). Cecropin-D gēna ekspres ija bija augst āka„augstv ērt īgas bar ības/ kontroles” grup ā nek ā „augstv ērt ī gas bar ības/aktiv ētas im ūnsist ēmas” grup ā (P = 0.019) un

18 „zemas uzturv ērt ības /aktiv ētas im ūnsist ēmas” grup ā (P = 0.008). Šī g ēna ekspresijas līme ņa atš ķir ībasstarp „zemas uzturv ērt ības bar ības/ kontroles” grup u un no „augstv ērt īgas bar ības/ aktiv ētas im ūnsist ēmas” grupas nebija statistiski noz īmīgas (11. att ēls).

11. att ēls. AMP Cecropin -Dgēna mRNS ekspresijas l īme ņa izmai ņas (k ārtu skaits ± SEM) visa k āpura ķerme ņa paraugos. K āpuri baroti vai nu ar augstv ērt īgu vai zemas uzturv ērt ības bar ību un to im ūnsist ēma tika vai nu aktiv ēta, veicot kutikulas pārduršanu ar neilona implantu , vai neaktiv ēta. Burti „a” un „b” apz īmē b ūtiskas atš ķir ības posteriorajos testos: ja izmantoti atš ķir īgi burti, tad atš ķir ības ir statistiski būtiskas P< 0.05.

AMP 6-tox gēna augst ākā ekspresija konstat ēta „augstv ērt īgas bar ības/ aktiv ētas im ūnsist ēmas” grup ā un t ā bija būtiski augst āka ne kā „augstv ērt īgas bar ības/kontroles” (P = 0.032) un „zemas uzturv ērt īgas bar ības/ kontroles” grup ā (P< 0.001). 6-tox gēna ekspresija s līmenis statistiski neatš ķī rās starp „augstv ērt īgas bar ības/ aktiv ētas im ūnsist ēmas” un „zemas uzturv ērt īgas bar ības/ aktiv ētas im ūnsist ēmas” grup ām (12 . att ēls).

12. att ēls. AMP 6-tox gēna mRNS ekspresijas l īme ņa izmai ņas (k ārtu skaits ± SEM) visa k āpura ķerme ņa paraugos. K āpuri baroti vai nu ar augstv ērt īgu vai zemas uzturv ērt ības bar ību un to im ūnsist ēma tika vai nu aktiv ēta, veicot kutikulas pārduršanu ar neilona implantu , vai neaktiv ēta. Burti „a”,„b”, „c” apz īmē b ūtiskas atš ķir ības posteriorajos testos: ja i zmantoti atš ķir īgi burti, tad atš ķir ības ir statistiski būtiskas P< 0.05, piem ēram, „ab” būtiski atš ķiras no „c”, bet „ab” neatš ķiras no „a” un „b” stabi ņiem.

19 3.4. Bar ības uzturv ērt ība, antibiotikas un AMPg ēnu ekspresija (IV)

Dispersijas anal īze par ādīja, ka visu pētāmoAMPgēnu ekspresijas līmenis bija augst āks k āpuriem no „augstv ērt īgas bar ības” grupas nek ā kāpuriem no „zemas uzturv ērt ības bar ības” grupas (Gallerimycin : iesp ējam ību attiec ība visp ārējā line āraj ā model ī (GLM, LR) Chisq 1 = 235.709, P< 0.0001; 6-tox : GLM, LRChisq 1 = 40.384, P < 0.0001; Galiomicin : GLM,LR Chisq 1 = 22.491, P < 0.0001; Cecropin-D:GLM,LR Chisq 1 = 171.380, P < 0.0001; Gloverin : GLM,LR Chisq 1 = 23.858, P < 0.0001). Kāpuru grup ās, kas tika pak ļautas antibiotiku ietekmei, AMP gēnu ekspresijas līmenis bija būtiski zem āks nek ā tiem k āpuriem, kuri netika pak ļauti antibiotiku iedarb ībai (6- tox : GLM,LR Chisq 1 = 77.948, P < 0.0001; Cecropin-D: GLM,LR Chisq 1 = 201.231, P < 0.0001; Gallerimycin : GLM,LR Chisq 1 = 288.633, P< 0.0001; Galiomicin : GLM,LR Chisq 1 = 61.111, P < 0.0001; Gloverin : GLM,LR Chisq 1 = 29.028, P < 0.0001). Bar ības uzturv ērt ības un antibiotiku izmantošanas mijiedarb ībaibija b ūtiska ietekme uz vair āku AMP gēnu ekspresiju: Gallerimycin (GLM,LR Chisq 1 = 7.322, P = 0.0068), 6-tox (GLM,LR Chisq 1 = 5.068, P = 0.0244) un Cecropin-D (GLM,LR Chisq 1 = 6.983, P = 0.0082),kam ēr bar ības uzturv ērt ības un antibiotiku mijiedarb ība neietekm ēja Gloverin (GLM,LR Chisq 1 = 3.260, P = 0.071) un Galiomicin (GLM,LR Chisq 1 = 0.438, P = 0.5079) gēnu ekspresiju, kas nor āda uz to, ka bar ības kvalit āte var veicin āt šo AMP gēnu ekspresiju. Posteriorais tests par ādīja, ka AMP gēnu ekspresija bija augst āka kāpuriem „augstv ērt īgas bar ības” grup ākā kāpuriem no „zemas uzturv ērt ības bar ības” grupas tikai tad, ja G.mellonella kāpurinetika baroti ar antibiotiku mais ījumu (Gallerymicin : vid ējais 1 ± SD = 16.96 ± 3.88 vs vid ējais 2 ± SD = 1.15 ± 0.2, P = 0.003; 6-tox : vid ējais 1 ± SD = 8.08 ± 1.12 vs vid ējais 2 ± SD = 0.82 ± 0.05, P < 0.001; Cecropin-D: vid ējais 1 ± SD = 11.46 ± 2.27 vs vid ējais 2 ± SD = 0.30 ± 0.07, P = 0.001; 13. att ēls). Būtiskas atš ķir ības AMP g ēnu ekspresijas līmen ī starp kāpuriem no „augstv ērt īgas bar ības” un „zemas uzturv ērt ības bar ības” grup ām, kur ās k āpuri tika baroti ar antibiotiku mais ījumu, netika konstat ētas (visi P> 0.05, 13. att ēls A-C). Kopum ā AMP gēnu ekspresijas līme ņi bija l īdz īgi kāpuriem no„zemas uzturv ērt ības bar ības/bez antibiotik ām” un „zemas uzturv ērt ības bar ības/ar antibiotik ām” un „augstv ērt īgas bar ības/ar antibiotik ām” grup ām (visi P > 0.05). Iz ņē mums bija tikai AMP 6-tox gēna ekspresija, kasbija b ūtiski augst āka kāpuriem no „zemas uzturv ērt ības bar ības/bez antibiotik ām” grupas kā kāpuriem no „augstv ērt īgas bar ības/ar antibiotik ām” grupas (P = 0.006, 13. att ēls). AMP Cecropin-D, 6-tox un Gallerymicin gēnu ekspresijas l īmenis „augstv ērt īgas bar ības/bez antibiotik ām” grupas k āpuriem bija būtiski augst āks k ā „augstv ērt īgas bar ības/bez antibiotik ām” un „zemas uzturv ērt ības bar ības/bez antibiotik ām” grupas k āpuriem (visi P < 0.005, 13. att ēls).

20

13. att ēls. Piecu AMP gēnu transkripcijas l īme ņi: 6-tox (A), Cecropin -D (B), Gallerimycin (C), Galiomicin (D) un Gloverin (E) vaska kožu k āpuru zarn ās. K āpuri baroti ar augstv ērt ī gu vai zemas uzturv ērt ības bar ību, k ā ar ī ar vai bez antibiotiku mais ījuma pētījuma s ākum ā. Gēnu ekspresijas l īmenis noteikts ar kvant itat īvo re āla laika P ĶR anal īzi un izteikt s pret references gēnu grupas ekspresiju situ ācij ā, kur zarnu mikrobioms tika iznicin āts, lietojot antibiotik u mais ījumu . Rezut āti noramaliz ēti, izmantojot referenc es gēnus 18S rRNA un EF1 ; vid ējās v ērt ības noteiktas izp ētot sešus paraugus katrai specifiskajai grupai . *** apz īmē bar ības veida un antibiotiku ietekmes galvenos b ūtiskus efektus (P< 0.0001). X apz īmē būtisku saist ību starp bar ības veidu un antibiotiku ietekmi (P<0.05). Mazie burtu „a”, „b” un „c” apz īmē būtiskas atš ķir ības posteriorajos testos (P< 0.05): p iem ēram, „bc” būtiski atš ķiras no „a”, bet „bc” neatš ķiras no „b” un „c” stabi ņiem.

3.5. 16S rRNA gēna V3 rajona taksonomisk ā sast āva anal īze (IV)

16S rRNS gēna V3 rajona taksonomisk ā sast āva anal īze, kas veikta ar Ion Proton TM sekvena toru, atkl āja, ka G.mellonella kāpuru zarnu trakt ā vi sbiež āk sastopamie mikroorganismi ir Enterococcus (apm. 73% no sekvenc ēm) ģints un Enterococcaceae dzimtas p ārst āvji (82% no sekvenc ēm).

3.6. Enterococci kultiv ēšana (IV)

Visliel ākais Enterococci koloniju veidojošo vien ību skaits konstat ēts „augstv ērt īgas bar ības /bez antibiotik ām” k āpuru grup ā (7.6x10 6 ± 14.70x10 6 kvv/ml; vid ējais ± SD). Enterococci koloniju veidojošo vien ību skaits bija b ūtiski maz āks kāpuriem no „zemas uzturv ērt ības bar ības” grupas (0.8x10 3 ± 1.5x10 3kvv /ml; vid ējais ± SD) ( t-tests: t(38) = 2.31, P = 0.027). Bakt ēriju kl ātb ūtne netika konst at ēta kāpuriem noabu bar ības veidu grup ām, kuri pētījuma s ākum ā tika baroti ar antibiotiku mais ījumu (14. att ēls).

21

14. att ēls. Enterococci koloniju veidojošo vien ību skaits (kvv/ml) G. Mellonella kāpuru zarnu traktu paraugos četr ās eksperiment ālaj ās grup ās. Trekn ās līnijas apz īmē medi ānas, bet vērt ībamplit ūdu k ārbas par āda 25 un 75 procent īles.

22 4. DISKUSIJA

4.1. Kompromisi starp dz īvības strat ēģ ijas paz īmēm un G. mellonella kāpuru att īst ību(I, II)

Pirmaj ā p ētījum ā ( I) tika atkl āts, ka k āpuri, kuriem bija pieejama augstv ērt īga bar ība, auga strauj āk, agr āk iek ūņ oj ās un to inkapsul ācijas reakcijas intensit āte bija vāja. Savuk ārt k āpuriem, kuriem bija pieejama gan augstv ērt īga, gan zemas uzturv ērt ības bar ība, bija ilg āks att īst ības laiks, un tiem nov ēroja sp ēcīgāku inkapsul ācijas reakciju. K āpuri, kam bija pieejama bar ība ar zemu uzturv ērt ību, att īstījās visilg āk, tom ēr tieši š īs grupas k āpuru inkapsul ācijas reakcijas intensit āte bija visstipr ākā. Viszem ākā mirst ība tika nov ērota kāpuriem, kam bija dota bar ība ar zemu uzturv ērt ību, bet visaugst ākā mirst ība bija tiem k āpuriem, kam visu laiku bijanodrošin āta bar ība ar augstu uzturv ērt ību. B ūtiska negat īva korel ācija tika atkl āta starp ķerme ņa masu un inkapsul ācijas reakcijas intensit āti kāpuriem, kam bija pieejama bar ība ar augstu uzturv ērt ību. Pētījumos ir noskaidrots, ka bar ības kvalit āte un pieejam ība agr īnās onto ģen ēzes stadij ās var b ūtiski ietekm ēt t ādas dz īvības strat ēģ ijas paz īmes k ā att īst ības laiks, ķerme ņa izm ērs, vairošan ās pan ākumi un izdz īvošana l īdz dzimumnobriešanai (Nylin & Gotthard 1998; Lindstrom 1999; Metcalfe & Monaghan 2001; Monaghan 2008; Dmitriew 2011). Pirmaj ā p ētījum ā ( I) ieg ūtie rezult āti par āda, ka G.mellonella kāpurivar ātri att īst īties un iek ūņ oties sasnieguši liel āku ķerme ņa svaru tikai tad, ja ir pieejama augstv ērt īga bar ība. Nepietiekamas bar ības apst ākļos G.mellonella kāpuri iek ūņ ojas būdami izm ēros maz āki, to att īst ībai ir nepieciešams ilg āks laiks un tiem ir liel āka mirst ība, un tas saskan ar citu p ētījumu rezult ātiem (Marstone et al. 1975). Pirmaj ā un otraj ā p ētījum ā ( I, II ) noskaidrots, ka ilg āks att īst ības laiks ir saist īts ar intens īvāku inkapsul ācijas reakciju, un tas nov ērtos kāpuriem, kam bija pieejamagan augstv ērt īga, gan zemas uzturv ērt ības bar ībavai tikaibar ība ar zemu uzturv ērt ību ( I, II ). Noz īmīga negat īva korel ācija starp ķerme ņa masu un inkapsul ācijas reakcijas intensit āti nov ērota tikai tiem kāpuriem, kam bija pieejama augstv ērt īga bar ība, kas nor āda uz savstarp ēji izsl ēdzošu kompromisu starp im ūnsist ēmas aktiv āciju un k āpuru augšanas ātrumu.

4.2. G. mellonella kompens ējoš ā augšana(II)

Šī promocijas darba p ētījumu rezult āti parāda, ka kompens ējoš ās augšanas par ādība (Hector & Nakagawa 2012) rakstur īga ar ī lielo vaska kožu k āpuriem ( II ). Kompens ējoš ā augšana tika konstat ēta tikai situ ācij ās, kad k āpurus pak ļā va īslaic īgam 12 stundas ilgam badam. Savuk ārt bar ības at ņemšana uz 24 vai 72 stund ām nebija saist īta ar kompens ējošo augšanu, jo 24 un 72 stundu badošan ās pal ēnin āja visu kāpuru augšanu, k ā ar ī paildzin āja k āpura stadijas laiku. Ta ču šiem k āpuriem bija intens īvāka inkapsul ācijas reakcija nek ā tiem, kas pa ātrin āja augšanas ātrumu pēc 12 stundu badošan ās (it seviš ķi strauji augoš ās m ātītes) vai kontroles grupas k āpuriem. Dabiskos apst ākļos, tikl īdz visa bar ība vien ā bišu strop ā ir ap ēsta, lielo vaska kožu kāpuri p ārvietojas uz citu bišu stropu, lai nodrošin ātu sev nep ārtrauktu att īst ību. Tom ēr, šaj ā p ētījum ā ( II ) bar ības tr ūkums, kas ilga vair āk k ā vienu dienu, noz īmīgi pal ēnin āja k āpuru att īst ību, neskatoties uz to, ka p ēc badošan ās perioda k āpuriem bar ība bija pieejama ad libitum. Visticam ākais izskaidrojums šim nov ērojumam –

23 dab ā k āpuriem, iesp ējams, ir nepieciešama vair āk k ā viena diena, lai sasniegtu citu apk ārtn ē esošu bišu stropu. P ārvietošan ās laik ā kāpuriem infic ēšan ās iesp ējam ība ir daudz augst āka nek ā atrodoties strop ā. Ārpus bišu stropa k āpuri risk ē sastapt patog ēnus un paraz ītus, un t āpēc lielo vaska kožu ( I) un Manduca sexta kāpuriem (Adamo et al. 2016) ir j āiegulda papildus resursi im ūnsist ēmas darb ībā. Pētījuma (II) rezult āti liecina, ka badošan ās periodi vai bar ības nepietiekam ība, kas G.mellonella paaugstina infic ēšan ās risku, var ētu b ūt noz īmīgs ķerme ņa izm ēra-att īst ības ātruma kompromisu ietekm ējošs faktors (Rantala & Roff 2005). Jo ilg āks ir badošan ās periods, jo ilg āka kāpura stadija un intens īvāka inkapsul ācijas reakcija. Šādos gad ījumos ir j āpaiet ilg ākam laikam, l īdz k āpurs var iek ūņ oties un sasniegt imago stadiju, bet tas savuk ārt palielina kop ējo dz īves ilgumu un paaugstina varb ūtību sastapties ar paraz ītiem, patog ēniem un infic ēties ar tiem. Š ī iemesla d ēļ kāpuriem ir izdev īgāk da ļu no saviem ierobežotajiem resursiem novirz īt uz im ūnsist ēmas aktiv āciju un t ās att īst ību kopum ā, vienlaic īgi maz āk invest ējot somatisk ās augšanas procesu uztur ēšanai (Lochmiller & Deerenberg, 2000; Zuk & Stoehr, 2002; Valtonen et al. 2010; Mohamed et al. 2014). Kopum ā š ī p ētījuma rezult āti skaidri par āda, ka starp att īst ības ātrumu un im ūnsist ēmu past āv kompromisu veidojoši meh ānismi. Kāpurus, kas badoj ās 12 stundas, var ēja iedal īt div ās apakšgrup ās: indiv īdi, kas pal ēnin āja att īst ību, sal īdzinot tos ar kontroles grupas k āpuriem, un kas turpin āja att īst īties l īdz īgi k ā k āpuri, kas badoj ās 24 vai 72 stundas, kā ar ī indiv īdi, kas auga iev ērojami ātr āk nekā kontroles grupas k āpuri. Kompens ējoš ā augšana ir ener ģē tiski dārgs process, uz ko nor āda iev ērojami īsāks dz īves ilgums k āpuriem ar kompens ējošo augšanu. Vājāka inkapsul ācijas reakcijas intensit āte strauji augošajiem kāpuriem izskaidro to īsāku dz īves ilgumu, nor ādot uz kompromisu starp imunit āti, ķerme ņa masas pieaugumu un att īst ības ātrumu (De Block & Stocks 2008b). Vēl viens iesp ējams izskaidrojums strauji augošo k āpuru-mātīšu īsākam dz īves ilgumam ir saist īts ar iesp ējamiem organisma oksidat īvajiem boj ājumiem. Tom ēr ir nepieciešami papildus p ētījumi, lai noskaidrotu oksidat īvā stresa darb ības meh ānismu ietekmi uz paaugstin ātu mirst ību k āpuriem, kam nov ērota kompens ējoš ā augšana. Šis p ētījums (II ) atkl āj, ka dzimums ietekm ē kompens ējoš ās augšanas iesp ējam ību p ēc īstermi ņa badošan ās. Tikai m ātītēm nov ērota kompens ējoš ā augšana, ko var izskaidrot ar ķerme ņa masas/izm ēra ietekmi uz daž ādu dzimumu individu ālo ģen ētisko piel āgot ību (Fairbairn et al. 2007). Ja daudzu bezmugurkaulnieku sugu mātītēm, sasniedzot dzimumnobriešanu, liel āka ķerme ņa masa ir noz īmīgs individu ālo ģen ētisko piel āgot ību ietekm ējošs faktors (Simmons & Zuk 1992; Simmons 1995; Harrison et al. 2013; Kelly et al. 2014), tad bezmugurkaulnieku tēvi ņiem ir svar īgāk nodrošin āt dz īvildzi uz ķerme ņa izm ēra r ēķ ina. T ēvi ņi g ūst individu ālās ģen ētisk ās piel āgot ības pieaugumu no lab āk att īst ītas imunit ātes un ilg ākas att īst ības, un G.melonella tēvi ņu dz īves ilgums bija caurm ērā divas reizes ilg āks nekā m ātītēm (Warren & Huddleston 1962). L īdz ar to mātītes var ieg ūt individu ālās ģen ētisk ās piel āgot ības liel āku pieaugumu, ja ener ģē tiskie resursi tiek vair āk novirz īti kompens ējošai augšanai. T ēvi ņu nesp ēja invest ēt resursus kompens ējoš ā augšan ā var b ūt saist īta ar ī ar iesp ējam ām dzimumatš ķir ībām endokr īnās un im ūnsist ēmas mijiedarb ībā un uz ņē mībā pret infekcij ām (Zuk & McKean 1996; Klein 2000; Foo et al. 2017). Ir svar īgi atz īmēt, ka murgurkaulinieku tēvi ņiem un m ātītēm ir konstat ētas atš ķir ības im ūnsist ēmasreakcij ās pret svešiem un pašu rad ītiem antig ēniem. T ēvi ņi ir uz ņē mīgāki pret infekcijas slim ībām, savuk ārt mātīšu im ūnsist ēmas reakcijas ir daudz sp ēcīgākas par t ēvi ņu reakcij ām, kas palielina

24 risku saslimt ar autoim ūnaj ām slim ībām (Klein & Flanagan 2016). Turkl āt straujas augšanas rezult ātā pieaug oksidat īvā stresa risks, un t āpēc sp ēcīgāka inkapsul ācijas reakcijas intensit āte var ētu izskaidrot lielo vaska kožu īsāku dz īvildzi (Krams et al. 2011a). P ētījum ā ieg ūtie rezult āti liecina, ka b ūtu j āveic padzi ļin āti p ētījumi ar ī par bezmugurkaulinieku t ēvi ņu un m ātīšu im ūnsist ēmas reakcijas atš ķir ībām uz infekcij ām saist ībā ar kompens ējošo augšanu.

4.3. Infekciju un bar ības savstarp ējā ietekme uz AMP g ēnu ekspresiju (III)

Šī promocijas darba rezult āti par āda, ka AMP g ēnu ekspresija main ās, ja kukai ņa ķermen ī tiek ievad īts neilona implants, kas imit ē paraz ītu vai parazito īdu darb ību, un gēnu ekspresijas izmai ņas var b ūt ļoti daudzveid īgas. Šie secin ājumi saskan ar citu iepriekš veikto pētījumu rezult ātiem, kas ir atkl ājuši ārk ārt īgi lielu ar imunit āti saist īto AMP g ēnu ekspresijas daudzveid ību s ēnīšu infekciju gad ījumos, un šo variabilit āti skaidro ar daudzu faktoru (melaniz ācija, stresa adapt ācija, detoksifik ācija, iekaisums) vienlaic īgu ietekmi (Dubovskiy et al. 2013a,b). Im ūnsist ēmas atbilde pret neilona implanta ievietošanu un s ēnīšu infekcij ām var ētu būt l īdz īgas, jo implants tiek ievietots l īdz īgi tam, k ā s ēnšu hifas iek ļū st kukai ņu kutikul ā. Tomēr p ētījuma rezult āti par ādīja, ka ir iev ērojamas atš ķir ības starp neilona implantu un s ēnīšu infekciju ietekmi uz organismu. Turkl āt, tika atkl āts, ka vaska kožu k āpuru bar ības daudzveid ība iev ērojami ietekm ē AMP g ēnu ekspresija (skat. Adamo et al. 2016), pie tam bar ības ietekme mijiedarbojas ar implanta ietekmi. Bar ības ener ģē tisk ā v ērt ība neietekm ēja AMP 18-Weeler , Galiomicin , Gloverin gēnu ekspresiju, bet noz īmīgi palielin āja 6-tox , Cecropin-D, Gallerimycin gēnu ekspresiju, kas pieauga no „zemas uzturv ērt ības bar ības/kontroles” grupas,sal īdzinot ar „augstv ērt īgas bar ības/kontroles” grupu. Ir zin āms, ka bar ība nosaka zarnu mikrobioma mikroorganisma sast āvu (Muegge et al. 2011), un bar ības daudzveid ība pozit īvi ietekm ē mikrobioma simbiontu skaitu un to sugu daudzveid ību (David et al. 2014; Carmody et al. 2015; Sonnenburg et al. 2016). Mikrobiomam ir liela loma saimniekorganisma homeost āzes uztur ēšan ā (Russell & Dunn 1996; Chatelier et al. 2013). Nesen veikt ā p ētījum ā ir noskaidrots, ka saimniekorganismi un simbionti savstarp ēji sadarbojas, lai saglab ātu zarnu mikrobioma līdzsvaru (Johnston & Rolff 2015), un saimniekorganisms simbiontu kontroli nodrošina sintiz ējot AMP prote īnus. Ja saimniekorganisma im ūnsist ēma nekontrol ē simbiontu augšanu un vairošanos, tie var k ļū t par tipiskiem patog ēniem, jo nekontrol ēti s āk izmantot resursus, kas nepieciešami saimniekorganisma augšanai un cit ām vajadz ībām (Erdogan & Rao 2015; Fujimori 2015). Svar īgi nor ādīt, ka šaj ā p ētījum ā ( III ) G.mellonella bar ība nebija steriliz ēta, t ādējādi, iesp ējams, ar uz ņemto bar ību zarn ās esošais mikrobioms tika izvad īts no organisma (Nyholm & McFall-Ngai 2004; Blum et al. 2013) un aizvietots ar bar ībā esoš ām oportuniskaj ām vai patog ēnaj ām bakt ērij ām, s ēnītēm (Jones et al. 2013; Cariveau et al. 2014). Iesp ējams tieši š ī iemesla d ēļ palielin ājās AMP 6-tox , Cecropin-D un Gallerimycin gēnu ekspresija. Daudzveid īga bar ība k āpuriem noz īmē liel āku varb ūtību, ka zarnu trakt ā non āks oportunisk ās infekcijas izraisošas bakt ērijas, un sainmiekorganisma AMP g ēnu ekspresijas izmai ņas var tik uzskat ītas par profilakses pas ākumu (Barnes & Siva- Jothy 2000). Zin āšanas par AMP prets ēnīšu un antimikrobi ālaj ām īpaš ībām nesniedza nek ādas priekšroc ības, lai var ētu paredz ēt AMP g ēnu ekspresijas izmai ņas pret neilona implantu – „māksl īgo paraz ītu”. Dažu AMP g ēnu ekspresijas pieaugums bija

25 saist īts ar bar ības daudzveid ību: š ī pētījuma rezult āti liecina, ka ne tikai bar ības daudzums (Adamo et al. 2016), bet ar ī bar ības daudzveid ība ietekm ē G.mellonella kāpuru im ūnsist ēmas atbildes reakciju. N ākotn ē ir nepieciešams veikt papildpētījumus, lai noskaidrotu, vai palielin āta dažu AMP g ēnu ekspresija tik tieš ām rada “uzraudz ības sist ēmu”, kas atpaz īst un elimin ē iebruc ējus, kuri non ākuši saimniekorganism ā kop ā ar bar ību, vai ar ī AMP g ēnu palielin āta ekspresija kalpo par atbildes reakciju pret tiem patog ēniem, kas jau ir p ārvar ējuši saimniekorganima aizsardz ības priekšposte ņus – im ūnsist ēmas prim ārās aizsardz ības l īnijas.

4.4. Mikrobioma un bar ības noz īme AMP aktiv ācij ā (IV)

Šī p ētījuma rezult āti par āda, ka G.mellonella kāpuriem, kam dotas antibiotikas, AMP g ēni tika ekspres ēti t ā saucamaj ā baz ālaj ā l īmen ī, kas atspogu ļo im ūnsist ēmas „uzraudz ības” aktivit āti situ ācij ā, kad zarnu trakt ā nav simbiontu. Interesanti, ka k āpuriem, kam tika dotas antibiotikas, 6-tox , Cecropin-D, Gallerimycin and Gloverin gēnu baz ālā ekspresija neatš ķī rās no t ās, kas nov ērota k āpuriem „zemas uzturv ērt ības bar ības/bez antibiotik ām” grup ā. Tas liecina, ka ener ģē tiskais ieguld ījums AMP g ēnu ekspresij ā nemain ījās, lai gan būtiski atš ķī rās zarnu trakta simbiontu skaits. Savuk ārt AMP g ēnu 6-tox , Cecropin-D, Galiomicin , Gallerimycin un Gloverin ekspresija bija iev ērojami liel āka tiem kāpuriem, kam dota augstv ērt īga bar ība, un kuru zarn ās bija liel āks Enterococci simbiontu skaits. Tas liecina par to, ka paaugstin āta g ēnu ekspresija ir pozit īvi saist īta ar bar ības daudzveid ību un Enterococci simbiontu skaitu zarnu trakt ā. Mikroorganismu alfa daudzveid ības p ētījumi par āda, ka G.mellonella zarnu mikrobiom ā visbiež āk sastopam ā mikroorganismu grupa ir Enterococci (Jarosz, 1979; Johnston & Rolff, 2015). Š ī pētījuma rezult āti apstiprina agr ākos atkl ājumus, ka, samazinoties bar ības vielu pieejam ībai, samazin ās ener ģē tiskie ieguld ījumi im ūnsist ēmā (Alonso-Alvarez & Tella 2001). Tas parāda bar ības daudzveid ības un kvalit ātes lielo noz īmi zarnu mikrobioma veidošan ā, k ā ar ī bar ības ietekmi uz augšanas trajektoriju un ar vairošan ās procesiem saist īto paz īmju un kompromisu starp t ām evol ūciju (Lazzaro & Rolff 2011). Š ī p ētījuma rezult āti atkl āj saikni starp simbiontu skaita pieaugumu un paaugstin ātu, ar imunit āti saist īto, gēnu ekspresiju kāpuriem, kam pieejama daudzveid īga bar ība. Visu ar imunit āti saist īto g ēnu ekspresija bija b ūtiski zem ākas k āpuriem, kuriem tika dota augstv ērt īga bar ība un antibiotikas, kā ar ī kāpuriem, kam dota zemas uzturv ērt ības bar ība bez antibiotik ām. Uzlabojoties bar ības kvalit ātei, palielin ās zarnu simbiontu daudzveid ība un simbiontu skaits, kas, savuk ārt, rada nepieciešam ību kontrol ēt simbiontus, izmantojot AMP prote īnus, kas funkcion ē k ā saimniekorganisma rad ītas antibiotikas. Tiek uzskat īts, ka veseliem indiv īdiem ir daudzveid īgāks zarnu mikrobioma sast āvs, un daž ādu slim ību gad ījum ā samazin ās zarnu mikrobioma daudzveid ība (skat īt Heiman & Greenway 2016). Iesp ējams, ka mikroorganismu daudzveid ību akt īvi ietekm ē ne tikai slim ības pašas par sevi, bet ar ī saimniekorganismu AMP. Ja simbionti nekontrol ēti aug un vairojas, tie var k ļū t kait īgi. Simbionti pat ērē saimniekorganisma bar ības vielas, ja vien saimnieka im ūnsist ēma neapspiež to att īst ību (Tamboli et al. 2004; Erdogan & Rao 2015; Fujimori 2015; Moos et al. 2016). Š ī p ētījuma rezult āti liecina, ka simbiotisko Enterococci bakt ēriju (Johnston & Rolff 2015) palielin āts skaits palielina ar imunit āti saist ītā Gloverin gēna ekspresiju, ko var uzskat īt par saimniekorganisma im ūnsist ēmas atbildes reakciju. Nekait īgo simbiotnu „uzraudz ība”, k ā ar ī AMP g ēnu aktiv ācija un to ekspresijas līme ņa

26 palielin āšana, gad ījum ā, ja simbionti ir par daudz savairojušies, ir ener ģē tiski d ārgs process tāpēc, ka kāpuriem j ānovirza būtiski savu resursu apjomi no augšanas un cit ām vajadz ībām uz im ūnsist ēmas vajadz ību nodrošin āšu. Pētījuma rezult āti par āda, ka bar ības daudzveid ība pati par sevi rada piecu ar imunit āti saist ītu g ēnu ekspresijas pieaugumu. Tika nov ērots ne tikai Gloverin gēna, kas apspiež Gram-pozit īvās baktērijas ( Enterococci ), bet ar ī Gallerimycin , 6-tox , Galiomicin and Cecropin-D gēnu ekspresijas pieaugums. Dabiskos apst ākļos G.mellonella kāpuri invad ē tikai tos stropus, kur ir pazemin āts medus bišu skaits, vai ar ī tos stropus, kur bišu saimi sk ārušas slim ības (Barjac & Thomson 1970). Š ādos stropos ar ī citi iebruc ēji, to skait ā bakt ērijas, ir sastopmai liel ākā skait ā. Vaska kodes ātri koloniz ē un „izt īra” šādus stropus, turkl āt pat ērē bar ību, kas satur daž ādus mikrobus. Bar ības daudzveid ība palielina vaska kožu k āpuru varb ūtību saslimt ar oportunisk ām infekcij ām, un t āpēc AMP g ēnu pastiprin āta ekspresija var kalpot k ā labs saimniekorganisma antimikrobi ālās profilakses pas ākums (Barnes & Siva-Jothy 2000). Lai ar ī simbiotisk ās attiec ības tiek uzskat ītas par abpus ēji izdev īgām gan saimniekam, gan simbiontam, šī promocijas darba ietvaros veiktie p ētījumi par āda, ka kukai ņu zarnu trakta simbionti rada ekolo ģiskas izmaksas saimniekorganismam. Pētījuma rezult āti liecina, ka l īdz ar bar ības daudzveid ību vienlaic īgi pieaug Enterococci koloniju veidojošo vien ību skaits, k ā ar ī Gallerimycin , Gloverin , 6-tox , Cecropin-D un Galiomicin gēnu ekspresijas intensit āte. Tom ēr, lai noskaidrotu ar simbiontiem saist īto ekolo ģisko kompromisu deta ļas, ir nepieciešami papildus pētījumi par bar ības daudzveid ības ietekmi uz šo kompromisu veidošanas un uztur ēšanas fiziolo ģiskajiem meh ānismiem. To ir iesp ējams paveikt profilaktiski aktiv ējot im ūnsist ēmu un analiz ējot mijiedarb ību starp bar ības daudzveid ību un simbiontu skaitu, ko saimniekorganisms kontrol ē ar AMP pal īdz ību. Š āda veida pētījumi ir noz īmīgi, lai izprastu bar ības resursu ekolo ģisko ietekmi uz kompromisiem starp imunit āti-augšanu-vairošanos bar ības ķē žu daudzveid ības apst ākļos.

27 SECINĀJUMI

1. Visstrauj ākā augšana, visv ājākā im ūnsist ēmas reakcija un augt āka mirst ība bija kāpuriem, kam dota daudzveid īga bar ība ar augstu uzturv ērt ību ( I). 2. Tika atkl āts, ka G.mellonella kāpuriem piem īt kompens ējoš ā augšana. T ā nov ērota tikai m ātītēm p ēc 12 stundu badošan ās, kas bija š ī p ētījuma īsākais badošan ās periods ( II ). 3. Ieg ūtie rezult āti par ādīja, lai ar ī implanta ievietošana izrais īja AMP g ēnu ekspresiju pieaugumu, neilona implants un s ēnīšu infekcijas nav identiski im ūnsist ēmas aktivatori ( III ). 4. Tika apstiprin āts, ka palielinoties bar ības daudzveid ībai, pieaug Enterococci koloniju veidojošo vien ību skaits, k ā ar ī palielin ās ar imunit āti saist īto AMP g ēnu Gallerimycin , Gloverin , 6-tox , Cecropin-D un Galiomicin ekspresija ( IV ).

KOPSAVILKUMS

Promocijas darb ā tika p ētīts, kā bar ības kvalit āte ietekm ē G.mellonella kāpuru augšanu, zarnu mikrobiomu, inkapsul ācijas reakciju, AMP g ēnu ekspresiju (I, II, III, IV ), k ā ar ī to, vai strauji augoši kukai ņi sp ēj pa ātrin āt to augšanu p ēc badošan ās perioda ( II ). Pētījumu laik ā noskaidrots, ka G.mellonella ir lielisks dz īvības strat ēģ iju teorijas p ētījumu objekts ( I, II, III, IV ). Visstrauj ākā augšana, visv ājākā im ūnsist ēmas reakcija un augt āka mirst ība bija k āpuriem, kamdota daudzveid īga bar ība ar augstu uzturv ērt ību ( I). K āpuriem, kam bija pieejama main īgas kvalit ātes bar ība (periodiski mainot bar ību no augstv ērt īgas uz zemas uzturv ērt ības bar ību), nov ēroja l ēnāku augšanu un sp ēcīgāku inkapsul ācijas reakciju. Visl ēnāk auga k āpuri, kam pieejama bar ība ar zemu uzturv ērt ību, bet tiem bija visstipr ākā inkapsul ācijas reakcija un viszem ākā mirst ība. Noz īmīga negat īva korel ācija starp ķerme ņa masu un inkapsul ācijas reakcijas intensit āti kāpuriem, kam dota daudzveid īga bar ība ar augstu uzturv ērt ību, nor āda uz konkurenci starp visstrauj āk augošo kukai ņu somatisko augšanu un imunit ātes darb ības nodrošin āšanu. Šie rezult āti pal īdz izprast saist ību starp bar ības veidu, bar ības uzturv ērt ību un G.mellonella dz īvības strat ēģ ijas paz īmēm. Pētījum ā ( II ) atkl āts, ka G.mellonella kāpuriem piem īt kompens ējoš ā augšana. Tā nov ērota tikai mātītēm p ēc 12 stundu badošan ās, kas bija š ī p ētījuma īsākais badošan ās periods. Š īs grupas m ātītēm bija visv ājākā inkapsul ācijas reakcija pret to ķermen ī ievietotu sveš ķermeni. Savuk ārt vissp ēcīgākā inkapsul ācijas reakcija nov ērota tēvi ņiem un m ātītēm, kas badoj ās 24 un 72 stundas. Šis p ētījums par āda ar dzimumu saist ītas imunit ātes reakciju atš ķir ības: grup ā, kas badoj ās 3 dienas, m ātītēm bija sp ēcīgāka inkapsul ācijas reakcijaskā t ēvi ņiem. Šis lielo vaska kožu att īst ības strat ēģ iju/augšanas plastiskums var tikt defin ēts k ā dinamisks kompromiss starp apk ārt ējo vidi, dz īvības strat ēģ ijas paz īmēm un dzimumu. Pētījumu rezult āti par āda, ka bezmugurkaulinieki var tikt izmantoti k ā mode ļorganismi, lai nākotn ēskaidrotu prec īzas atš ķir ības augšanas un imunit ātes reakciju procesos dzimumu starp ā. Izmantojot neilona implantu k ā sint ētisku paraz ītu, tika sagaid īts, ka dažu AMP g ēnu ekspresija var atspogu ļot rekcijas, kas rakstur īgas lielo vaska kožu kāpuriem s ēnīšu infekcijas gad ījum ā (III ). Tom ēr, ieg ūtie rezult āti par ādīja, lai ar ī implanta ievietošana izrais īja AMP g ēnu ekspresiju pieaugumu, neilona implants un

28 sēnīšu infekcijas nav identiski im ūnsist ēmas aktivatori. Konstat ēts, ka Gloverin un 6- tox gēnu ekspresija samazin ājās neilona implanta ietekmes rezult ātā. Savuk ārt 6-tox , Cecropin-D un Gallerimycin gēnu ekspresija bija iev ērojami augst āka, kad kāpuriempieejama vienk ārša zemas uzturv ērt ības bar ība,un maz āka, ja pieejama augstv ērt īga bar ība. Šie rezult āti liecina, ka bar ības kvalit āte un daudzveid ība ietekm ē G.mellonella kāpuru AMP g ēnu ekspresiju, un t āpēc pētījumos par G.mellonella bakt ēriju un s ēnīšu infekcij ām bar ības faktors vienm ēr ir jākontrol ē. Mikroorganismiem-simbiontiem, kas koloniz ē zarnu traktu, ir liela noz īme bar ības sagremošan ā un saimniekorganisma aizsardz ībā pret oport ūnistiskajiem mikrobiem, un tas j āņ em v ērā veicot ekolo ģiskos un entomolo ģiskos p ētījumus. Promocijas darba ceturtaj ā p ētījum ā ( IV ) tika apstiprin āts, ka Enterococci ir domin ējoš ā lielo vaska kožu zarnu trakta bakt ēriju grupa, un palielinoties bar ības daudzveid ībai, pieaug Enterococci koloniju veidojošo vien ību skaits, k ā ar ī palielin ās ar imunit āti saist īto AMP g ēnu Gallerimycin , Gloverin , 6-tox , Cecropin-D un Galiomicin ekspresija. Šie rezult āti par āda, ka bar ības daudzveid ība un kvalit āte ietekm ē G.mellonella mikrobioma daudzveid ību un im ūnsist ēmas reakcijas. Paaugstin āts ar imunit āti saist īto g ēnu ekspresijas pamata – baz ālais līmenis kalpo k ā saimniekorganisma pretmikrobu profilakses pas ākums un zarnu simbiontu kontroles veids. Tas liecina, ka bar ības daudzveid ība saimniekorganismam rada paaugstin ātas izmaksas past āvīgi aktiv ētas imunit ātes uztur ēšanai. Nākotn ē šaj ā jom ā b ūtu j āveic papildp ētījumi, jo somatisk ās augšanas, im ūnsist ēmas funkcion ēšanas, simbionto mikroorganismu un bar ības kvalit ātes savstarp ējā ietekme l īdz galam nav noskaidrota.

29 PATEICĪBAS

Esmu pateic īga savam darba vad ītājam Indri ķim Kramam par atbalstu, vad ību, sapratni un dal ību šaj ā darb ā. Esmu pateic īga ar ī saviem kol ēģ iem par piedal īšanos pētījumos, anal īžu veikšan ā, koment āru sniegšan ā diskusij ās un pal īdz ības sniegšan ā un it seviš ķi Tatjanai Kramai, Markus J. Rantala, Giedrius Trakimas, Inesei Kivleniecei, Jolantai Vrub ļevskai-Ļudi ņai, Katariina Kangassalo, Jorge Contreras- Garduño, Annai Rubikai, Fhionna Moore, Ērikam Jankevicam, Innai I ņaškinai, Didzim Elfertam, Jan īnai Daukštei, Severi Luoto, Priit Jõers, Lailai Meijai, Oj āram Lietuvietim, Ronaldam Kramam, Ditai Gudr āi, Dāvidam Fridmanim, Leldei Granti ņa- Ievi ņai, Sergejam Popovam.

30 CONTENTS

LIST OF ORIGINAL PAPERS ...... 4 1. INTRODUCTION ...... 32 1.1. Food, growth and life history ...... 32 1.2. Trade-offs between immunity and food availability ...... 33 1.3. Resources, compensatory growth and deficient development ...... 33 1. 4. Food availability, malnutrition and microbiome as part of immune function ..... 34 1.5. The aims of the thesis ...... 35 2. MATERIAL AND METHODS ...... 38 2.1. Study species ...... 38 2.2. Weighing and sexing of the moth ...... 38 2.3. Experimental groups and food ...... 38 2.4. Encapsulation response ...... 39 2.5. Extraction of RNA (III, IV) ...... 39 2.6. Quantitative real-time PCR (III, IV) ...... 39 2.7. 16S V3 rRNA gene amplification and sequencing (IV) ...... 40 2.8. Conventional bacterial culturing (IV) ...... 40 2.9. Removal of microbiota from the midgut (IV) ...... 40 3. RESULTS ...... 41 3.1. Nutritional value of food, time of development and encapsulation (I) ...... 41 3.2. Sex-specific compensatory growth (II) ...... 43 3.3. Food and immune treatment effects on expressions of AMP genes (III) ...... 45 3.4. Food, antibiotics and AMP expression (IV) ...... 47 3.5. Taxonomical composition analysis of 16S rRNA V3 region (IV) ...... 49 3.6. Conventional culturing of Enterococci (IV) ...... 49 4. DISCUSSION ...... 50 4.1. Life history trade-offs in the larval development of G. mellonella (I, II) ...... 50 4.2. Compensatory growth in G. mellonella (II) ...... 50 4.3. Infection and food interference in expressions of AMP genes (III) ...... 52 4.4. The role of microbiota and food in activation of AMP protection (IV) ...... 53 CONCLUSIONS ...... 55 SUMMARY ...... 55 ACNOWLEDGEMETS ...... 57 REFERENCES ...... 58 ORIGINAL PAPERS ...... 66

31 1. INTRODUCTION

1.1. Food, growth and life history

Life history theory posits that the schedule and duration of most important events in an organism's lifetime are shaped by natural selection to produce the largest possible number of surviving offspring. This is termed the individual fitness, and if taken together with the number of offspring of the individual’s relatives, it is termed the inclusive fitness. These events, notably duration of development, age of sexual maturity, time of the first reproduction, number of offspring produced and number of surviving offspring, level of parental investment, senescence and death, depend on the physical and ecological (biotic and abiotic) environment of the organism including pathogens and parasites. Organisms have evolved a great variety of life histories, from species, which produce thousands of eggs at one time and then die, to humans, other primates, elephants, which produce a few offspring over the course of decades. Factors that are present in a system and that control a process of the system can be defined as limiting factors. Within the living systems such factors affect processes of growth at the molecular and individual levels, influence the abundance of individuals and their distribution in a population and change the appearance and shape of the whole ecosystems. Importantly, a small change in the value of a limiting factorwould cause a significant effect on the system or change it substantially. Liebig's Law of the Minimum (Liebig's Law or the Law of the Minimum) is a concept of limiting factors developed in agricultural science by Carl Sprengel and later popularized by Justus von Liebig. This principle of Liebig’s Law states that growth is controlled not by the total amount of resources available, but by the scarcest resource. Limiting factors may be physical or biological and food/energy resources are among the most important limiting factors that have attracted much attention and research in ecology. Food is an important resource that fuels processes and patterns of growth, regeneration, dispersal and reproduction. Food is important not only to support the energy requirements of an organism but is consumed by a number of parasites of the organism and also used by the immune system and symbionts of the organism. Animal life cycles can be divided into two main phases: the first one is growth, which is followed by reproduction. While growth and reproduction of the same individual usually do not overlap, these major events can be shortened or prolonged at the expense of each other. These events are studied by life history theory that is part of evolutionary biology focused on the diversity of life history strategies of organisms of all kind and also the reasons and function of their life cycles. The main events of individual development and reproduction are as follows: the duration of juvenile development, age of sexual maturity and the timing of first reproduction, offspring number and the level of investment in offspring, the processes and timing of senescence and death. These life cycle events of the organism depend on the physical / biological environment, where the ability of immune system to respond to attacking pathogens and the availability / quality of food are among the most important qualities and limiting factors that link the organisms to their environment. Organisms have evolved nearly unlimited diversity of life histories, from species which develop directly during ontogenesis to those who undergo complex metamorphosis, and from organisms that produce millions of eggs and leave those without any parental care to primates and some other animals whose offspring cannot develop without continuous

32 care and need years to reach maturity. This has a substantial effect on fitness which is determined by the number of offspring an organism produces during its lifetime.

1.2. Trade-offs between immunity and food availability

Fast development is often associated with several fitness benefits such as better juvenile survival, more offspring and earlier investment into reproduction. However, increased speed of development can also have negative side effects because it monopolizes energy resources that cannot be invested into any other important trait or crucial physiological process. Evidence suggests that the maintenance and implementation of the immune system is costly, and that an organism often has to trade immune function against other fitness-related traits (Sheldon & Verhulst 1996;Norris & Evans 2000;Zuk & Stoehr 2002; van der Most et al. 2011; Schwenke et al. 2015; Flatt 2020). Moreover, maximal immune function brings an increase in the risk of shelf harm and autoimmune disease (Ricklefs & Wikelski 2002;Zuk & Stoehr 2002;Graham et al. 2005; Vojdani 2014; Wu et al. 2021). Thus, the strength of immune responses themselves must be adjusted and traded-off between other important organismal investments (Sheldon & Verhulst 1996;Zuk & Stoehr 2002; Rapkin 2018). During growth and reproduction stages trade-offs between immune function or its parts and reproduction (Knowles et al. 2009; Tuller et al. 2018), between parasite resistance and reproductive effort (Greer 2008; Singh et al. 2020) and between immune function and growth have been shown (Rantala & Roff 2005;Cotter et al. 2008;Vijendravarma, Kraaijeveld & Godfray 2009; Lozano-Durán & Zipfel 2015). It has been shown that malnutrition may make individuals more susceptible to disease (Lochmiller et al. 1993; Birkhead et al. 1999; Moret & Schmid-Hempel 2000; Hoi-Leitner et al. 2001; McKay et al. 2016; Farhadi &Ovchinnikov 2018; Dinh 2020). Under conditions of scarce resources not only immune function but also growth may be impaired suggesting a more complicated trade-off between these two life history traits (Klasing et al. 1987;Lochmiller & Deerenberg 2000;Hoi-Leitner et al. 2001; Cotter et al. 2010; Wilson et al. 2020). However, malnutrition may also prolong growth and immune function is needed in such cases to ensure longer life span in the stage of growth.

1.3. Resources, compensatory growth and deficient development

The availability of food is not constant through time and space. It may often run out so that organisms have to seek for new food elsewhere or wait until it is available again, or die. Compensatory growth, also known as catch-up growth or compensatory gain, is an unusually rapid development when an organism accelerates its growth to compensate or even overcompensate loss of body mass gain, tissue and organ development resulting from periods of food deprivation and ability to growth due to some other reasons (Leonard et al. 2002; Xu et al. 2014; Stumpf & López Greco 2015). Several factors have been outlined as being important to affect compensatory growth: the qualities of the restricted diet; the degree of severity of undernutrition; the duration of the period of undernutrition; the stage of development at the commencement of undernutrition; the relative rate of maturity of the species; the

33 pattern of re-alimenation (Wilson & Osborne 1960; Leonard et al. 2002; Steinberg 2018; Yuan et al. 2019). However, the role of these factors is not yet clear. Nutrient limitation may cause deficient development where an individual never reaches normal body mass or body size. To explain why all organisms do not grow at the maximum speed, it has been suggested that intense growth leads to the accumulation of oxidative damage of cellular lipids, proteins and DNA (Metcalfe & Monaghan 2003; Mangel & Munch 2005; Abdel-Wareth et al. 2015) by production of reactive oxygen species (ROS) (Finkel & Holbrook 2000; De Block & Stoks 2008a; Walsh et al. 2014). The costs of compensatory growth have also been found to decrease the maximum life span of individuals in a number of species (Metcalfe & Monaghan 2003; Holden et l. 2019). Rapid growth rate promotes adult diseases such as heart disease, diabetes and obesity in humans and rats (Cottrell & Ozanne 2008; Bol et al. 2009; Porrello et al. 2009; Zheng et al. 2018). Thus, compensatory growth allows animals to reach a larger size at maturity after periods of restricted food availability, although not every individual can afford this due to physiological and ecological constraints. Compensatory growth has been confirmed in a number of species such as microorganisms (Mikola & Setala 1998), fungi (Bretherton et al. 2006), plants (Orcutt & Nilsen 2000; McNickle & Evans 2018), insects (Dmitriew & Rowe 2004; De Block & 2008a,b,c; Xie et al. 2015), fish (Turkmen & Serhat 2012; de Oliveira et al. 2020), reptiles (Radder et al. 2007; Wang et al. 2011), birds (Hector & Nakagawa, 2012; de Morais e al. 2017) and mammals including (Cottrell & Ozanne 2008; Menegat et al. 2020). The exact physiological mechanism for compensatory growth is also not well explained, though it is clear that in some animals the endocrine systemis involved in the metabolism and nutrient partitioning in the tissues (Scanes 2003; Johnsonet al. 2014; Bertucci et al. 2019). It has been found that homeostatic and homeorhetic processes are involved in the abnormally high growth rates (Leonard et al. 2002; van der Meer 2021). Homeostatic processes usually affect compensatory growth in the short term, whereas homeorhetic processes usually have a long-term effect. However, more organisms need to be yesyed for their ability to follow the strategy of compensatory grwoth before one can conclude about its evolutionary and ecological role and general physiological mechanisms.

1. 4. Food availability, malnutrition and microbiome as part of immune function

During nutrient starvation, a reduction ofbasal metabolismtakes place (Scanes 2003; Caudwell et al. 2013). Then the amount of tissues decreases and the gut tissues are the first to be reduced in weight and activity. This is in line with findings showing that the elimination of nutrients reduces investments in the immune system (Lochmiller et al. 1993; Moret & Schmid-Hempel 2000; Alonso-Alvarez & Tella 2001; Hoi-Leitner et al. 2001; Krams et al. 2014; Mason et al. 2014; Childs et al. 2019), which in turn affects symbiont numbers and microbiota diversity (David et al. 2014; Mason & Raffa 2014; Carmody et al. 2015; Sonnenburg et al. 2016; Vernocchi et al. 2020). This suggests that food diversity and quality may be important in shaping intestinal microbiota, which may have profound effects on growth trajectories and the evolution of reproductive trade-offs (Lazzaro & Rolff 2011; Redmond et al. 2019). Recent research shows that the intestinal microbiome is a crucial part of immune system by serving a signalling hub that integrates environmental inputs, such as diet, with genetic and immune signals. It was shown that certain basic

34 developmental features and functions of the mammalian immune system depend on interactions with the human microbiome (Macpherson & Harris 2004; Ost & Round 2018). The most important parts of the innate immune system are found at the host– microbiome interface. The innate immune system of the host has the ability to sense microbes and their metabolic products and to translate the signals into host physiological responses which makes it possible to regulate microbiota. The lack of feedback between the immune system and the gut microbiota might and may result in immunological impairment and complex diseases (Thaiss et al. 2016). For example, immune system in germ-free laboratory animals is considered to be naïve to the influences by opportunistic microorganisms or gut symbionts. The gut-associated lymphoid tissues and other parts of the lymphatic system of these animals show a delayed development and defects in antibody production (Falk et al. 1998; Macpherson & Harris 2004; Round & Mazmaninan 2009; Lambring et al. 2019). Moreover, germ-free animals display impaired development and maturation of many parts of the gut (e.g., Dannappel et al. 2014; Vlantis et al. 2015). It was shown that intestinal epithelial cells, which line the gut and form a physical barrier between luminal contents (including the microbiota) and the underlying cells of the immune system, have altered patterns of microvilli formation and decreased rates of cell turnover in germ-free animals compared with wild-type animals (Dannappel et al. 2014). The relationships between species that live together in a community are also of high importance because an organism of one species may be exposed to the effects caused by an individual of another species. It has been found that the Gram-negative commensal organism, Bacteroides thetaiotaomicron , induces the expression of the antimicrobial peptide RegIII γ by specialized intestinal epithelial cells called Paneth cells (Cash et al. 2006; Sonnenburg et al. 2006). However, this response was not observed against the Gram-positive microbe, Bifidobacterium longum . Importantly, the antimicrobial activity of RegIII γ was found to be directed toward specific Gram- positive bacteria, which suggests that B. thetaiotaomicron directs innate immune responses of the gut in an effort to protect its environment against the Gram-positive competitors. To sum up, unlike opportunistic pathogens, which elicit immune responses that result in tissue damage during infection, symbiotic gut bacteria have long been appreciated for the benefits they provide to the host. This shows up as provision of essential nutrients, metabolism of indigestible compounds, defence against colonization by opportunistic pathogens and even contribution to the development of the intestinal morphology and function (Macpherson & Harris 2004; Round & Mazmanian 2009; Belkaid & Hand 2014; Gouba et al. 2019; Martin et al. 2019; Zheng et al. 2020). However, symbiotic microbiota also contains microorganisms that have been shown to induce inflammation under particular conditions. Therefore, the microbiota has the potential to exert both pro- and anti-inflammatory responses, and balances in the community structure of gut bacteria may be intimately linked to the proper function of the immune system. These ideas have never been tested before in terms of the ecological cost-benefit interplay under the regime of fluctuating food availability.

1.5. The aims of the thesis

35 The main aim of this thesis is to find out how the quality and availability of food affect growth patterns of the larvae of the greater wax moth ( Galleria mellonella ) and how larval development and some other life history traits can be traded off between ecological and physiological factors / parameters such food, immunity and mircobiome of the midgut. The first main aim of this thesis was to test whether individual larvae investment will change from growth to immune function under conditions of foods of low nutritional value because longer growth would need more investment into immune system. To test this one group of larvae of the greater wax moth was provided with high-energy food ad libitum during their development, one group provided with food of average quality, and another one received food containing low energy ( I). The strength of immune response was assessed via encapsulation response to nylon monofilament implantation, and the most rapid growth and weakest immunity were predicted in the high-energy food group. In the low-energy food group we predicted slower growth and stronger immunity. After activation of the immune system I expected higher mortality and less successful pupation in the high-energy food group and longer development in the low-energy group. Many animals are known to increase the speed of growth following a period of slowed development usually caused by food deprivation (Bohman 1955; Metcalfe & Monaghan 2001; De Block et al. 2008). The second aim of this study was to find out whether larvae of the greater wax moth respond to periods of dietary restrictions by growing slower/longer, or whether they can compensate for such periods via compensatory growth ( II ). I also expected to find sex-related differences in the growth responses. Females are known to respond to decreased nutrition by increasing growth rate because their fitness depend on a large adult body size (Nettle et al. 2016), whereas male fitness is more dependent on reaching adulthood and so they invest in immunity and survival to eclosion (Kelly et al. 2014). The encapsulation response is linked to all immune signaling pathways of insects (Lemaitre & Hoffmann 2007), and its strength depends on the availability and the nutritional value of food (Krams et al. 2014). This makes the strength of encapsulation response difficult to predict and to compare between different studies. The third aim of this thesis was to investigate the expression of various immunity- related antimicrobial peptide (AMP) genes during the insertion of a nylon monofilament in haemocoel of the larvae of the greater wax moth grown either on diverse food or simple food ( III ). AMPs belong to an early component of innate immune response towards bacterial and fungal infections. AMPs act as antibiotics that impose a lethal effect against invading organisms (Brogden 2005; Brown et al. 2009; Mylonakis et al. 2016) and modulate pathogen load in the host’s body (Kaneko et al. 2007). I predicted that AMP genes would be more expressed in the larvae with the activated immunity that are grown on high-quality macronutrient-rich food than when grown on simple food of low nutritional value. The fourth aim of this thesis was to test whether AMP gene expression is linked with the taxonomical composition of microorganisms in the midgut samples of the larvae of G. mellonella and how this is related to food richness (IV ). I expected to find Enterococci mundtii as the dominating bacterium in the midgut of larvae (Jarosz 1979; Johnston & Rolff 2015). I also predicted that AMP genes in the midgut of greater wax moth larvae would be less expressed when grown on simple food of low nutritional value than when grown on macronutrient/energy-rich food. Further, the larvae were fed with an antibiotic cocktail to test whether AMP genes’ expression during dysbiosis is similar to the transcriptional activation of AMPs of larvae raised

36 on nutrient-poor food. 16S V3 rRNA gene analysis to was used to determine the taxonomical composition of microorganisms in the midgut samples. Thesis: in the low-energy food group we predicted slower growth and stronger immunity. After activation of the immune system is expected higher mortality and less successful pupation in the high-energy food group and longer development in the low-energy group.

37 2. MATERIAL AND METHODS

2.1. Study species

The greater wax moth G. mellonella is a moth of the family Pyralidae that is distributed in most parts of the world. The larvae of the greater wax moth feed on the honeycomb inside honeybee hives and often become pests of apiculture (Warren & Huddleston 1962). Previous studies found extremely fast larval grow if food of the highest nutritional quality is available: the larvae started pupation on day 28 while under deficient food conditions, their development extends up to 6 months (Marston et al. 1975). The larvae of G. mellonella have been shown to be an excellent model organism in genetics, ecology, immunology and for testing new molecules and pathogenicity of substances in pharmacology studies. This may replace tests of rats, mice and other mammals in the future research (Harding et al. 2014). I studied a captive population of G. mellonella consisting of individuals collected from natural populations in Estonia in summer 2014 and individuals collected in Latvia. Moths were reared in 2.4 litre plastic boxes at 28-30 °C in the dark in Sanyo MIR-253 incubators. Each larva was placed individually into plastic containers with a lid and wire-mesh to allow ventilation and to prevent them from escaping.

2.2. Weighing and sexing of the moth

Measuring of body mass of the larvae was started on posthatch day 14 ( II, III ) or 15 (I) once daily until the larvae pupated. Body mass of the larvae was rounded to the nearest 0.01 mg. Larvae were weighed using a Kern analytical balance (Kern & Sohn GmbH, Balingen, Germany). We also had a separate group of larvae to assess survival during larval and pupal development; none of these larvae was used to assess the strength of encapsulation response. Sex identification was done during pupal and adult phase (Ellis et al. 2013) ( IV ).

2.3. Experimental groups and food

To study the links between growth ( I), food quality and immunity, the larvae were divided into three groups: (i) the high-energy food group received only food of the highest nutritional value provided ad libitum until day 30; (ii) the average-energy food group received food of high nutritional quality provided ad libitum for 2 days followed by another 2 days on low quality food until day 30 post-hatch; (iii) the low- energy food group received only ad libitum food of low quality and nutritional value from hatching till day 30 post-hatch. To study the effects of food deprivation on possible compensatory growth of G. mellonella larvae, the larvae were randomly assigned to one of three main starvation treatment groups and a control group ( II ). In the starvation groups, food was removed for periods of 12, 24 and 72 hours. There was also a control group where the larvae had an unlimited access to food. To study the expression of AMP genes ( III ), the larvae were assigned to the following groups: (i) the ‘diverse diet / immune treatment’ group, (ii) the ‘diverse diet

38 / control’ group, (iii) the ‘simple diet / immune treatment’ group and (iv) the ‘simple diet / control’ group. Finally, the larvae were kept on contrasting diets between hatching and post-hatch day 25 ( IV ): the ‘diverse diet’ group received only food of high nutritional value and diversity, provided ad libitum (Fig. 1), while the ‘simple diet’ group received only food of low nutritional value and diversity, provided ad libitum . The food diversity was combined with antibiotics treatment ( IV ). The diverse / energy rich diet consisted of a mix of equal proportions of honey, glycerol, bee-wax, dried milk, wheat flour, dry yeast, distilled water and two servings of corn meal. The amount of energy associated with this food was estimated as ca. 17.00 kJ/g by a combustion calorimeter (IKA ®-Werke GmbH & Co. KG, Germany) ( I, II, III, IV ). The larvae received only water during hours of food deprivation ( II ).

2.4. Encapsulation response

The strength of the encapsulation response was operationalized as the lightness of the nylon filament insert after it had been dried ( I). Insect immune systems respond to this challenge as if the insert were a foreign body, by attempting to encapsulate it in a coating of cellular materials and chemical deposits (e.g. Rantala et al. 2000). The stronger the immune response to the insert, the darker the encapsulation (Yourth et al. 2001; Krams et al. 2013a,b), due to phenoloxidase enzyme production activated by the immune response, resulting in melanization of the capsule (Ratcliffe et al. 1985). Lightness was assessed from photographs of the inserts taken from two or three directions under constant light conditions using a Zeiss Lumar V12 Stereo (Carl Zeiss, Jena, Germany) microscope. Digital images were analysed using the Image J software (http://rsbweb.nih.gov/ij/; Abramoff et al. 2004). Prior to this, we calibrated reflectance of an implant before the insertion to zero level.

2.5. Extraction of RNA (III, IV)

The larvae were chilled on ice for 15 min, surface-sterilized with 70% ethanol and their whole bodies were disrupted in liquid nitrogen ( III, IV ). We pooled individual larvae for each treatment group. RNA was obtained from several replicates of each of experimental groups. The larval bodies were further homogenized in 1 ml of Trizol reagent, and RNA was extracted according to the manufacturer's recommendations. RNA integrity was confirmed by ethidium bromide gel staining, and quantities were determined spectrophotometrically.

2.6. Quantitative real-time PCR (III, IV)

Levels of steady-state transcripts were determined from cDNA samples by real-time quantitative PCR (RT-PCR) using Ct protocol with the 7500 Real-Time PCR System (Applied Biosystems) and SYBR Green PCR mix (Qiagen), relative to two reference genes: 18S rRNA and translation elongation factor 1-alpha . The following six target genes were investigated, coding for AMPs: Gloverin , Gallerimycin , 6-tox , Galiomicin , Cecropin D and the Toll-like receptor 18-Wheeler (III, IV ).

39 2.7. 16S V3 rRNA gene amplification and sequencing (IV) rRNA V3 region was amplified separately by reverse and forward primers (Milani et al. 2013). PCR amplification was performed by GeneAmp® PCR System 9700 (Thermo Fisher Scientific, U.S.A.) and 16S rRNA PCR products were then quantified, pooled and purified ( IV ) Prior to clonal amplification, each library was diluted and pooled. Sample emulsion PCR, emulsion breaking and enrichment were performed using the Ion PI TM Hi-QTM OT2 Kit (Life Technologies, U.S.A.), following the manufacturer’s instructions. The complete sample was loaded onto a PI TM chip v3 and sequenced on the Ion Proton TM Semiconductor Sequencer for 520 cycles employing the Ion PI TM Hi-QTM Sequencing 200 Kit. Bidirectional sequencing was performed, but reads were not paired. After the sequencing run was completed, the individual sequence reads were filtered by the Proton software to remove low quality sequences. Sequences matching the Proton 3’ adaptor were automatically trimmed. All Proton quality- approved, trimmed and filtered data were exported as bam files. Sequencing data analysis was carried out using QIIME v.1.8.0. and UPARSE v.7.0.1001. pipeline to quality-filter and cluster 16S rRNA amplicon sequences (Pylro et al. 2014). Quality control retained sequences with the mean sequence quality score >20. Operational Taxonomic Units (OTUs) were built at 97% sequence identity with uclust (Edgar 2010). Taxonomic assignment to the lowest possible rank was performed with RDP (Wang et al. 2007), using the Greengenes (DeSantis et al. 2006) (http://greengenes.secondgenome.com) reference dataset (gg_otus-13_8 release). Alpha diversity measure−Shannon diversity index was calculated within the QIIME environment.

2.8. Conventional bacterial culturing (IV)

Larval midguts were dissected and used for microbiological analysis ( IV ). Serial dilutions of the midgut homogenate were prepared with sterile peptone water and plated in duplicates on the Bile Esculin Azide Agar, a selective Enterococcus agar (Sigma-Aldrich, U.S.A.). Enterococci were further determined by the BBL Crystal Identification Systems Gram-positive ID KIT (Becton, Dickinson and Company, U.S.A.) (e.g., Von Baum et al., 1998).

2.9. Removal of microbiota from the midgut (IV)

The midgut microbiota was removed by treating larvae with antibiotics and antifungal drugs. The larvae were force-fed antibiotic cocktail consisting of water-soluble forms of ampicillin, erythromycin, gentamicin, kanamycin and ketoconazole ( IV ).

40 3. RESULTS

3.1. Nutritional value of food, time of development and encapsulation (I)

All individuals of high-energy and average -energy groups survived, while only 30 out of 50 larvae survived until day 30 post -hatch in the low-energy food group (Fisher’s exact test: P = 0.0001). The time of pupation (duration of larval development) signifi cantly differed among the groups (one -way ANOVA: F 2,87 = 1765.60, P< 0.0001, Fig. 1). All three groups differed significantly (Tukey’s post -hoc test: P< 0.001, Fig. 1).

Fig. 1. The effects of food quality on duration of larval development of G. mellonella . Bars show means ± SE.

Body mass differed among the larvae on day 30 post -hatch (one-way ANOVA: F 2,87 = 26.40, P < 0.0001, Fig. 2), and it was significantly greater in the high -energy food group than body mass of individuals kept on average-en ergy food and individuals of the low-energy food group, while individuals in the average-energy food group were heavier than the larvae of low -energy food group (Tukey’s post-hoc test: all Ps < 0.001, Fig. 2).

Fig. 2. The effects of food quality on t he larval body mass prior pupation in G. mellonella . Bars show means ± SE.

41 The encapsulation response against the nylon monofilament differed significantly among larvae of the three food groups (one -way ANOVA: F2,87 = 62.32, P < 0.0001; Fig. 3) on day 30. The strength of encapsulation response of larvae from the high - energy food group was significantly weaker than that of larvae from the average - energy food group and weaker than encapsulation response of larvae of the low - energy food group (Tukey ’s post-hoc test: all Ps < 0.0001, Fig. 3).

Fig. 3. The effects of food quality on the strength of encapsulation response of G. mellonella larvae. Bars show means ± SE.

Fourteen of 30 larvae survived and pupated in the high -energy group over the course of three days upon removal of nylon implants. The larvae survived significantly better (26 out of 30) in the average -energy food group (Fisher’s exact test: P = 0.002), and in the low-energy group (28 out of 30) (Fisher’s exact test: P = 0.0001) than in the high-energy food group. Survival of larvae in the average -energy and low -energy food groups (Fisher’s exact test: P = 0.67) did not differ significantly. 2 Multiple linear regression analysis (adjusted R = 0.57, F 2,87 = 55.32, P< 0.0001) showed that encapsulation response of the larvae was dependent on the quality of food ( β = -0.75, P< 0.0001), while body weight ( β = -0.01, P = 0.87) was not a significant determinant of encapsulation response, demonstrating that high - energy food decreased the strength of encapsulation response in G. mellonella . No interaction was found to be significant suggesting that food quality was the pri mary determinant of encapsulation response. 2 Multiple linear regression analysis showed (adjusted R = 0.80, F 2,87 = 181.02, P< 0.0001) that developmental time of larvae was not dependent upon the strength of encapsulation response ( β = 0.09, P< 0.24), whi le it was dependent on food quality ( β = -0.83, P< 0.001), demonstrating that food of low energy -content increased the larval development in G. mellonella . The strength of encapsulation response was significantly negatively correlated with body mass only i n the high-energy food group (r = -0.44, P = 0.015 vs r = -0.05, P = 0.78 in the average-energy group and r = 0.18, P = 0.35 in the low-energy food group).

42 3.2. Sex -specific compensatory growth (II)

Post-starvation growth rates of the larvae significantly differed between the starvation treatment groups ( F = 367.138, df = 3, P< 0.0001) and sexes ( F = 66.656, df = 1, P< 0.0001). Interaction between sex and treatment was also significant ( F = 10.231, df = 3, P< 0.0001) meaning that females were always heavier than males. Importantly, males and females of two groups that fasted for 24 and 72 h were smaller and their body mass gain was lower than those in the control individuals and males and females of the 12 h starvation group (Fig. 4). However, all females in the 12 h starvation group did not seem to develop similarly because some females ( n = 19) remained smaller than the control females ( P< 0.0001), while other females ( n = 15) gained more body mass and grew significantly heavier than the femal es of the control group (P< 0.0001) (Fig. 4, 5). Thus, the latter females ( n = 15) of the 12 h starvation treatment group not only compensated for their body mass loss, but actually overcompensated with mass gain during the post -starvation period.

Fig . 4. The total gain of body mass in three starvation groups and the control group in the post-starvation period.

Fig. 5. The larval growth before and after food was removed on day 18 posthatch for 12, 24 and 72 hours in the experimental and control g roup.

The growth trajectory of the rapidly growing females was significantly steeper than the growth trajectories of all larvae in all other groups ( P< 0.0001) during the post - starvation period. The trajectory of larval growth in the control group was found to be steeper (Fig. 5) than that of the rest of females and males in the 12 h starvation

43 treatment group and the larvae of the 24 and 72 h starvation treatment groups ( P< 0.0001). The duration of larval development was significantly influenced by treatment (F = 493.20, df = 3, P< 0.0001) and by sex and treatment interaction ( F = 4.40, df = 3, P = 0.0053) (Fig. 6). The duration of larval development significantly differed between female subgroups in the 12 h starvation group (females growing typically vs rapidly growing females: 28.95 ± 1.31 vs 27.13 ± 0.35 days, mean ± SD, P< 0.0001) (Fig. 6). The longer the starvation, the longer became the larval development both in males and females, and males (32.083 ± 0.282 days, mean ± SD) and females (32.143 ± 0.359 days, mean ± SD) of the 72 h starvation treatment group had the longest growth time (Fig. 6). The males and females that grew typically in the 12 h group developed significantly longer than males and females in the control group (all Ps < 0.05). However, the rapidly growing females did not differ in their duration of larval dev elopment from the control group ( P> 0.05). No significant sex differences were found in any other groups ( P> 0.05).

Fig. 6. The duration of the larval stage in the starvation treatment groups and the control group.

The encapsulation response was af fected by treatment (F = 217.003, df = 3, P< 0.0001) and interaction between treatment and sex ( F = 27.457, df = 3, P< 0.0001), while it did not depend on sex ( F = 0.304, df = 1, P = 0.582). The e ncapsulation rate was significantly lower in the females tha t developed rapidly than in the females that developed typically in the 12 h starvation group (Fig. 7). The rapidly growing females in the 12 h starvation group had significantly lower encapsulation rates than the males, the females responded significantly stronger than males to the nylon implant ( P< 0.001, Fig. 7) in the 72 h starvation treatment group.

44 Fig. 7. The encapsulation rates (grayscale values) of G. mellonella larvae in 12 h, 24 h and 72 h starvation groups and the control group.

Adult lifespan was affected by treatment ( F = 49.439, df = 3, P< 0.0001), sex (F = 1876.305, df = 1, P<0.0001) and their interaction ( F = 4.955, df = 3, P = 0.003) (Fig. 8). The duration of the adult stage gradually decreased from control males and females to in dividuals in the 72 h starvation treatment group.

Fig. 8. The adult lifespan (days) of males and females of G. mellonella from 12 h, 24 h and 72 h starvation groups and the control group.

The shortest adult stage was found in individuals from the r apidly growing female subgroup in the 12 h starvation treatment group. It differed significantly from all female and male groups (all Ps > 0.0001) with the exception of the females from the 72 h starvation group ( P< 0.05, Fig. 8). The males always had long er lifespans than the females in all of the groups (all Ps < 0.001, Fig. 8).

3.3. Food and immune treatment effects on expressions of AMP genes (III)

The results show a significant variation between the four diet / immunity treatment groups of the larvae in expressions of Gallerimycin , Gloverin , Cecropin -D and 6-tox (Kruskal-Wallis chi-squared test, all Ps < 0.025). Expressions of Galiomicin and the Toll-like receptor 18-Wheeler did not differ significantly between the groups both Ps > 0.05). The Gallerimycin AMP gene was expressed at significantly higher level in the ‘diverse diet/control’ group than in the ‘simple diet / control’ group (Tukey HSD tes t: P = 0.002); higher in the ‘diverse diet / control’ group than in the ‘diverse diet / immune challenge’ group ( P = 0.005) and in the ‘simple diet / immune challenge’ group ( P = 0.003). Significant differences were found neither between the ‘simple diet / control’ and the ‘diverse diet / immune challenge’ groups, nor the ‘simple diet / immune challenge’ and the ‘diverse diet / immune challenge’ groups, nor the ‘simple diet / control’ and the ‘simple diet / immune challenge’ groups (all P > 0.05) (Fig. 9).

45

Fig. 9. Mean (± SEM) fold mRNA expression levels of Gallerimycin gene in the whole body samples of the greater wax moth larvae grown on diverse and simple diets that received the nylon implant or did not receive the implant. Lower -case letters ‘a’ and ‘b’ denote significant differences by post hoc tests at P< 0.05.

The expression of Gloverin AMP gene was higher in the ‘simple diet / immune challenge’ group than in the ‘simple diet / control’ group ( P< 0.001); higher in the ‘simple diet / immune challenge’ group than in the ‘diverse diet / control’ group ( P< 0.001) and in the ‘diverse diet / immune challenge’ group ( P< 0.001). The expression did not differ between the ‘diverse diet / immune challenge’ group of and the ‘simple diet / control group’ and the ‘diverse diet / control’ group (all P > 0.05) (Fig. 10).

Fig. 10. Mean (± SEM) fold mRNA expression levels of Gloverin gene in the whole body samples of the greater wax moth larvae grown on diverse and simple diets that received the nylon implant or did not receive the implant. Lower -case letters ‘a’ and ‘b’ denote significant differences by post hoc tests at P< 0.05.

The Cecropin-D AMP gene was upregulated in the ‘diverse diet / control’ group compared to the ‘simple diet / control’ group ( P = 0.001). The expression of Cecropin-D was higher in the ‘diverse diet / control’ group than in the ‘diverse diet / immune challenge’ ( P = 0.019) and the ‘simple diet / immune challenge’ groups ( P = 0.008). ‘Simple diet / control’ group was not statically different from the ‘diverse diet / immune challenge’ group (Fig. 11).

46

Fig. 11. Mean (± SEM) fold mRNA expression levels of Cecropin -D gene in the whole body samples of the greater wax moth larvae grown on diverse and simple diets that received the nylon implant or did not receive the implant. Lower -case letters ‘a’ and ‘b’ denote significant differences by post hoc tests at P< 0.05.

The expression of 6-tox AMP gene was the highest in the ‘diverse diet / immune challenge’ group and it was significantly higher than the 6-tox AMP gene expressions in the ‘diverse diet / control’ group ( P = 0.032) and in the ‘simple diet / control ’ group (P< 0.001). The expression of 6-tox gene in the ‘diverse diet / immune challenge’ group did not differ statistically from that in the ‘simple diet / immune challenge’ group (Fig. 12).

Fig. 12. Mean (± SEM) fold mRNA expression levels of 6-tox gene in the whole body samples of the greater wax moth larvae grown on diverse and simple diets that received the nylon implant or did not receive the implant. Lower -case letters ‘a’, ‘b’ and ‘c’ denote significant differences by post hoc tests at P< 0.05 . For instance, the ‘ab’ bar significantly differs from the ‘c’ bar, while the ‘ab’ bar does not significantly differ from the ‘a’ and ‘b’ bars.

3.4. Food, antibiotics and AMP expression (IV)

The analysis of variance showed that expressions of all the A MP genes were significantly higher in the ‘diverse diet’ group than in the ‘simple diet’ group (Gallerimycin :GLM,LR Chisq 1 = 235.709, P< 0.0001; 6-tox : GLM,LR Chisq 1 = 40.384, P < 0.0001; Galiomicin : GLM,LR Chisq 1 = 22.491, P < 0.0001; Cecropin- D:GLM,LR Chisq 1 = 171.380, P < 0.0001; Gloverin : GLM,LR Chisq 1 = 23.858, P < 0.0001). Treatment with antibiotics was associated with significantly lower expressions of all AMP genes compared with groups without antibiotics treatment ( 6-

47 tox : GLM,LR Chisq 1 = 77.948, P < 0.0001; Cecropin-D:GLM,LR Chisq 1 = 201.231, P < 0.0001; Gallerimycin :GLM,LR Chisq 1 = 288.633, P< 0.0001; Galiomicin : GLM,LR Chisq 1 = 61.111, P < 0.0001; Gloverin : GLM,LR Chisq 1 = 29.028, P < 0.0001). Diet and treatment interaction showed significant ef fect on expression of Gallerimycin (GLM,LR Chisq 1 = 7.322, P = 0.0068), 6-tox (GLM,LR Chisq 1 = 5.068, P = 0.0244) and Cecropin -D (GLM,LR Chisq 1 = 6.983, P = 0.0082) gene expression while Gloverin (GLM,LR Chisq 1 = 3.260, P = 0.071) and Galiomicin (GLM,LR Chisq 1 = 0.438, P = 0.5079) gene expression did not differ significantly between interaction groups, suggesting that diet alone has the potential to increase the expression of these two genes. Post hoc tests revealed that the AMP genes were expr essed at significantly higher levels in the ‘diverse diet’ group (mean 1 ± SD) than in the ‘simple diet’ group (mean 2 ± SD) when the larvae of G. mellonella were not treated with antibiotics (Gallerymicin : mean 1 ± SD = 16.96 ± 3.88 vs mean 2 ± SD = 1.15 ± 0. 2, P = 0.003; 6- tox : mean 1 ± SD = 8.08 ± 1.12 vs mean 2 ± SD = 0.82 ± 0.05, P < 0.001; Cecropin-D: mean 1 ± SD = 11.46 ± 2.27 vs mean 2 ± SD = 0.30 ± 0.07, P = 0.001; Fig. 13). However, we did not find any significant differences between the ‘diverse diet’ gr oup under antibiotics treatment and ‘simple diet’ group under antibiotics treatment in expressions of the AMP genes (all P > 0.05, Fig. 13A-C). In general, the AMP genes were similarly expressed between the ‘simple diet without antibiotics treatment’ group and the ‘diverse diet’ and ‘simple diet’ groups with antibiotics treatment ( P > 0.05). The exception was 6-tox which was expressed significantly more in the ‘simple diet without antibiotics’ group than in the ‘diverse diet with antibiotics’ group ( P = 0.0 06, Fig. 13). Expressions of Cecropin-D, 6-tox and Gallerymicin genes in the ‘diverse diet without antibiotics’ group were significantly higher than those in the diverse and simple diet groups with antibiotics (all P < 0.005, Fig. 13).

Fig. 13. The transcription levels of five AMP genes: 6-tox (A), Cecropin -D (B), Gallerimycin (C), Galiomicin (D) and Gloverin (E) in the midgut of the greater wax moth larvae grown on a diverse and a simple diet with and without antibiotic

48 treatment. The t ranscription levels of the AMP genes were determined by a quantitative real-time RT -PCR analysis and are shown relative to the expression levels of the reference group in which the microbiome was eliminated. Results were normalized against the expression o f the housekeeping 18S rRNA and EF1 genes and represent means of six independent determinations and standard deviations. *** indicates significant main effects of diet and antibiotic treatment ( P< 0.0001). X indicates significant interaction between diet a nd treatment ( P<0.05). Lower -case letters ‘a’, ‘b’ and ‘c’ denote significant differences by post hoc tests at P< 0.05. For example, the ‘bc’ bar significantly differs from the ‘a’ bar, while the ‘bc’ bar does not differ from the ‘b’ and ‘c’ bars.

3.5. T axonomical composition analysis of 16S rRNA V3 region (IV)

Taxonomical composition analysis performed by Ion Proton TM semiconductor sequencer of 16S rRNA V3 region revealed that the most prevalent genus in the microbial community associated with the midgut of G. mellonella larvae was Enterococcus (ca. 73% of the sequences), while the relative abundance of the family Enterococcaceae accounted for 82%.

3. 6. Conventional culturing of Enterococci (IV)

The highest number of CFU of Enterococci was found in the ‘diverse diet without antibiotics’ group (7.6x10 6 ± 14.70x10 6 CFU/ml; mean ± SD), while the number of Enterococci CFU was significantly lower in the ‘simple diet’ group (0.8x10 3 ± 1.5x10 3 CFU/ml; mean ± SD) (t -test: t(38) = 2.31, P = 0.027). Bacteria were not found in the antibiotics treatment groups grown on diverse and simple diets (Fig. 14).

Fig. 14. The Enterococci counts of colony forming units (CFU)/ml in the midgut samples of G. mellonella in four experimental treatments. Thick lines represent medians, while the boxes show 25 -75% percentiles.

49 4. DISCUSSION

4.1. Life history trade-offs in the larval development of G. mellonella (I, II)

The study ( I) revealed rapid growth, earlier pupation and weak encapsulation response in the larvae of the high-energy food group. It took longer to develop in the average-energy group, while encapsulation response was stronger in this group. The larvae grew longer in the low-energy food group, and had the strongest encapsulation response. The highest survival rates were observed in larvae of the low-energy food group, while the highest mortality rates were observed in the high-energy food group. Finally, a significant negative correlation was found between body mass and the strength of encapsulation response only in the high-energy food group. Evidence suggests that nutrition at early stages of ontogeny may substantially affect such life history traits as developmental time, body size, reproductive success and survival at maturity (Nylin & Gotthard 1998; Lindstrom 1999; Metcalfe & Monaghan 2001; Monaghan 2008; Dmitriew 2011). This study ( I) supports previous findings by showing that G. mellonella can afford fast larval development and greater body weight at pupation only if food of the highest nutritional quality is available. This shows that poor nutrition resultes in decreased body size of G. mellonella at pupation, prolonged larval development and high mortality as has previously been shown (Marstone et al. 1975). This study also shows that longer developmental time is associated with stronger encapsulation response as it was found in the average- and low-energy food groups ( I, II ). Low encapsulation response was a likely explanation for the high mortality rate after activation of the immune system in the larvae of the high-energy food group. Moreover, a significant negative correlation between body mass and the strength of encapsulation response was found only in G. mellonella larvae of the high-energy food group showing a trade-off between immune function and larval growth.

4.2. Compensatory growth in G. mellonella (II)

This thesis provided evidence for the phenomenon of compensatory growth (Hector & Nakagawa 2012) in the larvae of the greater wax moth ( II ). Compensatory growth was evident only in the group with the shortest food deprivation (12 h). In contrast, food deprivation for 24 and 72 hours was not associated with compensatory growth because the longer food deprivation slowed larval growth and prolonged the duration of larval phase in all individuals in the 24 h and 72 h starvation treatment groups. However the latter larvae had stronger encapsulation response than individuals that increased their growth in the 12 h starvation group (rapidly growing females) or individuals in the control group. The larvae of the greater wax moth move to another beehive once the food is consumed to ensure the continuation of their development. However, in our study food deprivation that lasted for more than one day significantly slowed the larval development, despite the larvae receiving food ad libitum during the post-starvation period. The most likely explanation for this finding is that in the nature larvae may have to spend more than one day to reach and infest any other bee nest in the vicinity. Importantly, during dispersal the probability to get infected is much higher than inside the beehive. Outside the beehive the larvae are more likely to encounter pathogens and parasites, and therefore they need to enhance investments in

50 the immune system as indicated in the greater wax moth ( I) and Manduca sexta caterpillars (Adamo et al. 2016). The results suggest ( II ) that periods of starvation (or food shortage), which are indicative of an elevated risk of encountering parasites and pathogens in G. mellonella , might be an important factor affecting body size–developmental speed trade-offs (Rantala & Roff 2005). The longer was the food deprivation time, the longer lasted the larval stage and the stronger was the encapsulation response. Prolonged time to reach the pupal and adult stages means that the larvae have more potential encounters with parasites. Thus, the larvae may benefit from allocating a portion of their limited nutritional resources to immunity rather than growth (Lochmiller & Deerenberg, 2000; Zuk & Stoehr, 2002; Valtonen et al. 2010; Mohamed et al. 2014). The results of this study suggest that developmental speed was traded off against immunity. The larvae in the group with food deprivation of 12 h became divided into the following two subgroups: i) individuals that slowed their development compared to the control group and followed the type of development similar to the larvae in the groups with food deprivation lasting 24 h or 72 h; ii) the larvae that grew significantly faster than individuals of the control group. Compensatory growth clearly brings costs, as can be seen in the significantly shorter life span in larvae in the compensatory growth subgroup than in any other subgroup or group. The weaker encapsulation response in the overcompensating larvae is a likely explanation for the shorter adult lifespan, indicating that they traded off immunity against body mass and developmental speed (De Block & Stocks 2008b). Another potential explanation for the shorter adult lifespan in the rapidly growing female larvae is related to oxidative damage. However, additional studies are needed to test oxidative stress linked mechanisms to prove their role in inducing higher mortality in the larvae exhibiting compensatory growth. The present study reveals sex has a crucial effect on the likelihood of compensatory growth following short-term fasting. Only females showed compensatory growth, and this result can be explained by accounting for the role of body size/mass in individual fitness in different sexes (Fairbairn et al. 2007). If larger body mass at maturity is crucial to female fitness (Simmons & Zuk 1992; Simmons 1995; Harrison et al. 2013; Kelly et al. 2014) and males need to ensure survival at the expense of body size, females may gain more by allocating resources into compensatory growth. Males can benefit from their enhanced immunity and longer development by merely reaching the adult stage because they have twice as long lifespan as females (Warren & Huddleston 1962). The inability of males to invest in compensatory growth may also be linked to potential sex differences in endocrine- immune interactions and consequent susceptibility to infection (Zuk & McKean 1996; Klein 2000; Foo et al. 2017). It is important to note that vertebrate males and females differ in responses of their immune system to foreign and self-antigens. Males are more susceptible to disease while females often have stronger immune responses which may contribute to higher incidence of autoimmune diseases and malignancies (Klein & Flanagan 2016). Besides higher risk of oxidative stress due to increased growth rates, a stronger encapsulation rate may account for the shorter life span observed in adults of the greater wax moth (Krams et al. 2011a). The results obtained suggest that invertebrates should also be studied in more detail in regard to possible male and female differences in responses of their immune system to foreign bodies and infections.

51 4.3. Infection and food interference in expressions of AMP genes (III)

The results of this thesis show that AMP gene expressions are highly variable during implantation of the nylon monofilament mimicking the parasite/parasitoid attack. This supports earlier findings that revealed an enormous variation in expression of immunity-related AMP genes against fungal infections and explained this as a simultaneous action of different kinds of stressors that work in concert with factors linked to melanism, stress adaptation, detoxification, and inflammation (Dubovskiy et al. 2013a,b). The immune responses against nylon monofilament insertion and fungal infections may be similar because both the insert and fungi penetrate the insect cuticle in a similar way. However, the present results show that there are considerable differences between the effects caused by fungal infections and insertion of the nylon monofilament. It was also found that the diversity of larval diet may cause a considerable source of variation in the expression of AMP genes (see also Adamo et al. 2016) and that food-borne effects interfere with the effects caused by insertion of the nylon monofilament. Food diversity did not affect the expression of 18-Weeler , Galiomicin , Gloverin , while the expression of 6-tox , Cecropin-D, Gallerimycin significantly increased from the ‘simple food / control’ group to the ‘diverse food / control’ group. The composition of gut microbiomes is known to be structured through diet (Muegge et al. 2011) and the increase in the diversity of nutrients positively affects symbiont numbers and microbiota diversity (David et al. 2014; Carmody et al. 2015; Sonnenburg et al. 2016). It is known that microbiome is of high importance in maintaining homeostasis of the host’s body (Russell & Dunn 1996; Chatelier et al. 2013). A recent study showed that host and symbiont communities cooperatively interact to maintain the midgut microbiota in a symbiotic balance (Johnston & Rolff 2015), suggesting that the host needs more control over symbionts by means of AMP proteins. Symbionts may become pathogenic if they grow and reproduce uncontrollably, diverting resources away from growth and other needs of the host if not controlled by the host’s immune system (Erdogan & Rao 2015; Fujimori 2015). Importantly, the food of G. mellonella was not sterilized in this study, which makes it possible that resident microbes in the gut may be flushed away by a downstream flow of ingested content (Nyholm & McFall-Ngai 2004; Blum et al. 2013) and replaced by opportunistic or pathogenic bacteria (Jones et al. 2013; Cariveau et al. 2014). This might also be a reason behind the increased expressions of 6-tox , Cecropin-D and Gallerimycin . One more possibility is that a diverse diet means a higher probability of opportunistic infections entering the midgut of the larvae, while the upregulation of AMP gene expression may indicate a prophylactic response by the host (Barnes & Siva-Jothy 2000). The knowledge about antibacterial and antifungal properties of AMPs was not helpful in predicting their expression in the response to insertion of the nylon monofilament – a ‘synthetic parasite’. This may be partly explained by the elevated expressions of certain immunity-related AMP in response to more diverse diet. Our results suggest that food diversity and not only the amount of food (Adamo et al. 2016) affects immune responses of G. mellonella larvae. In future research it is necessary to test whether the heightened expressions of some AMPs represent a surveillance system that recognizes and attacks the intruders entering the host’s body with more diverse food, or whether this is a response to pathogens that have already breached the host’s defense system.

52 4.4. The role of microbiota and food in activation of AMP protection (IV)

The results of this study show that when force-fed with antibiotics at larval stage, G. mellonella developed basal expression levels of immunity-related AMP genes. These levels reflect ‘surveillance’ activity of the immune system in the midgut in the absence of symbionts. Interestingly, the basal expression of 6-tox , Cecropin-D, Gallerimycin and Gloverin of larvae force-fed with antibiotics did not differ from expressions of those genes under conditions when the larvae received a simple diet without antibiotics. This suggests that investment in the production of AMPs did not change between conditions of microbial dysbiosis and the diet consisting of simple/low-energy food despite the difference in symbiont numbers in the midgut. In contrast, the AMP genes 6-tox , Cecropin-D, Galiomicin , Gallerimycin and Gloverin were all significantly upregulated in the group of larvae grown on a diverse diet − those harboring the highest number of Enterococci symbionts. Hence, the elevated gene expressions were positively linked with the increased diversity of diet and the number of Enterococci symbionts. Alpha diversity measurements show that Enterococci are the most abundant group of microorganisms in the midgut microbiome of G. mellonella (Jarosz, 1979; Johnston & Rolff, 2015). Our results also confirm earlier findings that the elimination of nutrients reduces investments in the immune system (Alonso-Alvarez & Tella 2001). This highlights the importance of food diversity and quality in shaping intestinal microbiota, which may have profound effects on growth trajectories and the evolution of reproductive trade-offs (Lazzaro & Rolff 2011). The results of this study demonstrate the link between the increased number of symbionts and elevated immune-related gene expressions in the larvae raised on a diverse diet. These results are opposite to our additional findings in the larvae raised on a diverse diet with guts cured using antibiotics or the larvae raised on a simple diet and not cured with antibiotics: expressions of all immunity-related genes were significantly lower in these groups. Thus, an increase in diet quality results in a higher number and greater diversity of symbionts involved in the digestion of nutrients, and this presumably requires more control over symbionts by means of AMP proteins. The gastrointestinal microbiome is considered to be more diverse in intestines of healthy individuals; a loss in species diversity is a common finding in several disease states (for a review, see Heiman & Greenway 2016). Symbionts may, however, become harmful if they grow and reproduce uncontrollably. Symbionts may therefore consume more nutrients than would be normally expected to maintain symbiotic relationships, becoming either commensal or causing bacterial overgrow in intestines/midgut if not properly suppressed by the immune system of the host (Tamboli et al. 2004; Erdogan & Rao 2015; Fujimori 2015; Moos et al. 2016). The results of this thesis suggest that high numbers of symbiotic Enterococci bacteria (Johnston & Rolff 2015) elicit elevated expressions of immune-related genes in order to produce, for example, Gloverin as an immune system response of the host. The ‘surveillance’ of a harmless symbiont, as well as an activation and production of AMP in cases when this symbiont becomes too abundant, might be costly since the larvae would need to divert resources and energy away from growth and other organismal needs. Importantly, our results suggest that food diversity itself induced the elevated expressions of all five immunity-related genes. Instead of elevated expression only of Gloverin (responsible for suppressing Gram-positive bacteria such as Enterococci ), we observed upregulation also in Gallerimycin , 6-tox , Galiomicin and Cecropin-D. In

53 nature, the larvae of G. mellonella often invade only hives with low honey bee populations or hives where bees have already died from a disease (Barjac & Thomson 1970). These hives are usually occupied by other intruders, including bacteria. The wax moth, for instance, quickly colonize and clean up these hives by consuming food contaminated by various microbes. Thus, a diverse diet might indicate a higher probability of acquiring opportunistic infections, while an elevated expression of all five immunity-related genes may be considered to be a prophylactic response (Barnes & Siva-Jothy 2000). Thus, while symbiotic interactions are considered to be mutually beneficial to the host and its symbionts, this study suggests that having midgut symbionts induces ecological costs to their insect hosts. This finding arises from the greater activation of the part of the immune system of G. mellonella larvae responsible for the production of AMPs. This thesis shows that the CFU of Enterococci and expressions of Gallerimycin , Gloverin , 6-tox , Cecropin-D and Galiomicin increased in response to a more diverse diet. However, quantifying and revealing the exact mechanisms of these costs as a part of ecological trade-offs remain to be done in future research. This task will require studies to disentangle the possible effects caused by a diverse diet. This can be accomplished by eliciting the prophylactic activation of the immune system and analyzing the positive relationship between diet diversity and the number of symbionts, which seemingly needs to be controlled by the host. This type of work is crucial in order to increase our understanding of the ecological effects that food resources have on immunity-growth-reproduction trade-offs under the immense complexity of food webs.

54 CONCLUSIONS

1. The most rapid growth and the weakest immunity were found in the larvae of the high-energy food group ( I). 2. The phenomenon known as ‘compensatory growth’ was revealed in G.Mellonella. This was confirmed only in the female larvae that starved for 12 h which was the shortest fast in this study ( II ). 3. The results obtained showed that the nylon implant is not quite the same as fungi, while AMPs strongly responded to the implant ( III ). 4. The number of colony forming units (CFU) of Enterococci and expressions of certain immunity-related antimicrobial peptide (AMP) genes such as Gallerimycin , Gloverin , 6-tox , Cecropin-D and Galiomicin increased in response to a more diverse diet ( IV ).

SUMMARY

In this thesis I tested some questions related to the effects of food quality and its interrelations with the midgut microbiome, encapsulation response, expression of AMP genes and growth in the larvae of G. mellonella (I, II, III, IV ). I was also interested to test whether this rapidly growing insect is able to accelerate its growth in a response to periods of food unavailability ( II ). It appeared that G. mellonella is an excellent object for the studies in the field of life history theory ( I, II, III, IV ). The most rapid growth and the weakest immunity were found in the larvae of the high-energy food group ( I). It took longer to develop on food of average nutritional quality, while encapsulation response was stronger in this group. The larvae grew longer in the low-energy food group, and had the strongest encapsulation response. The highest survival rates were found in larvae of the low-energy food group, while the highest costs via mortality rates were observed in the high-energy food group. A significant negative correlation between body mass and the strength of encapsulation response was found only in the high-energy food group revealing significant competition between growth and immunity functions only at the highest rates of growth. These results help to establish relationships between types of food, its nutritional value and life history traits of G. mellonella larvae. The phenomenon known as ‘compensatory growth’ was revealed in G. mellonella (II ). This was confirmed only in the female larvae that starved for 12 h which was the shortest fast in this study. The strength of encapsulation reactions against a foreign body inserted in haemocoel was the weakest in females that showed compensatory growth, whereas the strongest encapsulation was recorded in the males and females that fasted for 24 and 72 h. This study also found sex-biased immune reactions so that females had stronger encapsulation rates than males in the group that faster for three days. This thesis shows the plasticity in developmental strategies / growth rates in the greater wax moth, which is the result of highly dynamic trade-offs between the environment, life history traits and sex. Overall, my results suggest that invertebrates are suitable object for the future studies on sex-biased growth and immunity responses.

55 When a nylon monofilament was used a synthetic parasite I expected that expressions of some AMP would mimic responses characteristic to those when the larvae of greater wax moth are attacked by fungi ( III ). The results obtained showed that the nylon implant is not quite the same as fungi, while AMPs strongly responded to the implant. The expression of Gloverin and 6-tox were upregulated in response to the insertion of the nylon monofilament. Expression of 6-tox , Cecropin-D and Gallerimycin were significantly higher in the ‘simple food’ group than in the ‘diverse food’ group. Overall, the results suggest that the diversity of food may affect the expression of AMP genes of G. mellonella larvae. This suggests that the diversity of food should always be controlled in studies on bacterial and fungal infections of G. mellonella . Communities of symbiotic microorganisms that colonize the gastrointestinal tract play an important role in food digestion and protection against opportunistic microbes and this must be taken into account in ecological and entomological reserach. In the final study of this thesis ( IV ), it was shown that Enterococci are the dominating group of bacteria found in the midgut and that the number of colony- forming units (CFU) of Enterococci and expressions of certain immunity-related antimicrobial peptide (AMP) genes such as Gallerimycin , Gloverin , 6-tox , Cecropin- D and Galiomicin increased in response to a more diverse diet. Overall, the results suggest that the diversity and quality of food affect the diversity of the microbiome and immune responses in G. mellonella . That elevated basal levels of immunity- related genes act as a prophylactic against opportunistic infections and as a measure to control the gut symbionts may indicate that a diverse diet imposes higher immunity costs on an organism. Thus, this and many more question need to be addressed in future research to better understand the interplay of growth, immunity, microbes and food quality.

56 ACNOWLEDGEMETS

I am grateful to my scientific supervisor Indrikis Krams for a generous support, guidance, understanding and participation in this work. I also thank the colleagues for participation in the study, analysis, discussions, comments and various help, particularly Tatjana Krama, Markus J. Rantala, Giedrius Trakimas, Inese Kivleniece, Jolanta Vrub ļevska-Ļudi ņa, Katariina Kangassalo, Jorge Contreras-Garduño, Anna Rubika, Fhionna Moore, Ēriks Jankevics, Inna I ņaškina, Didzis Elferts, Jan īna Daukšte, Severi Luoto, Priit Jõers, Laila Meija, Ojārs Lietuvietis, Sergey Popov, Ronalds Krams, Dita Gudr ā, D āvids Fridmanis, Lelde Granti ņa-Ievi ņa.

57 REFERENCES / LITERATŪRAS SARAKSTS

Abdel-Wareth, A.A.A., Kehraus, S., Ali, A.H.H., Ismail, Z.S.K., Südekum, K.-H. 2015. Effects of temporary intensive feed restriction on performance, nutrient digestibility and carcass criteria of growing male Californian rabbits . Archives of Animal Nutrition 69(1): 69-78. Abramoff, M.D., Magalhaes, P.J. and Ram, S.J. 2004. Image processing with ImageJ. Biophotonics International 11: 36-42. Adamo, S.A., Roberts, J.L., Easy, R.H., Ross, N.W. 2008. Competition between immune function and lipid transport for the protein apolipophorin III leads to stress-induced immunosuppression in crickets. Journal of Experimental Biology 211: 531–538. Alonso-Alvarez, C., Tella, J.L. 2001. Effects of experimental food restriction and body-mass changes on the avian T-cell-mediated immune response. Canadian Journal of Zoology 79: 101–105. Belkaid, Y., Hand, T.W. 2014. Role of the microbiota in immunity and inflammation. Cell 157(1): 121-141. Bertucci, J.I., Blanco, A.M., Sundarrajan, L., Rajeswari, J.J., Velasco, C., Unniappan, S. 2019. Nutrient Regulation of Endocrine Factors Influencing Feeding and Growth in Fish. Front Endocrinol (Lausanne) 10: 83. Birkhead, T.R., Fletcher, F., Pellatt, E.J. 1999. Nestling diet, secondary sex- ual traits and fitness in the zebra finch. Proceedings of the Royal Society of London Series B-Biological Sciences 266: 385–390. Blum, J.E., Fischer, C.N., Miles, J., Handelsman, J. 2013. Frequent replenishment sustains the beneficial microbiome of Drosophila melanogaster . mBio 4: e00860–13. Bohman, V.R. 1955. Compensatory growth of beef cattle: the effect of hay maturity. J. Anim. Sci. 14: 249–255. Bol, V.V, Delattre, A.I., Reusens, B., Raes, M., Remacle, C. 2009. Forced catch-up growth after fetal protein restriction alters the adipose tissue gene expression program leading to obesity in adult mice. Am. J. Physiol. Regul. Integr. Comp. Physiol. 297: 291–299. Bretherton, S., Tordoff, G.M., Jones, T.H., Boddy, L. 2006. Compensatory growth of Phanerochaete velutina mycelial systems grazed by Folsomia candida (Collembola). FEMS Microbiology Ecology 58(1): 33–40. Brogden, K.A.2005. Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria? Nature Reviews Microbiology 3: 238–250. Brown, S.E., Howard, A., Kasprzak, A.,East, P.D.2009. A peptidomics study reveals the impressive antimicrobial peptide arsenal of the wax moth Galleria mellonella .Insect Biochemistry&Molecular Biology Journal 39: 792–800. Carmody, R.N., Gerber, G.K., Luevano, J.M., Gatti, D.M., Somes, L., Svenson, K.L., Turnbaugh, P.J. 2015. Diet dominates host genotype in shaping the murine gut microbiota. Cell Host and Microbe 17: 72–84. Cash, H.L., Whitham, C.V., Behrendt, C.L., Hooper, L.V. 2006. Symbiotic bacteria direct expression of an intestinal bactericidal lectin. Science 313:1126–30. Caudwell, P., Finlayson, G., Gibbons, C., Hopkins, M., King, N., Näslund, E., Blundell, J.E. 2013. Resting metabolic rate is associated with hunger, self- determined meal size, and daily energy intake and may represent a marker for appetite. Am J Clin Nutr. 97(1): 7-14. Chatelier, E.L., Nielsen, T., Qin, J., Prifti, E., Hildebrand, F., Falony, G. et al. 2013.

58 Richness of human gut microbiome correlates with metabolic markers. Nature 500: 541–546. Childs, C.E., Calder, P.C., Miles, E.A. 2019. Diet and Immune Function. Nutrients 11(8): 1933. Cotter, S.C., Myatt, J.P., Benskin, C.M.H., Wilson, K. 2008. Selection for cuticular melanism reveals immune function and life-history trade-offs in Spodoptera littoralis . Journal of Evolutionary Biology 21: 1744–1754. Cotter, S.C., Simpson, S.J., Raubenheimer, D., Wilson K. 2010.Macronutrient balance mediates trade ‐offs between immune function and life history traits. Functional Ecology 25: 186–198. Cottrell, E.C., Ozanne, S.E. 2008. Early life programming of obesity and metabolic disease. Physiol. Behav. 94: 17–28. Dannappel, M. et al.2014. RIPK1 maintains epithelial homeostasis by inhibiting apoptosis and necroptosis. Nature 513: 90–94. David, L.A., Maurice, C.F., Carmody, R.N., Gootenberg, D.B., Button, J.E., Wolfe, E., Ling, A.V.,Devlin, A.S.,Varma, Y.,Fischbach, M.A.,Biddinger, SB,Dutton, R.J.,Turnbaugh, P.J.2014. Diet rapidly and reproducible alters the humans gut microbiome. Nature 505: 559–563. De Block, M., Stoks, R. 2008a. Compensatory growth and oxidative stress in a damselfly. Proc. Roy. Soc. B 275: 781–785. De Block, M., Stoks, R. 2008b. Short-term larval food stress and associated compensatory growth reduce adult immune function in a damselfly. Ecol. Entomol. 33: 796–801. De Block, M., McPeek, M.A., Stoks, R. 2008c. Stronger compensatory growth in a permanent-pond Lestes damselfly relative to temporary-pond Lestes . Oikos 117: 245–254. de Morais, B.C., Netto, D.A., Alves, J.R., D’Avila Lima. 2017. Effect of early feed restriction on body weight and compensatory growth in Label Rouge broiler chickens. Acta Agron . 66(4): 606-611. de Oliveira L.C.C., Costa, L.G.B., Eiras, B.J.C.F., Brabo, M.F., Veras, G.C., de Moura, L.B., Salaro, A.L., Campelo, D.A.V. 2020. Feeding strategy induces compensatory growth in Heros severus fingerlings, an Amazonian ornamental fish. Aquaculture Reports 18: 100436. DeSantis, T.Z., Hugenholtz, P., Larsen, N., Rojas, M., Brodie, E.L., Keller, K., Huber, T., Dalevi, D., Hu, P., Andersen, G.L. 2006. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Applied and Environmental Microbiology 72: 5069 –5072. Dinh, T.T.H. 2020. An integrated approach of the interactions between nutrition and resistance to infection in fruit flies. PhD thesis, Macquarie University. 134 p. Dmitriew, C., Rowe, L. 2004. Resource limitation, predation risk and compensatory growth in a damselfly. Oecologia 142(1): 150–154. Dmitriew, C.M. 2011. The evolution of growth trajectories: what limits growth rate? Biological Reviews 86: 97–116. Dubovskiy, I.M., Whitten, M.M.A., Yaroslavtseva, O.N., Greig, C., Kryukov, V.Y. 2013a. Can insects develop resistance to insect pathogenic fungi? PLoS ONE 8(4): e60248. Dubovskiy, I.M., Whitten, M.M.A., Kryukov, V.Y., Yaroslavtseva, O.N., Grizanova, E.V., Greig, C., Mukherjee, K., Vilcinskas, A., Mitkovets, P.V., Glupov, V.V., Butt, T.M. 2013b. More than a colour change: insect melanism, disease resistance and fecundity. Proceedings of the Royal Society B 280: 20130584.

59 Edgar, R.C. 2010. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26: 2460–2461. Ellis, J.D., Graham, J.R., Mortensen, A. 2013. Standard methods for wax moth research. J. Apicult. Res. 52: 1–17. Erdogan, A., Rao, S.S. 2015. Small intestinal fungal overgrowth. Curr. Gastroenterol. Rep. 17: 16. Fairbairn, D.J., Blanckenhorn, W.U., Szekely, T. 2007. Sex, Size and Gender Roles: Evolutionary Studies of Sexual Size Dimorphism. Oxford University Press, Oxford. Falk, P.G., Hooper, L.V., Midtvedt, T., Gordon, J.I. 1998. Creating and maintaining the gastrointestinal ecosystem: what we know and need to know from gnotobiology. Microbiol Mol Biol Rev . 62:1157–70. Farhadi, S., Ovchinnikov, R.S. 2018. The relationship between nutrition and infectious diseases: A review. Biomed Biotechnol Res J 2:168-72. Finkel, T., Holbrook, N.J. 2000. Oxidants, oxidative stress and the biology of ageing. Nature 408: 239–247. Flatt, T. 2020. Life-History Evolution and the Genetics of Fitness Components in Drosophila melanogaster . Genetics 214(1): 3-48. Foo, Y.Z., Nakagawa, S., Rhodes, G., Simmons, L.W. 2017. The effects of sex hormones on immune function: a meta-analysis. Biol. Rev. 92: 551–571. Fujimori, S. 2015. What are the effects of proton pump inhibitors on the small intestine? World J. Gastroenterol. 21: 6817–6819. Gouba, N., Hien, Y.E., Guissou, M.L., Fonkou, M.D.M., Traoré, Y., Tarnagda, Z. 2019. Digestive tract mycobiota and microbiota and the effects on the immune system. Human Microbiome Journal 12: 100056. Graham, A.L., Allen, J.E. & Read, A.F. 2005. Evolutionary causes and conse- quences of immunopathology. Annual Review of Ecology Evolution and Sys- tematics 36: 373–397. Greer, A.W. 2008. Trade-offs and benefits: implications of promoting a strong immunity to gastrointestinal parasites in sheep. Parasite Immunology 30: 123– 132. Harding, C.R., Schroeder, G.N., Collins, J.W., Frankel, G. 2013.Use of Galleria mellonella as a model organism to study Legionella pneumophila infection. Journal of Visualized Experiments (81): e50964. Harrison, S.J., Thomson, I.R., Grant, C.M. & Bertram, S.M. 2013. Calling, courtship, and condition in the fall field cricket, Gryllus pennsylvanicus . PLoS ONE 8: e60356. Hector, K.L., Nakagawa, S. 2012. Quantitative analysis of compensatory and catch-up growth in diverse taxa. J. Anim. Ecol. 81: 583–593 Hoi-Leitner, M., Romero-Pujante, M., Hoi, H., Pavlova, A. 2001. Food availability and immune capacity in serin ( Serinus serinus ) nestlings. Behavioral Ecology and Sociobiology 49: 333–339. Holden, K.G., Reding, D.M., Ford, N.B., Bronikowski, A.M. 2018.Effects of early nutritional stress on physiology, life histories and their trade-offs in a model ectothermic vertebrate. Journal of Experimental Biology 222: jeb200220. Hooper, L.V., Gordon, J.I. 2001. Commensal host-bacterial relationships in the gut. Science 292:1115–8. Yourth, C.P., Forbes, M.R., Smith, B.P. 2001. On understanding variation in immune expression of the damselflies Lestes spp. Canadian Journal of Zoology 79: 815– 821.

60 Yuan, J., Wang, P., Yang, Y. 2019. Effects of Simulated Herbivory on the Vegetative Reproduction and Compensatory Growth of Hordeum brevisubulatum at Different Ontogenic Stages. Int J Environ Res Public Health 16(9):1663. Jarosz, J. 1979. Gut flora of Galleria mellonella suppressing ingested bacteria. J. Invertebr. Pathol. 34: 192–198. Johnson, E.C., Braco, J.T., Whitmill, M.A. 2014. Connecting nutrient sensing and the endocrine control of metabolic allocation in insects. Current Opinion in Insect Science 1: 66-72. Johnston, P.R., Rolff, J. 2015. Host and symbiont jointly control gut microbiota during complete metamorphosis. PLoS Pathogen 11(11): e1005246.. Kaneko, Y., Thoendel, M., Olakanmi, O., Britigan, B.E., Singh, P.K. 2007. The transition metal gallium disrupts Pseudomonas aeruginosa iron metabolism and has antimicrobial and antibiofilm activity. Journal of Clinical Investigation 117: 877–888. Kelly, C.D., Neyer, A.A., Gress, B.E. 2014. Sex-specific life history responses to nymphal diet quality and immune status in a field cricket. J. Evol. Biol. 27: 381–390. Klasing, K.C., Laurin, D.E., Peng, R.K., Fry, D.M. 1987. Immunologically mediated growth depression in chicks – influence of feed-intake, corticoste- rone and interleukin-1. Journal of Nutrition 117: 1629–1637. Klein, S.L., Flanagan, K.L. 2016. Sex differences in immune responses. Nature Rev. Immunol. 16: 626–638. Klein, S.L. 2000. The effects of hormones on sex differences in infection: from genes to behavior. Neurosci. Biobehav. Rev. 24: 627–638. Knowles, S.C.L., Nakagawa, S., Sheldon, B.C. 2009. Elevated reproductive effort increases blood parasitaemia and decreases immune function in birds: a meta- regression approach. Functional Ecology 23: 405–415. Krams, I., Daukšte, J., Kivleniece, I., Kaasik, A., Krama, T., Freeberg, T.M., Rantala, M.J. 2013. Trade-off between cellular immunity and life span in mealworm beetles Tenebrio molitor. Current Zoology 59: 340–346. Krams, I., Daukšte, J., Kivleniece, I., Krama, T., Rantala, M.J. 2013. Previous encapsulation response enhances within individual protection against fungal parasite in the mealworm beetle Tenebrio molitor . Insect Science 20: 771-777. Krams, I.A., Krama, T., Moore, F.M., Kivleniece, I., Kuusik, A., Freeberg, T.M., Mänd, R., Rantala, M.J., Daukšte, J., Mänd, M. 2014. Male mealworm beetles increase resting metabolic rate under terminal investment. Journal of Evolutionary Biology 27: 541–550. Lambring, C.B., Siraj, S., Patel, K., Sankpal, U.T., Mathew, S., Basha, R. 2019. Impact of the Microbiome on the Immune System. Crit Rev Immunol . 39(5):313-328. Lazzaro, B.P., Rolff, J. 2011. Danger, microbes, and homeostasis. Science 332: 43–44. Lemaitre, B., Hoffmann, J. 2007. The host defense of Drosophila melanogaster . Annual Review of Immunology 25: 697 –743. Leonard, T., Lawrence, J., Fowler, V.R. 2002.Growth of farm animals. CABI. pp. 229–254. Lindstrom, J. 1999. Early development and fitness in birds and mammals. Trends in Ecology and Evolution 14: 343–348. Lochmiller, R.L., Deerenberg, C. (2000) Trade-offs in evolutionary immunology: just what is the cost of immunity? Oikos 88: 87–98. Lochmiller, R.L., Vestey, M.R., Boren, J.C. 1993. Relationship between protein

61 nutritionalstatus and immunocompetence in Northern bobwhite chicks. The Auk 110: 503–510. Lozano-Durán, R., Zipfel, C. 2015. Trade-off between growth and immunity: role of brassinosteroids. Trends in Plant Science 20(1): 12-19. Macpherson, A.J., Harris, N.L. 2004. Interactions between commensal intestinal bacteria and the immune system. Nat Rev Immunol.4:478–85. Mangel, M., Munch, S.B. 2005. A life-history perspective on short- and long-term consequences of compensatory growth. Am. Nat. 166: E155–E176. Marston, N., Campbell, B., Boldt, P.E. 1975. Mass producing eggs of the greater wax moth, Galleria mellonella L. U.S. Department of Agriculture Technical Bulletin 1510. Martin, A.M., Sun, E.W., Rogers G.B., Keating, D.J. 2019. The Influence of the Gut Microbiome on Host Metabolism Through the Regulationof Gut Hormone Release. Front. Physiol. 10: 428. Mason, C.J.,Raffa, K.F. 2014. Acquisition and structuring of midgut bacterial communities in gypsy moth (Lepidoptera: Erebidae) larvae. Environ Entomol. 43(3):595-604. Mason, P.A., Smilanich, A.M., Singer, M.S. 2014. Reduced consumption of protein- rich foods follows immunechallenge in a polyphagous caterpillar. Journal of Experimental Biology 217: 2250-2260. McKay, A.F., Ezenwa, V.O., Altizer, S. 2016. Consequences of Food Restriction for Immune Defense, ParasiteInfection, and Fitness in Monarch Butterflies. Physiological and Biochemical Zoology 89(5):389–401. McNickle, G.G., Evans, W.D. 2018. Toleration games: compensatory growth by plants in response to enemy attack is an evolutionarily stable strategy. AoB PLANTS 10: ply035. Menegat, M.B., Dritz, S.S., Tokach, M.D., Woodworth, J.C., DeRouchey, J.M., Goodband, R.D. 2020. A review of compensatory growth following lysine restriction in grow-finish pigs. Translational Animal Science 4(2): 531–547. Metcalfe, N.B., Monaghan, P. 2001. Compensation for a bad start: grow now, pay later? Trends Ecol. Evol. 16: 254–260. Metcalfe, N.B., Monaghan, P. 2003 Growth versus lifespan: perspectives from evolutionary ecology. Exp. Gerontol. 38: 935–940. Mikola, J.,Setala, H.1998.No evidence of tropic cascades in an experimental microbial-based food web. Ecology 79: 153–164. Milani, C., Hevia, A., Foroni, E., Duranti, S., Turroni, F., Lugli, G.A., Sanchez, B., Martín, R., Gueimonde, M., van Sinderen, D., Margolles, A., Ventura, M. 2013. Assessing the fecal microbiota: an optimized ion torrent 16S rRNA gene-based analysis protocol. PLoS ONE 8: e68739. Mylonakis, E., Podsiadlowski, L., Muhammed, M., Vilcinskas, A.2016. Diversity, evolution and medical applications of insect antimicrobial peptides. Philosophical Transactions of the Royal Society B 371: 20150290. Mohamed, A.A, Ansari, M.J., Al-Ghamdi, A., Mohamed, M.O., Kaur, M. 2014. Effect of larval nutrition on the development and mortality of Galleria mellonella (Lepidoptera: Pyralidae). Rev. Colomb. Entomol. 40: 49–54. Moret, Y., Schmid-Hempel, P. 2000. Survival for immunity: the price of immune system activation for bumblebee workers. Science 290: 1166–1168. Muegge, B.D., Kuczynski, J., Knights, D., Clemente, J.C., González, A., Fontana, L., Henrissat, B., Knight, R., Gordon, J.I. 2011. Diet drives convergence in gut microbiome functions across mammalian phylogeny and within humans.

62 Science 332: 970–974. Nettle, D., Andrews, C., Bateson, M. 2017. Food insecurity as a driver of obesity in humans: The insurance hypothesis. Behavioral and Brain Sciences 40: e105 . Nyholm, S.V., McFall-Ngai, M. 2004. The winnowing: establishing the squid– Vibriosymbiosis. Nature Reviews Microbiology 2: 632–642. Nylin, S., Gotthard, K. 1998. Plasticity in life-history traits. Annual Review of Entomology 43: 63–83. Norris, K., Evans, M.R. 2000. Ecological immunology: life history trade-offs and immune defense in birds. Behavioral Ecology 11: 19–26. Orcutt, D.M., Nilsen, E.T. 2000.The Physiology of Plants Under Stress: Soil and biotic factors. John Wiley and Sons. pp. 277–278. Ost, K.S., Round, J.L. 2018. Communication Between the Microbiota and Mammalian Immunity. Annual Review of Microbiology 72(1): 399-422. Pylro, V.S., Roesch, L.F.W., Morais, D.K., Clark, I.M., Hirsch, P.R., Tótola, M.R. 2014. Data analysis for 16S microbial profiling from different benchtop sequencing platforms. Journal of Microbiological Methods 107: 30–37. Porrello, E.R., Bell, J.R., Schertzer, J.D., Curl, C.L., McMullen, J.R., Mellor, K.M., Ritchie, R.H., Lynch, G.S., Harrap, S.B., Thomas, W.G., Delbridge, L.M.D. 2009. Heritable pathologic cardiac hypertrophy in adult- hood is preceded by neonatal cardiac growth restriction. Am. J. Physiol. Regul. Integr. Comp. Physiol. 296: 672–680. Radder, R.S., Warner, D.A., Shine, R. 2007. Compensating for a bad start: Catch-up growth in juvenile lizards ( Amphibolurus muricatus , agamidae). Journal of Experimental Zoology Part A: Ecological Genetics and Physiology . 307A(9): 500–508. Rantala, M.J., Koskimaki, J., Taskinen, J., Tynkkynen, K., Suhonen, J. 2000. Immunocompetence, developmental stability and wingspot size in the damselfly Calopteryx splendens L. Proceedings of the Royal Society B 267: 2453–2457. Rantala, M.J., Roff, D.A. 2005. An analysis of trade-offs in immune function, body size and development time in the Mediterranean field cricket, Gryllus bimaculatus . Functional Ecology 19: 323–330. Rapkin, J., Jensen, K., Ruth Archer, C., House, C.M., Sakaluk, S.K., Del Castillo, E., Hunt, J. 2018. The geometry of nutrient space–based life-history trade-offs: Sex-specific effects of macronutrient intake on the trade-off between encapsulation ability and reproductive effort in decorated crickets. American Naturalist 191(4): 452-474. Ratcliffe, N.A., Rowley, A.F., Fitzgerald, S.W., Rhodes, C.P. 1985. Invertebrate immunity: basic concepts and recent advances. Int. Rev. Cytol. 97: 183–350. Redmond, M.D., Davis, T.S., Ferrenberg, S., Wion, A.P. 2019. Resource allocation trade-offs in a mast-seeding conifer: piñon pine prioritizes reproduction over defence.AoB PLANTS 11(6): plz070. Ricklefs, R.E., Wikelski, M. 2002. The physiology ∕ life -history nexus. Trends in Ecology & Evolution 17: 462–468. Round, J.L., Mazmanian, S.K. 2009. The gut microbiome shapes intestinal immune responses during health and disease. Nat Rev Immunol 9: 313-323. Russell, V., Dunn, P.E. 1996. Antibacterial proteins in the midgut of Manduca sexta during metamorphosis. Journal of Insect Physiology 42: 65–71. Scanes, C.G. 2003.Biology of growth of domestic animals. Wiley-Blackwell. p. 352 Schwenke, R.A., Lazzaro, B.P., Wolfner, M.F. 2015.Reproduction–Immunity Trade- Offs in Insects. Annual Review of Entomology 61:239-256.

63 Sheldon, B.C., Verhulst, S. 1996. Ecological immunology: costly parasite defences and trade-offs in evolutionary ecology. Trends in Ecology & Evolution 11: 317– 321. Simmons, L.W., Zuk, M. 1992. Variability in call structure and pairing success of male field crickets, Gryllus bimaculatus : the effects of age, size and parasite load. Anim. Behav. 44: 1145–1152. Simmons, LW. 1995. Correlates of male quality in the field cricket, Gryllus campestris L.: age, size, and symmetry determine pairing success in field populations. Behav. Ecol. 6: 376–381. Singh, S., Thompson, J.A., Weis, S., Sobral, D., Truglio, M., Yilmaz, B., Rebelo, S., Cardoso, S., Gjini, E., Nuñez, G., Soares, M.P. 2020. A trade-off between resistance to infection and reproduction in primate evolution. Cell Host & Microbe , 29(3):347-361. Sonnenburg, J.L., Chen, C.T., Gordon, J.I. 2006. Genomic and metabolic studies of the impact of probiotics on a model gut symbiont and host. PLoS Biol . 4:e413. Steinberg, C.E.W. 2018. Dietary Restriction, Starvation, Compensatory Growth – ‘Short-Term Fasting Does Not Kill You: It Can Make You Stronger’. In: Aquatic Animal Nutrition. Springer, Cham. Stumpf, L., López Greco, L.S. 2015. Compensatory Growth in Juveniles of Freshwater Redclaw Crayfish Cherax quadricarinatus Reared at Three Different Temperatures: Hyperphagia and Food Efficiency as Primary Mechanisms. PlosOne 10(9):e0139372. Thaiss, C.A., Zmora, N., Levy, M., Elinav, E. 2016. The microbiome and innate immunity. Nature 535: 65–74. Tuller, J., Marquis, R.J., Andrade, S.M.M., Monteiro, A.B., Faria, L.D.B. 2018. Trade-offs between growth, reproduction and defense in response to resource availability manipulations . PlosOne 13(8): e0201873. Turkmen, S. 2012. Compensatory growth response of European sea bass (Dicentrarchus labrax L.) under cycled starvation and restricted feeding rate. Aquaculture Research (43): 1643–1650. Valtonen, T.M., Kleino, A., Ramet, M., Rantala, M.J. 2010. Starvation reveals maintenance cost of humoral immunity. Evol. Biol. 37: 49–57. van der Meer, J. 2021. Production efficiency differences between poikilotherms and homeotherms have little to do with metabolic rate. Ecology Letters 24(2): 219- 226. van der Most, P.J., de Jong, B., Parmentier, H.K., Verhulst, S. 2011. Trade-off between growth and immune function: a meta-analysis of selection experiments. Functional Ecology 25: 74–80. Vernocchi, P., Del Chierico, F., Putignani, L. 2020. Gut Microbiota Metabolism and Interaction with Food Components. Int J Mol Sci. 21(10):3688. Vijendravarma, R.K., Kraaijeveld, A.R., Godfray, H.C.J. 2009. Experimental evolution shows Drosophila melanogaster resistance to a microsporidian pathogen has fitness costs. Evolution 63: 104–114. Vlantis, K., Polykratis, A., Welz, P., van Loo, G., Pasparakis, M., Wullaert, A. 2015 .TLR-independent anti-inflammatory function of intestinal epithelial TRAF6 signalling prevents DSS-induced colitis in mice. Gut 65:935-943. Vojdani, A. 2014. A Potential Link between Environmental Triggers and Autoimmunity. Autoimmune Diseases 2014: 437231.

64 Von Baum, H., Klemme, F.R., Geiss, H.K., Sonntag, H-G. 1998. Comparative evaluation of a commercial system for identification of gram-positive cocci. Eur. J. Clin. Microbiol. Infect. Dis . 17: 849–852. Walsh, M.E., Shi, Y., Van Remmen, H. 2014. The effects of dietary restriction on oxidative stress in rodents. Free Radic Biol Med. 66:88-99. Wang, J., Niu, C., Huang, C., Rummer, J.L., Xie, Z. 2011. Compensatory growth in juvenile freshwater Turtles, Chinemys reevesii , Following Feed Deprivation. Journal of the World Aquaculture Society 42(1): 82-89. Wang, Q., Garrity, G.M., Tiedje, J.M., Cole, J.R. 2007. Naïve bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Applied and Environmental Microbiology 73: 5261–5267. Warren, L.O., Huddleston, P. 1962. Life history of the greater wax moth Galleria mellonella L. in Arkansas. Journal of the Kansas Entomological Society 35: 212-216. Wilson, J.K., Ruiz, L., Davidowitz, G. 2020. Within-host competition drives energy allocation trade-offs in an insect parasitoid. PeerJ 8:e8810. Wilson, P., Osbourn, D. 1960. Compensatory growth after undernutrition in mammals and birds. Biological reviews of the Cambridge Philosophical Society 35: 324– 363. Wu, M., Zhao, M., Wu, H., Lu, Q.2021. Immune repertoire: Revealing the “real-time” adaptive immune response in autoimmune diseases.Autoimmunity 54(2): 61-75. Xie, J., De Clercq, P., Pan, C., Li, H., Zhang, Y., Pang, H. 2015. Physiological effects of compensatory growth during the larval stage of the ladybird, Cryptolaemus montrouzieri . Journal of Insect Physiology 83: 37-42. Xu, C., Xu, W., Lu, H. 2014. Compensatory growth responses to food restriction in the Chinese three-keeled pond turtle, Chinemys reevesii . SpringerPlus 3: 687. Zheng, D., Liwinski, T., Elinav, E. 2020. Interaction between microbiota and immunity in health and disease. Cell Res 30: 492–506. Zheng, M., Lamb, K.E., Grimes, C., Laws, R., Bolton, K., Ong, K.K., Campbell, K. 2018. Rapid weight gain during infancy and subsequent adiposity: a systematic review and meta-analysis of evidence. Obes Rev. 19(3): 321-332. Zuk, M., McKean, K.A. 1996. Sex differences in parasite infections: Patterns and processes. Int. J. Parasitol. 26: 1009–1024. Zuk, M., Stoehr, A.M. 2002. Immune defense and host life history. The American Naturalist 160: S9–S22.

65

ORIGINAL PAPERS

PUBLIKĀCIJAS

66 Insect Science (2015) 22, 431–439, DOI 10.1111/1744-7917.12132

ORIGINAL ARTICLE Effects of food quality on trade-offs among growth, immunity and survival in the greater wax moth Galleria mellonella

Indrikis Krams1,2, Sanita Kecko1, Katariina Kangassalo3, Fhionna R. Moore4, Eriks Jankevics5, Inna Inashkina5, Tatjana Krama1,6, Vilnis Lietuvietis7, Laila Meija7 and Markus J. Rantala3 1Institute of Systematic Biology, University of Daugavpils, 5401, Daugavpils, Latvia; 2Institute of Ecology and Earth Sciences, University of Tartu, 51014 Tartu, Estonia; 3Department of Biology, Section of Ecology, University of Turku, 20014 Turku, Finland; 4School of Psychology, University of Dundee, Dundee DD1 4HN, UK; 5Latvian Biomedical Research and Study Centre, 1067 R¯ıga, Latvia; 6Department of Plant Protection, Institute of Agricultural and Environmental Sciences, Estonian University of Life Science, Tartu, Estonia, and 7R¯ıga Stradins University, 1007 R¯ıga, Latvia

Abstract The resources available to an individual in any given environment are finite, and variation in life history traits reflect differential allocation of these resources to competing life functions. Nutritional quality of food is of particular importance in these life history decisions. In this study, we tested trade-offs among growth, immunity and survival in 3 groups of greater wax moth (Galleria mellonella) larvae fed on diets of high and average nutritional quality. We found rapid growth and weak immunity (as measured by encapsulation response) in the larvae of the high-energy food group. It took longer to develop on food of average nutritional quality. However, encapsulation response was stronger in this group. The larvae grew longer in the low-energy food group, and had the strongest encapsulation response. We observed the highest survival rates in larvae of the low-energy food group, while the highest mortality rates were observed in the high-energy food group. A significant negative correlation between body mass and the strength of encapsulation response was found only in the high-energy food group revealing significant competition between growth and immunity only at the highest rates of growth. The results of this study help to establish relationships between types of food, its nutritional value and life history traits of G. mellonella larvae. Key words Galleria mellonella; growth; immunity; life history; nutrition; survival

Introduction mune system, and most organisms do not grow at their maximal rate (Arendt, 1997; Mangel & Stamps, 2001; According to life history theory organisms attempt to allo- Fedorka et al., 2004; Rolff et al., 2004; Alonso-Alvarez cate limited resources to primary life functions related to et al., 2007; Bascun˜an-Garc´ ´ıa et al., 2010). growth, reproduction and self-maintenance in ways that In unpredictable environments, the ability to grow and optimize reproductive fitness (Stearns, 1992; Charnov, reproduce as fast as possible is of crucial importance. The 1993; Roff, 1992, 2002). Susceptibility to disease is ubiq- early reproduction and acquisition of a large body size uitous because of trade-offs between immunity and other can incur benefits, such as earlier reproductive output needs of the organism (Schmid-Hempel, 2011). These and reduced risk of predation (Metcalfe & Monaghan, trade-offs often cause considerable self-harm to the im- 2003). However, there are also many costs of growing fast. Individuals with rapid growth might be more exposed Correspondence: Indrikis Krams, Institute of Ecology and to predators because of more time spent foraging (Sorci Earth Sciences, University of Tartu, 51410 Tartu, Estonia. Tel: et al., 1996; Munch & Conover, 2003). They may be more +371 29465273; email: [email protected] susceptible to starvation during periods of food shortage

431 C 2014 Institute of Zoology, Chinese Academy of Sciences 432 I. Krams et al.

(Arendt, 1997; Blanckenhorn, 2000), and their growth months. Adult insects from poorly nourished larvae are rates might interfere with development (e.g., Fisher et al., smaller and their survival is decreased (Marston et al., 2006; Pihlaja et al., 2006) because the increase in 1975). In the absence of adequate food supplies the larvae metabolic activity needed to fuel rapid growth could cause become cannibalistic. oxidative damage to the organism (e.g., Farrell et al., Under conditions of foods of low nutritional value, in- 1997; Morgan et al., 2000; Forsen´ et al., 2004). It has dividual investment should change from growth to im- also been shown that the nutritional state of the host, and mune function because longer lifespan needs elaborated nutritional quality of food, may have a profound effect immune system. In this study, we provided 1 group of on life history trade-offs and ability to fight and resist larvae of the greater wax moth with high-energy food an infection (Moret & Schmid-Hempel, 2000; Alonso- ad libitum during their development, 1 group with food Alvarez & Tella, 2001; Siva-Jothy & Thompson, 2002; of average quality and another with food resources con- Ayres & Schneider, 2009; Cotter et al., 2011; Ponton taining low energy. We assessed immunity via encapsula- et al., 2011, 2013; Jimenez-Cort´ es´ et al., 2012; Jimenez-´ tion response to nylon monofilament implantation (e.g., Cortes´ & Cordoba-Aguilar,´ 2013; Povey et al., 2013). Rantala et al., 2000, 2002; Kivleniece et al., 2010). We A highly elaborate immune system is required by or- predicted the most rapid growth and weakest immunity in ganisms with long life expectancy, those requiring exten- the high-energy food group. In the low-energy food group sive parental care until they mature and those living in we predicted slower growth and stronger immunity. Af- predictable environments. However, while immunity has ter activation of the immune system we expected higher the obvious potential to ameliorate infection outcomes, mortality and less successful pupation in the high-energy immune responses require increased metabolism (Freitak food group. We did not expect any intermediate invest- et al., 2003; Krams et al., 2014) and immunity can also ment in the immune system because the average levels harm hosts by either damaging host tissues or monopoliz- of immune protection are not likely linked to benefits of ing resources leading to increased mortality (Kraaijeveld longer lifespan (Schmid-Hempel, 2011). & Godfray, 1997; Fellowes & Godfray, 2000; Kraaijeveld et al., 2001; Jensen et al., 2006; Sadd & Siva-Jothy, 2006; Little & Killick, 2007). The costs of immunity are either Materials and methods associated with genetic differences among hosts where some genotypes invest heavily in defense systems at the Insects expense of other functions, or are associated with the cost of launching an immune response (Schmid-Hempel, We studied a captive population of G. mellonella con- 2011). sisting of individuals originated from the stock of the The greater wax moth (Galleria mellonella)isamothof University of Turku mixed with individuals collected from the family Pyralidae which is found in most of the world. natural populations in Estonia. Our stock culture was This moth flies from May to October in the temperate maintained at the University of Daugavpils. Moths were parts of its range in the Northern Hemisphere. The larvae reared in 2.4 L plastic boxes at 28–30 °C. The larvae feed on the honeycomb inside bee nests and may become used in this study were obtained from 100 males and 100 important pests of apiculture (Warren & Huddleston, females. 1962). However, the presence of adult bees prevents wax moth damage, and destruction to combs usually occurs within weak hives with low populations. It has been sug- Food quality and experimental trials gested that when a colony of honey bees dies from one or more diseases in the wild (Barjac & Thomson, 1970), To study the effect of food quality on the strength of the wax moth will quickly clean up the natural holes for encapsulation response, the body size at pupation, and new bee colonies to breed. This indicates that the first survival of G. mellonella larvae, we kept the larvae on generation of the greater wax moth to invade a bee colony food of high nutritional value between hatching and day usually has larger amounts of food resources than any fur- 15 posthatch. On day 15 we assigned them to 3 groups dif- ther generation. The whole lifecycle of the greater wax fering in nutritional value (Fig. 1). Each larva was placed moth, and extent of population expansion, depends on individually into plastic containers with a lid and wire a suitable temperature range and adequate food. Obser- mesh to allow ventilation and to prevent individuals from vations show that the larvae are highly resistant to food escaping. Body weight of larvae was similar across the 3 shortage, but under deficient food conditions, their de- groups on day 15 posthatch (one-way ANOVA: F2,107 = velopment (from egg to adult) may be extended up to 6 1.72, P = 0.19).

C 2014 Institute of Zoology, Chinese Academy of Sciences, 22, 431–439 Food quality and life history trade-offs 433

Immune assays

The strength of the encapsulation response was oper- ationalized as the lightness of the nylon filament insert after it had been dried. Insect immune systems respond to this challenge as if the insert were a foreign body, by attempting to encapsulate it in a coating of cellular materi- als and chemical deposits (e.g., Rantala et al., 2000). The stronger the immune response to the insert, the darker the encapsulation (Yourth et al., 2001; Krams et al., 2013a, b), due to phenoloxidase enzyme production activated by the immune response, resulting in melanization of the capsule Fig. 1 Time course of the study. (Ratcliffe et al., 1985). In other insects, the encapsulation response is correlated with measures of immunity, such as the phenoloxidase cascade (Rantala et al., 2000, 2002, 2003), encapsulation of parasites (Paskewitz & Riehle, The high-energy food group received only food of the 1994; Gorman et al., 1998) and to resistance of an ento- highest nutritional value provided ad libitum until day mopathogenic fungal disease (Rantala & Roff, 2007). 30 (Fig. 1) when 10% of larvae initiated pupation. The Lightness was assessed from photographs of the in- average-energy food group received food of high nutri- serts taken from 2 directions under constant light condi- tional quality provided ad libitum for2dfollowedby tions using a Zeiss Lumar V12 Stereo (Carl Zeiss, Jena, another 2 d on low quality food and this combination Germany) microscope. Digital images were analyzed of foods was provided until day 30 posthatch. The low- using the Image J software (http://rsbweb.nih.gov/ij/; energy food group received only ad libitum food of low Abramoff et al., 2004). Prior to this, we calibrated re- quality and nutritional value from hatching till day 30 flectance of an implant before the insertion to zero level. posthatch. The high-energy food consisted of a mix of the same parts of honey, glycerol, bee-wax, dried milk, wheat Statistical analysis flour, dry yeast, distillate water and 2 parts of corn meal. The amount of food energy associated with this food was Developmental time, body mass and the strength estimated as ca.16.90 kJ/g. The low-energy food consisted of encapsulation response were distributed normally of natural bee wax only. Bee wax is a natural polymer pro- (Kolmogorov–Smirnov test, all P > 0.05) and paramet- duced by bees, and it is considered to have an extremely ric statistics were used in the further analyses. We used low nutritional value. However, we observed the ability of one-way ANOVA and post hoc tests to find any possible some wild progenitors of our study population to repro- differences among the groups. Multiple linear regression duce solely on bee wax. analysis was used to find out determinants of develop- On day 30 posthatch we weighed all of the larvae and mental time and the strength of encapsulation response. assigned individuals of all 3 groups to 2 subgroups: sur- Analyses were performed in SPSS 17 for Windows (SPSS vival subgroup and treatment subgroup. We recorded the Inc., Chicago, IL, USA). time of pupation in the survival subgroup, while in the treatment subgroup, the larvae received 1 sterile nylon monofilament implant (2 mm length, 0.18 mm diameter, Results knotted at one end) through their cuticle between the 3rd and 4th sternite (Krams et al., 2011a, b; Dauksteˇ et al., Developmental time, body mass, encapsulation 2012) for 5 h at 29 ± 0.5 °C. During implantation the and survival larvae were kept in individual small plastic containers containing no food, and, as soon as 5 h were over, we The first larvae of the high-energy food group pupated removed the implants (Fig. 1) and placed the larvae back on day 28 posthatch (31.30 ± 2.47d, mean ± SD). All to their individual containers with food. We checked their individuals of high-energy and average-energy groups survival for 72 h to see survival and pupation rates. This survived until day 30 when we performed experimen- was done to see whether there is any difference among the tal manipulations. In contrast, only 30 out of 50 larvae 3 groups in their ability to resist costs of the activation of survived until day 30 posthatch in the low-energyfood the immune system. group (Fisher’s exact test: P = 0.0001) suggesting a role

C 2014 Institute of Zoology, Chinese Academy of Sciences, 22, 431–439 434 I. Krams et al.

Fig. 2 The effects of food quality on duration of larval Fig. 4 The effects of food quality on the strength of development of Galleria mellonella. Bars show means ± SE. encapsulation response of Galleria mellonella larvae. Bars show means ± SE.

g, mean ± SD) (Tukey’s post hoc test: P = 0.001, Fig. 3) and individuals of the low-energy food group (0.053 ± 0.011 g, mean ± SD) (Tukey’s post hoc test: P < 0.0001), while individuals in the average-energy food group were heavier than the larvae of low-energy food group (Tukey’s post hoc test: P = 0.003, Fig. 3). The encapsulation response against the nylon monofil- ament differed significantly among the 3 food groups (one-way ANOVA: F2,87 = 62.32, P < 0.0001; Fig. 4) on the day of pupation of the larvae of high-energy food group. The strength of encapsulation response of larvae from the high-energy food group (13.06 ± 14.75, mean ± SD) was significantly weaker than that of larvae from the Fig. 3 The effects of food quality on the larval body mass prior average-energy food group (32.88 ± 25.95, mean ± SD) pupation in Galleria mellonella. Bars show means ± SE. (Tukey’s post hoc test: P < 0.0001, Fig. 4), and weaker than encapsulation response of larvae of the low-energy food group (66.27 ± 12.38, mean ± SD) (Tukey’s post of food quality in larval survival. The time of pupation sig- hoc test: P < 0.0001, Fig. 4). The strength of encapsu- nificantly differed among the groups (one-way ANOVA: lation response of larvae from the average-energy food F = 1765.60, P < 0.0001, Fig. 2). The 1st larvae of 2,87 group was lower than encapsulation response of larvae the average-energy food group pupated on the day 32 from low-energy food group (Tukey’s post hoc test: P < posthatch (34.63 ± 1.13d, mean ± SD), and this was 0.0001, Fig. 4). significantly later than the onset of pupation in the high- energy food group (Tukey’s post hoc test: P < 0.001, Fig. 2). The larvae of the low-energy group reached pupa- Determinants of pupation time and encapsulation tion phase on day 59 posthatch (65.20 ± 3.17d, mean ± response SD), which was significantly later than the day of pupa- tion observed in the average-energy food group (Tukey’s Multiple linear regression analysis (adjusted R2 = 0.57, post hoc test: P < 0.001, Fig. 2). F2,87 = 55.32, P < 0.0001) showed that encapsulation re- Body mass differed among the larvae on day 30 sponse of the larvae was dependent on the quality of food posthatch (one-way ANOVA: F2,87 = 26.40, P < 0.0001, (β = –0.75, P < 0.0001), while body weight (β = –0.01, Fig. 3), and it was significantly greater in the high-energy P = 0.87) was not a significant determinant of encap- food group (0.105 ± 0.045 g, mean ± SD) than body mass sulation response, demonstrating that high-energy food of individuals kept on average-energy food (0.078 ± 0.017 decreased the strength of encapsulation response in G.

C 2014 Institute of Zoology, Chinese Academy of Sciences, 22, 431–439 Food quality and life history trade-offs 435 mellonella. Entry of the interaction term for food group tory traits as developmental time, body size, reproduc- and body mass into the model did not result in a signif- tive success and survival at maturity (Nylin & Gotthard, icant increase in the adjusted R2 (0.57, P > 0.05) and 1998; Lindstrom, 1999; Metcalfe & Monaghan, 2001; the interaction did not reach significance in the model Monaghan, 2008; Dmitriew, 2011). Our study supports (β = 0.37, P = 0.45) suggesting that food quality was the previous findings by showing that G. mellonella can af- primary determinant of encapsulation response. ford fast larval development and greater body weight at Multiple linear regression analysis also showed (ad- pupation only if food of the highest nutritional quality 2 justed R = 0.80, F2,87 = 181.02, P < 0.0001) that de- is available. We show that poor nutrition resulted in de- velopmental time of larvae was not dependent upon the creased body size of G. mellonella at pupation, prolonged strength of encapsulation response (β = 0.09, P < 0.24), larval development and high mortality as has previously while it was dependent on food quality (β =−0.83, P < been shown (Marston et al., 1975). While we do not have 0.001), demonstrating that food of low energy content in- data on the immune function of the larvae that died before creased the larval development in G. mellonella. Entry of the strength of encapsulation response was measured, our the interaction term for encapsulation response and food results show that longer developmental time is associated type into the model resulted in a significant increase in the with stronger encapsulation response as it was found in the adjusted R2 (0.89, P < 0.0001) and the interaction reached average- and low-energy food groups. Low encapsulation significance in the model (β = –0.72, P < 0.0001). We response was a likely explanation for the high mortality also found that the strength of encapsulation response is rate after activation of the immune system in the larvae of significantly negatively correlated with body mass only the high-energy food group. Moreover, a significant neg- in the high-energy food group (r = –0.44, P = 0.015 vs. ative correlation between body mass and the strength of r = –0.05, P = 0.78 in the average-energy group and r = encapsulation response was found only in G. mellonella 0.18, P = 0.35 in the low-energy food group). larvae of the high-energy food group showing a trade-off between immune function and larval growth. After hatching, larvae tunnel in comb, lining their tun- Survival after activation of immune system nels with silky web as they go. Thus, the food provides not only nutrition and cover against bees but also protec- Fourteen of 30 larvae survived and pupated in the high- tion against parasites and pathogens. Most of bee products energy group over the course of 3 d upon removal of and especially honey have antiseptic, antibiotic, antifun- nylon implants. The larvae survived significantly better gal and antibacterial properties, which means that larvae (26 out of 30) in the average-energy food group (Fisher’s of the high-energy food group might be more protected exact test: P = 0.002), and in the low-energy group (28 against different kinds of pathogens than larvae in the re- out of 30) (Fisher’s exact test: P = 0.0001) than in the maining groups because of a higher content of honey in high-energy food group. We did not find any significant their food. Therefore, the enhanced antibacterial proper- difference in survival of larvae in the average-energy and ties of larval environment in the high-energy food group low-energy food groups (Fisher’s exact test: P = 0.67). might represent one more reason for their reduced invest- ment in immunity. Future research should disentangle the Discussion nutritional and antibacterial effects of food in life history trade-offs of G. mellonella. In this study we found rapid growth, earlier pupation It is noteworthy that the amount of food of the highest and weak encapsulation response in the larvae of the quality provided ad libitum in the average-energy group high-energy food group. It took longer to develop in the was the same as in the high-energy food group between average-energy group, while encapsulation response was day 1 and day 15 posthatch, while high-energy nutrition stronger in this group. The larvae grew longer in the low- was available only within 50% of the larval development energy food group, and had the strongest encapsulation re- between day 16 and the pupation. In total, it makes ca. sponse. The highest survival rates were observed in larvae 75% of time spent on high-energy food in the average- of the low-energy food group, while the highest mortality energy food group. Body mass of the larvae prior to pu- rates were observed in the high-energy food group. Fi- pation was 25% greater in the high-energy food group nally, we found a significant negative correlation between than in the average-energy food group which explains body mass and the strength of encapsulation response only the effect of food quality. However, encapsulation re- in the high-energy food group. sponse of individuals of the average-energy group was There is some evidence suggesting that nutrition at early twice as strong as that of the high-energy food group. stages of ontogeny may substantially affect such life his- This suggests that fast and slow larval development might

C 2014 Institute of Zoology, Chinese Academy of Sciences, 22, 431–439 436 I. Krams et al. represent different strategies with no transitional strate- efficacy of new kinds of drugs (Vilcinskas, 2011; Vogel gies in between. This idea is supported by the fact that et al., 2011; Dubovskiy et al., 2013a, 2013b). The results longer larval development needs elaborated immune sys- of this study will help to establish relationships between tem while insufficient investment in the immune system types of food, its nutritional value and life history traits of may lead to higher mortality as has been observed in ter- G. mellonella larvae to develop standardized food types minal investment into reproduction in mealworm beetles and make interlaboratory comparisons possible. (Krams et al., 2011a,b). Our study design did not allow us to identify sex- specific effects of diet on larval development, immune Acknowledgments status and body weight at pupation. The most reliable sex determination in G. mellonella can be done at the pupa We thank Inese Kivleniece for maintaining laboratory stage, while many individuals died already at the larval stock of greater wax moth. The study was supported by stage in this study. Since diet was shown to have sex- Latvian Council of Science (grant 290/2012). All animal specific effects on larval and nymphal development, im- manipulations were carried out in accordance with the mune system, sexual attractiveness and reproductive suc- legal and ethical standards of the Republic of Latvia. cess at maturity (Kelly & Tawes, 2013; Kelly et al., 2014), research on sex-specific effects on larval development of Disclosure G. mellonella should be performed using a different study design in the future. However, our results suggest that the The authors have no any conflict of interest. data on the strength of encapsulation response, develop- mental time and body mass in each of the groups were normally distributed. This indicates that sex-related fac- tors may have rather minor role than the effect of diet on References the strategy of larval development. Perhaps this is because both sexes vigorously fly and male greater wax moths are Abramoff, M.D., Magalhaes, P.J. and Ram, S.J. (2004) Image only slightly smaller than females. In this case, a poor diet processing with ImageJ. Biophotonics International, 11, 36– at the larval stage would force both males and females to 42. allocate resources to immune function rather than growth. Alonso-Alvarez, C., Betrtrand, S., Faivre, B. and Sorci, G. (2007) This might be expected to be opposite in such species as Increased susceptibility to oxidative damage as a cost of accel- the vapourer moth (Orgyia antiqua) where females are erated somatic growth in zebra finches. Functional Ecology, wingless, much larger than males and in which larger fe- 21, 873–879. male moths are generally more fecund (Tammaru et al., Alonso-Alvarez, C. and Tella, J.L. (2001) Effects of experi- 2002). Increasing body size should benefit female fitness mental food restriction and body-mass changes on the avian and we expect that species with large females would allo- T-cell-mediated immune response. Canadian Journal of Zo- cate more resources to growth than to immunity. ology, 79, 101–105. Some studies showed that larvae switching from a Arendt, J.D. (1997) Adaptive intrinsic growth rates: an integra- carbohydrate-biased diet onto a diet that is relatively tion across taxa. Quarterly Review of Biology, 72, 149–177. protein-rich will generally have more haemocytes and Ayres, J.S. and Schneider, D.S. (2009) The role of anorexia in higher levels of phenoloxidase with which to melanize and resistance and tolerance to infections in Drosophila. PLoS encapsulate virus-infected cells (Washburn et al., 1996; Biology, 7, e1000150. Trudeau et al., 2001), which contradicts our results. Some Banville, N., Browne, N. and Kavanagh, K. (2012) Effect of nu- other studies also showed that poor nutrition and stressors, trient deprivation on the susceptibility of Galleria mellonella such as heavy metal pollution, may increase investments larvae to infection. Virulence, 3, 497–503. in the immune system (de Block & Stoks, 2005, 2008; van Barjac, H. and Thomson, J.V.(1970) A new serotype of Bacillus Ooik & Rantala, 2010; Polkki¨ et al., 2012, but see Banville thuringiensis: Bacillus thuringiensis var. thompsoni (serotype et al., 2012). This suggests that the theory linking growth, 11). Journal of Invertebrate Pathology, 15, 141–144. immunity, reproduction, parasite- and nutrient-related ef- Bascun˜an-Garc´ ´ıa,A.P.,Lara,C.andCordoba-Aguilar,´ A. (2010) fects is still in its infancy and more research is needed to Immune investment impairs growth, female reproduction and explain the evolution of life history strategies. Finally, the survival in the house cricket, Acheta domesticus. Journal of larvae of the greater wax moth G. mellonella are increas- Insect Physiology, 56, 204–211. ingly used as hosts to study pathogenesis and virulence Blanckenhorn, W.U. (2000) The evolution of body size: what factors of many prominent bacterial and fungal human keeps organisms small? Quarterly Review of Biology, 75, pathogens, and as a reliable host model to evaluate the 385–407.

C 2014 Institute of Zoology, Chinese Academy of Sciences, 22, 431–439 Food quality and life history trade-offs 437 de Block, M. and Stoks, R. (2005) Fitness effects from egg to Jensen, K.N., Little, T.J., Skorping, A. and Ebert, D. (2006) reproduction: bridging the life history transition. Ecology, 86, Empirical support for an optimal virulence in a castrating 185–197. parasite. PLoS Biology, 4, e197. de Block, M. and Stoks, R. (2008) Short-term larval food stress Jimenez-Cort´ es,J.G.andC´ ordoba-Aguilar,´ A. (2013) Condition and associated compensatory growth reduce adult immune dependence and trade-offs of sexual vs. non-sexual traits in function in a damselfly. Ecological Entomology, 33, 796– an insect. Journal of Ethology, 31, 275–284. 801. Jimenez-Cort´ es,´ J.G., Serrano-Meneses, M.A. and Cordoba-´ Charnov, E.L. (1993) Life History Invariants. Oxford University Aguilar, A. (2012) The effects of food shortage during larval Press, Oxford, UK. development on adult body size, body mass, physiology and Cotter, S.C., Simpson, S.J., Raubenheimer, D. and Wilson, K. developmental time in a tropical damselfly. Journal of Insect (2011) Macronutrient balance mediates trade-offs between Physiology, 58, 318–326. immune function and life history traits. Functional Ecology, Kelly, C.D., Neyer, A.A. and Gress, B.E. (2014) Sex-specific 25, 186–198. life history responses to nymphal diet quality and immune Daukste,ˇ J., Kivleniece, I., Krama, T., Rantala, M.J. and Krams, status in a field cricket. Journal of Evolutionary Biology, 27, I. (2012) Senescence in immune priming and attractiveness 381–390. in a beetle. Journal of Evolutionary Biology, 25, 1298–1304. Kelly, C.D. and Tawes, B.R. (2013) Sex-specific effect of juve- Dmitriew, C. and Rowe, L. (2011) The effects of larval nutrition nile diet on adult disease resistance in a field cricket. PLoS on reproductive performance in a food-limited adult environ- ONE, 8, e61301. ment. PLoS ONE, 6, e17399. Kivleniece, I., Krams, I., Daukste, J., Krama, T. and Rantala, Dubovskiy, I.M., Whitten, M.M.A., Kryukov, V.Y., M.J. (2010) Sexual attractiveness of immune-challenged male Yaroslavtseva, O.N., Grizanova, E.V., Greig, C., Mukherjee, mealworm beetles suggests terminal investment in reproduc- K., Vilcinskas, A., Mitkovets, P.V., Glupov, V.V. and Butt, tion. Animal Behaviour, 80, 1015–1021. T.M. (2013b) More than a colour change: insect melanism, Kraaijeveld, A.R. and Godfray, H.C.J. (1997) Trade-off be- disease resistance and fecundity. Proceedings of the Royal tween parasitoid resistance and larval competitive ability in Society B, 280, 20130584, 1–10. Drosophila melanogaster. Nature, 389, 278–280. Dubovskiy, I.M., Whitten, M.M.A., Yaroslavtseva, O.N., Greig, Kraaijeveld, A.R., Limentani, E. and Godfray, H.C.J. (2001) C. and Kryukov, V.Y. (2013a) Can insects develop resistance Basis of the trade-off between parasitoid resistance and larval to insect pathogenic fungi? PLoS ONE, 8, e60248. competitive ability in Drosophila melanogaster. Proceedings Farrell, A.P., Bennett, W. and Devlin, R.H. (1997) Growth- of the Royal Society Series B, 268, 259–261. enhanced transgenic salmon can be inferior swimmers. Krams, I., Daukste,ˇ J., Kivleniece, I., Kaasik, A., Krama, T., Canadian Journal of Zoology, 75, 335–337. Freeberg, T.M. and Rantala, M.J. (2013b) Trade-off between Fedorka, K.M., Zuk, M. and Mousseau, T.A. (2004) Immune cellular immunity and life span in mealworm beetles Tenebrio suppression and the cost of reproduction in the ground cricket, molitor. Current Zoology, 59, 340–346. Allonemobius socius. Evolution, 58, 2478–2485. Krams, I., Daukste,ˇ J., Kivleniece, I., Krama, T. and Rantala, Fellowes, M.D.E. and Godfray, H.C.J. (2000) The evolutionary M.J. (2011b) Overwinter survival depends on immune de- ecology of resistanceto parasitoids by Drosophila. Heredity, fence and body length in male Aquarius najas water striders. 84, 1–8. Entomology Experimentalis et Appliccata, 140, 45–51. Fisher, M.O., Nager, R.G. and Monaghan, P. (2006) Compen- Krams, I., Daukste,ˇ J., Kivleniece, I., Krama, T.and Rantala, M.J. satory growth impairs adult cognitive performance. PLoS Bi- (2013a) Previous encapsulation response enhances within ology, 8, 1462–1466. individual protection against fungal parasite in the meal- Forsen, T., Osmond, C., Eriksson, J.G. and Baker, D.J.P. (2004) worm beetle Tenebrio molitor. Insect Science, 20, 771– Growth of girls who latter develop coronary heart disease. 777. Heart, 90, 20–24. Krams, I., Daukste,ˇ J., Kivleniece, I., Krama, T., Rantala, M.J., Freitak, D., Ots, I., Vanatoa, A. and Horak, P. (2003) Immune Ramey, G. and Sausa, L. (2011a) Female choice reveals ter- response is energetically costly in white cabbage butterfly minal investment in male mealworm beetles, Tenebriomolitor, pupae. Proceedings of the Royal Society of London. Series B, after a repeated activation of the immune system. Journal of Biological Sciences, 270, S220–S222. Insect Science, 11, 56. Gorman, M.J., Schwartz, A.M. and Paskewitz, S.M. (1998) Krams, I.A., Krama, T., Moore, F.M., Kivleniece, I., Kuusik, The role of surface characteristics in eliciting humoral en- A., Freeberg, T.M., Mand,¨ R., Rantala, M.J., Daukste,ˇ J. and capsulation of foreign bodies in Plasmodium-refractory and Mand,¨ M. (2014) Male mealworm beetles increase resting -susceptible strains of Anopheles gambiae. Journal of Insect metabolic rate under terminal investment. Journal of Evolu- Physiology, 44, 947–954. tionary Biology, 27, 541–550.

C 2014 Institute of Zoology, Chinese Academy of Sciences, 22, 431–439 438 I. Krams et al.

Lindstrom, J. (1999) Early development and fitness in birds and trition and immunology: a new frontier. Journal of Insect mammals. Trends in Ecology and Evolution, 14, 343–348. Physiology, 59, 130–137. Little, T.J. and Killick, S. (2007) Evidence for a cost of immunity Povey, S., Cotter, S.C., Simpson, S.J. and Wilson, K. (2013) Dy- when the crustacean Daphnia magna is exposed to the bacte- namics of macronutrient self-medication and illness-induced rial pathogen Pasteuria ramosa. Journal of Animal Ecology, anorexia in virally infected insects. Journal of Animal Ecol- 76, 1202–1207. ogy, 83, 245–255. Mangel, M. and Stamps, J. (2001) Trade-offs between growth Rantala, M.J., Jokinen, I., Kortet, R., Vainikka, A. and Suhonen and mortality and the maintenance of individual variation in J. (2002) Do pheromones reveal male immunocompetence? growth. Evolutionary Ecology Research, 3, 583–593. Proceedings of the Royal Society Series B, 269, 1681–1685. Marston, N., Campbell, B. and Boldt, P.E. (1975) Mass produc- Rantala, M.J., Kortet, R., Kotiaho, J.S., Vainikka, A. and Suho- ing eggs of the greater wax moth, Galleria mellonella L. U.S. nen, J. (2003) Condition dependence of pheromones and im- Department of Agriculture Technical Bulletin, 1510, 1–15. mune function in the grain beetle Tenebrio molitor. Func- Metcalfe, N.B. and Monaghan, P. (2003) Growth versus life- tional Ecology, 17, 534–540. span: perspectives from evolutionary ecology. Experimental Rantala, M.J., Koskimaki, J., Taskinen, J., Tynkkynen, K. and Gerontology, 38, 935–940. Suhonen, J. (2000) Immunocompetence, developmental sta- Metcalfe, N. and Monaghan, P. (2001) Compensation for a bad bility and wing spot size in the damselfly Calopteryx splen- start: grow now, pay later? Trends in Ecology and Evolution, dens L. Proceedings of the Royal Society Series B, 267, 2453– 16, 254–260. 2457. Morgan, I.J., McCarthy, I.D. and Metcalfe, N.B. (2000) Life- Rantala, M.J. and Roff, D.A. (2007) Inbreeding and extreme history strategies and protein metabolism in overwintering ju- out breeding cause sex differences in immune defense and venile Atlantic salmon: growth is enhanced in early migrants life history traits in Epirrita autumnata. Heredity, 98, 329– through lower protein turnover. Journal of Fish Biology, 56, 336. 637–647. Ratcliffe, N.A., Rowley, A.F., Fitzgerald, S.W. and Rhodes, C.P. Monaghan, P. (2008) Early growth conditions, phenotypic de- (1985) Invertebrate immunity: basic concepts and recent ad- velopment and environmental change. Philosophical Trans- vances. International Review of Cytology: A Survey of Cell actions of the Royal Society Series B, 363, 1635–1645. Biology, 97, 183–350. Moret, Y.and Schmid-Hempel, P.(2000) Survival for immunity: Roff, D.A. (1992) The Evolution of Life Histories: Theory and the price of immune system activation for bumblebee workers. Analysis. Chapman and Hall, New York. Science, 290, 1166–1168. Roff, D.A. (2002) Life History Evolution. Sinauer Associates Munch, S.B. and Conover, D.O. (2003) Rapid growth results Inc., Sunderland, MA. in increased susceptibility to predation in Menidia menidia. Rolff, J., van de Meutter, F.and Stoks, R. (2004) Time constraints Evolution, 57, 2119–2127. decouple age and size at maturity and physiological traits. The Nylin, S. and Gotthard, K. (1998) Plasticity in life-history traits. American Naturalist, 164, 559–565. Annual Review of Entomology, 43, 63–83. Sadd, B.M. and Siva-Jothy, M.T. (2006) Self-harm caused by an Paskewitz, S. and Riehle, M.A. (1994) Response of Plasmodium insect’s innate immunity. Proceedings of the Royal Society B, refractory and susceptible strains of Anopheles gambiae to Biological Sciences, 273, 2571–2574. inoculated Sephadex beads. Developmental and Comparative Schmid-Hempel, P. (2011) Evolutionary Parasitology: The In- Immunology, 18, 369–375. tegrated Study of Infections, Immunology, Ecology, and Ge- Pihlaja, M., Siitari, H. and Alatalo, R.V. (2006) Maternal anti- netics. Oxford University Press, New York. bodies in a wild altricial bird: effects on offspring immunity, Siva-Jothy, M. and Thompson, J. (2002) Short-term nutrient growth and survival. Journal of Animal Ecology, 75, 1154– deprivation affects immune function. Physiological Entomol- 1164. ogy, 27, 206–212. Polkki,¨ M., Kangassalo, K. and Rantala, M.J. (2012) Transgen- Sorci, G., Clobert, J. and Belichon, S. (1996) Phenotypic plas- erational effects of heavy metal pollution on immune defense ticity of growth and survival in the common lizard Lacerta oftheblowflyProtophormia terraenovae. PLoS ONE,7, vivipara. Journal of Animal Ecology, 65, 781–790. e38832. Stearns, S.C. (1992) The Evolution of Life Histories. Oxford Ponton, F.,Wilson, K., Cotter, S.C., Raubenheimer, D. and Simp- University Press, Oxford. son, S.J. (2011) Nutritional immunology: a multi-dimensional Tammaru, T., Esperk, T. and Castellanos, I. (2002) No evidence approach. PLoS Pathogens, 7, e1002223. for costs of being large in females of Orgyia spp. (Lepi- Ponton, F., Wilson, K., Holmes, A.J., Cotter, S.C., doptera, Lymantriidae): larger is always better. Oecologia, Raubenheimer, D. and Simpson, S.J. (2013) Integrating nu- 133, 430–438.

C 2014 Institute of Zoology, Chinese Academy of Sciences, 22, 431–439 Food quality and life history trade-offs 439

Trudeau, D., Washburn, J.O. and Volkman, L.E. (2001) Central of the lepidopteran model host Galleria mellonella. BMC role of hemocytes in Autographa californica M nucleopolyhe- Genomics, 12, 308. drovirus pathogenesis in Heliothis virescens and Helicoverpa Warren, L.O. and Huddleston, P. (1962) Life history of the zea. Journal of Virology, 75, 996–1003. greater wax moth Galleria mellonella L. in Arkansas. Journal van Ooik, T. and Rantala, M.J. (2010) Local adaptation of an of the Kansas Entomological Society, 35, 212–216. insect herbivore to a heavy metal contaminated environment. Washburn, J.O., Kirkpatrick, B.A. and Volkman, L.E. (1996) Annales Zoologici Fennici, 47, 215–222. Insect protection against viruses. Nature, 383, 767. Vilcinskas, A. 2011. Anti-infective therapeutics from the lepi- Yourth, C.P., Forbes, M.R. and Smith, B.P. (2001) On under- dopteran model host Galleria mellonella. Current Pharma- standing variation in immune expression of the damselflies ceutical Design, 17, 1240–1245. Lestes spp. Canadian Journal of Zoology, 79, 815–821. Vogel, H., Altincicek, B., Glockner,¨ G. and Vilcinskas, A. (2011) A comprehensive transcriptome and immune-gene repertoire Accepted March 26, 2014

C 2014 Institute of Zoology, Chinese Academy of Sciences, 22, 431–439 doi: 10.1111/jeb.13150

Sex-specific compensatory growth in the larvae of the greater wax moth Galleria mellonella

S. KECKO*, A. MIHAILOVA*, K. KANGASSALO†,D.ELFERTS‡,T.KRAMA*§,R.KRAMS*, S. LUOTO¶,M.J.RANTALA† &I.A.KRAMS**†† *Department of Biotechnology, Institute of Life Sciences and Technology, Daugavpils University, Daugavpils, Latvia †Department of Biology, University of Turku, Turku, Finland ‡Department of Botany and Ecology, University of Latvia, Rıga, Latvia §Department of Plant Protection, Institute of Agricultural and Environmental Sciences, Estonian University of Life Science, Tartu, Estonia ¶English, Drama and Writing Studies, School of Psychology, University of Auckland, Auckland, New Zealand **Department of Zoology and Animal Ecology, University of Latvia, Rıga, Latvia ††Institute of Ecology and Earth Sciences, University of Tartu, Tartu, Estonia

Keywords: Abstract compensatory growth; Deficiency of food resources in ontogeny is known to prolong an organism’s developmental plasticity; developmental time and affect body size in adulthood. Yet life-history traits Galleria mellonella; are plastic: an organism can increase its growth rate to compensate for a life-history; period of slow growth, a phenomenon known as ‘compensatory growth’. sex-specific immunity; We tested whether larvae of the greater wax moth Galleria mellonella can survival. accelerate their growth after a fast of 12, 24 or 72 h. We found that a sub- group of female larvae showed compensatory growth when starved for 12 h. Food deficiency lasting more than 12 h resulted in longer develop- ment and lower mass gain. Strength of encapsulation reactions against a for- eign body inserted in haemocoel was the weakest in females that showed compensatory growth, whereas the strongest encapsulation was recorded in the males and females that fasted for 24 and 72 h. More specifically, we found sex-biased immune reactions so that females had stronger encapsula- tion rates than males in one group that fasted for 72 h. Overall, rapidly growing females had a short larval development period and the shortest adult lifespan. These results suggest that highly dynamic trade-offs between the environment, life-history traits and sex lead to plasticity in developmen- tal strategies/growth rates in the greater wax moth.

and environmental stress that would reduce adult body Introduction size. It has been found that organisms can compensate Life-history traits often exhibit enormous variation the effects of impaired growth by growing slower and within species. Understanding the constraints and evo- longer (Gilbert & Barresi, 2016). Complete recovery lution of plasticity of these traits is a principal task for from food restrictions via compensatory gain of body evolutionary ecology (Nylin & Gotthard, 1998; Roff, mass without additional developmental time is also 2002). Variation in growth rate is of particular impor- possible. ‘Compensatory growth’ is an accelerated tance as it links age and size, the two life-history traits growth period following a period of slowed develop- that affect adult body mass and fitness (Roff, 2002). ment usually caused by nutrient deprivation (Bohman, Because of positive links between body mass and 1955; Metcalfe & Monaghan, 2001; De Block et al., immunity (Krams et al., 2011a, 2014), and between 2008). Sometimes, high compensatory growth results body mass and fitness (Blanckenhorn, 2005), organisms in overcompensation, in which the organism exceeds tend to avoid any negative effects of developmental normal body mass and often has excessive fat reserves (Hornick et al., 2000). Compensatory growth that occurs following a period of dietary restriction in onto- Correspondence: Indrikis A. Krams, Institute of Ecology and Earth Sciences, University of Tartu, Vanemuise 46, Tartu 51014, Estonia. geny has been observed in a number of animals Tel.: +371 29465273; fax: +371 65426719; e-mail: [email protected] (Metcalfe & Monaghan, 2001; Dmitriew, 2011; Hector

ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY. J. EVOL. BIOL. 30 (2017) 1910–1918 1910 JOURNAL OF EVOLUTIONARY BIOLOGY ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY Sex-specific compensatory growth 1911

& Nakagawa, 2012) and humans (Cottrell & Ozanne, adult body size and body fat deposits (cf. Nettle et al., 2008). 2016), whereas male fitness is more dependent on Besides compensatory growth, nutrient limitation reaching adulthood and so they invest in immunity often causes deficient development where an individual and survival to eclosion (Kelly et al., 2014). Therefore, never reaches normal body mass or body size. To we also tested whether compensatory growth is sex- explain why all organisms do not grow at the maxi- specific in greater wax moths. Females were predicted mum speed, it has been suggested that intense growth to grow rapidly; their growth was expected to occur at leads to the accumulation of oxidative damage of cellu- the expense of immune response measured by encapsu- lar lipids, proteins and DNA (Metcalfe & Monaghan, lation reaction. In contrast, we expected males to grow 2003; Mangel & Munch, 2005) by production of reac- slower after a period of dietary restriction than females. tive oxygen species (ROS) (Finkel & Holbrook, 2000; We hypothesized that the strength of encapsulation De Block & Stoks, 2008a). Rapid growth rate makes response would be greater in males of the starvation organisms more susceptible to adult diseases such as group than in males of the control group, as found ear- heart disease, diabetes and obesity (Cottrell & Ozanne, lier (Krams et al., 2014). Adult female wax moths live 2008; Bol et al., 2009; Porrello et al., 2009). The costs of on average 12 days, whereas the male moths live on compensatory growth have also been found to decrease average 21 days (Warren & Huddleston, 1962). Thus, the maximum lifespan of individuals in a number of we predicted longer lifespan in adult males than in species (Metcalfe & Monaghan, 2003). Thus, compen- adult females. Greater wax moths do not feed during satory growth allows animals to reach a larger size at adult stage. They do not have a risk of ingesting oppor- maturity after periods of restricted food availability, tunistic microorganisms, and therefore, their immune although not every individual can afford this due to system does not need to be highly activated to fight physiological and ecological constraints (Orizaola et al., intruders. 2014). The greater wax moth Galleria mellonella is a moth of Materials and methods the family Pyralidae that is distributed in most parts of the world. The larvae of the greater wax moth feed on Insects, starvation groups, growth and survival the honeycomb inside honeybee hives and often become pests of apiculture (Warren & Huddleston, We studied a laboratory population of G. mellonella. 1962). Previous studies found extremely fast larval Progenitors of this population were collected from bee- growth if food of the highest nutritional quality is avail- hives in south-eastern Estonia in 2014. Moths were able: the larvae started pupation on day 28 post-hatch reared in 2.4-L plastic boxes at 28 Æ 1 °C in the dark (Krams et al., 2014), whereas under deficient food con- in Sanyo MIR-253 environmental chambers. ditions, their development extends up to 6 months To study the effects of food deprivation on the (Marston et al., 1975). Although such enormous varia- growth of G. mellonella larvae (n = 202), the larvae tion in developmental time suggests a potential for were randomly assigned to one of three main starvation compensatory growth, this type of development has treatment groups and a control group. In the starvation never been found in the greater wax moth before. This groups, food was removed for periods of 12 (n = 64 lar- is probably due to two reasons: (i) the growth rate of vae), 24 (n = 53 larvae) and 72 (n = 45 larvae) hours. larvae is already close to its maximum and (ii) develop- We also had a control group (n = 40 larvae) where the ment often constitutes a trade-off against immunity, as larvae had unlimited access to food. measured by encapsulation response (Krams et al., Each larva was placed individually into plastic con- 2014). However, the larvae often need to change the tainers (50 mL) with a lid and wire mesh to allow ven- beehive for another bee nest because the first genera- tilation and to prevent individuals from escaping. In all tion of greater wax moths to invade a bee colony usu- starvation groups, the food was removed on post-hatch ally has larger amounts of food resources than any day 18. We started measuring body mass of the larvae further generation (Barjac & Thomson, 1970). In this on post-hatch day 14 once daily until the larvae way, the larvae migrating for another bee nest obvi- pupated. Body mass of the larvae was rounded to the ously are temporarily deprived of food, and thus, com- nearest 0.01 mg. Larvae were weighed using a Kern pensatory growth is possible if the food becomes analytical balance (Kern & Sohn GmbH, Balingen, Ger- available again. many). We also had a separate group of larvae to assess We carried out an experimental study to test whether survival during larval and pupal development; none of larvae of the greater wax moth respond to periods of these larvae was used to assess the strength of encapsu- impaired growth caused by dietary restrictions by grow- lation response. Sex identification was carried out dur- ing slower/longer, or whether they can compensate for ing pupal phase and adult phase (as in Smith, 1965; such periods via compensatory growth. Further, females Ellis et al., 2013). may respond to decreased nutrition by increasing All the larvae groups received food of high nutri- growth rate because their fitness depends on a large tional value and diversity, provided ad libitum until the

ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY. J. EVOL. BIOL. 30 (2017) 1910–1918 JOURNAL OF EVOLUTIONARY BIOLOGY ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY 1912 S. KECKO ET AL.

experimental manipulation commenced. The diverse Statistical analyses diet consisted of a mix of equal proportions of honey, glycerol, bee-wax, dried milk, wheat flour, dry yeast, All statistical analyses were performed using software R distilled water and two servings of corn meal. The 3.3.2 (R Core Team, 2017). For all the starvation groups amount of energy associated with this food was esti- and sexes, body mass measurements were graphically mated as ca. 17.00 kJ/g (Krams et al., 2014) by a com- checked by means of histograms to see their daily value bustion calorimeter (IKA-Werke GmbH & Co. KG, distribution. All groups showed similar unimodal distri- Bitterfeld-Wolfe, Germany). The larvae received only bution except for the 12-h starvation group of females. water during the hours of food deprivation. Starting from day 22, it was observed that the data showed a bimodal distribution: these two groups of females appeared to follow different growth trajectories Immune assays from the other groups. Therefore, the females in the As stated above, we had four groups of larvae: 12-h starvation group were divided into two groups for deprived from food for 12, 24 and 72 h and the con- further analysis: (i) 12-h starvation females that grew trol group. For each group, we had an additional typically and (ii) 12-h starvation females that grew immune treatment subgroup of larvae (n = 184 larvae rapidly. in total). These animals were only used to evaluate To compare response variables between sexes and the strength of the encapsulation response against a treatment groups and their interaction, generalized foreign body inserted through the larval cuticle. All least-square models with variance structure dependent larvae in the immune treatment subgroup on post- on treatment group as implemented in R library NLME hatch day 25 were subjected to a challenge to their (Pinheiro et al., 2017) were used because variances of immune system so that a disinfected nylon monofila- response variables between treatment groups were not ment implant (2 mm length, 0.18 mm diameter, knot- homogenous. Separate models were developed for ted at one end) was inserted through their cuticle body mass at the beginning of measurements, the between the 3rd sternite and 4th sternite (Krams duration of larval development, adult lifespan and et al., 2014) for 10 h at 28 Æ 0.5 °C. The implant was the strength of encapsulation response. To test for the removed after this treatment. The strength of encapsu- effect of treatment, sex and interaction on the pupal lation response was measured as the darkness of the survival, generalized linear model (GLM) with nylon filament insert after it had been dried. Insect binomial error structure was used. Tukey multiple immune systems respond to this challenge by attempt- comparisons tests (with modification for generalized ing to encapsulate it in a coating of cellular materials least-square models) were used to assess pairwise dif- and chemical deposits as if the insert were a foreign ferences between sex/treatment combinations as body/parasite (e.g. Rantala et al., 2000). The stronger implemented in R library MULTCOMP (Hothorn et al., the immune response to the insert, the darker the 2008). A linear mixed-effects model as implemented encapsulation and the higher its greyscale value in R library LME4 (Bates et al., 2015) was used to assess (Yourth et al., 2001; Krams et al., 2011b, 2013; Dauk- the effects of sex, treatment, measurement day and ste et al., 2012) due to phenoloxidase enzyme produc- interactions (fixed effects) on the body mass of the tion activated by the immune response, resulting in larvae. For each larva, three body mass measurements melanization of the capsule (Ratcliffe et al., 1985). In were used: (i) body mass on day 18 (the start of star- the greater wax moth, encapsulation response has vation period), (ii) body mass after the starvation per- been confirmed to be associated with parasitoid (Kryu- iod (the evening of day 18 for control and 12-h kova et al., 2011), fungal (Dubovskiy et al., 2011, starvation group, day 19 for 24-h starvation group 2013) and bacterial infections (Grizanova et al., 2014). and day 21 for the 72-h starvation group) and (iii) In other insects, the encapsulation response against body mass at the end of the larval development per- the foreign object is correlated with measures of iod. Larva ID was used as a random factor to account immunity, such as the phenoloxidase cascade (Rantala for repeated measures on the same individual. Linear et al., 2000, 2002, 2003), encapsulation of (Paskewitz mixed-effects model was used as it deals with repeated & Riehle, 1994; Gorman et al., 1998) and resistance to measurement as efficiently as repeated-measures ANOVA an entomopathogenic fungal disease (Rantala & Roff, but enables to do post hoc tests between different 2007). Lightness was assessed from photographs of the interaction effects groups. inserts taken from three directions under constant light conditions using a Zeiss Lumar V12 Stereo (Carl Results Zeiss, Jena, Germany) microscope. Digital images were analysed using the ImageJ software (http://rsbweb.nih. We did not observe any larval mortality, whereas 25 of gov/ij/; Abramoff et al., 2004). Before the insertion of 202 (12.38%) pupae were found dead. Pupal survivor- the monofilament implant, we calibrated the reflec- ship did not depend on sex (F = 2.480, d.f. = 1, tance of the implant to zero level. P = 0.115), treatment (F = 0.726, d.f. = 3, P = 0.867) or

ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY. J. EVOL. BIOL. 30 (2017) 1910–1918 JOURNAL OF EVOLUTIONARY BIOLOGY ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY Sex-specific compensatory growth 1913

sex and treatment interaction (F = 0.770, d.f. = 3, The duration of larval development did not depend P = 0.857). on sex (F = 0, d.f. = 1, P = 0.919). However, it was sig- At the beginning of this study, the body mass of nificantly influenced by treatment (F = 493.20, d.f. = 3, G. mellonella larvae was similar across all starvation and P < 0.0001) and by sex and treatment interaction control groups on post-hatch day 18 before we (F = 4.40, d.f. = 3, P = 0.0053) (Fig. 3). The duration of removed the food in the starvation groups (Fig. 1). We larval development significantly differed between did not find any significant effect of starvation treat- female subgroups in the 12-h starvation group (females ment (F = 1.273, d.f. = 3, P = 0.285), sex (F = 0.014, growing typically vs. rapidly growing females: d.f. = 1, P = 0.905) and interaction (F = 0.233, d.f. = 3, 28.95 Æ 1.31 vs. 27.13 Æ 0.35 days, mean Æ SD, P = 0.873) on body mass of the larvae. P < 0.0001) (Fig. 3). The longer the starvation, the Body mass significantly decreased across starvation longer became the larval development in both males groups during starvation periods (P < 0.0001) whereas and females (Fig. 3). Males (32.083 Æ 0.282 days, it did not change in the control group (Figs 1 and 2). mean Æ SD) and females (32.143 Æ 0.359 days, The greatest body mass loss was observed for the 72-h mean Æ SD) of the 72-h starvation treatment group starvation group. After the starvation period, all starva- had the longest growth time (Fig. 3). Larval develop- tion groups showed significantly lower body masses ment was longer in the 24 h (all Ps < 0.001) and the compared to the same-sex control group (P < 0.0001). 72 h (all Ps < 0.001) groups than in the control group. The larvae of the starvation groups resumed their It was longer in the 24-h (all Ps < 0.001) and the 72-h growth as soon as the food deprivation was over and (all Ps < 0.001) group than in the 12-h group, and showed a significant body mass increase between the longer in the 72-h than in the 24-h starvation treat- end of the starvation period and the end of larval ment group (all Ps < 0.001). The males and females development (P < 0.0001) (Fig. 2). The highest body that grew typically in the 12-h group developed signifi- mass increase was observed for the 12-h starvation cantly longer than males and females in the control rapidly growing females, whereas the lowest increase group (all Ps < 0.05). However, the rapidly growing occurred in both sexes of the 72-h starvation group. females did not differ from the control group in the Except for the 12-h starvation rapidly growing female duration of larval development (P > 0.05). We did not group, all starvation groups showed lower body mass at find sex differences in any other groups (P > 0.05). the end of larval development compared to the control The encapsulation response was affected by treatment group. For the 24-h and 72-h starvation groups, body (F = 217.003, d.f. = 3, P < 0.0001) and interaction mass difference between the control group increased between treatment and sex (F = 27.457, d.f. = 3, (comparing body mass after starvation and at the end P < 0.0001), whereas it did not depend on sex of larval development). The body mass difference of (F = 0.304, d.f. = 1, P = 0.582). The encapsulation rate females starved for 12 h and females of the control was significantly lower in the females that developed group remained the same (Fig. 2). The body mass dif- rapidly than in the females that developed typically in ference decreased between males starved for 12 h and the 12-h starvation group (Fig. 4). The encapsulation males of the control group (Fig. 2). rate of the larvae in the control group did not differ from the encapsulation rate of males and typically growing females in the 12-h starvation group (all Ps > 0.05). However, individuals in the control group and the 12-h starvation group (males and typically growing females) significantly differed in their encapsu- lation rates from the larvae in the 24-h and 72-h star- vation groups (all Ps < 0.001), and the latter two groups also differed significantly from one another (all Ps < 0.001). Encapsulation of males and females did not differ significantly in the control group, in the 12-h starvation group (males and typically growing females) nor in the 24-h starvation treatment group (Fig. 4). Whereas the rapidly growing females in the 12-h star- vation group had significantly lower encapsulation rates than the males, the females responded significantly stronger than males to the nylon implant (P < 0.001, Fig. 4) in the 72-h starvation treatment group. Adult lifespan was affected by treatment (F = 49.439, Fig. 1 The larval growth before and after food was removed on d.f. = 3, P < 0.0001), sex (F = 1876.305, d.f. = 1, day 18 post-hatch for 12, 24 and 72 h in the experimental and P < 0.0001) and their interaction (F = 4.955, d.f. = 3, control groups. P = 0.003). The duration of the adult stage gradually

ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY. J. EVOL. BIOL. 30 (2017) 1910–1918 JOURNAL OF EVOLUTIONARY BIOLOGY ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY 1914 S. KECKO ET AL.

Fig. 2 Standard boxplots showing the body mass of the larvae in the begging of starvation period (a), after the starvation period (b) and at the end of the larvae development (c).

decreased from control males and females to individuals in the 72-h starvation treatment group. Whereas all groups of males differed significantly (all Ps < 0.001, Fig. 5), the control females did not differ significantly from the females of the 12-h starvation treatment group. Furthermore, females from the 12-h and 24-h groups did not differ significantly from one another (both Ps > 0.05). However, females from the 24-h star- vation treatment group significantly differed from the control females and females from the 72-h starvation treatment group (Fig. 5). The shortest adult stage was found in individuals from the rapidly growing female subgroup in the 12-h starvation treatment group. It dif- fered significantly from all female and male groups (all Ps > 0.0001) with the exception of the females from Fig. 3 Standard boxplots showing the duration of the larval stage the 72-h starvation group (P < 0.05, Fig. 5). The males in the starvation treatment groups and the control group. always had longer lifespans than the females in all of the groups (all Ps < 0.001, Fig. 5).

Fig. 4 Standard boxplots showing the encapsulation rates Fig. 5 Standard boxplots showing the adult lifespan (days) of (greyscale values) of Galleria mellonella larvae in 12-h, 24-h and males and females of Galleria mellonella from 12-h, 24-h and 72-h 72-h starvation groups and the control group. starvation groups and the control group.

ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY. J. EVOL. BIOL. 30 (2017) 1910–1918 JOURNAL OF EVOLUTIONARY BIOLOGY ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY Sex-specific compensatory growth 1915

Discussion The results of this study suggest that periods of star- vation, which are indicative of an elevated risk of In this study, we found evidence for the phenomenon encountering parasites and pathogens in G. mellonella, of compensatory growth (Hector & Nakagawa, 2012) in might be an important factor affecting body size–devel- the larvae of the greater wax moth. However, compen- opmental speed trade-offs (Rantala & Roff, 2005). The satory growth was evident only in the group with the longer was the food deprivation time, the longer lasted shortest food deprivation (12 h). In contrast, food the larval stage and the stronger was the encapsulation deprivation for 24 and 72 h was not associated with response. Prolonged time to reach the pupal and adult compensatory growth because the longer food depriva- stages means that the larvae have more potential tion slowed larval growth and prolonged the duration encounters with parasites. Thus, the larvae may benefit of larval phase in all individuals in the 24-h and 72-h from allocating a portion of their limited nutritional starvation treatment groups. resources to immunity rather than growth (Lochmiller Surprisingly, the larvae did not resume the initial & Deerenberg, 2000; Zuk & Stoehr, 2002; Valtonen speed of growth after the fasting periods of 24 h and et al., 2010; Mohamed et al., 2014). Our results show 72 h. However, these larvae had stronger encapsulation that the investment in the immune system was highly response than individuals that increased their growth efficient in the larvae that we studied, because survival in the 12-h starvation group (rapidly growing females) until the adult stage appeared to be similar in the con- or individuals in the control group. The larvae of the trol group and in the groups that fasted for 24 h and greater wax moth move to another beehive once the 72 h. This suggests that developmental speed was food is consumed to ensure the continuation of their traded off against immunity. development. However, food deprivation that lasted for The larvae in the group with food deprivation of more than one day significantly slowed larval develop- 12 h became divided as a natural result of the experi- ment in our study, despite the larvae receiving food ment into the following two subgroups: (i) individuals ad libitum during the post-starvation period. The most that slowed their development compared to the control likely explanation for this finding is that in the nature, group and followed the type of development similar to larvae may have to spend more than one day to reach the larvae in the groups with food deprivation lasting and infest any other bee nest in the vicinity. Impor- 24 h or 72 h; and (ii) the larvae that grew significantly tantly, during dispersal, the probability to get infected is faster than individuals of the control group. Compen- much higher than inside the beehive. This is because satory growth clearly brings costs, as can be seen in the the food (honey, bee-wax) may provide not only nutri- significantly shorter lifespan in individuals in the com- tion and cover against bees but also protection against pensatory growth subgroup than in any other subgroup parasites and pathogens due to its antimicrobial proper- or group. The weaker encapsulation response in the ties. Outside the beehive, the larvae are more likely to overcompensating larvae is a likely explanation for the encounter pathogens and parasites, and therefore, they shorter adult lifespan, indicating that they traded off need to enhance investments in the immune system as immunity against body mass and developmental speed indicated in the greater wax moth (Krams et al., 2014) (De Block & Stoks, 2008b). and Manduca sexta caterpillars (Adamo et al., 2016). Another potential explanation for the shorter adult Moreover, in the present study 24-h and 72-h fasting lifespan in the rapidly growing female larvae is related periods accounted for approximately 3.5% and 11.0% to oxidative damage which can arise from two nonex- of the total duration of the larval stage, respectively. clusive mechanisms. First, compensatory growth may Such long durations of fasting supposedly match the affect the antioxidant protection systems, thus making conditions of poor overall nutrition, and the resulting organisms more vulnerable to oxidative stress (De Block malnutrition may have profound long-term effects on & Stoks, 2008a). Second, compensatory growth may resource allocation to fitness-related life-history traits itself cause oxidative stress (Loft et al., 1994) because and trade-offs between those traits in the larval, pupal rapid development requires high oxygen consumption and adult developmental stages (Metcalfe & Monaghan, (Fischer et al., 2004; Stoks et al., 2006; Lee et al., 2017). 2001; Boggs, 2009; Teder et al., 2014). Thus, the dura- Future studies are needed to test oxidative stress-linked tion of starvation may be a crucial factor determining mechanisms to prove their role in inducing higher mor- investment into compensatory growth: if food is lacking tality in the larvae exhibiting compensatory growth. It for more than 12 h, the larva adjusts its immune sys- is important to note that the greater wax moth is one tem to accommodate a longer and slower development. of the best model species to study those topics because Thus, the greater wax moth showed a preference for these animals grow fast and their laboratory popula- the strategy of longer development to the strategy of tions are easy and cheap to maintain. compensatory growth. Evidence shows that the larvae Previous work on the greater wax moth has sug- of this moth are highly resistant to food shortage, and gested that sex-related factors have a minor role on the under deficient food conditions, their development may strategy of larval development when related to the be prolonged up to 6 months (Marston et al., 1975). effect of diet (Krams et al., 2014). However, the current

ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY. J. EVOL. BIOL. 30 (2017) 1910–1918 JOURNAL OF EVOLUTIONARY BIOLOGY ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY 1916 S. KECKO ET AL.

study shows that sex has a crucial effect on the likeli- quality is available post-starvation. Compensatory hood of compensatory growth following short-term growth is costly because the females that grew in a fasting. We found that only females showed compen- compensatory mode had shorter lifespans than females satory growth, and the ratio of females and males was that developed slowly. We show that the larval devel- nearly equal in the slower-growing subgroup of the 12- opment in the greater wax moth is the result of compli- h starvation treatment and the rest of the starvation cated trade-offs between immunity, speed of groups. This result can be explained by accounting for development, food availability and sex-specific resource the role of body size/mass in individual fitness in differ- allocation to life-history traits. Importantly, these trade- ent sexes (Fairbairn et al., 2007). If larger body mass at offs may depend on the type of melanin used in encap- maturity is crucial to female fitness (Simmons & Zuk, sulation responses. It has recently been found that 1992; Simmons, 1995; Harrison et al., 2013; Kelly et al., insects are capable of synthesizing the sulphurated form 2014) and males need to ensure survival at the expense of melanin that is called pheomelanin (Galvan et al., of body size, only females may gain by allocating 2015). The synthesis of pheomelanin requires a semi- resources into compensatory growth. Males can benefit essential amino acid cysteine that is mainly obtained from their enhanced immunity and longer development from food (Stipanuk et al., 2006) and substantial by merely reaching the adult stage because they have amounts glutathione (the most important intracellular twice as long lifespan as females (Warren & Huddle- antioxidant) (Galvan et al., 2014). The consumption of ston, 1962). cysteine and glutathione has the potential to constrain The inability of males to invest in compensatory immune responses in animals exposed to oxidative growth may also be linked to potential sex differences stress (Karell et al., 2011; Galvan et al., 2014). There- in endocrine–immune interactions and consequent sus- fore, future experiments on trade-offs associated with ceptibility to infection (Zuk & McKean, 1996; Klein, compensatory growth must also take into account the 2000; Foo et al., 2017). However, we cannot even com- type of melanin deposited on the surface of nylon pare the strength of encapsulation response between monofilaments used as artificial parasites. the rapidly growing females in the 12-h starvation group and the respective males as none of the males Acknowledgments attempted compensatory growth. On the other hand, females had significantly higher encapsulation rates We acknowledge Jolanta Vrublevska for her help with against the nylon implant than males in the 72-h star- the experiment. vation treatment group. We show that greater encapsu- lation was not related to longer adult lifespan because Ethical statement it was the shortest among females of the 72-h starva- tion group. The increased strength of encapsulation was The greater wax moth is not classified as an endangered rather needed when the larval development time was or protected species. No permits are required for carry- longest to ensure pupation. It is important to note that ing out experiments with this species. males and females differ in responses of their immune system to antigens in both vertebrates (see Klein & Funding Flanagan, 2016 for a review) and invertebrates (Joop et al., 2006; Kraaijeveld et al., 2008; Barthel et al., The study was funded by grants from the Latvian 2015). Males are more susceptible to disease, whereas Council of Science (# 290/2012) and Estonian Research females often have stronger immune responses which Council (PUT1223, IUT36-2) to SK, TK, IK. may contribute to higher incidence of autoimmune dis- eases and malignancies. Besides higher risk of oxidative Competing interest stress due to increased growth rates, a stronger encap- sulation rate may account for the shorter lifespan The authors declare that they have no competing inter- observed in adults of the greater wax moth (Krams ests. et al., 2011a). Our results suggest that invertebrates should also be studied in more detail in regard to possi- Author contributions ble male and female differences in responses of their immune system to foreign bodies and infections. IK, SK, KK and TK designed the study; SK, MJR and To sum up, our results reveal sex-specific compen- RK performed the experiment; DE and AM analysed satory growth in the larvae of the greater wax moth. the data; and IK and SL wrote the manuscript. The larvae are highly adapted to grow slowly because their food resources are seasonal, patchy and thus not References fully predictable. However, some females may follow the strategy of compensatory growth when the fasting Abramoff, M.D., Magalhaes, P.J. & Ram, S.J. 2004. Image pro- periods do not exceed 12 h and food of high nutritional cessing with ImageJ. Biophotonics Intern. 11:36–42.

ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY. J. EVOL. BIOL. 30 (2017) 1910–1918 JOURNAL OF EVOLUTIONARY BIOLOGY ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY Sex-specific compensatory growth 1917

Adamo, S.A., Davies, G., Easy, R., Kovalko, I. & Turnbull, K.F. Foo, Y.Z., Nakagawa, S., Rhodes, G. & Simmons, L.W. 2017. 2016. Reconfiguration of the immune system network dur- The effects of sex hormones on immune function: a meta- ing food limitation in the caterpillar Manduca sexta. J. Exp. analysis. Biol. Rev. 92: 551–571. Biol. 219: 706–718. Galvan, I., Bonisoli-Alquati, A., Jenkinson, S., Ghanem, G., Barjac, H. & Thomson, J.V. 1970. A new serotype of Bacillus Wakamatsu, K., Mousseau, T.A. et al. 2014. Chronic expo- thuringiensis: Bacillus thuringiensis var. thompsoni (serotype sure to low-dose radiation at Chernobyl favours adaptation 11). J. Invertebr. Pathol. 15:14–144. to oxidative stress in birds. Funct. Ecol. 28: 1387–1403. Barthel, A., Staudacher, H., Schmaltz, A., Heckel, A.G. & Galvan, I., Jorge, A., Edelaar, P. & Wakamatsu, K. 2015. Groot, A.T. 2015. Sex-specific consequences of an induced Insects synthesize pheomelanin. Pigment Cell Melanoma Res. immune response on reproduction in a moth. BMC Evol. Biol. 28: 599–602. 15: 282. Gilbert, S.F. & Barresi, M.J.F. 2016. Developmental Biology. Sin- Bates, D., Maechler, M., Bolker, B. & Walker, S. 2015. Fitting auer Associates, Sunderland, Massachusetts. linear mixed-effects models using lme4. J. Stat. Soft. 67:1– Gorman, M.J., Schwartz, A.M. & Paskewitz, S.M. 1998. 48. The role of surface characteristics in eliciting humoral Blanckenhorn, W.U. 2005. Behavioral causes and conse- encapsulation of foreign bodies in Plasmodium -refractory quences of sexual size dimorphism. Ethology 111: 977–1016. and -susceptible strains of Anopheles gambiae. J. Insect Physiol. Boggs, C.L. 2009. Understanding insect life histories and senes- 44: 947–954. cence through a resource allocation lens. Funct. Ecol. 23:27– Grizanova, E.V., Dubovskiy, I.M., Whitten, M.M.A. & Glupov, 37. V.V. 2014. Contributions of cellular and humoral immunity Bohman, V.R. 1955. Compensatory growth of beef cattle: the of Galleria mellonella larvae in defence against oral infection effect of hay maturity. J. Anim. Sci. 14: 249–255. by Bacillus thuringiensis. J. Invertebr. Pathol. 119:40–46. Bol, V.V., Delattre, A.I., Reusens, B., Raes, M. & Remacle, C. Harrison, S.J., Thomson, I.R., Grant, C.M. & Bertram, S.M. 2009. Forced catch-up growth after fetal protein restriction 2013. Calling, courtship, and condition in the fall field alters the adipose tissue gene expression program leading to cricket, Gryllus pennsylvanicus. PLoS ONE 8: e60356. obesity in adult mice. Am. J. Physiol. Regul. Integr. Comp. Phys- Hector, K.L. & Nakagawa, S. 2012. Quantitative analysis of iol. 297: 291–299. compensatory and catch-up growth in diverse taxa. J. Anim. Cottrell, E.C. & Ozanne, S.E. 2008. Early life programming of Ecol. 81: 583–593. obesity and metabolic disease. Physiol. Behav. 94:17–28. Hornick, J.L., Van Eenaeme, C., Gerard, O. & Istasse, L. 2000. Daukste, J., Kivleniece, I., Krama, T., Rantala, M.J. & Krams, Mechanisms of reduced and compensatory growth. Domest. I. 2012. Senescence in immune priming and attractiveness Anim. Endocrinol. 19: 121–132. in a beetle. J. Evol. Biol. 25: 1298–1304. Hothorn, T., Bretz, F. & Westfall, P. 2008. Simultaneous De Block, M. & Stoks, R. 2008a. Compensatory growth and inference in general parametric models. Biometr. J. 50: 346– oxidative stress in a damselfly. Proc. Roy. Soc. B 275: 781– 363. 785. Joop, G., Mitschke, A., Rolff, J. & Siva-Jothy, M.T. 2006. De Block, M. & Stoks, R. 2008b. Short-term larval food stress Immune function and parasite resistance in male and poly- and associated compensatory growth reduce adult immune morphic female Coenagrion puella. BMC Evol. Biol. 6: 19. function in a damselfly. Ecol. Entomol. 33: 796–801. Karell, P., Ahola, K., Karstinen, T., Valkama, J. & Brommer, De Block, M., McPeek, M.A. & Stoks, R. 2008. Stronger com- J.E. 2011. Climate change drives microevolution in a wild pensatory growth in a permanent-pond Lestes damselfly rela- bird. Nat. Commun. 2: 208. tive to temporary-pond Lestes. Oikos 117: 245–254. Kelly, C.D., Neyer, A.A. & Gress, B.E. 2014. Sex-specific life Dmitriew, C.M. 2011. The evolution of growth trajectories: history responses to nymphal diet quality and immune sta- what limits growth rate? Biol. Rev. 86:97–116. tus in a field cricket. J. Evol. Biol. 27: 381–390. Dubovskiy, I.M., Grizanova, E.V., Ershova, N.S., Rantala, Klein, S.L. 2000. The effects of hormones on sex differences in M.J. & Glupov, V.V. 2011. The effects of dietary nickel on infection: from genes to behavior. Neurosci. Biobehav. Rev. 24: the detoxification enzymes, innate immunity and resis- 627–638. tance to the fungus Beauveria bassiana in the larvae of the Klein, S.L. & Flanagan, K.L. 2016. Sex differences in immune greater wax moth Galleria mellonella. Chemosphere 85:92– responses. Nat. Rev. Immunol. 16: 626–638. 96. Kraaijeveld, A.R., Barker, C.L. & Godfray, H.C.J. 2008. Stage- Dubovskiy, I.M., Whitten, M.M.A., Kryukov, V.Y., Yaroslavt- specific sex differences in Drosophila immunity to parasites seva, O.N., Grizanova, E.V., Greig, C. et al. 2013. More than and pathogens. Evol. Ecol. 22: 217–228. a colour change: insect melanism, disease resistance and Krams, I., Daukste, J., Kivleniece, I., Krama, T. & Rantala, fecundity. Proc. Roy. Soc. B 280: 20130584. M.J. 2011a. Overwinter survival depends on immune Ellis, J.D., Graham, J.R. & Mortensen, A. 2013. Standard defence and body length in male Aquarius najas water strid- methods for wax moth research. J. Apicult. Res. 52:1–17. ers. Entomol. Exp. Appl. 140:45–51. Fairbairn, D.J., Blanckenhorn, W.U. & Szekely, T. 2007. Sex, Krams, I., Daukste, J., Kivleniece, I., Krama, T., Rantala, M.J., Size and Gender Roles: Evolutionary Studies of Sexual Size Dimor- Ramey, G. et al. 2011b. Female choice reveals terminal phism. Oxford University Press, Oxford. investment in male mealworm beetles, Tenebrio molitor, after Finkel, T. & Holbrook, N.J. 2000. Oxidants, oxidative stress a repeated activation of immune system. J. Insect Sci. 11: 56. and the biology of ageing. Nature 408: 239–247. Krams, I., Daukste, J., Kivleniece, I., Kaasik, A., Krama, T., Fischer, K., Zeilstra, I., Hetz, S.K. & Fiedler, K. 2004. Physio- Freeberg, T.M. et al. 2013. Trade-off between cellular immu- logical costs of growing fast: does accelerated growth reduce nity and life span in mealworm beetles Tenebrio molitor. Curr. pay-off in adult fitness? Evol. Ecol. 18: 343–353. Zool. 59: 340–346.

ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY. J. EVOL. BIOL. 30 (2017) 1910–1918 JOURNAL OF EVOLUTIONARY BIOLOGY ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY 1918 S. KECKO ET AL.

Krams, I., Kecko, S., Kangassalo, K., Moore, F.K., Jankevics, Mediterranean field cricket, Gryllus bimaculatus. Funct. Ecol. E., Inashkina, I. et al. 2014. Effects of food quality on trade- 19: 323–330. offs among growth, immunity and survival in the greater Rantala, M.J. & Roff, D.A. 2007. Inbreeding and extreme out- wax moth (Galleria mellonella). Insect Sci. 22: 431–439. breeding cause sex differences in immune defence and life Kryukova, N.A., Dubovskiy, I.M., Chertkova, E.A., Vorontsova, history traits in Epirrita autumnata. Heredity 98: 329–336. Y.L., Slepneva, I.A. & Glupov, V.V. 2011. The effect of Rantala, M.J., Koskimaki, J., Taskinen, J., Tynkkynen, K. & Habrobracon hebetor venom on the activity of the prophe- Suhonen, J. 2000. Immunocompetence, developmental sta- noloxidase system and the generation of reactive oxygen bility and wingspot size in the damselfly Calopteryx splendens species and encapsulation in the haemolymph of Galleria L. Proc. Roy. Soc. B 267: 2453–2457. mellonella larvae. J. Insect Physiol. 57: 796–800. Rantala, M.J., Jokinen, I., Kortet, R., Vainikka, A. & Suhonen, Lee, M.S., Yin, T.C., Sung, P.H., Chiang, J.Y., Sun, C.K. & Yip, J. 2002. Do pheromones reveal male immunocompetence? H.K. 2017. Melatonin enhances survival and preserves func- Proc. Roy. Soc. B 269: 1681–1685. tional integrity of stem cells: a review. J. Pineal Res. 62: Rantala, M.J., Kortet, R., Kotiaho, J.S., Vainikka, A. & Suho- e12372. nen, J. 2003. Condition dependence of pheromones and Lochmiller, R.L. & Deerenberg, C. 2000. Trade-offs in evolu- immune function in the grain beetle Tenebrio molitor. Funct. tionary immunology: just what is the cost of immunity? Ecol. 17: 534–540. Oikos 88:87–98. Ratcliffe, N.A., Rowley, A.F., Fitzgerald, S.W. & Rhodes, C.P. Loft, S., Astrup, A., Buemann, B. & Poulsen, H.E. 1994. Oxida- 1985. Invertebrate immunity: basic concepts and recent tive DNA-damage correlates with oxygen-consumption in advances. Int. Rev. Cytol. 97: 183–350. humans. FASEB J. 8: 534–537. Roff, D.A. 2002. Life History Evolution. Sinauer Associates, Sun- Mangel, M. & Munch, S.B. 2005. A life-history perspective on derland, Massachusetts. short- and long-term consequences of compensatory growth. Simmons, L.W. 1995. Correlates of male quality in the field Am. Nat. 166: E155–E176. cricket, Gryllus campestris L.: age, size, and symmetry deter- Marston, N., Campbell, B. & Boldt, P.E. 1975. Mass Producing mine pairing success in field populations. Behav. Ecol. 6: Eggs of the Greater wax Moth, Galleria Mellonella L. U.S. 376–381. Department of Agriculture Technical Bulletin 1510, Simmons, L.W. & Zuk, M. 1992. Variability in call structure Washington, DC. and pairing success of male field crickets, Gryllus bimaculatus: Metcalfe, N.B. & Monaghan, P. 2001. Compensation for a bad the effects of age, size and parasite load. Anim. Behav. 44: start: grow now, pay later?. Trends Ecol. Evol. 16: 254–260. 1145–1152. Metcalfe, N.B. & Monaghan, P. 2003. Growth versus lifespan: Smith, T.L. 1965. External morphology of the larva, pupa, and perspectives from evolutionary ecology. Exp. Gerontol. 38: adult of the wax moth, Galleria mellonella L. J. Kansas Ento- 935–940. mol. Soc. 38: 287–310. Mohamed, A.A., Ansari, M.J., Al-Ghamdi, A., Mohamed, M.O. & Stipanuk, M.H., Dominy, J.E. Jr, Lee, J.-I. & Coloso, R.M. Kaur, M. 2014. Effect of larval nutrition on the development 2006. Mammalian cysteine metabolism: new insights into and mortality of Galleria mellonella (Lepidoptera: Pyralidae). regulation of cysteine metabolism. J. Nutr. 136: 1652S– Rev. Colomb. Entomol. 40:49–54. 1659S. Nettle, D., Andrews, C. & Bateson, M. 2016. Food insecurity as Stoks, R., De Block, M. & McPeek, M.A. 2006. Physiological a driver of obesity in humans: the insurance hypothesis. costs of compensatory growth in a damselfly. Ecology 87: Behav. Brain Sci. 28:1–34. 1566–1574. Nylin, S. & Gotthard, K. 1998. Plasticity in life-history traits. Teder, T., Vellau, H. & Tammaru, T. 2014. Age and size at Annu. Rev. Entomol. 43:63–83. maturity: a quantitative review of diet-induced reaction Orizaola, G., Dahl, E. & Laurila, A. 2014. Compensatory growth norms in insects. Evolution 68: 3217–3228. strategies are affected by the strength of environmental time Valtonen, T.M., Kleino, A., Ramet, M. & Rantala, M.J. 2010. constraints in anuran larvae. Oecologia 174: 131–137. Starvation reveals maintenance cost of humoral immunity. Paskewitz, S. & Riehle, M.A. 1994. Response of Plasmodium Evol. Biol. 37:49–57. refractory and susceptible strains of Anopheles gambiae to inoc- Warren, L.O. & Huddleston, P. 1962. Life history of the greater ulated Sephadex beads. Dev. Comp. Immunol. 18: 369–375. wax moth, Galleria mellonella, in Arkansas. J. Kansas Entomol. Pinheiro, J., Bates, D., DebRoy, S. & Sarkar, D., R Core Team. Soc. 35: 212–216. 2017. nlme: Linear and nonlinear mixed effects models. R Yourth, C.P., Forbes, M.R. & Smith, B.P. 2001. On understand- package version 3.1-131. https://CRAN.R-project.org/packa ing variation in immune expression of the damselflies Lestes ge=nlme spp. Can. J. Zool. 79: 815–821. Porrello, E.R., Bell, J.R., Schertzer, J.D., Curl, C.L., McMullen, Zuk, M. & McKean, K.A. 1996. Sex differences in parasite J.R., Mellor, K.M. et al. 2009. Heritable pathologic cardiac infections: patterns and processes. Int. J. Parasitol. 26: 1009– hypertrophy in adulthood is preceded by neonatal cardiac 1024. growth restriction. Am. J. Physiol. Regul. Integr. Comp. Physiol. Zuk, M. & Stoehr, A. 2002. Immune defense and host life his- 296: 672–680. tory. Am. Nat. 160:S9–S22. R Core Team. 2017. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria. https://www.R-project.org/. Received 25 March 2017; accepted 28 July 2017 Rantala, M.J. & Roff, D.A. 2005. An analysis of trade-off in immune function, body size and development time in the

ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY. J. EVOL. BIOL. 30 (2017) 1910–1918 JOURNAL OF EVOLUTIONARY BIOLOGY ª 2017 EUROPEAN SOCIETY FOR EVOLUTIONARY BIOLOGY DOI: 10.1111/eea.12629 Food quality affects the expression of antimicrobial peptide genes upon simulated parasite attack in the larvae of greater wax moth

Indrikis Krams1,2,3*, Sanita Kecko1, Inna Inashkina4, Giedrius Trakimas1,5, Ronalds Krams1, Didzis Elferts6,7, Jolanta Vrublevska1, Priit J~oers8,MarkusJ.Rantala9, Severi Luoto10,11, Jorge Contreras-Gardu~no12,Lıga Jankevica13, Laila Meija14 & Tatjana Krama1,15 1Department of Biotechnology, Institute of Life Sciences and Technology, Daugavpils University, Daugavpils, Latvia, 2Institute of Ecology and Earth Sciences, University of Tartu, Tartu, Estonia, 3Department of Zoology and Animal Ecology, Faculty of Biology, University of Latvia, Rıga, Latvia, 4Latvian Biomedical Research and Study Centre, Rıga, Latvia, 5Life Sciences Center, Vilnius University, Vilnius, Lithuania, 6Department of Botany and Ecology, Faculty of Biology, University of Latvia, Rıga, Latvia, 7Latvian State Forest Research Institute “Silava”, Salaspils, Latvia, 8Institute of Molecular and Cell Biology, University of Tartu, Tartu, Estonia, 9Department of Biology & Turku Brain and Mind Centre, University of Turku, Turku, Finland, 10English, Drama and Writing Studies, University of Auckland, Auckland, New Zealand, 11School of Psychology, University of Auckland, Auckland, New Zealand, 12Ecuela Nacional de Estudios Superiores Unidad Morelia, Universidad Nacional Autonoma de Mexico, Morelia, Mexico, 13Institute of Biology, University of Latvia, Salaspils, Latvia, 14Rıga Stradinßs University, Rıga, Latvia, and 15Department of Plant Protection, Institute of Agricultural and Environmental Sciences, Estonian University of Life Science, Tartu, Estonia Accepted: 5 October 2017

Key words: ecological immunology, innate immunity, Galleria mellonella, Lepidoptera, Pyralidae

Abstract Predator-prey interactions are an important evolutionary force affecting the immunity of the prey. Parasitoids and mites pierce the cuticle of their prey, which respond by activating their immune sys- tem against predatory attacks. Immunity is a costly function for the organism, as it often competes with other life-history traits for limited nutrients. We tested whether the expression of antimicrobial peptides (AMP) of the larvae of the greater wax moth Galleria mellonella (L.) (Lepidoptera: Pyrali- dae) changes as a consequence of insertion of a nylon monofilament, which acts like a synthetic para- site. The treatment was done for larvae grown on a high-quality vs. a low-quality diet. The expression of Gloverin and 6-tox were upregulated in response to the insertion of the nylon monofilament. The expression of 6-tox, Cecropin-D,andGallerimycin were significantly higher in the ‘low-quality diet’ group than in the ‘high-quality diet’ group. As food quality seems to affect AMP gene expression in G. mellonella larvae, it should always be controlled for in studies on bacterial and fungal infections in G. mellonella.

reproduction and development – to improve its lifetime Introduction fitness (Stearns, 1992; Dillon et al., 2013; Minkov & Bond, Immunity is the ability of the organism to protect itself 2015; Ellison, 2017). The resources available to satisfy against invasions of foreign bodies such as bacteria, competing functions of an individual are limited (Stearns, viruses, parasitoids, parasites, and toxic substances. The 1992). Susceptibility to disease is therefore higher under immune system keeps the body healthy and free from circumstances in which investment in immunity is com- infections, but each organism also has to allocate resources promised. On the other hand, an over-active immune to a variety of other life-history functions – such as system may cause considerable self-harm to an organism (Kraaijeveld & Godfray, 1997; Jensen et al., 2006; Sadd & Siva-Jothy, 2006; Spottiswoode, 2008; Schmid-Hempel, 2011). As immune function is energetically expensive (e.g., *Correspondence: Indrikis Krams, Institute of Ecology and Earth Sciences, University of Tartu, Tartu, Estonia. Lochmiller & Deerenberg, 2000; Muehlenbein & Bribi- E-mail: [email protected] escas, 2005; Ardia et al., 2012; Krams et al., 2012),

© 2017 The Netherlands Entomological Society Entomologia Experimentalis et Applicata 165: 129–137, 2017 129 130 Krams et al. nutritional quantity and quality are of particular impor- modulate pathogen load in the host’s body (Kaneko et al., tance in life-history trade-offs (Moret & Schmid-Hempel, 2007). Higher expressions of certain AMP genes were 2000; Morehouse et al., 2010; Ponton et al., 2013; Povey found to be associated with a ‘dark morph’ melanic strain et al., 2013; Adamo, 2016). of G. mellonella larvae, making melanic insects able to The innate immune response has physical and chemical mount an immediate immune response against invading barriers that exist as the first line of defense against infec- fungi (Dubovskiy et al., 2013a). We therefore expected tious pathogens (Schmid-Hempel, 2011). When ectopara- that AMP genes would be more expressed in the larvae sites attempt to pierce insect exoskeleton (Smith, 1988; with activated immunity that are grown on high-quality Robb & Forbes, 2005), the immune system reacts to the macronutrient-rich food than in larvae grown on simple challenge by attempting to encapsulate the feeding tubes food of low nutritional value. of mites in a coating of cellular materials and chemical deposits (e.g., Rantala et al., 2000; Robb & Forbes, 2005; Materials and methods Krams et al., 2011). Therefore, the strength of immunity is often accessed via an encapsulation response to the Insects, treatment groups, and food quality implantation of a nylon monofilament which acts as if the We studied a captive population of G. mellonella consist- insert were a real parasite piercing the host’s exoskeleton. ing of individuals collected from natural populations in The encapsulation response is one of the frontline defenses Estonia in summer 2014. The moths were reared in 2.4-l during pathogen invasion (de Melo et al., 2013). This plastic boxes at 28 Æ 1 °C in the dark in Sanyo MIR-253 response is correlated not only with encapsulation of para- incubators (Panasonic Healthcare, Osaka, Japan). To sites (Paskewitz & Riekle, 1994; Gorman et al., 1998), but study the effects of diet diversity on the expression of AMP also with other measures of immunity, such as the phe- genes of G. mellonella larvae, we assigned them to groups noloxidase cascade (Rantala et al., 2000, 2002, 2003) and differing in the macronutritional diversity/energetic value resistance to an entomopathogenic fungal disease (Rantala of the food. Each larva was kept individually in a plastic & Roff, 2007). During the encapsulation reaction, the container (50 ml) with a lid and wire-mesh to enable ven- organism acts via its cellular and humoral responses. tilation and to prevent individuals from escaping. Hemocytes phagocytose small foreign particles, or attach In this study, we had groups of G. mellonella larvae that themselves to large foreign objects (Gupta, 1986; Kanost, differed in food quality and activation of the immune sys- 2009; Krams et al., 2013). The foreign object may become tem via a nylon monofilament. All larvae received diverse completely encapsulated and isolated from other host tis- food ad libitum from hatching until day 14 post hatch sues as hemocytes attach to its surface and ultimately (Krams et al., 2013) (Figure 1). The larvae were subse- enclose it (Grimstone et al., 1967; Lavine & Strand, 2002). quently assigned to the following four groups: (1) ‘high- This cellular response is aided also by a humoral response, quality diet/immune treatment’ group, (2) ‘high-quality which consists of proteins such as antimicrobial peptides diet/control’ group, (3) ‘low-quality diet/immune treat- (AMP) that are able to interfere with a parasitic intruder ment’ group, and (4) ‘low-quality diet/control’ group and regulate coagulation and melanization of hemolymph (Figure 1). In the ‘high-quality diet/immune treatment’ (Lavine & Strand, 2002; Hancock et al., 2006; Schmid- group the larvae were grown on diverse high-quality food Hempel, 2011). provided ad libitum until day 30, when each larva was The encapsulation is linked to all immune signaling pathways of insects (Lemaitre & Hoffmann, 2007). More- over, its strength largely depends on the availability and the nutritional value of food (Krams et al., 2014,) which makes the strength of encapsulation response difficult to predict. In this study, we investigated the expression of various immunity-related AMP genes during the insertion of a nylon monofilament in the hemocoel of larvae of the greater wax moth, Galleria mellonella (L.) (Lepidoptera: Pyralidae), grown either on high-quality and diverse food or on low-quality food. AMPs belong to an early compo- nent of innate immune response toward bacterial and fun- gal infections. AMPs act as antibiotics that impose a lethal Figure 1 The experimental protocol used to study effects of diet effect against invading organisms (Zasloff, 2002; Brogden, diversity on the expression of antimicrobial peptides genes in 2005; Brown et al., 2009; Mylonakis et al., 2016) and greater wax moth larvae. Food quality and immunity of greater wax moth 131 subjected to a challenge to their immune system: a sterile both in the midgut and cuticle. Therefore, we studied the nylon monofilament implant (2 mm long, 0.18 mm expression of AMP genes from the whole body of the diameter, knotted at one end) was inserted through their G. mellonella larvae. cuticle between the third and fourth sternite (Krams et al., The larvae were chilled on ice for 15 min, surface-steri- 2014) for 10 h at 28 Æ 0.5 °C. After this treatment, the lized with 70% ethanol and their whole bodies were dis- implantswereremovedandthelarvaewereusedforgene rupted in liquid nitrogen. We pooled six individual larvae expression analysis. The larvae in the ‘high-quality diet/ for each treatment group. RNA was obtained from three control’ groups received high-quality food until day 30 replicates of each of the four groups (96 larvae in total). post hatch, when their bodies were used for gene expres- The larval bodies were further homogenized in 1 ml of sion analysis (Figure 1). The immune system of these lar- Trizol reagent (Sigma-Aldrich, St. Louis, MO, USA), and vae was not activated by the nylon implants. The ‘low- RNA was extracted according to the manufacturer’s rec- quality diet/ immune treatment’ group was grown on ad li- ommendations. RNA integrity was confirmed by ethidium bitum food of low quality from day 14 until day 30 post bromide gel staining, and quantities were determined hatch and they were implanted with the nylon monofila- spectrophotometrically. ment for 10 h. The ‘low-quality diet/control’ group Levels of steady-state transcripts were determined from received ad libitum food of low quality between days 14 cDNA samples by real-time quantitative PCR using DDCt and 30 post hatch and the immune system of these indi- protocol with the 7500 real-time PCR System (Applied viduals was not affected by nylon implants before their Biosystems, Foster City, CA, USA) and SYBR Green PCR bodies were studied for the expressions of AMP genes. mix (Qiagen, Venlo, The Netherlands), relative to two ref- The high-quality diet consisted of a homogenized mix erence genes, 18S rRNA (AF286298; forward primer: of equal proportions of honey, glycerol, bee-wax, dried CACATCCAAGGAAGGCAG, reverse primer: AGTG milk, wheat flour, dry yeast, and distilled water, and two TACTCATTCCGATTACGA) and translation elongation parts of maize meal. The food was not autoclaved. The factor 1-alpha (EF1; AF423811; forward primer: amount of energy contained in this food was estimated as AACCTCCTTACAGTGAATCC, reverse primer: ATGT À ca. 16.90 kJ g 1. The low-quality diet consisted of natural TATCTCCGTGCCAG) (Vogel et al., 2011). Six target bee-wax with a 5% admixture of maize meal. Bee-wax is a genes were investigated, coding for AMPs: Gloverin (strong natural polymer produced by bees; it is considered to have activity against Gram-positive bacteria and weak activity À a low nutritional value (3.03 kJ g 1) and it is hard to pro- against Gram-negative bacteria) (forward primer: cess in the gut. However, we have observed the ability of AGATGCACGGTCCTACAG, reverse primer: GATCG some wild progenitors of our study population to repro- TAGGTGCCTTGTG), Gallerimycin (strong effect against duce solely on bee-wax (Krams et al., 2014). What is more, filamentous fungi) (forward primer: GAAGTCTACA larvae of G. mellonella have been recently found to con- GAATCACACGA, reverse primer: ATCGAAGACATT sume polymer polyethylene, producing ethylene glycol GACATCCA) (Schuhmann et al., 2003), 6-tox (an atypical (Bombelli et al., 2017). Thus, the larvae of the low-quality defensin-derived immune-related peptide expressed in food group received slightly better food than pure wax. midgut against invading bacteria) (forward primer: The environment containing high-quality food such as GACGAACTGCGAAGAATTATC, reverse primer: used in this study matches the situation that the G. mel- TGTCTGTCTTGAGTTGCATATTG) (Lee et al., 2010), lonella larvae enjoy during their initial stages of invasion Galiomicin (strong antifungal effect and limited effect into the beehive when the honeycomb contains bee larvae, against bacteria) (forward primer: GTGCGAC honey, and pollen (Barjac & Thomson, 1970). The low- GAATTACACCTC, reverse primer: TACTCGCACCAA quality food environment of this study matches those situ- CAATTGAC), Cecropin D (strong activity against Gram- ations in which previous generations of greater wax moths negative bacteria and fungi, weak activity against Gram- have left their larvae with honeycomb cells that contain no positive bacteria) (forward primer: CTGCGCCA bee larvae, honey, or pollen. TGTTCTTCA, reverse primer: TCGCATCTCTGATC CTCTG), and Toll-like receptor 18-Wheeler (necessary for RNA extraction and quantitative real-time PCR activation of all AMP genes in Drosophila larvae (Ligoxy- The highest concentrations of AMPs are found in tissues gakis et al., 2002), not affected by bacterial or fungal infec- exposed to microorganisms or cell types that are involved tions in G. mellonella larvae (Dubovskiy et al., 2013b) in host defense such as epithelia and glandular structures (forward primer: CGCTCTAGAATCGCATCGGCAA (Ouellette & Selsted, 1996; Ganz, 2003). As experimental CATCACC, reverse primer: CGCGAATTCCGGAGA treatments done in this study involved manipulations with GATTCAGCCACAGCA). The primers were obtained food and cuticular defense, these may affect AMP secretion from Metabion International (Planegg, Germany). 132 Krams et al.

Statistical analysis quality diet/immune challenge’ and the ‘high-quality diet/ The data from three independent experimental trials were immune challenge’ groups, nor between the ‘low-quality pooled after confirming that ‘trial’ as a factor had no sig- diet/control’ and the ‘low-quality diet/immune challenge’ nificant effect on data variation (two-way ANOVA) groups (all P>0.05; Figure 2). (Dubovskiy et al., 2013b). Individual gene comparisons The expression of Gloverin AMP gene was higher in the were made with Kruskal-Wallis one-way ANOVA, fol- ‘low-quality diet/immune challenge’ group than in the lowed by Tukey’s honestly significant difference (HSD) ‘low-quality diet/control’ group (Tukey HSD test: post-hoc tests if the ANOVA indicated significant P<0.001). The expression of Gloverin in the ‘low-quality variation. diet/immune challenge’ group was higher than in the ‘high-quality diet/control’ and the ‘high-quality diet/im- < Results mune challenge’ groups (both P 0.001). The Gloverin gene expression did not differ between the ‘high-quality diet/ The results indicate a significant variation between the immune challenge’ group and the ‘low-quality diet/con- four diet/ immunity treatment groups of the larvae in the trol group’ and the ‘high-quality diet/control’ groups expression of Gallerimycin (Kruskal-Wallis v²=9.974, (both P>0.05) (Figure 2). P = 0.019), Gloverin (v²=9.462, P = 0.024), Cecropin-D The Cecropin-D AMP gene was upregulated in the (v²=9.974, P = 0.019), and 6-tox (v²=10.385, ‘high-quality diet/control’ group compared to the ‘low- P = 0.016), whereas the expression of Galiomicin quality diet/control’ group (Tukey HSD test: (v²=6.846, P = 0.077) and the Toll-like receptor 18- P = 0.001). The expression of Cecropin-D was higher in Wheeler (v²=3.00, P = 0.39; all d.f. = 3) did not differ the ‘high-quality diet/control’ group than in the ‘high- between the groups. quality diet/immune challenge’ (P = 0.019) and the Post-hoc tests revealed that the Gallerimycin AMP gene ‘low-quality diet/immune challenge’ groups (P = 0.008). was expressed at a significantly higher level in the ‘high- The expression in the ‘low-quality diet/control’ group quality diet/control’ group than in the ‘low-quality diet/ was not different from the Cecropin-D gene expression control’ group (Tukey HSD test: P = 0.002). Gallerimycin in the ‘high-quality diet/immune challenge’ group expressions were higher in the ‘high-quality diet/control’ (P>0.05) (Figure 2). group than in the ‘high-quality diet/ immune challenge’ The expression of 6-tox AMP gene was the highest in group (Tukey HSD test: P = 0.005) and in the ‘low-quality the ‘high-quality diet/immune challenge’ group and it was diet/immune challenge’ group (Tukey HSD test: higher than the 6-tox AMP gene expressions in the ‘high- P = 0.003). However, we did not find any differences quality diet/control’ group (Tukey HSD test: P = 0.032) between the ‘low-quality diet/control’ and the ‘high-qual- and in the ‘low-quality diet/control’ group (P<0.001). ity diet/immune challenge’ groups, nor between the ‘low- However, the expression of 6-tox gene in the ‘high-quality

Figure 2 Mean (+ SEM) fold mRNA expression level of (A) Gallerimycin,(B)Gloverin,(C)Cecropin-D,and(D)6-tox genes in whole- body samples of greater wax moth larvae grown on high-quality or low-quality diets that did/did not receive a nylon implant. Means within a panel capped with the same letter are not significantly different (Tukey HSD tests: P>0.05). Food quality and immunity of greater wax moth 133 diet/immune challenge’ group did not differ from its In Drosophila melanogaster Meigen, 18-Wheeler has expression in the ‘low-quality diet/immune challenge’ been proposed to be directed against Gram-negative and group (P>0.05) (Figure 2). Gram-positive bacteria (Ligoxygakis et al., 2002), whereas in G. mellonella it was found to be facultative for immune responses (Dubovskiy et al., 2013b). Our results reveal Discussion that 18-Wheeler is not involved in recognition of such a Evidence shows that G. mellonella larvae increase foreign body as the nylon monofilament. Besides Galler- expression of Gallerimycin, Gloverin, Galiomicin,and imycin (Langen et al., 2006), Galiomicin is a defensin-like Cecropin-D genes when infected by filamentous fungi antifungal peptide (Lee et al., 2004) which is not used by (Wojda et al., 2009; Mak et al., 2010; Xu et al., 2012; G. mellonella larvae in their responses against the nylon Dubovskiy et al., 2013a). Some studies suggest that the inserts. Although the encapsulation response begins as potency of AMP depends on the fungal species and the soon as the cuticle of an insect is pierced, the response may strain (Zhang & Zhu, 2009; Fullaondo et al., 2011). last for hours (Dubovskii et al., 2010) or days (Schmit & Thus, the broad-spectrum AMP genes may be activated Ratcliffe, 1977; Eggenberger et al., 1990; Krams et al., by a wide range of factors (Schuhmann et al., 2003; 2013). Hence, it would be important to study the kinetics Mak et al., 2010). For example, Dubovskiy et al. of AMP gene expression because elevated expressions of (2013a,b) observed an enormous variation in expression Gallerimycin, Cecropin-D,andGloverin were highly upreg- of immunity-related AMP genes against fungal infec- ulated by 48 h after fungal infection; in contrast, by 24 h tions and explained this as a simultaneous action of dif- after infection, expression of these AMPs was found to be ferent kinds of stressors that work in concert with either slightly upregulated or not affected at all (Dubovskiy factors linked to melanism, stress adaptation, detoxifica- et al., 2013b), a finding replicated in this study. tion, and inflammation. Our results support the previ- Food diversity did not affect the expression of 18-Wee- ous findings, showing that AMP gene expressions are ler, Galiomicin,andGloverin, whereas the expression of 6- highly variable also during implantation of the nylon tox, Cecropin-D,andGallerimycin significantly increased monofilament mimicking the parasite/parasitoid attack. from the ‘low-quality diet/control’ group to the ‘high- The immune responses against nylon monofilament quality diet/control’ group. The composition of gut insertion and fungal infections may be similar because microbiomes is known to be structured through diet both the insert and fungi penetrate the insect cuticle in (Muegge et al., 2011) and the increase in the diversity of a similar way. However, our results show that there are nutrients positively affects symbiont numbers and micro- considerable differences between the effects caused by biota diversity (David et al., 2014; Carmody et al., 2015; fungal infections and insertion of the nylon monofila- Sonnenburg et al., 2016). It is known that the microbiome ment. We also suggest that the quality/diversity of larval is of high importance in maintaining homeostasis of the diet may cause a considerable source of variation in the host’s body (Russell & Dunn, 1996; Chatelier et al., 2013). expression of AMP genes (see also Adamo et al., 2016) A recent study showed that host and symbiont communi- and that food-borne effects interfere with the effects ties cooperatively interact to maintain the midgut micro- caused by insertion of the nylon monofilament. biota in a symbiotic balance (Johnston & Rolff, 2015), Gloverin and 6-tox were the AMPs that became suggesting that the host needs more control over sym- increasingly expressed because of the nylon monofila- bionts by means of AMP proteins. Symbionts may become ment. However, the upregulation of Gloverin and 6-tox pathogenic if they grow and reproduce uncontrollably, was seen only in the ‘low-quality food/immune treat- diverting resources away from growth and other needs of ment’ group. Cecropin-D and Gallerimycin expressions the host if not controlled by the host’s immune system were downregulated upon implantation of the nylon (Erdogan & Rao, 2015; Fujimori, 2015). Importantly, the monofilament. This was seen only in the ‘high-quality food of G. mellonella was not sterilized in this study, which diet/immune treatment’ group, suggesting that the more makes it possible that resident microbes in the gut may be diverse high-quality diet may fuel some other parts of flushed away by a downstream flow of ingested content the immune defense rather than activate the production (Nyholm & McFall-Ngai, 2004; Blum et al., 2013) and of Cecropin-D and Gallerimycin. This might be sup- replaced by opportunistic or pathogenic bacteria (Jones ported by a non-significant upregulation of Cecropin-D et al., 2013; Cariveau et al., 2014). This could also be a rea- gene expression in the ‘low-quality diet/immune treat- son behind the increased expressions of 6-tox, Cecropin-D, ment’ group. We did not find any significant changes in and Gallerimycin. One more possibility is that a high-qual- expressions of 18-Wheeler, 6-tox,andGaliomicin follow- ity diet results in a higher probability of opportunistic ing the implantation procedure. infections entering the midgut of the larvae, whereas the 134 Krams et al. upregulation of AMP gene expression may indicate a pro- analyze the specific actions and roles of each nutrient sepa- phylactic response by the host (Barnes & Siva-Jothy, 2000; rately. Krams et al., 2016). In conclusion, the knowledge about antibacterial and Acknowledgements antifungal properties of AMPs was not helpful in predict- ing their expression in response to the insertion of a nylon The study was supported by the Latvian Council of monofilament – a ‘synthetic parasite’. This may be partly Science (grant 290/2012) and a personal grant explained by the elevated expression of certain immunity- (PUT1223) and institutional grant (IUT36-2) from the related AMP in response to a more diverse diet. Our results Estonian Research Council. suggest that not only food quantity (Adamo et al., 2016) but also food quality affects immune responses of G. mel- References lonella larvae. In future research, it would be necessary to Adamo SA (2016) The stress response and immune system share, test whether the heightened expression of some AMPs rep- borrow, and reconfigure their physiological network elements: resents a surveillance system that recognizes and attacks evidence from the insects. Hormones and Behavior 88: 25–30. the intruders entering the host’s body with more diverse Adamo SA, Davies G, Easy R, Kovalko I & Turnbull KF (2016) food, or whether this is a response to pathogens that have Reconfiguration of the immune system network during food already breached the host’s defense system. In this study, limitation in the caterpillar Manduca sexta. Journal of Experi- however, we did not observe any increased mortality of the mental Biology 219: 706–718. larvae associated with food of higher quality. Galleria mel- Ardia DR, Gantz JE, Schneider BC & Strebel S (2012) Costs of lonella is often used as a model host to study interactions immunity in insects: an induced immune response increases between human pathogens and microbiota (e.g., Glavis- metabolic rate and decreases antimicrobial activity. Functional – Bloom et al., 2012; Mukherjee et al., 2013), and future Ecology 26: 732 739. research could combine different types of food and bacte- Barjac H & Thomson JV (1970) A new serotype of Bacillus thuringiensis: Bacillus thuringiensis var. thompsoni (serotype rial/fungal infections to see possible effects of food on 11). Journal of Invertebrate Pathology 15: 141–144. pathogen virulence, the variation in the host’s immune Barnes AI & Siva-Jothy MT (2000) Density-dependent prophy- responses, and tolerance against infections. Manipulation laxis in the mealworm beetle Tenebrio molitor L. (Coleoptera: of specific nutrients provides better control for isolating Tenebrionidae): cuticular melanization is an indicator of the dietary causes of immunological responses (Ponton investment in immunity. Proceedings of the Royal Society B et al., 2011, 2013; Povey et al., 2013). This is especially 267: 177–182. important in G. mellonella because the larval food in this Blum JE, Fischer CN, Miles J & Handelsman J (2013) Frequent species consists of bee-wax and honey, both possessing replenishment sustains the beneficial microbiome of Droso- substantial antibacterial properties (Fratini et al., 2016). phila melanogaster. mBio 4: e00860–13. Most likely, the antibacterial properties of food explain the Bombelli P, Howe CJ & Bertocchini F (2017) Polyethylene bio- dominance of Enterococcus mundtii (syn. Streptococcus fae- degradation by caterpillars of the wax moth Galleria mellonella. Current Biology 27: R292–R293. calis Andrewes and Horder) in the midgut of G. mellonella Brogden KA (2005) Antimicrobial peptides: pore formers or (Jarosz, 1979; Johnston & Rolff, 2015). This microbe is a metabolic inhibitors in bacteria? Nature Reviews Microbiology heritable nutrient-providing symbiont of G. mellonella 3: 238–250. (Bucher, 1963; Johnston & Rolff, 2015) that is transmitted Brown SE, Howard A, Kasprzak A & East PD (2009) A pep- vertically, from mother to offspring (Chen et al., 2016). It tidomics study reveals the impressive antimicrobial peptide is probably among those rare microorganisms that can arsenal of the wax moth Galleria mellonella. Insect Biochem- survive under the antibacterial properties of the G. mel- istry and Molecular Biology 39: 792–800. lonella diet. Bucher GE (1963) Survival of populations of Streptococcus faecalis Finally, we would like to suggest an approach based on a Andrewes and Horder in the gut of Galleria mellonella (Lin- combination of diet-level studies, such as the present one naeus) during metamorphosis, and transmission of the bacte- and nutrient-level experiments done earlier (Ponton et al., ria to the filial generation of the host. Journal of Insect Pathology 5: 336–343. 2011, 2013; Povey et al., 2013). Food manipulation experi- Cariveau DP, Powell JE, Koch H, Winfree R & Moran NA (2014) ments such as those performed in this study are effective Variation in gut microbial communities and its association for establishing the overall impacts of different types of with pathogen infection in wild bumble bees (Bombus). ISME food resources and to find specific pointers of which nutri- Journal 8: 2369–2379. ents are likely to be involved in organismal growth and Carmody RN, Gerber GK, Luevano JM, Gatti DM, Somes L et al. which to manipulate in nutrient-level experiments. The (2015) Diet dominates host genotype in shaping the murine nutrient-level analysis would be the next important step to gut microbiota. Cell Host & Microbe 17: 72–84. Food quality and immunity of greater wax moth 135

Chatelier EL, Nielsen T, Qin J, Prifti E, Hildebrand F et al. (2013) Grimstone AV, Rotheram S & Salt G (1967) An electron-micro- Richness of human gut microbiome correlates with metabolic scope study of capsule formation by insect blood cells. Journal markers. Nature 500: 541–546. of Cell Science 2: 281–292. Chen B, The B-S, Sun C, Hu S, Lu X et al. (2016) Biodiversity Gupta AP (1986) Arthropod immunocytes: identification, struc- and activity of the gut microbiota across the life history of the ture, functions and analogies to the functions of vertebrate B- insect herbivore Spodoptera littoralis. Scientific Reports 6: and T-lymphocytes. Hemocytic and Humoral Immunity in 29505. Arthropods (ed. by AP Gupta), pp. 3–59. John Wiley, New David LA, Maurice CF, Carmody RN, Gootenberg DB, Button JE York, NY, USA. et al. (2014) Diet rapidly and reproducibly alters the humans Hancock REW, Brown KL & Mookherjee N (2006) Host defence gut microbiome. Nature 505: 559–563. peptides from invertebrates: emerging antimicrobial strategies. Dillon HM, Adair LE, Wang Z & Johnson Z (2013) Slow and Immunobiology 211: 315–322. steady wins the race: life history, mate value, and mate settling. Jarosz J (1979) Gut flora of Galleria mellonella suppressing Personality and Individual Differences 55: 612–618. ingested bacteria. Journal of Invertebrate Pathology 34: 192– Dubovskii IM, Grizanova EV, Chertkova EA, Slepneva IA, 198. Komarov DA et al. (2010) Generation of reactive oxygen spe- Jensen KN, Little TJ, Skorping A & Ebert D (2006) Empirical sup- cies and activity of antioxidants in hemolymph of the moth lar- port for an optimal virulence in a castrating parasite. PLoS vae Galleria mellonella (L.) (Lepidoptera: Piralidae) at Biology 4: e197. development of the process of encapsulation. Journal of Evolu- Johnston PR & Rolff J (2015) Host and symbiont jointly control tionary Biochemistry and Physiology 46: 35–43. gut microbiota during complete metamorphosis. PLoS Patho- Dubovskiy IM, Whitten MMA, Yaroslavtseva ON, Greig C, Kryu- gens 11: e1005246. kov VY et al. (2013a) Can insects develop resistance to insect Jones RT, Vetter SM, Montenieiri J, Holmes J, Bernhardt SA & pathogenic fungi? PLoS ONE 8: e60248. Gage KL (2013) Yersinia pestis infection and laboratory condi- Dubovskiy IM, Whitten MMA, Kryukov VY, Yaroslavtseva ON, tions alter flea-associated bacterial communities. ISME Journal Grizanova EV et al. (2013b) More than a colour change: insect 7: 224–228. melanism, disease resistance and fecundity. Proceedings of the Kaneko Y, Thoendel M, Olakanmi O, Britigan BE & Singh PK Royal Society B 280: 20130584. (2007) The transition metal gallium disrupts Pseudomonas Eggenberger LR, Lamoreaux WJ & Coons LB (1990) Hemocytic aeruginosa iron metabolism and has antimicrobial and antibio- encapsulation of implants in the tick Dermacentor variabilis. film activity. Journal of Clinical Investigation 117: 877–888. Experimental and Applied Acarology 9: 279–287. Kanost MR (2009) Hemolymph. Encyclopedia of Insects (ed. by Ellison PT (2017) Endocrinology, energetics, and human life his- VH Resh & RT Carde), pp. 446–448. Elsevier, Burlington, MA, tory: a synthetic model. Hormones and Behavior 91: 97–106. USA. Erdogan A & Rao SS (2015) Small intestinal fungal overgrowth. Kraaijeveld AR & Godfray HCJ (1997) Trade-off between para- Current Gastroenterology Reports 17: 16. sitoid resistance and larval competitive ability in Drosophila Fratini F, Cilia G, Turchi B & Felicioli A (2016) Beeswax: a melanogaster. Nature 389: 278–280. minireview of its antimicrobial activity and its application in Krams I, Daukste J, Kivleniece I, Krama T, Rantala MJ et al. medicine. Asian Pacific Journal of Tropical Medicine 9: 839– (2011) Female choice reveals terminal investment in male 843. mealworm beetles, Tenebrio molitor, after a repeated activation Fujimori S (2015) What are the effects of proton pump inhibitors of immune system. Journal of Insect Science 11: 56. on the small intestine? World Journal of Gastroenterology 21: Krams I, Vrublevska J, Cirule D, Kivleniece I, Krama T et al. 6817–6819. (2012) Heterophil/lymphocyte ratios predict the magnitude of Fullaondo A, Garcıa-Sanchez S, Sanz-Parra A, Recio E, Lee SY & humoral immune response to a novel antigen in great tits Gubb D (2011) Spn1 regulates the GNBP3-dependent toll sig- (Parus major). Comparative Biochemistry and Physiology Part naling pathway in Drosophila melanogaster. Molecular and Cel- A161:422–428. lular Biology 31: 2960–2972. Krams I, Daukste J, Kivleniece I, Kaasik A, Krama T et al. (2013) Ganz T (2003) The role of antimicrobial peptides in innate Trade-off between cellular immunity and life span in meal- immunity. Integrative and Comparative Biology 43: 300–304. worm beetles Tenebrio molitor. Current Zoology 59: 340–346. Glavis-Bloom J, Muhammed M & Mylonakis E (2012) Of model Krams I, Kecko S, Kangassalo K, Moore KF, Jankevics E et al. hosts and man: using Caenorhabditis elegans, Drosophila mela- (2014) Effects of food quality on trade-offs among growth, nogaster and Galleria mellonella as model hosts for infectious immunity and survival in the greater wax moth (Galleria mel- disease research. Advances in Experimental Medicine and Bio- lonella). Insect Science 22: 431–439. logy 710: 11–17. Krams I, Burghardt GM, Krams R, Trakimas G, Kaasik A et al. Gorman MJ, Schwartz AM & Paskewitz SM (1998) The role of (2016) A dark cuticle allows higher investment in immunity, surface characteristics in eliciting humoral encapsulation of longevity and fecundity in a beetle upon a simulated parasite foreign bodies in Plasmodium-refractory and -susceptible attack. Oecologia 182: 99–109. strains of Anopheles gambiae. Journal of Insect Physiology 44: Langen G, Imani J, Altincicek B, Kieseritzky G, Kogel KH & Vil- 947–954. cinskas A (2006) Transgenic expression of gallerimycin, a novel 136 Krams et al.

antifungal insect defensin from the greater wax moth Galleria Nyholm SV & McFall-Ngai M (2004) The winnowing: establish- mellonella, confers resistance to pathogenic fungi in tobacco. ing the squid–Vibrio symbiosis. Nature Reviews Microbiology Biological Chemistry 387: 549–557. 2: 632–642. Lavine MD & Strand MR (2002) Insect hemocytes and their role Ouellette AJ & Selsted ME (1996) Paneth cell defensins: endoge- in immunity. Insect Biochemistry and Molecular Biology 32: nous peptide components of intestinal host defense. FASEB 1295–1309. Journal 10: 1280–1289. Lee YS, Yun EK, Jang WS, Kim I, Lee JH et al. (2004) Purifica- Paskewitz S & Riekle MA (1994) Response of Plasmodium refrac- tion, cDNA cloning and expression of an insect defensin from tory and susceptible strains of Anopheles gambiae to inoculated the great wax moth, Galleria mellonella.InsectMolecularBio- sephadex beads. Developmental and Comparative Immuno- logy 13: 65–72. logy 18: 369–375. Lee JH, Park S, Chae K-S & Lee IH (2010) Galleria mellonella 6- Ponton F, Wilson K, Cotter SC, Raubenheimer D & Simpson SJ Tox gene, putative immune related molecule in Lepidoptera. (2011) Nutritional immunology: a multi-dimensional International Journal of Industrial Entomology 21: 127–132. approach. PLoS pathogens 7: e1002223. Lemaitre B & Hoffmann J (2007) The host defense of Drosophila Ponton F, Wilson K, Holmes AJ, Cotter SC, Raubenheimer D & melanogaster. Annual Review of Immunology 25: 697–743. Simpson SJ (2013) Integrating nutrition and immunology: a Ligoxygakis P, Bulet P & Reichhart J-M (2002) Critical evaluation new frontier. Journal of Insect Physiology 59: 130–137. of the role of the Toll-like receptor 18-Wheeler in the host Povey S, Cotter SC, Simpson SJ & Wilson K (2013) Dynamics of defense of Drosophila. EMBO Reports 5: 666–673. macronutrient self-medication and illness-induced anorexia in Lochmiller RL & Deerenberg C (2000) Trade-offs in evolutionary virally infected insects. Journal of Animal Ecology 83: 245–255. immunology: just what is the cost of immunity? Oikos 88: 87– Rantala MJ & Roff DA (2007) Inbreeding and extreme outbreed- 98. ing cause sex differences in immune defence and life history Mak P, Zdybicka-Barabas A & Cytrynska M (2010) A different traits in Epirrita autumnata. Heredity 98: 329–336. repertoire of Galleria mellonella antimicrobial peptides in lar- Rantala MJ, Koskimaki J, Taskinen J, Tynkkynen K & Suhonen J vae challenged with bacteria and fungi. Developmental and (2000) Immunocompetence, developmental stability and Comparative Immunology 34: 1129–1136. wingspot size in the damselfly Calopteryx splendens L. Proceed- de Melo NR, Abdrahman A, Greig C, Mukherjee K, Thornton C ings of the Royal Society B 267: 2453–2457. et al. (2013) Myriocin significantly increases the mortality of a Rantala MJ, Jokinen I, Kortet R, Vainikka A & Suhonen J (2002) non-mammalian model host during Candida pathogenesis. Do pheromones reveal male immunocompetence? Proceed- PLoS ONE 8: e78905. ings of the Royal Society B 269: 1681–1685. Minkov M & Bond MH (2015) Genetic polymorphisms Rantala MJ, Kortet R, Kotiaho JS, Vainikka A & Suhonen J predict national differences in life history strategy and time (2003) Condition dependence of pheromones and immune orientation. Personality and Individual Differences 76: 204– function in the grain beetle Tenebrio molitor. Functional Eco- 215. logy 17: 534–540. Morehouse NI, Nakazawa T, Booher CM, Jeyasingh PD & Hall Robb T & Forbes MR (2005) Success of ectoparasites: how MD (2010) Sex in a material world: why the study of sexual important is timing of host contact? Biology Letters 1: 118– reproduction and sex-specific traits should become more 120. nutritionally-explicit. Oikos 119: 766–778. Russell V & Dunn PE (1996) Antibacterial proteins in the midgut Moret Y & Schmid-Hempel P (2000) Survival for immunity: the of Manduca sexta during metamorphosis. Journal of Insect price of immune system activation for bumblebee workers. Physiology 42: 65–71. Science 290: 1166–1168. Sadd BM & Siva-Jothy MT (2006) Self-harm caused by an insect’s Muegge BD, Kuczynski J, Knights D, Clemente JC, Gonzalez A innate immunity. Proceedings of the Royal Society B 273: et al. (2011) Diet drives convergence in gut microbiome func- 2571–2574. tions across mammalian phylogeny and within humans. Schmid-Hempel P (2011) Evolutionary Parasitology: The Inte- Science 332: 970–974. grated Study of Infections, Immunology, Ecology, and Genet- Muehlenbein MP & Bribiescas RG (2005) Testosterone-mediated ics. Oxford University Press, Oxford, UK. immune functions and male life histories. American Journal of Schmit AR & Ratcliffe NA (1977) The encapsulation of foreign Human Biology 17: 527–558. tissue implants in Galleria mellonella larvae. Journal of Insect Mukherjee K, Hain T, Fischer R, Chakraborty T & Vilcinskas A Physiology 23: 175–184. (2013) Brain infection and activation of neuronal repair mech- Schuhmann B, Seitz V, Vilcinskas A & Podsiadlowski L (2003) anisms by the human pathogen Listeria monocytogenes in the Cloning and expression of gallerimycin, an antifungal peptide lepidopteran model host Galleria mellonella. Virulence 4: 324– expressed in immune response of greater wax moth larvae, 332. Galleria mellonella. Archives of Insect Biochemistry and Physi- Mylonakis E, Podsiadlowski L, Muhammed M & Vilcinskas A ology 53: 125–133. (2016) Diversity, evolution and medical applications of insect Smith BP (1988) Host–parasite interaction and impact of larval antimicrobial peptides. Philosophical Transactions of the water mites on insects. Annual Review of Entomology 33: 487– Royal Society B 371: 20150290. 507. Food quality and immunity of greater wax moth 137

Sonnenburg ED, Smits SA, Tikhonov M, Higginbottom SK, Win- Wojda I, Kowalski P & Jakubowicz T (2009) Humoral immune green NS & Sonnenburg JL (2016) Diet-induced extinctions in response of Galleria mellonella larvae after infection by Beauve- the gut microbiota compound over generations. Nature 529: ria bassiana under optimal and heat-shock conditions. Journal 212–215. of Insect Physiology 55: 525–531. Spottiswoode CN (2008) Cooperative breeding and immunity: a Xu X-X, Zhong X, Yi H-Y & Yu X-Q (2012) Manduca sexta glo- comparative study of PHA response in African birds. Behav- verin binds microbial components and is active against bacte- ioral Ecology and Sociobiology 62: 963–974. ria and fungi. Developmental and Comparative Immunology Stearns SC (1992) The Evolution of Life Histories. Oxford 38: 275–284. University Press, Oxford, UK. Zasloff M (2002) Antimicrobial peptides of multicellular organ- Vogel H, Altincicek B, Glockner G & Vilcinskas A (2011) A com- isms. Nature 415: 389–395. prehensive transcriptome and immune-gene repertoire of the Zhang ZT & Zhu SY (2009) Drosomycin, an essential component lepidopteran model host Galleria mellonella. BMC Genomics of antifungal defence in Drosophila. Insect Molecular Biology 12: 308. 18: 549–556. © 2017. Published by The Company of Biologists Ltd | Journal of Experimental Biology (2017) 220, 4204-4212 doi:10.1242/jeb.169227

RESEARCH ARTICLE Microbiome symbionts and diet diversity incur costs on the immune system of insect larvae Indrikis A. Krams1,2,3,*, Sanita Kecko4, Priit Jõers5, Giedrius Trakimas4,6, Didzis Elferts7, Ronalds Krams4, Severi Luoto8,9, Markus J. Rantala10, Inna Inashkina11, Dita Gudrā11,Dāvids Fridmanis11, Jorge Contreras-Garduño12, Lelde Grantiņa-Ieviņa13 and Tatjana Krama4,14

ABSTRACT INTRODUCTION Communities of symbiotic microorganisms that colonize the Pathogens are a constant threat to organisms (Schmid-Hempel, 2011), gastrointestinal tract play an important role in food digestion and and so they need a surveillance system that recognizes and attacks the protection against opportunistic microbes. Diet diversity increases the intruders. These may consist of viral, bacterial, fungal and parasitic ’ number of symbionts in the intestines, a benefit that is considered to infections or even the body s own non-cooperative cells, such as impose no cost for the host organism. However, less is known about the cancer. The innate immunity system is important because it starts ’ possible immunological investments that hosts have to make in order to acting immediately after a pathogen breaches the host sdefense control the infections caused by symbiont populations that increase system (Janeway et al., 2005). The responses of the innate immunity because of diet diversity. Using taxonomical composition analysis of system are more general than the more pathogen-specific responses of the 16S rRNA V3 region, we show that enterococci are the dominating the adaptive immune system. The production of antimicrobial group of bacteria in the midgut of the larvae of the greater wax moth peptides (AMPs) is an early component of an innate immune (Galleria mellonella). We found that the number of colony-forming units response towards bacterial and fungal infections. AMPs are a group of enterococci and expressions of certain immunity-related of antibiotics that impose a lethal effect against invading organisms antimicrobial peptide (AMP) genes such as Gallerimycin, Gloverin, 6- by interfering with their basal biochemical functions (Zasloff, 2002; tox, Cecropin-D and Galiomicin increased in response to a more Brogden, 2005). Various AMPs modulate pathogen load and prevent diverse diet, which in turn decreased the encapsulation response of the the occurrence of an infection (Kaneko et al., 2007). larvae. Treatment with antibiotics significantly lowered the expression of Immune function is expensive in terms of energy expenditure all AMP genes. Diet and antibiotic treatment interaction did not affect (e.g. Lochmiller and Deerenberg, 2000; Ardia et al., 2012), the expression of Gloverin and Galiomicin AMP genes, but significantly immunopathology (e.g. Råberg et al., 1998) and depletion of influenced the expression of Gallerimycin, 6-tox and Cecropin-D. Taken somatic resources (Adamo et al., 2008; Krams et al., 2012). This together, our results suggest that diet diversity influences microbiome suggests that there are trade-offs in the allocation of resources diversity and AMP gene expression, ultimately affecting an organism’s between immune function and other components of fitness (e.g. capacity to mount an immune response. Elevated basal levels of Sheldon and Verhulst, 1996; González-Santoyo and Córdoba- immunity-related genes (Gloverin and Galiomicin)mightactasa Aguilar, 2012). Access to food and the nutritional quality of food prophylactic against opportunistic infections and as a mechanism that are of particular importance in trade-offs between life history traits controls the gut symbionts. This would indicate that a diverse diet and nutrients. For example, the nutritional state of the host and the imposes higher immunity costs on organisms. nutritional quality of its diet may have a profound effect on life history trade-offs and the ability to resist an infection (Alonso- KEY WORDS: Antimicrobial peptides, Bacterial endosymbionts, Alvarez and Tella, 2001; Moret and Schmid-Hempel, 2000; Ponton Encapsulation response, Diet diversity, Galleria mellonella, Immunity et al., 2013; Povey et al., 2014). This suggests that food limitation and a low quality diet are likely to compromise the host’s immune response (Smits et al., 2017). However, different levels of food 1Institute of Ecology and Earth Sciences, University of Tartu, 51014 Tartu, Estonia. 2Department of Zoology and Animal Ecology, Faculty of Biology, University of limitation may produce different immune response patterns (e.g. Latvia, 1004 Rı̄ga, Latvia. 3University of Tennessee, Department of Psychology, Krams et al., 2014). For example, brief food deprivation may lead to Knoxville, TN 37996, USA. 4Department of Biotechnology, Institute of Life Sciences an increase in the expression of AMP genes in the fruit fly and Technology, Daugavpils University, 5401 Daugavpils, Latvia. 5Institute of Molecular and Cell Biology, University of Tartu, 51014 Tartu, Estonia. 6Institute of Drosophila melanogaster, even in the absence of pathogens Biosciences, Vilnius University, 10257 Vilnius, Lithuania. 7Department of Botany (Becker et al., 2010). This response is the opposite of what would and Ecology, Faculty of Biology, University of Latvia, 1004 Rı̄ga, Latvia. 8English, Drama and Writing Studies, University of Auckland, Auckland 1010, New Zealand. be predicted if the immune system gradually declined as resources 9School of Psychology, University of Auckland, Auckland 1010, New Zealand. dwindle. Moreover, recent research shows that intracellular immune 10Department of Biology & Turku Brain and Mind Centre, University of Turku, Turku signaling pathways are interconnected with nutrient signaling 20014, Finland. 11Latvian Biomedical Research and Study Centre, 1067 Riga, Latvia. 12Ecuela Nacional de Estudios Superiores Unidad Morelia, Universidad pathways (e.g. in invertebrates, Becker et al., 2010; Adamo et al., Nacional Autónoma de México, Morelia 58190, Mexico. 13Institute of Food Safety, 2016; in vertebrates, Odegaard and Chawla, 2013), providing an Animal Health and Environment BIOR, 1076 Rı̄ga, Latvia. 14Department of Plant evolutionary explanation for the complex effects of food Protection, Institute of Agricultural and Environmental Sciences, Estonian University of Life Science, 51014 Tartu, Estonia. deprivation on immunity. Epithelial cells of the gastrointestinal tract are covered with a *Author for correspondence ([email protected]) large population of normally nonpathogenic bacteria. A I.A.K., 0000-0001-7150-4108 fundamental part of digestion, these nonpathogenic bacteria are known as ‘the microbiota’. Associations between the host and its

Received 30 August 2017; Accepted 15 September 2017 microbiota are often mutualistic, which facilitates the establishment Journal of Experimental Biology

4204 RESEARCH ARTICLE Journal of Experimental Biology (2017) 220, 4204-4212 doi:10.1242/jeb.169227 of persistent colonization of host organs and provides a variety of (Kangassalo et al., 2016; Krams et al., 2016; Kecko et al., 2017), an benefits to the hosts (Kau et al., 2011; Huang and Douglas, 2015; important defence mechanism against parasitic protozoans and Masson et al., 2016). The microbiota competes with opportunistic metazoans, fungi, mites and parasitoids such as wasp eggs or larvae microbes for nutrients and for attachment sites on epithelial surfaces (Gillespie et al., 1997; Lavine and Strand, 2002; Krams et al., 2017). by producing various antimicrobial substances. When the microbiota are affected by antibiotic treatment, pathogens may MATERIALS AND METHODS replace mutualistic microorganisms and cause diseases such as Insects and food quality gastroenteritis, metabolic imbalance, inflammatory bowel disease We studied a captive population of G. mellonella consisting of and colorectal cancer (see Garrett et al., 2010). Moreover, the host’s individuals collected from natural populations in Estonia in summer failure to regulate the survival and numbers of mutualistic 2014. Moths were reared in 2.4 litre plastic boxes at 28±1°C in the microorganisms can allow normally nonpathogenic bacteria to dark in Sanyo MIR-253 incubators. To study the effects of diet grow excessively and also cause disease. A balance between diversity on the expression of AMP genes of G. mellonella larvae, we bacterial growth and efficiency of nutrient processing in the gut and assigned them to groups differing in the macronutritional diversity intestines is maintained by immunity mechanisms, such as and energetic value of food. Each larva was placed individually into a generation of reactive oxygen species (De Block and Stoks, 2008; plastic container (50 ml) with a lid and wire-mesh to allow ventilation Jones et al., 2012) and AMPs (Login et al., 2011; Johnston and and to prevent it from escaping. The larvae were kept on contrasting Rolff, 2015; Makarova et al., 2016). Overall, the composition of gut diets between hatching and post-hatch day 25. microbiomes is structured by (the host’s) diet (Muegge et al., 2011). The ‘diverse diet’ group received only food of high nutritional Some studies show that diet diversity correlates positively with value and diversity, provided ad libitum. The ‘simple diet’ group microbiome diversity, leading the microbiome to be more adaptable received only food of low nutritional value and diversity, provided to perturbations (reviewed in Heiman and Greenway, 2016, but see ad libitum. The diverse diet consisted of a mix of equal proportions Bolnick et al., 2014). Previous studies on Lepidoptera (Broderick of honey, glycerol, beeswax, dried milk, wheat flour, dry yeast, et al., 2004; Xiang et al., 2006; Pinto-Tomás et al., 2011; Gayatri distilled water and two servings of corn meal. Foods in both diets Priya et al., 2012; Mason and Raffa, 2014) confirm the positive were autoclaved at 121°C for 15 min. Under natural conditions, relationship between diet diversity and larval midgut community increased diet diversity typically means that a higher diversity of composition. The prediction arises that food limitations potentially opportunistic microorganisms is ingested by a host. This was not the decrease microbiome diversity. This may relieve the organism’s case in our study, however, because the larvae received bacteria-free investment in immune mechanisms of microbiota control in general food. The amount of energy associated with this food was estimated and expression of AMP genes in particular, a factor commonly as ca. 16.90 kJ g−1 by a combustion calorimeter C 2000 basic overlooked in eco-immunological research. (IKA®-Werke GmbH & Co. KG, Germany). The simple diet It has been demonstrated that dysbiosis caused by the oral consisted of natural beeswax with a 5% admixture of corn meal. delivery of antibiotics eliminates the midgut microbiome of the Beeswax is a natural polymer produced by bees, and it is considered larvae of the greater wax moth [Galleria mellonella (Linnaeus to have an extremely low nutritional value. However, we observed 1758)] and decreases the transcriptional activation of AMPs the ability of some wild progenitors of our study population to (Mukherjee et al., 2013). In this study, we expected that AMP reproduce solely on beeswax. Thus, the larvae of the simple food genes in the midgut of greater wax moth larvae would be less group received a slightly better food than pure wax. expressed when grown on simple food of low nutritional value than On post-hatch day 26, one half of the larvae in both food groups when grown on macronutrient- or energy-rich food. We also fed received peroral antibiotics to eliminate their microbiota. These larvae with an antibiotic cocktail to test whether AMP gene individuals were treated with antibiotics and antifungal drugs, expression during dysbiosis is similar to the transcriptional which was done twice within an 8-h interval. We force-fed each activation of AMPs of larvae raised on nutrient-poor food. larva with 10 μl of antibiotic cocktail consisting of water-soluble In G. mellonella, Enterococci mundtii (syn. Streptococcus forms of ampicillin (Sigma-Aldrich, St Louis, MO, USA; code: faecalis Andrewes and Horder) is considered to be the dominating A5354, concentration 50 mg ml−1; Gram-positive bacteria bacterium found in the midgut of the host (Jarosz, 1979; Johnston including Streptococcus pneumonia, S. pyogenes, Staphylococcus and Rolff, 2015). The dominance of just one microorganism can be aureus, enterococci and Gram-negative bacteria including explained by the antibacterial properties of their larval food, which Enterobacteriaceae), erythromycin (Sigma-Aldrich) (code: 45703, consists of beeswax and honey, and the ability of E. mundtii to concentration 1 mg ml−1; Gram-positive bacteria: streptococci, survive under these conditions. This microbe is a heritable nutrient- staphylococci and Gram-negative bacteria and some fungi), providing symbiont that is transmitted vertically − from mother to gentamicin (Sigma-Aldrich; code: G-1397 code, concentration offspring (Chen et al., 2016) – in G. mellonella (Bucher, 1963; 50 mg ml−1; Gram-negative bacteria including Pseudomonas, Johnston and Rolff, 2015). We analyzed the V3 region of 16S rDNA Escherichia coli, Enterobacter aerogenes, Proteus spp., Serratia to determine the taxonomical composition of microorganisms in the marcescens, Klebsiella pneumonia and Gram-positive midgut samples of the larvae of G. mellonella. Using conventional Staphylococcus), kanamycin (Sigma-Aldrich; code: K0254, bacterial culturing, we investigated the numbers of enterococci in concentration 50 mg ml−1; Gram-negative bacteria including E. the midgut microbiota of the larvae grown either on diverse or coli, Proteus spp., S. marcescens, K. pneumonia) and ketoconazole simple food, and either force-fed with antibiotics or receiving no (Sigma-Aldrich) solution in dimethyl sulfoxide (code: K0600000, antibiotic treatment (control group). Food-related stress has been antifungal agent given in concentration of 1 μg larva−1). The shown to affect the arms of the immune system via an antagonistic antibacterial cocktail has previously been documented to cross-regulation between different components of the immune significantly decrease the expression of AMP genes and stress- system (Krams et al., 2012). To determine any possible costs of related genes in G. mellonella (Mukherjee et al., 2013). AMP gene upregulation in G. mellonella, we tested whether higher We extracted RNA from the larvae 24 h after they received the levels of AMP gene expression suppress encapsulation ability first dose of antibiotics. We also extracted RNA from the larvae Journal of Experimental Biology

4205 RESEARCH ARTICLE Journal of Experimental Biology (2017) 220, 4204-4212 doi:10.1242/jeb.169227

10 15 A a B a Diverse diet 8 12 Simple diet

6 9

4 6 X X 2 3 b b,c c bb b 0 0 25 15 CDAntibiotic treatment a 20 12 ***

15 9 Diet diversity *** 10 6 X 5 3 b b b

Steady-state transcript level (a.u.) 0 0 No antibiotics With antibiotics 1.5 E Antibiotic treatment

1.2 ***

0.9 Diet diversity *** 0.6

0.3

0 No antibiotics With antibiotics

Fig. 1. The transcription levels of five AMP genes in the midgut of the greater wax moth larvae grown on a diverse and a simple diet with and without antibiotic treatment. (A) 6-tox, (B) Cecropin-D, (C) Gallerimycin, (D) Galiomicin and (E) Gloverin. The transcription levels of the AMP genes were determined by a quantitative real-time RT-PCR analysis and are shown relative to the expression levels of the reference group in which the microbiome was eliminated. Results were normalized against the expression of the housekeeping 18S rRNA and EF1 genes and represent means of six independent determinations and standard deviations. Asterisks indicate significant main effects of diet and antibiotic treatment (***P<0.0001). X indicates a significant interaction between diet and treatment (P<0.05). Different lowercase letters denote significant differences by post hoc tests at P<0.05. raised on diverse and simple foods that did not receive any antibiotics We pooled midguts from 10 individual larvae for each group. RNA − these individuals were force-fed 10 μl of distilled water. In total, we was obtained from five replicates of each of the four groups (200 had four experimental groups and one reference group of the greater larvae in total). The midguts were homogenized in 1 ml of Trizol wax moth. The experimental groups were as follows: (1) a control reagent (Sigma-Aldrich), and RNA was extracted according to the group raised on a diverse diet, (2) a control group raised on a simple manufacturer’s recommendations. RNA integrity was confirmed by diet, (3) an antibiotic treatment group raised on a diverse diet and (4) ethidium bromide gel staining, and quantities were determined an antibiotic treatment group raised on a simple diet. The larvae of the spectrophotometrically. reference group were raised on a simple diet. These larvae were force- Levels of steady-state transcripts were determined from cDNA fed 10 μl of distilled water every 3 h and received the antibiotics samples by real-time quantitative RT-PCR using the ΔΔCt protocol cocktail three times within a 12-h interval to eliminate their with the 7500 Real-Time PCR System (Applied Biosystems, microbiome. RNA was extracted from these larvae 24 h after they Waltham, MA, USA) and SYBR Green PCR mix (Qiagen, Venlo, received the first dose of antibiotics. The Netherlands). First-strand cDNA was synthesized using 5 µg of RNA, random hexamers and RevertAid™ M-MuLV Reverse RNA extraction and quantitative real-time PCR of immunity- Transcriptase (Fermentas, Vilnius, Lithuania) according to the related gene expression manufacturer’s protocols, and subsequently diluted with nuclease- Collected larvae were chilled on ice for 15 min, surface sterilized free water (Fermentas) 10 to 100 times. Amplification mixtures with 70% ethanol and then dissected for collection of their midguts. (25 µl) contained 2 µl template cDNA, 2× SYBR Green Master Mix Journal of Experimental Biology

4206 RESEARCH ARTICLE Journal of Experimental Biology (2017) 220, 4204-4212 doi:10.1242/jeb.169227 buffer (12.5 µl) (Life Technologies, Carlsbad, CA, USA) and Nagel, Düren, Germany). The quality and acquired amount of 16S 2 µmol l−1 forward and reverse primer. rRNA V3 amplicons was assessed by an Agilent High Sensitivity Five target genes were investigated, coding for AMPs: Gloverin DNA kit on an Agilent 2100 BioAnalyzer (Agilent Technologies, (strong activity against gram-positive bacteria and weak activity Santa Clara, CA, USA). against Gram-negative bacteria; forward primer: AGATGCACG- Prior to clonal amplification, each library was diluted to GTCCTACAG, reverse primer: GATCGTAGGTGCCTTGTG), 8 pmol l−1 and pooled. Sample emulsion PCR, emulsion breaking Gallerimycin (strong effect against filamentous fungi; forward and enrichment were performed using the Ion PI™ Hi-Q™ OT2 Kit primer: GAAGTCTACAGAATCACACGA, reverse primer: ATC- (Life Technologies), following the manufacturer’s instructions. The GAAGACATTGACATCCA; Schuhmann et al., 2003), 6-tox (an complete sample was loaded onto a PI™ chip v3 and sequenced on atypical defensin-derived immune-related peptide expressed in the Ion Proton™ Semiconductor Sequencer for 520 cycles midgut against invading bacteria; forward primer: GACGAACT- employing the Ion PI™ Hi-Q™ Sequencing 200 Kit. GCGAAGAATTATC, reverse primer: TGTCTGTCTTGAGTTG- Bidirectional sequencing was performed (i.e. sequence reads CATATTG; Lee et al., 2010), Galiomicin (strong antifungal effect started from forward and reverse PCR primers), but reads were and limited effect against bacteria; forward primer: GTGCGACG- not paired. Each run was expected to produce approximately AATTACACCTC, reverse primer: TACTCGCACCAACAATTG- 240,000 reads. After the sequencing run was completed, the AC) and Cecropin-D (strong activity against Gram-negative bacteria individual sequence reads were filtered by the Proton software to and fungi, weak activity against Gram-positive bacteria; forward remove low quality sequences. Sequences matching the Proton 3′ primer: CTGCGCCATGTTCTTCA, reverse primer: TCGCATC- adaptor were automatically trimmed. All Proton quality-approved, TCTGATCCTCTG; de Melo et al., 2013). trimmed and filtered data were exported as bam files. Cycling conditions were 95°C for 5 min, followed by 42 cycles Sequencing data analysis was carried out using QIIME v.1.8.0 of: 95°C for 5 s, annealing for 10 s and 72°C for 20 s. An initial and UPARSE v.7.0.1001 pipeline to quality-filter and cluster 16S touchdown of 1°C per cycle from 65°C for the first five cycles rRNA amplicon sequences (Pylro et al., 2014). Quality control resulted in optimal amplification for all loci. High-resolution retained sequences with the mean sequence quality score >20. melting analysis performed at the end of each run allowed each PCR Operational taxonomic units (OTUs) were built at 97% sequence to be checked for the presence of the expected product. We are identity with uclust (Edgar, 2010). Taxonomic assignment to the confident that the efficiency was between 98.0% and 100% for all lowest possible rank was performed with RDP (Wang et al., 2007), primer pairs. Every cDNA sample was normalized against two using the Greengenes (DeSantis et al., 2006) (http://greengenes.lbl. housekeeping genes: 18S rRNA (AF286298; forward primer: CA- gov) reference dataset (gg_otus-13_8 release). An alpha diversity CATCCAAGGAAGGCAG, reverse primer: AGTGTACTCATT- measure – the Shannon diversity index – was calculated within the CCGATTACGA) and translation elongation factor 1-alpha (EF1a; QIIME environment. AF423811; forward primer: AACCTCCTTACAGTGAATCC, reverse primer: ATGTTATCTCCGTGCCAG) (Vogel et al., 2011) Conventional bacterial culturing using geNorm software (Vandesompele et al., 2002). The calculated Midguts from six individual larvae were dissected and pooled for gene expression stability coefficient M was applied to the assay each of 20 replicates in four groups (480 larvae in total) and used for results of the genes of interest. The primers were obtained from microbiological analysis. We homogenized 0.1 ml of the midgut Metabion International AG (Planegg, Germany). samples with 1 ml of a sterile 0.1% peptone water solution using a laboratory paddle sampler for 3 min. Serial dilutions of the midgut 16S V3 rRNA gene amplification and Ion Proton™ homogenate were prepared with sterile peptone water and plated in semiconductor sequencing duplicates on Bile Esculin Azide Agar (Sigma-Aldrich), a selective The larvae used for gene sequencing received the same food as the Enterococcus agar. Enterococci were further determined by the diverse diet group, matching the conditions of ad libitum food BBL Crystal Identification Systems Gram-positive ID kit (Becton, availability in natural bee hives. DNAwas extracted using Fast DNA Dickinson and Company, Franklin Lakes, NJ, USA) (e.g. Von Spin Kit for Soil (MP Biomedicals, Santa Ana, CA, USA) Baum et al., 1998). according to the manufacturer’s guidelines. The concentration of extracted DNA was measured using the Qubit® 2.0 Fluorometer Immune assays High Sensitivity Assay (Life Technologies). The amount, average The strength of encapsulation response was measured in the control size and quality of the DNA were assessed using electrophoresis in larvae raised on (1) the diverse diet (n=28) and (2) the simple diet 1.2% agarose gels. DNA was obtained from six laboratory (n=27). We also used G. mellonella larvae of the antibiotic populations and we used the midguts of six individual larvae per treatment group raised on (3) the diverse diet (n=29) and (4) the each sample (36 larvae in total). simple diet (n=26). However, these were different larvae than those The rRNA V3 region was amplified separately by reverse used for RNA extraction and conventional bacterial culturing. (Probio_Uni_R 5′-ATTACCGCGGCTGCT-3′) and forward The immune treatment of G. mellonella larvae on post-hatch day (Probio_Uni_F 5′-CCTACGGGRSGCAGCAG-3′) primers 25 consisted of an immune system challenge induced with a (Milani et al., 2013). Both primers were tagged with 10–11 bp disinfected nylon monofilament implant (2 mm length, 0.18 mm unique barcode labels along with the adapter sequence (5′- diameter, knotted at one end) which was inserted between the third CCATCTCATCCCTGCGTGTCTCCGAC-3′). PCR amplification and fourth sternites of the cuticle of the larvae (Krams et al., 2014; was performed using the GeneAmp® PCR System 9700 (Thermo Kecko et al., 2017) for 10 h at 28±0.5°C. The implant was removed Fisher Scientific, Waltham, MA, USA) with the PCR conditions after this treatment. The strength of the encapsulation response was used as follows: 98°C for 30 s, 35 cycles of 98°C for 10 s, 67°C for measured as the darkness of the nylon filament insert after it had 15 s, 72°C for 15 s with the final extension at 72°C for 7 min. 16S been dried. Insect immune systems respond to this challenge by rRNA PCR products were then quantified, pooled and purified using attempting to encapsulate the implant in a coating of cellular ® the NucleoMag NGS Clean-Up and Size Select kit (Macherey- materials and chemical deposits as if the insert were a foreign body Journal of Experimental Biology

4207 RESEARCH ARTICLE Journal of Experimental Biology (2017) 220, 4204-4212 doi:10.1242/jeb.169227 or parasite (e.g. Rantala et al., 2000). The stronger the immune treatment (all P>0.05; Fig. 1A–C). In general, the AMP genes were response to the insert, the darker the encapsulation and the higher its similarly expressed between the simple diet without antibiotics grayscale value (Yourth et al., 2001; Krams et al., 2011, 2017; treatment group and the diverse diet and simple diet groups with Daukšte et al., 2012) owing to phenoloxidase enzyme production antibiotics treatment (P>0.05). The exception was 6-tox, which was activated by the immune response, resulting in melanization of the expressed significantly more in the simple diet without antibiotics capsule (Ratcliffe et al., 1985). In the greater wax moth, the group than in the diverse diet with antibiotics group (P=0.006; encapsulation response has been confirmed to be associated with Fig. 1). Expression of Cecropin-D, 6-tox and Gallerymicin genes in parasitoid (Kryukova et al., 2011), fungal (Dubovskiy et al., 2011, the diverse diet without antibiotics group was significantly higher 2013) and bacterial infections (Grizanova et al., 2014). The than that in the diverse and simple diet groups with antibiotics (all intensity of melanization was assessed from photographs of the P<0.005; Fig. 1). inserts taken from three directions under constant light conditions Sequencing the midgut samples of G. mellonella by the Ion using a Zeiss Lumar V12 stereo microscope (Carl Zeiss, Jena, Proton™ semiconductor sequencer resulted in 248,073 sequences Germany). Digital images were analyzed using ImageJ software per sample, but the number of sequences retained after the quality (http://rsbweb.nih.gov/ij/; Abramoff et al., 2004). Before the control was 177,742. Taxonomical composition analysis of the 16S insertion of the monofilament implant, we calibrated the rRNA V3 region revealed that the most prevalent genus in the reflectance of the implant to zero level. microbial community associated with the midgut of G. mellonella larvae was Enterococcus (ca. 80% of the sequences), while the Data analysis relative abundance of the family Enterococcaceae accounted for As the Brown–Forsythe test showed a violation of the homogeneity 87% of the microbiome. of variance of gene expression levels and encapsulation rates, we The highest number of CFU of enterococci was found in the diverse used generalized linear models (GLM) with gamma error structure diet without antibiotics group (7.6×106±14.70×106 CFU ml−1), while and an inverse link function to compare gene expression levels and the number of enterococci CFU was significantly lower in the simple 3 3 −1 encapsulation rates. Diet, treatment and their interaction were used diet group (0.8×10 ±1.5×10 CFU ml ; t-test: t38=2.31, P=0.027). as independent variables. If an interaction showed a significant We did not find any bacteria in the midgut of the individuals in the effect, the Games–Howell post hoc test was used to account for antibiotic treatment groups grown on diverse and simple diets (Fig. 2). unequal variance. The analysis was performed using R 3.3.2 (R The encapsulation response was affected by diet (GLM, LR Core Team, 2016) and the packages onewaytests (Dag et al., 2016) Chisq1=371.42, P<0.0001), treatment (LR Chisq1=24.78, and userfriendlyscience (Peters, 2016). We compared the number of P<0.0001) and interaction between diet and treatment (LR enterococci colony forming units (CFU) in diverse and simple diet Chisq1=7.32, P=0.007). The Games–Howell post hoc test showed groups (without antibiotic treatment) using a t-test. Data are that there are significant differences (all P<0.01; Fig. 3) in expressed as means±s.d. where applicable. encapsulation response between the simple diet without antibiotics treatment group (29.04±2.47), the simple diet with RESULTS antibiotics treatment group (35.88±4.26), the diverse diet without The GLM analysis showed that expression of all the AMP genes antibiotics group (19.50±3.17) and the diverse diet with antibiotics was significantly higher in the diverse diet group than in the simple group (19.76±3.16). The only exception occurred between the diet group [Gallerimycin: Rao–Scott modified likelihood ratio test diverse diet without antibiotics and the diverse diet with antibiotics (LR Chisq1)=235.709, P<0.0001; 6-tox: LR Chisq1=40.384, treatment groups, which did not differ significantly (P>0.05; Fig. 3). P<0.0001; Galiomicin: LR Chisq1=22.491, P<0.0001; Cecropin- D: LR Chisq1=171.380, P<0.0001; Gloverin: LR Chisq1=23.858, DISCUSSION P<0.0001]. Treatment with antibiotics was associated with Alpha diversity measurements of the relative abundance of bacteria significantly lower expression of all AMP genes compared with have shown that enterococci are the most common group of groups without antibiotic treatment (6-tox: LR Chisq1=77.948, microorganisms in the midgut microbiome of G. mellonella (Jarosz, P<0.0001; Cecropin-D: LR Chisq1=201.231, P<0.0001; 1979; Johnston and Rolff, 2015). Our results confirm those findings Gallerimycin: LR Chisq1=288.633, P<0.0001; Galiomicin:LR and support other findings on how the elimination of nutrients Chisq1=61.111, P<0.0001; Gloverin: LR Chisq1=29.028, P<0.0001). The diet and treatment interaction showed a significant effect on expression of Gallerimycin (LR 6ϫ106 Chisq1=7.322, P=0.0068), 6-tox (LR Chisq1=5.068, P=0.0244) ) –1 and Cecropin-D (LR Chisq1=6.983, P=0.0082), whereas Gloverin 4ϫ106 (LR Chisq1=3.260, P=0.071) and Galiomicin (LR Chisq1=0.438, P=0.5079) gene expression did not differ significantly between 2ϫ106 interaction groups, suggesting that diet alone has the potential to increase the expression of these two genes. 800 Post hoc tests revealed that the AMP genes were expressed at significantly higher levels in the diverse diet group than in the 400 simple diet group (means±s.d.) when the larvae of G. mellonella Enterococci counts (CFU ml were not treated with antibiotics (Gallerymicin: diverse=16.96± 0 3.88 versus simple=1.15±0.2, P=0.003; 6-tox: diverse=8.08±1.12 Diverse diet Simple diet Diverse diet Simple diet versus simple=0.82±0.05, P<0.001; Cecropin-D: diverse=11.46± no antibiotics no antibiotics with antibiotics with antibiotics 2.27 versus simple=0.30±0.07, P=0.001; Fig. 1). However, we did Fig. 2. Enterococci counts (CFU ml−1) in the midgut samples of Galleria not find any significant differences in AMP gene expression mellonella in four experimental treatments. Thick lines represent medians, between the diverse and simple diet groups under antibiotics while the boxes show 25th–75th percentiles. Journal of Experimental Biology

4208 RESEARCH ARTICLE Journal of Experimental Biology (2017) 220, 4204-4212 doi:10.1242/jeb.169227

50 Erdogan and Rao, 2015; Fujimori, 2015; Moos et al., 2016). For Diverse diet example, insects are known to use protective bacterial symbionts to Simple diet c 40 provide additional defense against their predators and parasitoids X (Oliver et al., 2010; Polin et al., 2014). However, these symbioses b have been shown to induce costs. For example, while bacterial 30 symbionts provide the pea aphid (Acyrthosiphon pisum) with strong a a protection against parasitoids, this symbiosis becomes costly in the 20 presence of predatory ladybirds because aphids infected by protective symbionts express less defensive anti-predator

Encapsulation rate 10 responses (Polin et al., 2014). Luo et al. (2017) have recently investigated the ecological effects of a non-essential secondary endosymbiont Regiella insecticola on different clones of the 0 No antibiotics With antibiotics English grain aphid (Sitobion avenae) based on the life table data. They showed that R. insecticola can decelerate the normal Fig. 3. Encapsulation rate (mean±s.d.) of the greater wax moth larvae development of the hosts. Similarly, our results suggest that high grown on the ‘diverse diet’ and the ‘simple diet’ with and without numbers of symbiotic enterococci bacteria (Johnston and Rolff, antibiotic treatment. X indicates a significant interaction between diet 2015) are involved in the elevation of costly expression of immune- diversity and treatment (P<0.01). Different lowercase letters denote significant differences by post hoc tests at P<0.01. related genes (for example, Gloverin), an outcome that may be further influenced by the presence of other microorganisms undetected or not evaluated in our study. The ‘surveillance’ of reduces investments in the immune system (Alonso-Alvarez and symbionts and the activation and production of AMPs in cases when Tella, 2001; Krams et al., 2014), while also reducing symbiont the symbionts become too abundant are important functions. These numbers and microbiota diversity (David et al., 2014; Carmody functions might incur costs, as the larvae would need to divert et al., 2015; Sonnenburg et al., 2016). This highlights the resources and energy away from growth and other organismal needs importance of food diversity and quality in shaping intestinal in order to carry out those functions. A fine-grained analysis of these microbiota, which may have profound effects on organismal growth potential trade-offs requires a more detailed experimental approach trajectories and the evolution of reproductive trade-offs (Lazzaro in future studies. and Rolff, 2011). Our findings are indirectly aligned with previous studies The results of this study show that when force-fed with antibiotics concerning the role of host immunity in shaping microbiota. The at larval stage, G. mellonella developed basal expression levels of gut microbiome often represents a complex and highly dynamic immunity-related AMP genes. We suggest that these levels reflect biological system (e.g. Lanan et al., 2016). Symbiont communities ‘surveillance’ activity of the immune system in the midgut in the within the gut lumen may be unstable owing to the constant influx of absence of symbionts. Interestingly, the basal expression of food particles (Blum et al., 2013) and invasions of other non- Cecropin-D, Gallerimycin and 6-tox of larvae force-fed with symbiotic food-associated bacteria (Jones et al., 2013; Cariveau antibiotics did not differ from expression of those genes under et al., 2014). Thus, the number of bacteria and the diversity of insect conditions when the larvae received a simple diet without microbiome can be explained by bacterial competition in the midgut antibiotics. This shows that investment in the production of (Greenberg and Klowden, 1972). Another hypothesis suggests that AMPs remains the same between conditions of microbial the immune system of the host plays an important role in the dysbiosis and the diet consisting of simple/low-energy food formation and maintenance of bacterial assemblages in the midgut despite the difference in symbiont numbers in the midgut. This of insects (Russell and Dunn, 1996; Caccia et al., 2016). Other result suggests the leading role of diet played in the expression of recent work shows that host and symbiont communities AMPs. In contrast, the AMP genes 6-tox, Cecropin-D, cooperatively interact to maintain the midgut microbiota in a Galiomicin, Gallerimycin and Gloverin were all significantly symbiotic balance (Johnston and Rolff, 2015). Our results suggest upregulated in the group of larvae grown on a diverse diet−those that all of the above ideas are worth testing by manipulating the harbouring the highest number of enterococci symbionts. Hence, levels of food resources available to the host, which we found to be the elevated gene expression was correlated with the increased an important agent affecting symbiont numbers and the strength of diet diversity and the number of enterococci symbionts as AMP gene expression. revealed by conventional bacterial culturing. This positive Importantly, our results suggest that food diversity has the association between the increased number of symbionts and potential to influence the immune system, as shown by the elevated elevated immune-related gene expression shows that diet quality expression of Gloverin (responsible for suppressing Gram-positive and/or diversity may result in a higher number of symbionts bacteria such as enterococci) and Galiomicin AMP genes. This involved in the digestion of nutrients, and this presumably may be adaptive under natural conditions because the larvae of requires more control over symbionts by means of AMP proteins. G. mellonella often invade only hives with low honey bee The gastrointestinal microbiome is considered to be more diverse populations or hives where bees have already died from a disease in the intestines of healthy organisms, while a loss in species (de Barjac and Thompson, 1970). However, the hives are not kept as diversity is a common finding in several disease states (for a review, clean as those maintained by healthy bee colonies. This suggests see Heiman and Greenway, 2016). However, symbionts may that the food of G. mellonella is often contaminated by various become harmful if they grow and reproduce uncontrollably. bacteria and fungi. Thus, a diverse diet in nature might indicate a Symbionts may therefore consume more nutrients than would be higher probability of acquiring opportunistic infections, while an normally expected to maintain symbiotic relationships, causing elevated expression of Gloverin and Galiomicin AMP genes may be bacterial overgrowth in the intestines and/or midgut if not properly considered to be a prophylactic response to pathogens (Barnes and controlled by the immune system of the host (Tamboli et al., 2004; Siva-Jothy, 2000). Journal of Experimental Biology

4209 RESEARCH ARTICLE Journal of Experimental Biology (2017) 220, 4204-4212 doi:10.1242/jeb.169227

It has recently been shown that a high-energy and/or diverse diet Acknowledgements decreases the strength of the encapsulation response, which We thank Dr Inese Kivleniece and Dr Jolanta Vrublevska for maintaining a laboratory indicates that food quality is the primary determinant of stock of the greater wax moth. encapsulation response in the larvae of G. mellonella (Krams Competing interests et al., 2014). Because the larvae grow the fastest when raised on a The authors declare no competing or financial interests. high-quality diet, it was suggested that longer larval development on low-quality diet requires enhanced encapsulation reactions (Krams Author contributions et al., 2014). The present study, however, reveals one more Conceptualization: I.A.K., S.K., G.T., S.L., M.J.R., I.I., J.C.-G., T.K.; Methodology: I.A.K., S.K., P.J., G.T., R.K., M.J.R., J.C.-G., L.G.-I., T.K.; Software: D.E.; Validation: mechanism that may link the diverse and/or high-quality diet with I.A.K., D.E., R.K., S.L., D.F., T.K.; Formal analysis: I.A.K., S.K., P.J., G.T., D.E., weaker encapsulation responses in G. mellonella. We show that the M.J.R., D.G., D.F., L.G.-I., T.K.; Investigation: I.A.K., S.K., G.T., R.K., M.J.R., I.I., elevated expression of all AMP genes is associated with the diverse D.G., D.F., L.G.-I., T.K.; Resources: I.A.K., S.L., I.I., J.C.-G.; Data curation: I.A.K., diet and that this result was independent of the antibiotics treatment. G.T., R.K., J.C.-G.; Writing - original draft: I.A.K., S.K., S.L., I.I.; Writing - review & Interestingly, the encapsulation response was stronger in the simple editing: I.A.K., S.K., P.J., G.T., D.E., R.K., S.L., M.J.R., I.I., D.G., D.F., J.C.-G., L.G.-I., T.K.; Visualization: G.T., D.E., J.C.-G.; Supervision: I.A.K., M.J.R.; Project diet with antibiotics treatment group, which indicates that the administration: P.J., T.K.; Funding acquisition: I.K., T.K. encapsulation response is also dependent on the presence of bacteria, but only when grown on the simple diet. This shows that Funding the diverse diet itself provides a signal of possible bacterial The study was funded by a grant from the Latvian Council of Science (290/2012 to contamination which decreases the encapsulation rate and elevates S.K., T.K. and I.A.K.). The Estonian Research Council supported T.K. and I.A.K. (PUT1223) and P.J. (PUT573). the AMP protection because the latter is more important in fighting opportunistic infections. However, what needs to be investigated in References the future is whether the relationship between the production of Abramoff, M. D., Magalhaes, P. J. and Ram, S. J. (2004). Image processing with AMP peptides and the strength of the encapsulation response is a Image. J. Biophot. Internat. 11, 36-42. Adamo, S. A., Roberts, J. L., Easy, R. H. and Ross, N. W. (2008). Competition result of stress-induced suppression of the humoral immune between immune function and lipid transport for the protein apolipophorin III leads response manifesting through an antagonistic cross-regulation to stress-induced immunosuppression in crickets. J. Exp. Biol. 211, 531-538. between different components of the immune system (Sapolsky Adamo, S. A., Davies, G., Easy, R., Kovalko, I. and Turnbull, K. F. (2016). et al., 2000; Dhabhar, 2009) or whether the encapsulation response Reconfiguration of the immune system network during food limitation in the caterpillar Manduca sexta. J. Exp. Biol. 219, 706-718. and AMP gene expression are a part of the same protective Alonso-Alvarez, C. and Tella, J. L. (2001). Effects of experimental food restriction mechanism. For example, Nagai et al. (2001) found that and body-mass changes on the avian T-cell-mediated immune response. tachyplesin, a major chitin-binding AMP of the horseshoe crab Can. J. Zool. 79, 101-105. Ardia, D. R., Gantz, J. E., Schneider, B. C. and Strebel, S. (2012). Costs of (Tachypleus tridentatus), induces the synthesis of phenoloxidase, immunity in insects: an induced immune response increases metabolic rate and which is a crucial part of the host defense system including the decreases antimicrobial activity. Funct. Ecol. 26, 732-739. synthesis of melanin and facilitation of encapsulation response. Barnes, A. I. and Siva-Jothy, M. T. (2000). Density-dependent prophylaxis in the Phenoloxidase, a copper-containing enzyme, is known to be mealworm beetle Tenebrio molitor L. (Coleoptera: Tenebrionidae): cuticular melanization is an indicator of investment in immunity. Proc. R. Soc. Lond. B 267, responsible for initiating the biosynthesis of melanin, which is 177-182. used during the encapsulation response (e.g. Hoffmann et al., 1999). Becker, T., Loch, G., Beyer, M., Zinke, I., Aschenbrenner, A. C., Carrera, P., In conclusion, although symbiotic interactions are supposed to be Inhester, T., Schultze, J. L. and Hoch, M. (2010). FOXO-dependent regulation of innate immune homeostasis. Nature 463, 369-373. mutually beneficial to the host and its symbionts, this study suggests Blum, J. E., Fischer, C. N., Miles, J. and Handelsman, J. (2013). Frequent that high numbers of midgut symbionts may induce ecological costs replenishment sustains the beneficial microbiome of Drosophila melanogaster. to their insect hosts. This conclusion is based on the finding that a mBio 4, e00860-13. Bolnick, D. I., Snowberg, L. K., Hirsch, P. E., Lauber, C. L., Knight, R., diverse diet (and, consequently, a higher number of microbiome Caporaso, J. G. and Svanbäck, R. (2014). Individuals’ diet diversity influences symbionts) activates the part of the immune system of G. mellonella gut microbial diversity in two freshwater fish (threespine stickleback and Eurasian larvae that is responsible for the production of AMPs. More perch). Ecol. Lett. 17, 979-987. specifically, we found that the number of CFU of enterococci and Broderick, N. A., Raffa, K. F., Goodman, R. M. and Handelsman, J. (2004). Census of the bacterial community of the gypsy moth larval midgut by using expression of Gallerimycin, Gloverin, 6-tox, Cecropin-D and culturing and culture-independent methods. Appl. Environ. Microbiol. 70, Galiomicin increased in response to a more diverse diet. 293-300. However, quantifying and revealing the exact mechanisms of Brogden, K. A. (2005). Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria? Nat. Rev. Microbiol. 3, 238-250. these costs as a part of ecological trade-offs remain to be done in Bucher, G. E. (1963). Survival of populations of Streptococcus faecalis Andrewes future research. This task will require studies to disentangle the and Horder in the gut of Galleria mellonella (Linnaeus) during metamorphosis, possible effects caused by a diverse diet (Huang and Douglas, and transmission of the bacteria to the filial generation of the host. J. Insect Pathol. 2015). This can be accomplished by eliciting the prophylactic 5, 336-343. Caccia, S., Di Lelio, I., La Storia, A., Marinelli, A., Varricchio, P., Franzetti, E., activation of the immune system and analyzing the relationship Banyuls, N., Tettamanti, G., Casartelli, M., Giordana, B. et al. (2016). Midgut between diet diversity and the number of symbionts, which microbiota and host immunocompetence underlie Bacillus thuringiensis killing seemingly needs to be controlled by the host. Finally, food mechanism. Proc. Natl. Acad. Sci. USA 113, 9486-9491. Cariveau, D. P., Elijah Powell, J., Koch, H., Winfree, R. Moran, N. A. (2014). availability is an important growth determinant not only for the Variation in gut microbial communities and its association with pathogen infection host but also for its symbionts. Because the availability of food in wild bumble bees (Bombus). ISMEJ. 8, 2369-2379. resources has the potential to affect symbiont numbers and Carmody, R. N., Gerber, G. K., Luevano, J. M., Gatti, D. M., Somes, L., Svenson, K. L. and Turnbaugh, P. J. (2015). Diet dominates host genotype in shaping the microbiota species composition, these effects need to be taken murine gut microbiota. Cell Host Microbe 17, 72-84. into account while designing and performing future experiments. Chen, B., Teh, B.-S., Sun, C., Hu, S., Lu, X., Boland, W. and Shao, Y. (2016). This type of work is crucial in order to increase our understanding of Biodiversity and activity of the gut microbiota across the life history of the insect the ecological effects that food resources have on immunity, growth herbivore Spodoptera littoralis. Sci. Rep. 6, 29505. Dag, O., Dolgun, A. and Konar, N. M. (2016). onewaytests: One-Way Tests in and reproduction trade-offs under the immense complexity of food Independent Groups Design. R package version 1.2. https://CRAN.R-project.org/ webs and their dynamic interactions with the microbiota. package=onewaytests. Journal of Experimental Biology

4210 RESEARCH ARTICLE Journal of Experimental Biology (2017) 220, 4204-4212 doi:10.1242/jeb.169227

Daukšte, J., Kivleniece, I., Krama, T., Rantala, M. J. and Krams, I. (2012). Kau, A. L., Ahern, P. P., Griffin, N. W., Goodman, A. L. and Gordon, J. I. (2011). Senescence in immune priming and attractiveness in a beetle. J. Evol. Biol. 25, Human nutrition, the gut microbiome and the immune system. Nature 474, 1298-1304. 327-336. David, L. A., Maurice, C. F., Carmody, R. N., Gootenberg, D. B., Button, J. E., Kecko, S., Mihailova, A., Kangassalo, K., Elferts, D., Krama, T., Krams, R., Wolfe, B. E., Ling, A. V., Devlin, A. S., Varma, Y., Fischbach, M. A. et al. (2014). Luoto, S., Rantala, M. J. and Krams, I. A. (2017). Sex-specific compensatory Diet rapidly and reproducible alters the humans gut microbiome. Nature 505, growth in the larvae of the greater wax moth Galleria mellonella. J. Evol. Biol. 30, 559-563. 1910-1918. de Barjac, H. and Thompson, J. V. (1970). A new serotype of Bacillus Krams, I., Daukšte, J., Kivleniece, I., Krama, T., Rantala, M. J., Ramey, G. and ̌ thuringiensis: B. thuringiensis var. thompsoni (serotype 11). J. Invertebr. Pathol. Sauša, L. (2011). Female choice reveals terminal investment in male mealworm 15, 141-144. beetles, Tenebrio molitor, after a repeated activation of the immune system. De Block, M. and Stoks, R. (2008). Short-term larval food stress and associated J. Insect Sci. 11, 56. compensatory growth reduce adult immune function in a damselfly. Ecol. Krams, I., Vrublevska, J., Cirule, D., Kivleniece, I., Krama, T., Rantala, M. J., Entomol. 33, 796-801. Sild, E. and Hõrak, P. (2012). Heterophil/lymphocyte ratios predict the magnitude de Melo, N. R., Abdrahman, A., Greig, C., Mukherjee, K., Thornton, C., Ratcliffe, of humoral immune response to a novel antigen in great tits (Parus major). Comp. N. A., Vilcinskas, A. and Butt, T. M. (2013). Myriocin significantly increases the Biochem. Physiol. A Mol. Integr. Physiol. 161, 422-428. Krams, I., Kecko, S., Kangassalo, K., Moore, F. R., Jankevics, E., Inashkina, I., mortality of a non-mammalian model host during Candida pathogenesis. PLoS Krama, T., Lietuvietis, V., Meija, L. and Rantala, M. J. (2014). Effects of food ONE 8, e78905. quality on trade-offs among growth, immunity and survival in the greater wax moth DeSantis, T. Z., Hugenholtz, P. and Larsen, N., Rojas, M., Brodie, E. L., Keller, (Galleria mellonella). Insect Sci. 22, 431-439. K., Huber, T., Dalevi, D., Hu, P. and Andersen, G. L. (2006). Greengenes, a Krams, I., Burghardt, G. M., Krams, R., Trakimas, G., Kaasik, A., Luoto, S., chimera-checked 16S rRNA gene database and workbench compatible with ARB. Rantala, M. J. and Krama, T. (2016). A dark cuticle allows higher investment in Appl. Environ. Microbiol. 72, 5069-5072. immunity, longevity and fecundity in a beetle upon a simulated parasite attack. Dhabhar, F. S. (2009). Enhancing versus suppressive effects of stress on Oecologia 182, 99-109. immune function: implications for immunoprotection and immunopathology. Krams, I. A., Krama, T., Trakimas, G., Kaasik, A., Rantala, M. J. and Škute, A. Neuroimmunomodulation 16, 300-317. (2017). Reproduction is costly in an infected aquatic insect. Ethol. Ecol. Evol. 29, Dubovskiy, I. M., Grizanova, E. V., Ershova, N. S., Rantala, M. J. and Glupov, 74-84. V. V. (2011). The effects of dietary nickel on the detoxification enzymes, innate Kryukova, N. A., Dubovskiy, I. M., Chertkova, E. A., Vorontsova, Y. L., Slepneva, immunity and resistance to the fungus Beauveria bassiana in the larvae of the I. A. and Glupov, V. V. (2011). The effect of Habrobracon hebetor venom on the greater wax moth Galleria mellonella. Chemosphere 85, 92-96. activity of the prophenoloxidase system, the generation of reactive oxygen Dubovskiy, I. M., Whitten, M. M. A., Kryukov, V. Y., Yaroslavtseva, O. N., species and encapsulation in the haemolymph of Galleria mellonella larvae. Grizanova, E. V., Greig, C., Mukherjee, K., Vilcinskas, A., Mitkovets, P. V., J. Insect Physiol. 57, 796-800. Glupov, V. V. et al. (2013). More than a colour change: insect melanism, disease Lanan, M. C., Rodrigues, P. A. P., Agellon, A., Jansma, P. and Wheeler, D. E. resistance and fecundity. Proc. R. Soc. Lond. B 280, 20130584. (2016). A bacterial filter protects and structures the gut microbiome of an insect. Edgar, R. C. (2010). Search and clustering orders of magnitude faster than BLAST. ISMEJ 10, 1866-1876. Bioinformatics 26, 2460-2461. Lavine, M. D. and Strand, M. R. (2002). Insect hemocytes and their role in Erdogan, A. and Rao, S. S. C. (2015). Small intestinal fungal overgrowth. Curr. immunity. Insect Biochem. Mol. Biol. 32, 1295-1309. Gastroenterol. Rep. 17, 16. Lazzaro, B. P. and Rolff, J. (2011). Danger, microbes, and homeostasis. Science Fujimori, S. (2015). What are the effects of proton pump inhibitors on the small 332, 43-44. intestine? World J. Gastroenterol. 21, 6817-6819. Lee, J. H., Park, S., Chae, K.-S. and Lee, I. H. (2010). Galleria mellonella 6-Tox Garrett, W. S., Gordon, J. I. and Glimcher, L. H. (2010). Homeostasis and gene, putative immune related molecule in Lepidoptera. Int. J. Industr. Entomol. inflammation in the intestine. 21, 127-132. Cell 140, 859-870. Lochmiller, R. L. and Deerenberg, C. (2000). Trade-offs in evolutionary Gayatri Priya, N., Ojha, A., Kajla, M. K., Raj, A. and Rajagopal, R. (2012). Host immunology: just what is the cost of immunity? Oikos 88, 87-98. plant induced variation in gut bacteria of Helicoverpa armigera. PLoS ONE 7, Login, F. H., Balmand, S., Vallier, A., Vincent-Monegat, C., Vigneron, A., Weiss- e30768. Gayet, M., Rochat, D. and Heddi, A. (2011). Antimicrobial peptides keep insect Gillespie, J. P., Kanost, M. R. and Trenczek, T. (1997). Biological mediators of endosymbionts under control. Science 334, 362-365. insect immunity. Annu. Rev. Entomol. 42, 611-643. Luo, C., Luo, K., Meng, L., Wan, B., Zhao, H. and Hu, Z. (2017). Ecological impact González-Santoyo, I. and Córdoba-Aguilar, A. (2012). Phenoloxidase: a key of a secondary bacterial symbiont on the clones of Sitobion avenae (Fabricius) component of the insect immune system. Entomol. Exp. Appl. 142, 1-16. (Hemiptera: Aphididae). Sci. Rep. 7, 40754. Greenberg, B. and Klowden, M. (1972). Enteric bacterial interactions in insects. Makarova, O., Rodriguez-Rojas, A., Eravci, M., Weise, C., Dobson, A., Am. J. Clin. Nutr. 25, 1459-1466. Johnston, P. and Rolff, J. (2016). Antimicrobial defence and persistent Grizanova, E. V., Dubovskiy, I. M., Whitten, M. M. A. and Glupov, V. V. (2014). infection in insects revisited. Philos. Trans. R. Soc. Lond. B 371, 20150296. Contributions of cellular and humoral immunity of Galleria mellonella larvae in Mason, C. J. and Raffa, K. F. (2014). Acquisition and structuring of midgut bacterial defence against oral infection by Bacillus thuringiensis. J. Invertebr. Pathol. 119, communities in gypsy moth (Lepidoptera: Erebidae) larvae. Environ. Entomol. 43, 595-604. 40-46. Masson, F., Zaidman-Rémy, A. and Heddi, A. (2016). Antimicrobial peptides and Heiman, M. L. and Greenway, F. L. (2016). A healthy gastrointestinal microbiome is cell processes tracking endosymbiont dynamics. Philos. Trans. R. Soc. Lond. B dependent on dietary diversity. Mol. Metab. 5, 317-320. 371, 20150298. Hoffmann, J. A., Kafatos, F. C., Janeway, C. A. and Ezekowitz, R. A. (1999). Milani, C., Hevia, A., Foroni, E., Duranti, S., Turroni, F., Lugli, G. A., Sanchez, B., Phylogenetic perspectives in innate immunity. Science 284, 1313-1318. Martın,́ R., Gueimonde, M., van Sinderen, D. et al. (2013). Assessing the Fecal Huang, J.-H. and Douglas, A. E. (2015). Consumption of dietary sugar by gut Microbiota: an optimized ion torrent 16S rRNA gene-based analysis protocol. bacteria determines Drosophila lipid content. Biol. Lett. 11, 20150469. PLoS ONE 8, e68739. Janeway, C., Travers, P., Walport, M. and Shlomchik, M. (2005). Immunobiology. Moos, W. H., Faller, D. V., Harpp, D. N., Kanara, I., Pernokas, J., Powers, W. R. New York: Garland Science. and Steliou, K. (2016). Microbiota and neurological disorders: a gut feeling. Jarosz, J. (1979). Gut flora of Galleria mellonella suppressing ingested bacteria. Biores. Open Access 5, 137-145. J. Invertebr. Pathol. 34, 192-198. Moret, Y. and Schmid-Hempel, P. (2000). Survival for immunity: the price of Johnston, P. R. and Rolff, J. (2015). Host and symbiont jointly control gut immune system activation for bumblebee workers. Science 290, 1166-1168. microbiota during complete metamorphosis. PLoS Pathog. 11, e1005246. Muegge, B. D., Kuczynski, J. and Knights, D., Clemente, J. C., Gonzalez, A., Jones, R. M., Mercante, J. W. and Neish, A. S. (2012). Reactive oxygen production Fontana, L., Henrissat, B., Knight, R. and Gordon, J. I. (2011). Diet drives induced by the gut microbiota: pharmacotherapeutic implications. Curr. Med. convergence in gut microbiome functions across mammalian phylogeny and Chem. 19, 1519-1529. within humans. Science 332, 970-974. Jones, R. T., Vetter, S. M., Montenieiri, J., Holmes, J., Bernhardt, S. A. and Mukherjee, K., Raju, R., Fischer, R. and Vilcinskas, A. (2013). Galleria mellonella Gage, K. L. (2013). Yersinia pestis infection and laboratory conditions alter flea- as a model host to study gut microbe homeostasis and brain infection by the associated bacterial communities. ISMEJ 7, 224-228. human pathogen Listeria monocytogenes. Adv. Biochem. Eng. Biotechnol. 135, Kaneko, Y., Furukawa, S., Tanaka, H. and Yamakawa, M. (2007). Expression of 27-39. antimicrobial peptide genes encoding enbocin and gloverin isoforms in the Nagai, T., Osaki, T. and Kawabata, S.-I. (2001). Functional conversion of silkworm, Bombyx mori. Biosci. Biotechnol. Biochem. 71, 2233-2241. hemocyanin to phenoloxidase by horseshoe crab antimicrobial peptides. J. Biol. Kangassalo, K., Kosonen, K., Pölkki, M., Sorvari, J., Krams, I. and Rantala, M. J. Chem. 276, 27166-27170. (2016). Immune challenge has a negative effect on cuticular darkness in the Odegaard, J. I. and Chawla, A. (2013). The immune system as a sensor of the

mealworm beetle, Tenebrio molitor. Ann. Zool. Fenn. 53, 255-262. metabolic state. Immunity 38, 644-654. Journal of Experimental Biology

4211 RESEARCH ARTICLE Journal of Experimental Biology (2017) 220, 4204-4212 doi:10.1242/jeb.169227

Oliver, K. M., Degnan, P. H., Burke, G. R. and Moran, N. A. (2010). Facultative Schuhmann, B., Seitz, V., Vilcinskas, A. and Podsiadlowski, L. (2003). Cloning symbionts in aphids and the horizontal transfer of ecologically important traits. and expression of gallerimycin, an antifungal peptide expressed in immune Annu. Rev. Entomol. 55, 247-266. response of greater wax moth larvae, Galleria mellonella. Arch. Insect Biochem. Peters, G. (2016). userfriendlyscience: Quantitative Analysis Made Accessible. R Physiol. 53, 125-133. package version 0.5-2. https://rdrr.io/cran/userfriendlyscience/. Sheldon, B. C. and Verhulst, S. (1996). Ecological immunology: costly parasite ́ ı́ ı́ Pinto-Tomas, A. A., Sittenfeld, A., Uribe-lor o, L., Chavarr a, F., Mora, M., defences and trade-offs in evolutionary ecology. Trends Ecol. Evol. 11, 317-321. Janzen, D. H., Goodman, R. M., Holly, M. and Simon, H. M. (2011). Comparison Smits, S. A., Leach, J., Sonnenburg, E. D., Gonzalez, C. G., Lichtman, J. S., of midgut bacterial diversity in tropical caterpillars (Lepidoptera: Saturniidae) fed Reid, G., Knight, R., Manjurano, A., Changalucha, J., Elias, J. E. et al. (2017). on different diets. Environ. Entomol. 40, 1111-1122. Seasonal cycling in the gut microbiome of the Hadza hunter-gatherers of Polin, S., Simon, J.-C. and Outreman, Y. (2014). An ecological cost associated Tanzania. Science 357, 802-806. with protective symbionts of aphids. Ecol. Evol. 4, 836-840. Sonnenburg, E. D., Smits, S. A., Tikhonov, M., Higginbottom, S. K., Wingreen, Ponton, F., Wilson, K., Holmes, A. J., Cotter, S. C., Raubenheimer, D. and Simpson, S. J. (2013). Integrating nutrition and immunology: a new frontier. N. S. and Sonnenburg, J. L. (2016). Diet-induced extinctions in the gut J. Insect Physiol. 59, 130-137. microbiota compound over generations. Nature 529, 212-215. Povey, S., Cotter, S. C., Simpson, S. J. and Wilson, K. (2014). Dynamics of Tamboli, C. P., Neut, C., Desreumaux, P. and Colombel, J. F. (2004). Dysbiosis in macronutrient self-medication and illness-induced anorexia in virally infected inflammatory bowel disease. Gut 53, 1-4. insects. J. Anim. Ecol. 83, 245-255. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, Pylro, V. S., Roesch, L. F. W., Morais, D. K., Clark, I. M., Hirsch, P. R. and Tótola, A. and Speleman, F. (2002). Accurate normalization of real-time quantitative RT- M. R. (2014). Data analysis for 16S microbial profiling from different benchtop PCR data by geometric averaging of multiple internal control genes. Genome Biol. sequencing platforms. J. Microbiol. Methods 107, 30-37. 3, research0034.1. R Core Team (2016). R: A language and environment for statistical computing. Vogel, H., Altincicek, B., Glöckner, G. and Vilcinskas, A. (2011). A Vienna: R Foundation for Statistical Computing. https://www.R-project.org/. comprehensive transcriptome and immune-gene repertoire of the lepidopteran Råberg, L., Grahn, M., Hasselquist, D. and Svensson, E. (1998). On the adaptive model host Galleria mellonella. BMC Genomics 12, 308. significance of stress-induced immunosuppression. Proc. R. Soc. Lond. B 265, Von Baum, H., Klemme, F. R., Geiss, H. K. and Sonntag, H.-G. (1998). 1637-1641. Comparative evaluation of a commercial system for identification of gram-positive Rantala, M. J., Koskimiki, J., Taskinen, J., Tynkkynen, K. and Suhonen, J. cocci. Eur. J. Clin. Microbiol. Infect. Dis. 17, 849-852. (2000). Immunocompetence, developmental stability and wingspot size in the Wang, Q., Garrity, G. M., Tiedje, J. M. and Cole, J. R. (2007). Naïve bayesian damselfly Calopteryx splendens L. Proc. R. Soc. Lond. B 267, 2453-2457. classifier for rapid assignment of rRNA sequences into the new bacterial Ratcliffe, N. A., Rowley, A. F., Fitzgerald, S. W. and Rhodes, C. P. (1985). taxonomy. Appl. Environ. Microbiol. 73, 5261-5267. Invertebrate immunity: basic concepts and recent advances. Int. Rev. Cytol. 97, Xiang, H., Wei, G.-F., Jia, S., Huang, J., Miao, X.-X., Zhou, Z., Zhao, L.-P. and 183-350. Russell, V. and Dunn, P. E. (1996). Antibacterial proteins in the midgut of Manduca Huang, Y.-P. (2006). Microbial communities in the larval midgut of laboratory and sexta during metamorphosis. J. Insect Physiol. 42, 65-71. field populations of cotton bollworm (Helicoverpa armigera). Can. J. Microbiol. 52, Sapolsky, R. M., Romero, L. M. and Munck, A. U. (2000). How do glucocorticoids 1085-1092. influence stress responses? Integrating permissive, suppressive, stimulatory, and Yourth, C. P., Forbes, M. R. and Smith, B. P. (2001). On understanding variation in preparative actions. Endocrinol. Rev. 21, 55-89. immune expression of the damselflies Lestes spp. Can. J. Zool. 79, 815-821. Schmid-Hempel, P. (2011). Evolutionary Parasitology: The Integrated Study of Zasloff, M. (2002). Antimicrobial peptides of multicellular organisms. Nature 415, Infections, Immunology, Ecology, and Genetics. Oxford: Oxford University Press. 389-395. Journal of Experimental Biology

4212