DOCSLIB.ORG

Renal Tuberculosis As an Aetiology of Sterile Pyuria)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Renal Tuberculosis As an Aetiology of Sterile Pyuria) Egyptian Journal of Medical Microbiology, July 2009 Vol. 18, No. 3 Diagnostic Relevance of Pyuria in Haemodialysis Patients (Renal Tuberculosis as an Aetiology of Sterile Pyuria) Mohamed Saber1, Laila Aboul Fadl2, Hoda Helmi2, Ehab El-Dobaa1, Emam Waked3, Azza El Shamaa3, Manar A. Hussein3, Dalia Roshd4 Departments of Biochemistry1, Microbiology2, Nephrology3 Theodor Bilharz Research Institute and Internal Medicine Dep., Cairo University4 ABSTRACT This study was designed to assess the significance of pyuria as a marker of urinary tract infections (UTIs) in haemodialysis patients and renal tuberculosis as a common aetiology of sterile pyuria. The study was conducted on 50 patients with end stage renal disease (ESRD) on regular haemodialysis (group I), as well as 10 healthy controls (group II). Fresh urine samples were cultured, examined microscopically for pyuria and tested by Bayer reagent strips for protein, blood, nitrite and leucocyte esterase (LE). Gram stain of colonies and their identification to the species level using API 20 E system were performed. Ziehl-Neelson (ZN) staining for acid alcohol fast bacilli and Polymerase chain reaction (PCR) for detection of Mycobacterium tuberculosis (MTB) DNA were performed on 24 hours collected urine samples. All patients had pyuria (≥5 WBCs/hpf). Protein, blood, LE and nitrite were significantly higher in patients than in controls (P value <0.01, <0.01, <0.001 and <0.05 respectively). A significant correlation was found between patients' symptoms and bacterial growth (p<0.1). Thirty one patients had sterile pyuria, three out of them (10%) were proved to be tuberculous by ZN or PCR. To conclude, pyuria is a common finding in haemodialysis patients and is proved to be a valuable parameter of UTIs in these patients. In symptomatic patients with sterile pyuria, renal tuberculosis should be excluded by ZN staining and/or PCR. In asymptomatic patients, periodic urine culture should be performed to confirm presence or absence of UTIs. INTRODUCTION pyuria and white cell casts in their urine regardless of presence or absence of infection. (5) Urinary tract infection is the most Kim and Corwin have stated that pyuria in common bacterial infection in humans. It can be dialysis patients is not indicative of UTIs either symptomatic or asymptomatic. because of several clinical factors that may Symptomatic infection is associated with a wide confound this relationship. Other studies have spectrum of morbidity, from mild irritative defended pyuria as a good marker of UTIs in (6) (7) voiding symptoms to bacteremia, sepsis and those patients . Chaudhry et al. have found occassionally death. Asymptomatic urinary that asymptomatic dialysis patients with many infection is the isolation of bacteria from urine white cells in their urine are more likely to in quantitative counts consistent with infection, produce a possible urinary pathogen on culture. but without localizing genitourinary signs or They suggested to utilize the level of pyuria in symptoms, and with no systemic symptoms these patients to recognize infection. Urinary attributable to the infection(1). tract tuberculosis is one of the most common Fasolo et al.(2) reported that dialysis causes of sterile pyuria. It results of dependent patients have documented defects in haematogenous spread from a pulmonary site of (8) their immune responses, and are commonly primary infection . Sterile pyuria commonly predisposed to UTIs that contribute significantly associated with ESRD was found to be one of (9) to their morbidity and mortality. Diagnosis of the risk factors of extrapulmonary TB . The UTIs usually involve the appearance of value of pyuria in immunosuppressed appropriate symptoms, the finding of pyuria and haemodialysis patients is unclear. So the present the culture of possible urinary pathogens from study was designed to assess the significance of the urine(3). pyuria as a marker of UTIs in haemodialysis The value of pyuria as a marker of UTI patients and renal tuberculosis as common in haemodialysis dependent patients is aetiology of sterile pyuria. controversial. Cabuluna et al.(4) reported that end stage renal disease (ESRD) patients exhibit 19 Egyptian Journal of Medical Microbiology, July 2009 Vol. 18, No. 3 MATERIAL & METHODS KC1, 1.5mM MgC12, 0.001% gelatin (w/v) and 2.5units Taq DNA polymerase (Promega Inc.). The study was conducted on 50 patients Amplification program was as follows; one o with ESRD under maintenance haemodialysis in cycle of denaturing at 94 C for 5 minutes o Theodor Bilharz Research Institute (group I). followed by 40 cycles, each at 94 C for 1 They were on regular haemodialysis sessions 3 minute as denaturing step, annealing step at o o times weekly, 4 hours each using hemophan 55 C for 1 minute and extension step at 72 C for o filters and sodium acetate solution as dialysate. 1 minute, the final extension step was 72 C for 7 Ten healthy subjects were also included as minutes. In the second PCR (nested PCR), 2ul controls (group II). of first PCR amplification products and the Personal and present history was taken nested primers were added in a total volume of from all patients stressing on the aetiology of 100µl reaction mix containing the same renal failure, duration of haemodialysis components as in the first PCR. Annealing o treatment and symptoms of urinary tract temperature was 65 C in second PCR. The problems as dysuria, haematuria, frequency and amplification was done in the thermal cycler TM suprapubic pain. Patients were clinically PTC100 system (Mj, USA). The PCR examined for suprapubic tenderness and tender amplification products along with DNA ladder renal angles. Patients with positive urine culture were separated using 2.5% agarose gel were subjected to abdomino-phric electrophoresis, stained with ethidium bromide (12) ultrasonography to exclude pyocystosis. and visualized using UV illumination . A Sample collection: specific band at 400bp was expected. Morning midstream urine sample was Bayer reagent strips for urinalysis (Bayer freshly collected. It was used for culture, diagnostics MFg., Ltd. Bridgend, UK): urinalysis using Bayer reagent strips. Then it According to manifacturer's instruction, was centrifuged and the spun was examined fresh urine specimen was tested by Bayer microscopically. reagent strips which include test pads for Twenty four hours urine was also collected protein, blood, nitrite and leucocyte esterase and centrifuged. The precipitate was used for (LE). In cases of UTIs, gram negative bacteria ZN staining, and for detection of MTB DNA by converts diet derived nitrate to nitrite which is PCR. detected by testing the urine with reagent strips. Laboratory Investigations: The detection of LE in urine denotes the Detection of Mycobacterium tuberculosis presence of leucocytes especially granulocytic (MTB) DNA by PCR in urine samples: ones as they contain esterase enzymes. The 24 hours collected urine was Urinalysis result was considered positive by the centrifuged at 2000rpm for five minutes and the detection of leucocyte esterase LE or nitrite. precipitate was used for DNA extraction(10). In Microscopic examination of urine: brief, lysis of cells was done by proteinase K at Fresh urine sample was centrifuged at a concentration of 20µg/ml in 1% SDS. DNA 2000rpm for five minutes, then the spun is was extracted using guanidinium examined microscopically. Pyuria was defined isothiocyanate-phenol-chloroform method as greater than or equal to five white blood (alkaline phenol, pH 8). cells/high power field (5WBCs/hpf) according (2) (5) PCR for the extracted DNA has been done to Fasolo et al. ; Kim and Corwin . using a set of specific nested primers designed Urine culture: for detection of the gene coding for the 65KDa Morning midstream urine sample is freshly antigen (cell wall protein) (Gene Bank Acc. No. collected, cultured on blood agar, Mac Conkey's M15467). The sequence of the primers were: agar and sabouraud's dextrose agar using Forward 1: 5`AGATCGAGAACAGCGACTCC calibrated platinum loop (0.002ml), and o Reverse 1: 5`GCGAGCAGATCCTCGTAGAC aerobically incubated at 37 C overnight. On the The sequence of the nested primers were: second day, the plates were examined for Forward 2: 5`CATGTCGCCGCCACCGGGAA presence of growth. Gram stain and Reverse 2: 5`GTGGCCCAGATCCGCCAG identification to the species level using API 20E A total volume of 100µl PCR mixture was system (Biomérieux SA. Marcy L'Etoile, prepared for the first PCR(11). The reaction France) were performed. Culture was 5 mixture consisted of approximately 500ng considered positive when ≥10 colony forming genomic DNA, 200µM dNTPs, 1µM of both 5` unit/ml were isolated. and 3` primers, 10mM Tris-HC1, pH 8.3, 50mM 20 Egyptian Journal of Medical Microbiology, July 2009 Vol. 18, No. 3 Ziehl-Neelson staining of the urine: Results of Bayer reagent strips for The collected 24 hours urine sample was urinalysis were also illustrated in table I. centrifuged at 2000rpm for five minutes. The Protein, Blood, LE and Nitrite were deposit was stained by ZN stain for acid alcohol significantly higher in patients than in controls fast bacilli according to Ayers(13). with P value of <0.01, <0.01, <0.001 and <0.05 Statistical Analysis: respectively. A significant correlation was Results were expressed as percent. found between pyuria and LE, and between Comparison between the percent positivity of pyuria and nitrite with same P value of <0.01. the two groups was done using Chi Square (χ2). Table II showed the presence of patients' SPSS computer program (version 17 windows) symptoms and bacterial growth. Forty two was used for data analysis. P value less than percent of patients were symptomatic, whereas 0.05 was considered significant; less than 0.01 fifty eight percent were asymptomatic. None of was considered highly significant and less than the controls had UTI symptoms. Sixty two 0.001 was considered extremely significant. percent of the patients have no growth (sterile pyuria) while thirty eight percent gave bacterial RESULTS growth on urine culture.
Load more

Recommended publications
  • The Association Between Fever and Pyuria in Children Older Than One Month
    J Renal Inj Prev. 2019; 8(3): 240-242. http://journalrip.com DOI: 10.15171/jrip.2019.45 Journal of Renal Injury Prevention The association between fever and pyuria in children older than one month Saeed Mohajeri ID , Pouria Hemmati*, Morteza Sedehi ID Department of Pediatrics, Faculty of Medicine,Shahrekord University of Medical Sciences, Shahrekord, Iran A R T I C L E I N F O A B S T R A C T Article Type: Introduction: Some assumptions have been made on the probable association between fever Original and pyuria. Objectives: The present study aimed to investigate the association between fever and pyuria. Article History: Patients and Methods: In this case-control study, 90 febrile and 90 non-febrile children Received: 26 January 2019 aged more than one month who were admitted to the pediatric ward were included. Urine Accepted: 4 May 2019 specimens of children less than 2 years of age were collected by urine bag. Midstream urine Published online: 8 June 2019 samples were collected and immediately sent to the laboratory for complete urinalysis and urine culture. Keywords: Results: Overall, 6.7% in febrile children and 2.2% in control group had pyuria however Pyuria, there was no significant association between fever and pyuria (P > 0.05). Additionally, no Interstitial nephritis association between the presence of pyuria and type of disease was detected (P > 0.40). Fever Conclusion: The present study could not reveal any association between fever and pyuria in children older than one month. Original Implication for health policy/practice/research/medical education: In this cross-sectional study, 90 febrile and 90 non-febrile children aged more than one month, we found no association between fever and pyuria in children older than one month.
    [Show full text]
  • Case Reports.Pmd
    CASE REPORTS so far described and not in pediatric patients as per Funding: None. Competing interest: None stated. available English literature. REFERENCES A large number of adverse reactions to IVIG have been 1. Rizk A, Gorson KC, Kenney L, Weinstein R. Transfusion- reported [4-7], including hypersensitivity reaction like related acute lung injury after the infusion of IVIG. urticaria, angioedema and bronchospasm. Respiratory Transfusion. 2001;41:264-8. distress following any infusion can also occur because of 2. Kleinman S, Caulfield T, Chan P, Davenport R, McFarland circulatory overload or anaphylactic transfusion reactions. J, McPhedran S, et al. Toward an understanding of Transfusion-associated circulatory overload develops transfusion-related acute lung injury: statement of a within minutes to hours of transfusion as congestive consensus panel. Transfusion. 2004;44:1774-89. cardiac failure, cyanosis, hypertension and it rapidly 3. Suassuna JHR, da Costa MADL, Faria RA, Melichar AC. Noncardiogenic pulmonary edema triggered by responds to aggressive diuresis and ventilatory support. intravenous immunoglobulin in cancer – associated Anaphylactic transfusion reactions results in laryngeal and thrombotic thrombocytopenic purpura- hemolytic uremic bronchial spasm and manifest as tachypnea, wheezing, syndrome. Nephron. 1997;77:368-70. cyanosis, erythma, edema and severe hypotension, during 4. Orbach H, Katz U, Sherer Y, Shoenfeld Y. Intravenous the transfusion of any type of protein-containing blood immunoglobulin: adverse effects and safe administration. component [8]. Clin Rev Allergy Immunol. 2005;29:173-84. 5. Berkovitch M, Dolinski G, Tauber T, Aladjem M, Akin to post blood component infusion TRALI, that Kaplinsky C. Neutropenia as a complication of intravenous following IVIG infusion could have been due to immune immunoglobulin (IVIG) therapy in children with immune mediated mechanism [9] or neutrophil priming thrombocytopenic purpura: common and non-alarming.
    [Show full text]
  • Pyuria, Urinary Tract Infection and Renal Outcome in Patients with Chronic
    www.nature.com/scientificreports OPEN Pyuria, urinary tract infection and renal outcome in patients with chronic kidney disease stage 3–5 I‑Ching Kuo1,2,6, Jia‑Jung Lee1,6, Daw‑Yang Hwang1,5, Lee‑Moay Lim1, Hugo You‑Hsien Lin1,2, Shang‑Jyh Hwang1,3,4, Hung‑Chun Chen1,3 & Chi‑Chih Hung1* Pyuria is common in chronic kidney disease (CKD), which could be due to either urinary tract infection (UTI) or renal parenchymal infammation. Only little is known regarding the association of pyuria or UTI with renal outcomes. We investigated 3226 patients with stage 3–5 CKD. Pyuria was defned as ≥ 50 WBC per high‑power feld (hpf) and was correlated to old age, female, diabetes, hypoalbuminemia, lower eGFR, and higher infammation status. In Cox regression, patients with more than one episode of pyuria in the frst year (11.8%) had increased risks for end‑stage renal disease (ESRD) [hazard ratio (95% CI): 1.90 (1.58–2.28); p < 0.001], rapid renal function progression [odds ratio (95% CI): 1.49 (1.13–1.95); p = 0.001], and all‑cause mortality [hazard ratio: 1.63 (1.29–2.05); p < 0.001], compared to those without pyuria. In a subgroup analysis, the risk of pyuria for ESRD was modifed by CKD stages. We investigated the efects of UTI (urinary symptoms and treated by antibiotics) and pyuria without UTI (urine WBC < 50 to ≥ 10/hpf without any episodes of ≥ 50 WBC/hpf or UTI), while both groups were associated with clinical outcomes. In conclusion, CKD stage 3–5 patients with frequent pyuria or UTI episodes have increased risks of renal outcomes.
    [Show full text]
  • Sterile Pyuria in Patients Admitted to the Hospital with Infections Outside of the Urinary Tract
    J Am Board Fam Med: first published as 10.3122/jabfm.2014.01.130084 on 3 January 2014. Downloaded from ORIGINAL RESEARCH Sterile Pyuria in Patients Admitted to the Hospital With Infections Outside of the Urinary Tract Jared B. Hooker, MS2, James W. Mold, MD, MPH, and Satish Kumar, MD Objectives: The objective of this study was to determine the incidence, associations, evaluation, and management of pyuria in patients admitted to the hospital with nonurinary infections. Methods: This study abstracted inpatient records of consecutive patients hospitalized for pneumonia, intra-abdominal infections, female genital tract infections (GYN infections), bacterial septicemia, and enteritis in the pediatric and adult medical and surgical units at an academic medical center. Results: The study population included 210 patients (66 children; 144 adults). Nearly one-third had >5 white blood cells (WBCs) per high-power field (pyuria). Pyuria was more common in women (P < > and less common in patients with pneumonia (P (001. ؍ and in patients with GYN infections (P (001. .001). Cultures were performed on 18 of 19 children (94.7%) and 26 of 43 adults (60.5%) with pyuria. Of those, 11.1% of children and 42.1% of adults had a positive culture, and all but one of those met criteria for a urinary tract infection. Excluding patients with GYN infections, only 18.8% of patients with pyuria had a positive culture. Of the 44 patients with pyuria who were cultured, a positive culture was moderate or large amounts of bacteria in the urine ,(01. ؍ associated with having a GYN infection (P The absolute number of WBCs or red blood cells in .(004.
    [Show full text]
  • Managing Common Infections in Older Adults
    MANAGING COMMON INFECTIONS IN OLDER ADULTS Ghinwa Dumyati, MD Professor of Medicine Infectious Diseases Division and Center for Community Health University of Rochester Medical Center Objectives 1. Review the common infection syndromes in the nursing home population 2. Discuss when antibiotic treatment is necessary 3. Evaluate examples for assessing the appropriateness of antibiotic treatment Impact of Infections in Nursing Homes • Estimated prevalence of infections: 5.3% • Incidence rates: 3.6-5.2/1,000 resident days • Infections are associated with • High mortality and morbidity • Re-hospitalization • Extended hospital stay and substantial healthcare expenditures Rhee MS, Stone ND. Infect Dis Clin N Am. 2014; 28: 237-246 Strausgbaugh L , Joseph C. Infect Control and Hosp Epidemiol. 2000; 21:674-679 Risk of Infections in the Older Adults • Impairment in immunity • Functional impairment • Multiple comorbidities • Presence of indwelling devices • Recent admission to an acute care facility MS is an 89 year old male, long term resident of a nursing home • Hx of diabetes, renal insufficiency, mild dementia, no history of COPD • He has peripheral vascular disease and a chronic ulcer over the right lateral malleolus, previous culture from the ulcer grew methicillin resistant Staphylococcus aureus (MRSA) • The CNA notices that he is coughing up yellow phlegm and asks the resident if he is feeling OK. • Mr. MS reports some headache, chills and he does not feel hungry for dinner • The nurse assesses the resident • His temperature is 990 F, HR 90/min, RR 22/min, BP: 156/90, pulse oximetry 98% on room air • Mr. MS looks fatigued and very weak. His chest exam is negative, he has no abdominal or CVA tenderness, his chronic ankle ulcer has minimal yellow material at the base.
    [Show full text]
  • Lower Genitourinary Infections in Women
    CLINICAL REVIEW Lower Genitourinary Infections in Women Alfred 0. Berg, MD, MPH, and Michael P. Soman, MD, MPH Seattle, Washington Vaginitis, cystitis, urethritis, and cervicitis are common diagnoses made in women attending family physicians’ offices. Recent research has fundamen­ tally altered available information on the diagnosis and management of these common genitourinary infections. This clinical review discusses presenting symptoms, physical findings, laboratory diagnostic aids, treatment, and follow-up for each lower genitourinary syndrome in women concluding with a summary flow chart illustrating an overall recommended approach. aginitis, cystitis, urethritis, and cervicitis collec­ toms predicts diagnosis accurately enough so that one V tively account for between 5 and 15 percent of all or more diagnoses can be eliminated from considera­ visits by women to family physicians.1 Women rarely, tion at the outset. Evidence is mixed. Komaroff2 found however, volunteer such diagnoses as complaints: ap­ that differentiating dysuria into external and internal pointments- are made for vaginal discharges and was helpful in establishing diagnoses of vaginitis and malodor, dysuria, urgency, vulvar pruritus, and other cystitis-urethritis, respectively. He further identified symptoms. Translating symptoms into treatable diag­ three clinical groups that would allow the physician to noses is an important part of the physician’s task dur­ focus the remainder of the examination: ing the office visit. Unfortunately, clinical syndromes 1. Vaginal discharge and irritation absent, internal overlap, physical findings may be nonspecific, and dysuria and frequency present. This group had a very microbiological confirmation of diagnoses may be both low probability of vaginitis and high probability of uri­ expensive and untimely.
    [Show full text]
  • Urinary Tract Infection in Adults
    ADULT UTI URINARY TRACT INFECTION IN ADULTS Urinary tract infection in adults is common and may be complicated or uncomplicated. Infection of the urinary tract (UTI) is frequently encountered in clinical practice — in the USA these infections account for approximately 7 million office visits annu- ally. The reported incidence in women is 11% per year and approximately 50% of all women have at least one UTI in their lifetime.1,2 UTI accounts for 40% of nosocomial infections and catheter use is the leading cause.3 Up to 25% of hos- pitalised patients undergo catheterisation and the incidence of bacteriuria is 5% per day.4 Symptomatic UTI exists when clinical symptoms are attributable to bacteria in the normally sterile urinary tract. Symptoms vary depending on the site of infection (lower or upper tract). • Uncomplicated UTI describes infection where the urinary tract is entirely nor- ELIZABETH COETZER mal. MB ChB, FCP (SA) • Complicated UTI occurs where the urinary tract is compromised, either struc- Specialist Physician turally, functionally, metabolically or immunologically. Pretoria East Hospital Asymptomatic UTI is identified when organisms can be isolated in appropriate numbers from urine in the absence of symptoms. Elizna Coetzer graduated at the University of Pretoria and did her internship at Adult patients with UTI can be categorised according to different clinical syn- Boksburg-Benoni Hospital. She was dromes (Fig. 1). Medical Registrar in the Department of 1,5 Medicine at Groote Schuur Hospital from DEFINITIONS AND DIAGNOSTIC TESTS 1998 to 2001. She completed 2 years at Bacterial invasion of the urinary tract causes an inflammatory response resulting the UCT Renal Unit and is currently a spe- in bacteriuria and pyuria.
    [Show full text]
  • Pyuria in Pediatrics
    Is Pyuria Necessary to Diagnose Pediatric UTI? Howard Uman, MD Pediatrician An Answer to Joe Breuner 3-month-old female with fever >102, no localizing source. Workup: UA (–), UC (+) >100,000 E coli WBC 20, 75% PMN; blood culture (-),CRP 10 “10% of infants with pyelonephritis have no pyuria” ? Early in course ? Inadequate time to mild inflammatory response ? “Immaturity of inflammatory response” Finding a reliable model… “diagnostic accuracy of the urinalysis for urinary tract infection in infants <3 months of age,” Shroeder, et al, pediatrics volume 135, #6, June 2015, PE. 965–971. Sample: “True UTI”—urosepsis with (+)UC + (+)BC (vs NOT “asymptomatic bacteriuria”) Invasion of renal parenchymabacterial multiply invade bloodstream Damage occurs as a byproduct of the body’s own inflammatory response Findings from Schroeder, 2016 “pyuria is a reliable finding in “true UTI” Pyuria present in 96–99.5% “UA sensitivity in bacteremic UTI is higher than previous reports in infants with UTI in general…”: >99% sensitivity for pyuria and/or LE With UC(-): 87.8% LE (-) and WBC (-) Previous studies promoted “faulty gold standards”—results skewed by inclusion of (+)UC caused by “contaminants or asymptomatic bacteriuria” Problem with Schroeder, 2016 Definition of pyuria: >3 WBC/ high power field Definition of (+) leukocyte esterase: “Any” ( trace–(1+)-(2+)-(3+) ) 2011 AAP guidelines Diagnosis of UTI based on pyuria and significant colony count in and “appropriately collected” urine specimen Lowered threshold for (+)UC: 50,000 colonies of a recognized uropathogen Pyuria definition: >5-10 WBC Questions remain What is the actual threshold for WBC in UA? Cf: CSF, joint fluid Questions remain How reproducible is the UA? Technique may effect the UA (semi quantitative) Suggestion of “enhanced UA”: UA by hemocytometer Questions remain Correlation with acute phase reactants: CRP, pro calcitonin Expect inflammatory markers should reflect invasive disease.
    [Show full text]
  • Urinalysis and Urinary Tract Infection: Update for Clinicians
    Infect Dis Obstet Gynecol 2001;9:249–255 Urinalysis and urinary tract infection: update for clinicians Jennifer L. Young and David E. Soper Medical University of South Carolina, Charleston, SC Dysuriais a common presentingcomplaint of women andurinalysis is a valuable tool inthe initial evaluationof this presentation.Clinicians need to beaware that pyuriais the bestdeterminate of bacteriuriarequiring therapy and that valuessignificant for infection differ dependingon the method of analysis.A hemocytometer yieldsa valueof ³ 10 WBC/mm3 significantfor bacteriuria, while manual microscopystudies show ³ 8 WBC/high-power field reliably predictsa positiveurine culture. In cases of uncomplicatedsymptomatic urinarytract infection, a positive valuefor nitrites and leukocyte esterase by urine dipstick can be treatedwithout the needfor a urineculture. Auto- mated urinalysisused widely inlarge volume laboratoriesprovides more sensitivedetection of leukocytesand bacteria inthe urine.With automated microscopy,a valueof > 2WBC/hpf issignificant pyuria indicative of inflam- mation ofthe urinarytract. In complicated casessuch as pregnancy, recurrent infection or renal involvement, further evaluation is necessary including manual microscopy and urine culture with sensitivities. Key words: D YSURIA; PYURIA; BACTERIURIA; URINE CULTURE; AUTOMATED URINALYSIS Asmany as oneinfour women experience anepi- bringthe clinician upto date on automated sodeof dysuriaeach year, makingthis oneof the urinalysis procedures. most commonpresenting complaints of women seen byclinicians 1.Dysuria suggests thediagnosis BACTERIURIA IN DIAGNOSIS ofcystitis butmay bepresentin other conditions suchas vaginitis, chlamydial urethritis orpyelo- While aurineculture is thegold standard in the nephritis2.Urinalysis is valued as aquickand in- diagnosis ofaUTI, thelimitations ofthis test have expensive screening methodfor the presence ofa led many physiciansto use urinalysis asaninitial lowerurinary tract infection (UTI). Oftenthis test step inthe evaluation ofdysuria.
    [Show full text]
  • Sterile Pyuria Masashi Narita
    Reprinted from www.antimicrobe.org Sterile Pyuria Masashi Narita Pyuria is defined as the presence of leukocytes in the urine and suggests that inflammation exists in the urinary tract. Polymorphonuclear leukocytes are the predominant cell type in urinary tract infections. Monocytes, lymphocytes and eosinophils suggest interstitial nephritis. Inflammation of the adjacent structure of prostate and urethra can also cause sterile pyuria. Noninfectious systemic diseases, structural/abnormalities of the urinary tract, and adverse effects of drugs can also produce sterile pyuria (Table 1). One common cause of sterile pyuria is that of a chronic indwelling foley catheter which may cause bladder wall irritation and subsequent low grade pyuria. Infectious diseases with sterile pyuria include microorganisms not detected by standard bacteriological media including Mycobacterium tuberculosis, fungi, viruses (herpesviruses, adenoviruses, varicella-zoster virus), leptospirosis, brucellosis, and parasites (Schistosomiasis). Fastidious bacteria such as Hemophilus influenzae will also not be detected by routine cultures. Systemic fungal infection such as Cryptococcus neoformans, Blastomyces dermatitidis or Coccodioides immitis involving the prostate or epididymitis can cause sterile pyuria in the urine. Urinary tract infection treated with antibiotics may show pyuria for up to a week following discontinuation of the antibiotics. A perinephric abscess may lead to subsequent sterile pyuria. Systemic causes of sterile pyuria include diabetic nephropathy and
    [Show full text]
  • Screening for Asymptomatic Bacteriuria in Pregnancy: Urinalysis Vs Urine Culture Abdulrazak Abyad, M D, M PH Tucson, a Rizona
    Screening for Asymptomatic Bacteriuria in Pregnancy: Urinalysis vs Urine Culture Abdulrazak Abyad, M D, M PH Tucson, A rizona Background. Asymptomatic bacteriuria is common dur­ organism with a bacteria level o f at least 1000 organ­ ing pregnancy. Its average prevalence is 6%. It is an isms per milliliter. In the prediction of a positive cul­ important risk factor for acute pyelonephritis, hyper­ ture, the microscopic findings o f five or more leuko­ tension, preeclampsia, fetal wastage, low birthweight, cytes per high-power field (HPF) showed a sensitivity and prematurity. This study was performed to deter­ o f 94.4% and a specificity o f 95.0% . mine the usefulness of urine microscopy as a substitute Conclusions. Physicians should test the urine of for doing a screening urine culture. all prenatal patients at their first visit and send to the M ethods. The medical records o f all first trimester laboratory only those specimens with 5 or more obstetric visits from 1984 to 1990 were reviewed at a leukocytes per HPF. Using this method, unnecessary major university. The results o f 888 screening urinaly­ screening urine cultures will be substantially ses were recorded and compared with those of subse­ reduced. quent urine cultures. K ey words. Bacteriuria; pregnancy; urine; culture; R esults. Fifty-four cultures had growth o f a single microscopy. / Fam Pract 1991; 33:471-474. Pregnancy substantially alters the function o f the urinary nancy can reduce the incidence of pyelonephritis and tract1 and increases the risk o f infection, potentially caus­ possibly the incidence of low birthweight babies.13- 16 ing maternal and fetal morbidity.
    [Show full text]
  • Clinical Characteristics of Kawasaki Disease with Sterile Pyuria
    Original article Korean J Pediatr 2013;56(1):13-18 http://dx.doi.org/10.3345/kjp.2013.56.1.13 pISSN 1738-1061• eISSN 2092-7258 Korean J Pediatr Clinical characteristics of Kawasaki disease with sterile pyuria Ja Yun Choi, MD, Sun Young Park, MD, Kwang Hae Choi, MD, PhD, Yong Hoon Park, MD, PhD, Young Hwan Lee, MD, PhD Department of Pediatrics, Yeungnam University College of Medicine, Daegu, Korea Purpose: Kawasaki disease (KD) is a systemic vasculitis and affects many organ systems. It often Corresponding author: Young Hwan Lee MD, PhD Department of Pediatrics, Yeungnam University presents sterile pyuria, microscopic hematuria, and proteinuria due to renal involvement. The aims College of Medicine, 170 Hyeonchung-ro, Nam- of this study were to define clinical characteristics of acute KD patients with pyuria and to analyze gu, Daegu 705-717, Korea meaning of pyuria in KD. Tel: +82-53-620-4381 Methods: The medical records and laboratory findings including serum and urine test of 133 patients Fax: +82-53-629-2252 E-mail: [email protected] with KD admitted to Yeungnam University Hospital from March 2006 to December 2010 were reviewed retrospectively. Received: 14 September 2011 Results: Forty patients had sterile pyuria and their clinical characteristics including age, gender Revised: 12 June 2012 and body weight were not significantly different with those who did not have pyuria. Fever duration Accepted: 19 October 2012 after treatment was significantly longer in KD patients with pyuria. Erythrocyte sedimentation rate, C-reactive protein and serum concentration of alanine aminotransferase were significantly higher in patients with pyuria.
    [Show full text]