Identification of the Function of the Vpx Protein of Primate Lentiviruses

University of Massachusetts Medical School eScholarship@UMMS

GSBS Dissertations and Theses Graduate School of Biomedical Sciences

2009-12-14

Identification of the unctionF of the Vpx Protein of Primate Lentiviruses: A Dissertation

Xiaonan Zhu University of Massachusetts Medical School

Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/gsbs_diss

Part of the Amino Acids, Peptides, and Proteins Commons, Cells Commons, Genetic Phenomena Commons, and the Viruses Commons

Repository Citation Zhu X. (2009). Identification of the unctionF of the Vpx Protein of Primate Lentiviruses: A Dissertation. GSBS Dissertations and Theses. https://doi.org/10.13028/cgm8-q756. Retrieved from https://escholarship.umassmed.edu/gsbs_diss/447

This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in GSBS Dissertations and Theses by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected].

IDENTIFICATION OF THE FUNCTION OF THE VPX PROTEIN OF PRIMATE LENTIVIRUSES

A Dissertation Presented

XIAONAN ZHU

Submitted to the Faculty of the University of Massachusetts Graduate School of Biomedical Sciences, Worcester in partial fulfillment of the requirement for the degree of

DOCTOR OF PHILOSOPHY

Dec 14, 2009

PROGRAM IN IMMUNOLOGY AND VIROLOGY

iii

Parts of this dissertation have appeared in separate publications: Sharova N*, Wu Y*, Zhu X, Stranska R, Kaushik R, Sharkey M, Stevenson M. (2008) Primate lentiviral Vpx commandeers DDB1 to counteract a macrophage restriction. PLoS Pathog. 4 (5):e1000057.

Kaushik R*, Zhu X*, Stranska R, Wu Y, Stevenson M. (2009) A cellular restriction dictates the permissivity of nondividing monocytes/macrophages to lentivirus and gammaretrovirus infection. Cell Host Microbe. 6 (1):68-80.

*These authors contributed equally.

Collaborators contributed to the study presented in this dissertation:

Dr. Natalia Sharova: SIVΔVpx and HIV-1ΔVpr infection in macrophages, which laid the foundation for this study, was performed by Dr. Natalia Sharova (Figure 3-1 and Figure 3-4). The data showing the effect of proteasome inhibitor on HIV-1 infection (Figure 4-4A) was generated by Natalia.

Dr. Yuanfei Wu: The fluorescent image of macrophages infected by HIV-1 GFP (Figure 3-16) was generated by Dr. Yuanfei Wu. The study of Vpx ubiquitylation and DDB1 interaction (Figure 4-1 and Figure 4-5) was performed by Dr. Yuanfei Wu. Figure 4-6 was a result of collaboration between Yuanfei and I. Yuanfei performed the siRNA knockdown experiment and constructed the Vpr-DDB1 fusion protein.

Dr. Ruzena Stranska: The heterokaryon experiments shown in Figure 3-2 and Figure 5-1 were performed by Dr. Ruzena Stranska.

Dr. Rajnish Kaushik: The fluorescence image of macrophages infected by MLV shown in figure 3-18B was generated by Dr. Rajnish Kaushik. iv

ACKNOWLEDGEMENTS

First and foremost, I would like to thank my mentor, Mario Stevenson, for his support and insightful discussions during my time in his lab. He encouraged me to think independently and scientifically, which has been very helpful for my professional development.

I would not have been successful in my thesis work without the help and support from all the collaborators Natalia Sharova, Yuanfei Wu, Ruzena Stranska, Rajnish

Kaushik and Mark Sharkey. We worked closely together and had lots of great discussions.

They also encouraged me a lot and taught me experimental techniques.

I am so lucky to have Maria Zapp, Paul Clapham and Celia Schiffer on my thesis research committee. They are the ones who are always there helping and encouraging me, even during the most difficult times. I was always being told how much I have done and those encouraging remarks always kept me motivated. I also enjoyed all the constructive suggestions from them. I would also like to thank Heinrich Gottlinger and Ann Sheehy for being on my dissertation committee, and taking time and effort to evaluate my work.

I would also like to thank all the past and present members of Stevenson’s lab who have been like my family for the last several years supporting me personally and scientifically. They created a great scientific environment and made my study here full of fun and memorable moments. I would especially like to thank Yuanfei Wu and Patrick

Younan for their time in completion of this thesis.

Last but not least, I would like to thank my husband and my parents. Without their unconditional love and support, I would not have completed the six years of graduate studies. I am also grateful that I have so many friends who have supported and encouraged me along every step of my way. v

ABSTRACT

Primate lentiviruses encode four “accessory proteins” including Vif, Vpu, Nef, and

Vpr/ Vpx. Vif and Vpu counteract the antiviral effects of cellular restrictions to early and late steps in the viral replication cycle. The functions of Vpx/ Vpr are not well understood.

This study presents evidence that the Vpx proteins of HIV-2/ SIVSM promote HIV-1 infection by antagonizing an antiviral restriction in myeloid cells.

Fusion of macrophages in which Vpx was essential for virus infection, with COS cells in which Vpx was dispensable for virus infection, generated heterokaryons that supported infection by wild-type SIV but not Vpx-deleted SIV. The restriction potently antagonized infection of macrophages by HIV-1, and expression of Vpx in macrophages in trans overcame the restriction to HIV-1 and SIV infection. Similarly, the cellular restriction is the obstacle to transduction of macrophages by MLV. Neutralization of the restriction by Vpx rendered macrophages permissive to MLV infection. Vpx was ubiquitylated and both ubiquitylation and the proteasome regulated the activity of Vpx.

The ability of Vpx to counteract the restriction to HIV-1 and SIV infection was dependent upon the HIV-1 Vpr interacting protein, damaged DNA binding protein 1

(DDB1), and DDB1 partially substituted for Vpx when fused to Vpr.

This study further demonstrates that this restriction prevents transduction of quiescent monocytes by HIV-1. Although terminally differentiated macrophages are vi

partially permissive to HIV-1, quiescent monocytes, which are macrophage precursors,

are highly refractory to lentiviral infection. Monocyte-HeLa heterokaryons were resistant

to HIV-1 infection, while heterokaryons formed between monocytes and HeLa cells

expressing Vpx were permissive to HIV-1 infection, suggesting the resistance of

quiescent monocytes to HIV-1 transduction is governed by a restriction factor.

Encapsidation of Vpx within HIV-1 virions conferred the ability to infect quiescent

monocytes. Introduction of Vpx into monocytes by pre-infection also rendered quiescent

monocytes permissive to HIV-1 infection. Infection of monocytes by HIV-1 either with

or without Vpx did not have an effect on temporal expression of CD71. In addition, Vpx

increased permissivity of CD71– and CD71+ cells to HIV-1 infection with no apparent

bias. These results confirm that Vpx directly renders undifferentiated monocytes permissive to HIV-1 transduction without inducing their differentiation. The introduction

of Vpx did not significantly alter APOBEC3G complex distribution, suggesting a

restriction other than APOBEC3G was responsible for the resistance of monocytes to

HIV-1.

Collectively our results indicate that macrophages and monocytes harbor a potent

antiviral restriction that is counteracted by the Vpx protein. The relative ability of primate

lentiviruses and gammaretroviruses to transduce non-dividing myeloid-cells is dependent

upon their ability to neutralize this restriction. vii

TABLE OF CONTENTS

ACKNOWLEDGEMENTS...... iv

ABSTRACT...... v

LIST OF TABLES ...... x

LIST OF FIGURES ...... xi

ABBREVIATIONS ...... xiv

CHAPTER I Background and Introduction...... 1

1.1 General Introduction to Primate Lentiviruses...... 1

1.2 Introduction to Restriction Factors ...... 13

1.3 Introduction to Vpx and Vpr Proteins...... 23

1.4 Monocyte Infection by HIV-1...... 28

CHAPTER II Materials and Methods...... 31

2.1 Clones...... 31

2.2 Cell Culture ...... 34

2.3 Production of Virus Stocks ...... 35

2.4 Infection...... 36

2.5 Analysis of Viral Infection by Quantitative PCR...... 37

2.6 Proteasome Inhibition...... 37

2.7 COS-Macrophage Cell Staining and Cell Fusion ...... 39

2.8 HeLa-Monocyte Cell Staining and Cell Fusion...... 40

2.9 Virion Precipitation, Protein Purifications and Western Blotting ...... 41

2.10 Analysis of Vpx Ubiquitylation...... 41

2.11 RNA interference of DDB1 ...... 42

2.12 Vpx-DDB1 co-immunoprecipitation ...... 43 viii

2.13 Dose Dependent Analysis of Vpx...... 43

2.14 FACS and Monocyte/Macrophage Immunophenotyping ...... 44

2.15 APOBEC3G Analysis...... 44

CHAPTER III Vpx Promotes Macrophage Infection by HIV-1 and MLV...... 46

3.1 Chapter Summary...... 46

3.2 SIVSM Vpx but not Vpr is Required for Infection of Human Macrophages by SIVSM...... 48

3.3 Macrophages Harbor a Restriction Factor that is Counteracted by the Vpx Protein ...... 50

3.4 HIV-1 Vpr is Dispensable for HIV-1 Reverse Transcription in Macrophages...... 55

3.5 The Antiviral Restriction Which Antagonizes SIVSM Infection of Macrophages is Active against HIV-1 ...... 57

3.6 Vpx Counters the Restriction and Promotes HIV-1 infection in trans...... 69

3.7 Vpx Renders Macrophages Permissive to MLV Infection...... 76

CHAPTER IV Proteasome/Ubiquitylation Pathway and DDB1 Interaction are Required for the Ability of Vpx to Counteract the Restriction ...... 80

4.1 Chapter Summary...... 80

4.2 Vpx Activity Requires Ubiquitylation and Functional Proteasome...... 81

4.3 Vpx Function Requires DDB1...... 90

4.4 HIV-1 Vpr Impairs the Ability of Vpx to Neutralize the Macrophage Restriction ...... 94

4.5 Primary HIV-1 Vpr Alleles Fail to Overcome the Macrophage Restriction ...... 98

4.6 The Ability of Vpx to Neutralize the Restriction is Dose Dependent...... 99

CHAPTER V Vpx Renders Primary Monocytes Permissive to HIV-1 Transduction ...... 104

5.1 Chapter Summary...... 104

5.2 The Resistance of Quiescent Monocytes to Lentivirus Transduction is Governed by a Restriction 105

5.3 Vpx Counteracts a Monocyte Restriction to HIV-1 Infection in trans...... 109

5.4 Vpx Renders Monocytes Permissive to HIV-1 Infection without Inducing Monocyte Differentiation...... 112

5.5 Vpx Promotes HIV-1 Infection of Quiescent Monocytes without Preferably Infecting Differentiated Monocytes...... 115 ix

5.6 Vpx Affects Monocyte Permissivity Independent of APOBEC3G ...... 123

CHAPTER VI Summary and Discussions...... 125

6.1 Myeloid Cell Permissivity to Lentiviruses and Gammaretroviruses is Determined by a Restriction ...... 125

6.2 Vpx but not Vpr Removes a Restriction in Myeloid Cells ...... 128

6.3 Vpx Function Requires Proteasome/Ubiquitylation Pathway and DDB1 Interaction ...... 131

6.4 Characteristics of the Restriction Factor in Myeloid Cells ...... 133

6.5 Restrictions as Novel Targets for Antiviral Therapy...... 135

6.6 Future Directions ...... 136

REFERENCES...... 140

LIST OF TABLES

Table 1-1 Proposed functions of HIV-1 Vpr, HIV-2/SIVSM Vpr and 27

HIV-2/SIVSM Vpx based on previous studies. Table 2-1 Primers and probes for quantitative real-time PCR. 38

Table 6-1 Functional comparison of HIV-1 Vpr, HIV-2/SIVSM Vpr and 129

HIV-2/SIVSM Vpx based on this study.

LIST OF FIGURES

Figure 1-1 The phylogenetic tree of primate lentiviruses. 3 Figure 1-2 General aspects of the primate lentivirus replication cycle. 9 Figure 1-3 Process of reverse transcription of the lentiviral genome. 12 Figure 1-4 Model of APOBEC3G mediated restriction 15 Figure 1-5 The mechanism of Vif-dependent APOBEC3G degradation 17 Figure 1-6 The structure of TRIM5α and the mechanism of TRIM5α- mediated 19 lentivirus restriction

Figure 1-7 Model of tetherin mediated inhibition of HIV-1 virion release 24 Figure 1-8 Predicted 3-helix structure of Vpx and Vpr. 25 Figure 3-1 Differential susceptibility of macrophages and cell lines to infection 49 by wild-type and Vpx-deleted (ΔVpx) or Vpr-deleted (ΔVpr)

variants of SIVSM. Figure 3-2 Vpx antagonizes an antiviral restriction in macrophages. 52

Figure 3-3 Model of the function of Vpx in SIVSM infection of macrophages. 54 Figure 3-4 Vpr is dispensable for HIV-1 infection of macrophages at the level 56 of reverse transcription.

Figure 3-5 Structure of chimeric clones between HIV-1 and SIVSM. 58 Figure 3-6 Vpx is required for SHIV-MA infection of macrophages. 60 Figure 3-7 Vpx is required for SHIV-CA infection of macrophages. 61 Figure 3-8 Vpx is required for SHIV-NA infection of macrophages. 62 Figure 3-9 Vpx is required for SHIV-RT infection of macrophages. 63 Figure 3-10 A schematic of chimeric proviral clone NL43 (SIV-Vif-Env) and 64 Vpx-deleted variant NL43 (SIV-Vif-EnvΔVpx)

Figure 3-11 Vpx promote NL43 (SIV-Vif-Env) infection in macrophages. 66 xii

Figure 3-12 A schematic of chimeric proviral clone NL43 (SIV-Vif-Vpx) and 67 Vpx-deleted variant NL43 (SIV-Vif-ΔVpx).

Figure 3-13 Vpx promote NL43 (SIV-Vif-Vpx) infection in macrophages. 68 Figure 3-14 Vpx enhances HIV-1 spreading infection in macrophages. 70 Figure 3-15 HIV-1 is sensitive to the macrophage restriction and SIV Vpx but 73 not HIV-1 Vpr antagonizes the restriction.

Figure 3-16 Vpx enhances transduction of macrophages by GFP- expressing 74 HIV-1.

Figure 3-17 SIVSM Vpx promotes NA20 B59/NL43ΔVpr infection in 75 macrophages.

Figure 3-18 Vpx permits transduction of macrophages by MLV in trans. 78 Figure 4-1 Identification of ubiquitylated residues in Vpx. 83 Figure 4-2 Packaging of Vpx proteins in wild-type and Vpr-deleted HIV-1. 85 Figure 4-3 Ubiquitylation is required by Vpx for enhancement of HIV-1 86 infectivity in macrophages.

Figure 4-4 The ability of Vpx to enhance permissivity of macrophages to 88 HIV-1 and MLV infection requires a functional proteasome.

Figure 4-5 Vpx ubiquitylation is required for Vpx interaction with DDB1. 91 Figure 4-6 DDB1 is required for the ability of Vpx to counteract the restriction 93 to macrophage infection by HIV-1 and SIV.

Figure 4-7 HIV Vpr inhibits the ability of SIVSM Vpx to antagonize the 95 macrophage restriction.

Figure 4-8 Vpx delivered to macrophages by SIVWT infection enhances the 97

permissivity to HIV-1WT and HIV-1ΔVpr infection. Figure 4-9 Primary HIV-1 Vpr alleles fail to overcome the macrophage 100 restriction. xiii

Figure 4-10 Dose-dependent ability of packaged Vpx to counteract a 102 macrophage restriction.

Figure 5-1 Transduction of primary monocytes by HIV-1 is blocked by a 107 restriction.

Figure 5-2 HIV-1 virions encapsidating Vpx efficiently transduce primary 110 monocytes.

Figure 5-3 Vpx delivered to monocytes by SIVWT infection removes a block to 113 subsequent infection by HIV-1.

Figure 5-4 Vpx Renders Monocytes Permissive to HIV-1 Infection without 116 Inducing Monocyte Differentiation.

Figure 5-5 HIV-1 virions encapsidating Vpx efficiently transduce CD71– 119 monocytes.

Figure 5-6 HIV-1 with encapsidated Vpx equally transduces undifferentiated 120 (CD71–) and differentiated (CD71+) monocyte populations.

Figure 5-7 Vpx enhances late product and 2-LTR cDNA production in 122 undifferentiated CD71– cell population.

Figure 5-8 Vpx renders monocytes permissive to HIV-1 infection without 124 inducing APOBEC3G redistribution.

xiv

ABBREVIATIONS

AID Activation-Induced Deaminase AIDS Acquired Immunodeficiency Syndrome APC Antigen Presenting Cell APOBEC3G Apolipoprotein B mRNA-Editing Catalytic Polypeptides 3G AZT Azidothymidine BST-2 Bone Marrow Stromal Cell Antigen 2 CA Capsid CUL5 Cullin-5 CTL Cytotoxic T-Lymphocyte DDB1 Damaged DNA Binding Protein 1 FACS Fluorescence-Activated Cell Sorting FPLC Fast Protein Liquid Chromatography GFP Green Fluorescent Protein GPCR G Protein-Coupled Receptor GPI Glycosylphosphatidylinositol HIV Human Immunodeficiency Virus HMM High Molecular Mass IN Integrase LMM Low-Molecular-Mass LPS Lipopolysaccharide LTR Long Terminal Repeat MA Matrix MHC Major Histocompatibility Complex MLV Murine Leukemia Virus xv

mRNA Micro-RNA NC Nucleocapsid PBMC Peripheral Blood Mononuclear Cell PBS Primer Binding Site PEG Polyethylene Glycol PIC Pre-Integration Complex PPT Polypurine-Track PR Protease RBX1 Ring-Box-1 RRE Rev Response Element RT Reverse Transcriptase SIV Simian Immunodeficiency Virus TAR Transactivation Response Element TM Transmembrane TRIM5α Tripartite Motif-5α Isoform Ub Ubiquitin UDG Uracil DNA Glycosylase VSV-G Vesicular Stomatitis Virus G Envelope Protein WT Wild-type 1

CHAPTER I

Background and Introduction

1.1 General Introduction to Primate Lentiviruses

Human immunodeficiency virus (HIV) is the virus that causes acquired immunodeficiency syndrome (AIDS), which leads to opportunistic infections or malignancies due to CD4+ T cell depletion and the progressive failure of the immune system. According to the World Health Organization, as of Dec 2007, there were 33 million people living with HIV, while 2 million deaths were affiliated to AIDS in 2007 alone (1). AIDS is now one of the leading causes of death and loss of life quality worldwide. Effectively fighting HIV/AIDS is one of the most urgent challenges in the world.

HIV and the closely related Simian immunodeficiency virus (SIV) are lentiviruses that belong to the retrovirus family, the Retroviridae. They are RNA viruses that encode reverse transcriptase (RT), which catalyzes the synthesis of cDNA from viral genomic

RNA. Viral DNA is ultimately integrated into the host genome and the integrated proviral DNA directs gene expression. Below is a primate lentivirus phylogenetic tree.

HIV-1 group M, which is responsible for the majority of the global AIDS pandemic, as well as groups N and O evolved from the chimpanzee virus SIVCPZ (2, 3). HIV-2, which is slightly attenuated with regards to disease progression, evolved from SIVSM, which 2

naturally infects sooty mangabey (4, 5). SIVSM was used to generate the various rhesus macaque-adapted SIVMAC viruses that are often used for AIDS pathogenesis study. There is another cluster that includes SIVAGM evolved from African green monkeys (Figure 1-1)

(6).

Lentiviral Pathogenesis and Reservoirs

In its natural hosts, SIV does not cause AIDS even with high viral loads. However,

SIV infection of rhesus macaques, and HIV-1 infection of human cause progression to

AIDS. HIV-1 primarily infects immune cells including CD4+ T lymphocytes, tissue macrophages, and dendritic cells. Infection of these cells accounts for the major aspects of HIV-1 pathogenesis in vivo. The depletion of CD4+ T cells is the main reason for the progression to AIDS in HIV-1 infected patients. Upon initial HIV-1 infection, there is active viral replication but viral replication is limited by a strong immune pressure and this leads to the partial recovery of peripheral CD4+ T cells. Infection then enters an asymptomatic phase characterized by low levels of viral load with no disease symptoms, which ultimately leads to loss of cell-mediated immunity due to a reduction in CD4+ T cell numbers. This is the onset of the AIDS stage in which the patient becomes progressively more susceptible to opportunistic infections that inevitably lead to death in the vast majority of untreated patients (7). This model was primarily based on the study of the peripheral CD4+ T cell counts. Recent studies showed that during acute HIV 3

HIV Sequence Compendium 2001

Figure 1-1. The phylogenetic tree of primate lentiviruses (6). Phylogenetic relationships of primate lentiviruses with major clusters shown: HIV-1/SIVCPZ,

HIV-2/SIVMAC/SIVSM, and SIVAGM.

infection, the frequency of infection was especially high in memory CD4+ T cells in the gut, and depletion of these cells led to increased gut permeability with microbial translocation. Higher circulating LPS level drives systemic immune activation and leads to chronic HIV infection (8, 9).

HIV-1 infection of macrophages, dendritic cells and other non-T cells may also play essential roles in several critical aspects of HIV disease. In addition to CD4+ T lymphocytes, monocyte-macrophage lineage and dendritic cells may form viral reservoirs in HIV-1 infection. HIV-1 in macrophages is assembled in intracellular vesicles and virions can be transmitted from macrophages to T cells across transient virological synapses (10–12). HIV-1virions that are assembled intracellularly within monocyte-derived macrophages persist and retain infectivity for extended intervals (13), confirming that macrophages serve as a HIV-1 reservoir and contribute to viral persistence. In addition, macrophages are able to cross the blood-brain barrier and spread viruses in the immuno-privileged central nervous system (CNS) ( 14 ). Although monocytes express the required HIV-1 receptors and coreceptors, they are not productively infected by HIV-1 in vitro (15, 16). HIV-1 infection of freshly isolated blood monocytes is blocked prior to the completion of reverse transcription and integration (16). Several studies indicate that peripheral monocytes may also serve as a viral reservoir in vivo. HIV-1 can be detected in blood monocytes. However, whether the 5

viruses are produced or are maintained latently in monocytes is unclear (17–20). Other evidence support monocytes as a HIV-1 reservoir by showing that there is continued evolution of HIV-1 sequences in peripheral monocytes following antiviral therapy (21).

CD16+ monocytes, which constitute about 5% of monocyte population, are more susceptible to HIV-1 infection and possibly harbor the viruses long-term in vivo (22).

Dendritic cells may also play a important role in the dissemination of HIV-1 following primary infection, as they can capture virions at the site of infection and provide HIV-1 access to the CD4+ T cells, by being infected and transmitting newly produced viruses, or by harboring infectious viruses without being infected (23). Studies have suggested that DC-SIGN mediates the capture and internalization of infectious virions that are subsequently transmitted to T cells, via the immunological synapses formed between dendritic cells and T cells (24).

HIV-1 genome organization and viral proteins

Nine open-reading frames are found in the HIV-1 genome, encoding viral gene products that include structural proteins, enzymes for virus replication, and proteins that regulate viral gene expression. The gag and env genes encode the structural proteins and the pol open-reading frame encodes the enzymatic proteins. They are common to all retroviruses.

The functions of HIV-1 gene products are reviewed in Fields virology (7). The 6

mature proteins of Matrix (MA, p17), Capsid (CA, p24), Nucleocapsid (NC, p7) and p6 are cleaved from the Gag polyprotein by the virus-encoded protease during maturation.

MA is responsible for membrane anchoring and interacts with envelope. MA also contains cytotoxic T-lymphocyte (CTL) epitopes. CA is an important structural protein that forms the conical core of the viral particle. NC binds and incorporates viral RNA into virions. P6 contains a late domain that promotes virus release, and Vpx/Vpr binding domains that mediate the incorporation of Vpx/ Vpr proteins into assembling virions.

Several distinct enzymatic proteins are encoded by the pol open-reading frame, including protease (PR, p15), reverse transcriptase (RT, p66/ p51), and integrase (IN, p31). PR is responsible for Gag/ Pol cleavage and maturation. RT has RNA-dependant and DNA-dependant polymerase activity and synthesizes DNA from viral RNA, while the RNase H activity of RT removes the RNA template strand from the RNA/ DNA duplex. IN catalyzes viral DNA integration into the host genome. RT and PR are the most targeted enzymes in antiviral therapies.

Env glycoprotein is cleaved by a cellular endopeptidase to yield gp120 surface (SU) and gp41 transmembrane (TM) proteins. Gp120 interacts with the CD4 receptor and chemokine coreceptors. Gp41 traverses the lipid bilayer and non-covalently binds to gp120, thus mediates the fusion of viral and cellular membranes.

HIV-1 gene expression is regulated by Tat (transactivator of transcription) and Rev 7

(regulator of virion expression) at the transcriptional and posttranscriptional levels, respectively. Tat (p16/ p14) is an essential viral transcriptional activator that promotes efficient HIV-1 long terminal repeat (LTR) specific viral transcription. This requires interaction of Tat with transactivation response element (TAR) which is located in the R region of LTR5. Rev (p19) is an RNA transporter and stabilizer. Rev binds to Rev

Response Element (RRE) and mediates the exportation of incompletely spliced mRNA that contains RRE to the cytoplasm, thus allows the production viral RNA genome and mRNA for viral proteins. The cellular Crm1 nuclear export factor is recruited to HIV-1 transcripts by Rev and thereby facilitates their nuclear egress.

The genomes of primate and non-primate lentiviruses also encode ‘accessory’ proteins from small open reading frames which are absent from the genomes of simple retroviruses. They are Vif (viral infectivity factor), Vpx (viral protein x)/ Vpr (viral protein r), Vpu (viral protein u), and Nef (negative factor). Accessory proteins were so named because they were dispensable for viral replication in some cell lines. However, recent studies have shown that they all play crucial roles in lentiviral replication and persistence (reviewed in (25)). Nef (p27) down regulates the major viral receptor CD4, the major histocompatibility complex (MHC) class I and class II molecules, as well as the T cell receptor TCR-CD3 (26–29). Two of the accessory proteins, Vif and Vpu, have been found to overcome restriction factors. Vif antagonizes the antiviral activity of 8

APOBEC3G (30). Vpu, which is not expressed in HIV-2 and SIVSM, antagonizes the activity of tetherin/ BST-2 (Bone marrow stromal cell antigen 2) to promote the release of virions from the cell surface (31). Vpu also mediates CD4 receptor degradation (32).

Vpx and Vpr both play important but less well defined roles in viral replication. Vpr has been reported to induce G2 cell cycle arrest and to promote HIV-1 infection in macrophages (33–37). HIV-2/SIVSM encodes an additional accessory protein Vpx, which is derived from an ancestral recombination event (38). Vpx is essential for SIV replication in simian macrophages and for dissemination and pathogenesis of SIV in vivo

(38–40).

Lentiviral LTRs, which are composed of U3, R, and U5, contain important regulatory regions such as those for transcription initiation and polyadenylation. They are also the sequences the IN uses to insert viral cDNA into host genomes.

Lentivirus life cycle

In the replication cycle of HIV-1, the virions undergo binding, fusion and uncoating, reverse transcription, nuclear import, integration, transcription and translation, assembly and budding to produce new virions (Figure 1-2). Viral entry into the target cells is mediated through sequential interactions of HIV-1 Env with the primary receptor

CD4, and coreceptors. CCR5 and CXCR4 appear to be the two major coreceptors for

HIV-1 entry into cells. HIV-1 is categorized into R5 and X4 tropic based on the 9

Rambaut A et al. Nat Rev Genet. 2004 Jan; 5(1):52-61.

Figure 1-2. General aspects of the primate lentivirus replication cycle ( 41 ).

Complete lentiviral life cycle is depicted as steps including virus binding, fusion and uncoating, reverse transcription, nuclear import, integration, transcription and translation, assembly and budding.

coreceptor usage during entry. Viruses that use the CCR5 receptor are termed R5 tropic, which mainly infect macrophages and dendritic cells. While those that use CXCR4 are termed X4 tropic, which mainly infect CD4+ T cells. However, coreceptor usage is not the only determinant for viral tropism and recent studies have shown that HIV-1 R5 viruses vary extensively in macrophage tropism (42). In addition to CCR5 and CXCR4, alternative coreceptors are used by lentiviruses. More than 10 members of seven-transmembrane G protein-coupled receptors (GPCRs) have been shown to support lentiviral entry in vitro, including CCR2b, CCR3, CCR8, D6, CXCR5/BLR1,

CXCR6/BONZO et al, although there is no clear evidence that they play a role in vivo

(43–4 7). After fusion, the viral core is released into cytoplasm and subsequently disassembles to liberate the viral genome, during a process called uncoating. The viral genome associates with the viral proteins including RT, IN, MA, NC to form a pre-integration complex (PIC), in which the viral RT catalyzes the synthesis of a linear double-stranded cDNA from single- stranded viral RNA. After transportation of PIC into the nucleus, the viral cDNA is integrated into the host genome by HIV IN. This integrated provirus may remain latent in an unexpressed form, particularly in resting lymphocytes. Upon activation, host RNA polymerase is used to generate transcripts including new viral genomic RNA and spliced mRNA molecules, which are transported to the cytoplasm for protein synthesis. The production of viral RNA and proteins is 11

regulated by Rev and Tat proteins. The de novo synthesized viral proteins are assembled with HIV-1 genome and the newly assembled viruses bud from the plasma membrane of infected cells. During particle maturation, the virion associated PR cleaves the immature

Gag and Gag–Pol precursors into functional viral proteins, leading to the production of infectious virions (7, 48).

The reverse transcription of HIV-1 is characterized by two strand transfers and requires two enzymatic activities of RT, including DNA polymerase activity that can use

RNA or DNA as a template and RNase H activity. The process is summarized in figure

1-3 (49). The tRNA binds to the primer binding site (PBS) and initiates the synthesis of minus strand strong-stop DNA. RNase H activity of RT then removes the U5 and R region of the RNA. With the first strand transfer, the minus strand strong-stop DNA jumps to the 3’ end of RNA and serves as a primer for minus strand DNA synthesis.

During the extension, RNase H removes the most of the viral RNA except for a region called polypurine-tract (PPT), which serves as a primer to initiate plus strand DNA synthesis. After completion of plus strand strong stop DNA, this small region of viral

RNA and tRNA is removed. With the second strand transfer the newly synthesized plus strand strong stop DNA jumps to the opposite end and pairs up with minus strand DNA at PBS sequence. The extension of 3’ end on both strands is the last step for the synthesis of linear double-stranded DNA with LTR sequences on both ends. Viral cDNA is 12

Sarafianos SG et al. EMBO J. 2001 Mar 15;20(6):1449-61.

Figure 1-3. Process of reverse transcription of the lentiviral genome (49). RNA strand is represented in black and DNA strand in red (A) Minus strand strong stop DNA synthesis is initiated by tRNA binding to the PBS. RNase H removes the U5 and R region of the RNA strand. (B) First strand transfers to the 3’ end of viral RNA and serves as primer for minus strand DNA extension. (C) Minus strand DNA extension, accompanied by RNase H digestion of all viral RNA except PPT. (D) PPT serves as a primer for plus strand strong stop DNA synthesis. (E) RNase H removes the tRNA and the PPT. (F) Minus and plus strands extend following second strand transfer and results in cDNA duplex with LTRs at both ends. 13

eventually integrated into the host genome, or forms circles containing one or two LTRs through recombination or direct ligation. Since 2-LTR circles are formed only after completion of reverse transcription, they can be used to determine the efficiency of reverse transcription post virus infection.

1.2 Introduction to Restriction Factors

Not all the cells support efficient viral infection. Cells that support efficient viral replication are called permissive cells. Cells that do not support efficient viral replication are called nonpermissive. Lentiviruses interact with various cellular factors throughout the viral life cycle. Nonpermissive cells either have evolved some mechanisms to restrict virus infection, or lack some positive factors that are essential for virus infection. Those host cellular factors whose expression restricts viral replication are named restriction factors. They constitute novel aspects of intrinsic immunity and act at different steps in the viral life cycle. Several restriction factors have been identified recently, including

APOBEC3G, TRIM5α, and Tetherin (30, 31, 50, 51). Many lentiviruses, in turn, have evolved mechanisms to inactivate or overcome the blocks to infection.

APOBEC3G (Apolipoprotein B mRNA-editing catalytic polypeptide 3G)

Vif, a 23-kDa basic protein, is encoded by the majority of lentiviruses. As a cytoplasmic protein, Vif exists in a soluble cytosolic form or a membrane-associated form. The latter form of Vif is a peripheral membrane protein that is tightly associated 14

with the cytoplasmic side of cellular membranes (52). Vif is dispensable for viral replication in “permissive” cell lines such as SupT1, CEM-SS, C8166, HeLa and 293T cells. However, Vif is essential for viral replication in “nonpermissive” cells such as primary CD4+ T cells, monocyte-derived macrophages, and certain T-cell leukemia lines such as CEM (53–55). Vifminus virions produced in nonpermissive cells are poorly infectious, whereas Vif minus virions produced in permissive cells are able to infect both permissive and nonpermissive cell types (56, 57).

In 2002, Sheehy and colleagues identified APOBEC3G through a cDNA subtraction screen for transcripts specifically expressed in nonpermissive cells (30).

APOBEC3G belongs to the APOBEC superfamily, which consists of APOBEC1,

APOBEC2, APOBEC3A to H, and the activation-induced deaminase (AID) gene (58,

59). They share a conserved cytidine deaminase motif, which acts as DNA mutators that target the genome of viruses by catalyzing deamination of cytidine (C) to uridine (U) in minus strand reverse transcripts, resulting in guanidine (G) to adenosine (A)

hypermutation in plus strand DNA (60-61). 61 In 62 the absence of Vif, APOBEC3G molecules are packaged into viral particles through interaction with viral RNA and Gag proteins (63, 64) and induce cytidine deamination in newly infected cells. Consequently, the infectivity of the virions produced from nonpermissive cells is dramatically impaired

(Figure 1-4) (65). However, there is evidence that the enzymatic activity of APOBEC3G

Harris RS, Liddament MT. Nat Rev Immunol. 2004 Nov; 4(11):868-77.

Figure 1-4. Model of APOBEC3G mediated restriction (65). In the absence of Vif,

APOBEC3G molecules are packaged into viral particles and induce G to A hypermutation in newly infected cells. Hypermutation of viral genomes leads to the degradation of nascent viral cDNA or mutations in viral genes, which hinders viral replication. Vif binds to the APOBEC3G molecules and eliminates APOBEC3G from producing cells through proteasomal degradation. 16

is not the only determinant of its antiviral activity (66–68). Deaminase-independent antiviral mechanisms, such as inhibition of tRNA primer annealing or strand transfer, may also play a role in the antiviral function of APOBEC3G (69, 70).

In an evolutionary conflict, the viral Vif protein antagonizes APOBEC3G by inhibiting its packaging into viral particles and therefore allows production of virions free of APOBEC3G. This involves the degradation of APOBEC3G through a proteasome/ubiquitylation system (65, 71). Vif binds to APOBEC3G before it can be packaged into newly assembled virions. The ability of Vif to antagonize APOBEC3G is species-specific and is decided by how efficiently Vif binds to APOBEC3G. (68). Vif recruits the cellular proteins elongin B and elongin C, which then mediate cullin-5

(CUL5)-ring-box-1 (RBX1)-dependent ligation of ubiquitins (Ub) to APOBEC3G.

Ubiquitylated APOBEC3G is subsequently degraded by the proteasome (Figure 1-5)

(65). However, a degradation-independent pathway was also suggested by observation that a Vif variant efficiently induced APOBEC3G degradation but was unable to restore viral infectivity (72).

Although APOBEC3G expressed in target cells does not generally inhibit virus replication (57), studies have suggested that the expression of APOBEC3G in CD4+ T cells or monocytes/macrophages determines their permissivity to HIV-1 (22, 73, 137).

Studies show that APOBEC3G is sequestered in an enzymatically active low-molecular- 17

Harris RS, Liddament MT. Nat Rev Immunol. 2004 Nov; 4(11):868-77.

Figure 1-5. The mechanism of Vif-dependent APOBEC3G degradation (65). Vif binds to APOBEC3G and recruits the cellular proteins elongin B and elongin C, which then mediate CUL5-RBX1-dependent Ubiquitylation of APOBEC3G. Ubiquitylated

APOBEC3G is subjected to proteasomal degradation.

mass (LMM) ribonucleoprotein complex in resting CD4+ T cells or quiescent monocytes thus restricts infection of these cells by HIV-1. However, in activated CD4+ T cells or macrophages, cytoplasmic APOBEC3G resides in an enzymatically inactive high-molecular-mass (HMM) form (22, 74, 137) that allows HIV-1 infection. Whether deamination is required for APOBEC3G activity in these cells remains unclear (137).

TRIM5α (Tripartite Motif-5α isoform)

HIV-1 enters old world monkey cells efficiently but is restricted before reverse transcription (75, 76). A dominant negative factor TRIM5α confers the post entry block to HIV-1 in old world monkey cells (51). HIV-1 replication is restricted efficiently by

TRIM5α derived from rhesus macaques and TRIMCyp from owl monkeys, but is less sensitive to TRIM5α from humans. SIV, which naturally infects old world monkeys, is less sensitive to restriction by rhesus monkey TRIM5α. Murine leukemia virus (MLV) is not restricted by rhesus TRIM5α, however, human TRIM5α efficiently restricts MLV

(50, 51, 77). These studies revealed the restriction activities of TRIM5α and its homologues derived from primate are species-specific.

TRIM5α is a trimeric cytoplasmic protein belonging to the TRIM (TRIpartite

Motif) family, which was first identified by Reddy in 1992 as proteins containing a

RING domain, a B-box, and a coiled-coil region (78). TRIM5α is an isoform containing a carboxy-terminal SPRY (B30.2) domain (Figure 1-6). The coiled-coil domain is 19

Emerman M. Proc Natl Acad Sci U S A. 2006 Apr 4;103(14):5249-50.

Figure 1-6. The structure of TRIM5α and the mechanism of TRIM5α-mediated lentivirus restriction (79). (A) The structure of TRIM5α is composed of a RING domain, a B-box, a coiled-coil region and a carboxy-terminal B30.2 domain. (B) The mechanism of TRIM5α-mediated restriction. After virus binding and fusion with host cells, viral core disassembles and viral RNA is released for reverse transcription. The

CA proteins on viral core are targeted by TRIM5α thus leading to accelerated uncoating.

As a result reverse transcription is compromised. 20

necessary for TRIM5α multimerization and is required for anti-viral restriction. The sequence in the SPRY domain is highly variable and contributes to the species-specific restriction, while in the TRIMCyp isoform from owl monkeys, this region is substituted by a CypA domain (50, 80–82). A single amino acid change (Arginine 332) in this region has been reported to determine the differential ability of human and monkey

TRIM5α to restrict HIV-1 replication (83, 84). The B-box domain is suggested to mediate TRIM5α self-association which is important for the efficient binding of

TRIM5α to the retroviral CA proteins (85).

TRIM5α-mediated restriction occurs post entry and through interaction with viral

CA proteins. SIV containing HIV-1 CA has been shown to be sensitive to the block in old world monkey cells, while HIV-1 containing SIV CA is less sensitive to the block in old world monkey cells (86). The expression of TRIM5α induces a decrease of particulate CA and sometimes an increase of soluble CA in the cytosol. This suggests

TRIM5α specifically recognizes the CA proteins and promotes the rapid, premature disassembly of viral core, thereby inhibiting reverse transcription (82) (Figure 1-6).

Studies have demonstrated that the TRIM5α ring finger has an E3 ubiquitin ligase activity in vitro and in vivo. A mutation in this domain decreases the restriction by

TRIM5α and the treatment with proteasome inhibitors removes the restriction. These results indicate the possible involvement of ubiquitin in TRIM5α-mediated restriction 21

(87–90). In addition, studies have suggested that TRIM5α may block HIV-1 infection at nuclear import, and may function at later stages of the viral life cycle by degradation of viral Gag polyproteins (91–93).

Tetherin

Vpu is an accessory protein unique to HIV-1, SIVCPZ, SIVGSN, SIVMUS, SIVMON and SIVDEN. There is no similar gene in HIV-2, SIVSM or other SIVs. Vpu is a dimeric integral membrane protein of 81 amino acids. Vpu mediates degradation of CD4 in the endoplasmic reticulum and regulates HIV-1 replication at late stages of the viral life cycle (32, 94, 95).

The influence of Vpu is cell-type specific, suggesting involvement of a cellular factor. Using a cell fusion strategy, non permissive cells were found to express a cellular restriction factor and cause the retention of viral particles (96). In 2008, this restriction factor was identified as Bone marrow stromal cell antigen 2 (BST-2)/CD317 termed tetherin (31, 97). The expression of tetherin is cell type dependent and is part of the interferon induced antiviral defense system (31, 97, 98). Upon treatment with interferon, cells that are Vpu-independent become Vpu-dependent for efficient viral release (98).

Tetherin prevents the release of virions from the cell membrane. In the absence of Vpu, viral particles produced from tetherin-expressing cells complete membrane fusion at the plasma membrane. However, these virions are retained at the cell surface where they 22

accumulate and are subsequently transported to endosomes (99).

Tetherin prevents HIV-1 particle release by directly tethering virions to cells (100).

Other than HIV-1, tetherin affects a large diversity of enveloped viruses including retroviruses (31, 97), filoviruses (Ebola) (98, 101), arenaviruses (102) and herpes viruses (103), indicating a common mechanism for tetherin-virion interaction. Tetherin protein has an N-terminal transmembrane (TM) domain and a C terminal glycosylphosphatidylinositol (GPI) lipid anchor ( 104 ). Additionally there is an extracellular domain that is predicted to form a coiled coil between the two membrane anchors (100). The tetherin molecules are anchored to the viral envelope and the cell membrane, associating through the coiled coil domain and thus prevent virions from detaching (31, 100). Virions trapped at the cell surface are eventually internalized for degradation. This is supported by the observation that with protease treatment, the attached virions can be released from cell surface (98, 99). An artificial tetherin protein assembled from fragments of heterologous proteins inhibited the release of HIV-1 and

Ebola viruses. This confirmed the above model and demonstrated that the overall configuration of tetherin, rather than the specific sequence of the protein, is required for its antiviral activity (100). The exact role of each domain and how tetherin ‘tethers’ virions to the cell membrane remains unclear. Studies on tetherin mutants favor a model in which tetherin molecules form a dimer through the coiled coil domains, and the TM 23

domains of the dimer are incorporated into the virion envelope, while the GPI domains are anchored to the host-cell membrane (Figure 1-7) (100).

How Vpu counteracts tetherin and permits viral particle release remains unclear.

Vpu expressed via transient transfection or in the context of viral genome was found to reduce tetherin expression in HeLa cells (97, 103). In addition, Vpu may block the incorporation of the tetherin TM domain into virion envelopes (100, 105). Vpu may also alter tetherin trafficking and thus interfered with the function of tetherin (106).

1.3 Introduction to Vpx and Vpr Proteins

In all HIV and SIV genomes, a central viral region overlapping the Vif and Tat open reading frames encodes at least one protein Vpr. Vpr is a nuclear protein of

96-amino acid, with a molecular mass of 14-kDa (107). Vpr interacts with p6 of the Gag precursor and is incorporated into virions during viral particle production ( 108 ).

Members of the HIV-2/SIVSM/SIVMAC lineage contain an additional gene termed Vpx, which was originally derived from the African green monkey vpr gene by an ancestral recombination event (38). Vpx is a protein of 16-kDa that is highly conserved among divergent isolates of HIV-2 and SIVSM (109, 110).

Vpx and Vpr proteins share considerable sequence similarity. Both proteins are predicted to have 3 helices (Figure 1- 8) and are packaged into virions through 24

Perez-Caballero D et al. Cell. 2009, 139 (3):499-511.

Figure 1-7. Model of tetherin mediated inhibition of HIV-1 virion release (100).

Tetherin molecules form a dimer through the coiled coil domain. This dimmer is anchored to the host cell membrane through the TM domains on the N terminal, and is anchored to the envelope of budding virions through the GPI domains, thus preventing viral particle release.

Le Rouzic E, Benichou S. Retrovirology. 2005 Feb 22;2:11.

Figure 1-8. Predicted 3-helix structure of Vpx and Vpr. (A) NMR based structure of

Vpr. The NMR-based 3D-structure of Vpr (1–96) is characterized by 3 helices and flexible N and C termini. Three α helices are presented in pink (17–33), blue (38–50) and orange (54–77). The loops and flexible N and C termini are presented in green (111).

(B) The Vpx and Vpr sequence alignment was generated by Clustal W 2.0 with consensus secondary structure prediction. H represents helix. C represents random coil.

E represents beta strand. 26

association with p6 region of the Gag polyprotein (112–114). The packaging of Vpx and Vpr proteins into virions indicates they may play a role in the early stages of virus life cycle proceeding de novo production of viral proteins. Despite the similarities, the functions of Vpr and HIV-2/SIVSM Vpx do not appear to be the same.

Most of the information regarding the roles of Vpr and Vpx proteins in primate lentivirus replication has been derived from studies with HIV-1 Vpr. The Vpr protein of

HIV-1 has been shown to promote the accumulation of cells in the G2 stage of the cell cycle (33, 34, 115, 116), and to associate with the DNA repair enzyme Uracil DNA glycosylase (UDG) (117). The ability of HIV-1 Vpr to induce cell cycle arrest requires its binding partner, the E3 ubiquitin ligase complex scaffolding factor, DDB1

(118–122). In addition, Vpr has been shown to promote the infection of terminally differentiated macrophages and dendritic cells (33, 36, 37, 123, 124), possibly by mediating the nuclear import of the viral PIC (125). These HIV-1 Vpr-ascribed activities have been suggested to segregate between the Vpx and Vpr proteins of HIV-2/SIVSM.

The Vpr protein of HIV-2/SIVSM induces cell cycle arrest and associates with UDG but is dispensable for macrophage infection, while Vpx neither induces cell cycle arrest nor associates with UDG (38, 39). However, Vpx is essential for infection of simian macrophages by SIV in vitro ( Table 1-1 ). Following the infection of simian

Vpr of HIV-1 Vpr of HIV-2/SIVSM Vpx of HIV-2/SIVSM

G2 cell cycle arrest G2 cell cycle arrest No

UDG association UDG association No

Promote macrophage Promote macrophage infection possibly by infection possibly by No facilitating nuclear import of facilitating nuclear import of PIC PIC

Table 1-1. Proposed functions of HIV-1 Vpr, HIV-2/SIVSM Vpr and HIV-2/SIVSM

Vpx based on previous studies (38, 39). 28

macrophages by Vpx minus SIVSM, late cDNA products are reduced while 2-LTR circles, which are formed only after completion of reverse transcription, are absent (38,

39). In vivo, Vpx is also indispensable for dissemination and pathogenesis of SIV in pigtailed macaques (40).

Whether any of these activities relate to the functional role of Vpr/Vpx proteins in primate lentivirus replication is unclear. In order to understand the functions of the

Vpr/Vpx proteins in macrophage infection, I have focused on Vpx because of its profound impact on macrophage infection. In addition, its effect can be studied independently of other Vpr/Vpx-assigned activities including UDG association and cell cycle arrest. The purpose of this study is to further investigate the function of Vpx in myeloid cells infected by lentiviruses, and the mechanisms by which Vpx enhances lentiviral replication.

1.4 Monocyte Infection by HIV-1

HIV-1 infects and replicates primarily in CD4+ T cells and tissue macrophages.

However, peripheral monocytes may also serve as a HIV-1 reservoir in disease progression. Peripheral blood monocytes are vitally important cells in the immune system as the precursor cells to professional antigen presenting cells (APCs). CD14 is expressed on the cell surface of 80-90% of blood monocytes and monocyte-derived macrophages. CD14 is a lipopolysaccharide (LPS) receptor that constitutively expressed 29

during monocyte differentiation (126). Upon differentiation of quiescent monocytes to macrophages, the expression of a macrophage-specific transferrin receptor, CD71, increases (126).

The frequency of monocyte infection by HIV-1 in vivo appears to be low.

Monocytes are implicated as a viral reservoir based on the detection of infectious viruses from monocytes isolated from HIV-1 positive individuals on antiretroviral therapy. In some cases, infectious viruses can be recovered from monocytes upon appropriate stimulation, although these cells produced undetectable amounts of viral RNA (17, 19,

20, 127). In addition, monocytes harbor latent HIV-1 proviral DNA during the disease progression in spite of antiviral therapy (128). A small population of monocytes which are CD16+ apprears to be more susceptible to infection and preferentially harbors HIV-1 viruses in vivo (22).

Although lentiviruses have evolved the ability to infect terminally differentiated macrophages, peripheral blood monocytes are highly refractory to lentivirus transduction in vitro (16, 129–134). Permissivity to HIV-1 infection is coordinated to the state of monocyte differentiation (126, 134, 135). The mechanisms underscoring the block to transduction of quiescent monocytes by lentiviruses are not well understood. A different set of factors has been proposed to regulate infection of quiescent monocytes by lentiviruses. G0 monocytes have low intracellular dNTP levels (126, 136), and this 30

has been proposed to limit the efficiency of viral cDNA synthesis in these quiescent cells.

The cytidine deaminase APOBEC3G, which is a target of the viral accessory protein Vif, has been shown to influence the permissivity of quiescent lymphocytes and monocytes to HIV-1 infection (22, 137, 138). The enzymatically active LMM APOBECEG complex, which is the exclusive form in quiescent cells, has been shown to restrict infection of quiescent monocytes by HIV-1 (22, 74, 137). In addition, studies suggest that naturally occurring anti-HIV micro-RNA (miRNA) suppress HIV-1 in peripheral blood mononuclear cells or purified monocytes (139–142). In this study, the hypothesis that a restriction prevents the in vitro transduction of quiescent monocytes by HIV-1 was examined. 31

CHAPTER II

Materials and Methods

2.1 Clones

SIVSM clone PBj1.9

The infectious molecular clone SIVSM PBj1.9 was used for SIV infection in this study. This clone, which is representative of the HIV-2/SIVSM group of viruses, is a primary isolate and was derived from short-term peripheral blood mononuclear cell

(PBMC) cultures (143). Unlike many other HIV-2 and SIVSM clones, PBj1.9 has a complete set of uninterrupted accessory genes and replicates efficiently in macrophages and represents a physiologically relevant virus strain. Mutants with deletion of Vpx or

Vpr were constructed by Dr. Mark Sharkey as previously described (38). GFP (green fluorescent protein) expressing variants of wild-type and ΔVpx SIV contain an EGFP gene inserted between Bst 1107I sites within the viral envelope gene.

HIV-1 clones

NL43 is a CXCR4 tropism HIV-1 strain. This clone was derived from Full-length, replication and infection competent chimeric DNA, in which the 5´ fragment of proviral

NY5 and the 3´ fragment of proviral LAV were cloned into pUC18 after removal of polylinker sites (144). In most experiments, wild-type and ΔVpr HIV-1 variants were 32

studied in the context of HIV-1 NL43. NL43ΔVpr clone was constructed by PCR based mutagenesis to generate mutation on start codon and to introduce early stop codons.

NL43 GFP (a gift from Dr. Paul Clapham) contains an EGFP gene inserted between the envelope stop codon and nef within the HIV-1 NL43 backbone.

ADA is a R5 HIV-1 strain originally isolated from a seropositive AIDS patient.

LAI is an X4 HIV-1 strain which is the first strain of HIV-1 isolated in the laboratory cultured from Human PBMCs or CEM cells

NA20 B59 is a NL43 clone with highly macrophage-tropic envelope (a gift from

Dr. Paul Clapham’s lab). R5 tropic NA20 B59 envelope was amplified from brain tissue of AIDS patients (145), and cloned into pNL43 backbone using a BbsI site at the start of the envelope and an XhoI site downstream from the 3′ end of the envelope.

Chimeric clones between SIV and HIV-1

In all HIV-1/SIVSM chimeras, SIVSM proviral sequence was from PBj1.9, HIV-1 sequence was from NL43 clone. The different domains of NL43 were precisely substituted for the corresponding domains of PBj1.9. All the chimeric clones were created by overlapping PCR.

NL43 (SIV-Vif-Env) and the Vpx-deleted variant: The fragment from vif to env of NL43 was replaced with the corresponding sequence from PBj1.9 to generate chimeric clone NL43 (SIV-Vif-EnvΔVpx). NL43 (SIV-Vif-EnvΔVpx) is the same 33

chimera with Vpx deletion, which was introduced by Vpx start codon mutation and early stop codons. All the mutations are silent mutations for vif gene.

NL43 (SIV-Vif-Vpx) and the Vpx-deleted variant: the NL43 sequence from vif to vpr was replaced with the sequence of vif to vpx from PBj1.9 to generate NL43

(SIV-Vif-Vpx) clone. NL43 (SIV-Vif-ΔVpx) is the chimera variant in which Vpx was deleted with the same strategy mentioned above.

Vpx and M4 mutant

The SIVSM Vpx gene was amplified from PBj1.9 proviral clone, and inserted into a pIRES2-EGFP vector (BD) either with or without a N-terminal minimum HA epitope.

The upstream primer for each PCR product provided a Kozak sequence. The Vpx lysine mutant M4 was generated using Quikchange XL sitedirected mutagenesis (Stratagene).

These clones were generated by Dr. Yuanfei Wu.

DDB1-Vpr fusion

The DDB1 gene was amplified and subcloned from pBj-hp125 (ATCC, MBA-126) and inserted into pIRES2-EGFP as an in frame fusion with the C-terminal of SIV Vpr. A

Flag epitope was added to the N terminal of DDB1 as flanking sequences between Vpr and DDB1. As a control, an N-terminal Flag tagged DDB1 was inserted into pIRES2-EGFP. 34

Vpr expressing plasmid and primary Vpr expressing plasmid

The HIV-1 Vpr was amplified from NL43 proviral clones, and inserted into a pIRES2-EGFP vector (BD). The primary Vpr sequences were derived from plasma samples of AIDS patients with high viral load (Courtesy from Dr. Katherine Luzuriaga’s lab). The RNA was extracted from the plasma sample and first strand DNA was synthesized. The primary Vpr region was amplified from DNA and cloned into pIRES2-EGFP vector to create the primary Vpr expressing vectors.

2.2 Cell Culture

293T, HeLa and COS-1 cells

293T, HeLa, and COS-1 cells were maintained in DMEM containing 10% Fetal

Bovine Serum (FBS).

Macrophages

Peripheral blood monocytes were obtained by elutriation and counter current centrifugation and maintained 2 days in DMEM containing 10% human serum and monocyte colony stimulating factor (MCSF) (RD Systems) and for a further 5 days in medium lacking MCSF prior to use in experiment. 35

Monocytes

Human monocytes were obtained from healthy donors by countercurrent centrifugal elutriation (146). The monocytes were kept in DMEM containing 10% human serum and used freshly for infection.

2.3 Production of Virus Stocks

Unless indicated other way, viruses were pseudotyped with Vesicular Stomatitis

Virus G envelope proteins (VSV-G). For the generation of viral stocks, 293T cells were transfected with proviral DNAs using a modified calcium phosphate/DNA precipitation method. Viruses were pseudotyped with VSV envelope glycoproteins by cotransfection of proviral DNAs with a plasmid expressing the VSV envelope glycoprotein. For encapsidation of wild-type and mutant Vpx and Vpr proteins, 293T cells were cotransfected with proviral DNAs and plasmids expressing Vpx and Vpr proteins. The

DNA ratio for pVSV-G, proviral clones and pIRES2-EGFP-Vpx was 1:14:1. HIV-1 and

SIV stocks were normalized on the basis of reverse transcriptase activity.

Pseudotyped MLV (MLV-G) was prepared by Dr. Rajnish Kaushik. The stocks were obtained by transfecting retroviral-packaging 293A cells with pLEGFP-c1 and pMD-G. Viral particles in culture supernatants were harvested after 24 and 48 hours, passed through 0.45 mm filter and concentrated by ultra-centrifugation.

All virus stocks were treated with DNaseI (Worthington, NJ, USA) to remove 36

residual transfection DNA.

2.4 Infection

For infection, macrophages or monocytes were plated in 24 well plates and infected with HIV-1 at 1 million RT units/well. After 4 hours, cells were washed with fresh medium and incubated at 37ºC for the remainder of the experiment.

Pre-infection studies were performed by first infecting macrophages with pseudotyped wild-type SIV (SIVWT) or SIVΔVpx variants and 4 hours later, the supernatant was removed and the cells were inoculated with HIV-1 or MLV for another

4 hours. The supernatant was removed and the cells were washed with fresh medium and incubated at 37ºC for the remainder of the experiment. At indicated time points after inoculation, the cells were lysed and DNA extracted from each sample for quantitative real time PCR. When indicator viruses were used for infection, the cells were checked under fluorescent microscope or the numbers of green cells were quantitated by flow cytometry.

To control for the carry over DNA from virions, cells were treated with reverse transcriptase inhibitor Azidothymidine (AZT) 4 hours before infection at a final concentration of 10µM. The same concentration of AZT was kept during the whole experiment. 37

2.5 Analysis of Viral Infection by Quantitative PCR

Viral infection efficiency was gauged from synthesis of viral cDNA products at early intervals (24 and 48 h) post-infection. Cells were initially infected with viruses.

After 4 hours, cells were washed with fresh medium and incubated at 37ºC for the remainder of the experiment. Pre-infection studies were performed by first infecting macrophages with pseudotyped SIV wild-type or SIVΔVpx variants and 4 hours later, the cells were infected with HIV-1 or MLV for another 4 hours before washing cells with fresh medium. Infected cells were washed with PBS before harvesting samples for

DNA analysis. Total DNA was extracted from infected cells using DNAzol reagent

(Invitrogen).

Quantitative analysis of viral cDNA intermediates is as described (38, 147, 148), and primers and probes for quantitative PCR are listed in table 2-1. Copy number estimates of cDNA and 2-LTR circles were determined on an ABI Prism 7500 fast machine. The real-time PCR analysis from each sample was carried out in duplicate wells and most of the values shown in the figures are average of independent experiments using macrophages from at least 3 different donors. Viral cDNA was expressed on a per cell basis after quantitation of cellular CCR5.

2.6 Proteasome Inhibition

Macrophages in 24 well plates were directly infected with VSV-G-pseudotyped 38

PBj1.9 late products (Plus strand extension) PBj1.9 late f AAGCCAGTGTGTGTTCCCATC U5 PBj1.9 late r CATCTGCTTTCTTCCCTGACAA Gag 6-FAM-CCTAGCCGCCGCCTGGTCATCT- Iowa Black U5 PBj1.9 late prb FQTM PBj1.9 2-LTR circles pBj4n/f AGAAGCCCCTGGTCTGTTAGGAC U5 pBjC/r TCGTCTTCCTGAGCTTCATCTGA U3 6-FAM-TGGCAAAATTACACAGCAGGGCCAG-Iowa U3 PBj1.9 probe Black FQTM HIV late products (Plus strand extension) C1/f TAGACCAGATTTGAGCCTGGGA R LAI 7/r TCTCCTTCTAGCCTCCGCTAGTCAA GLS 6-FAM-AGCCTCAATAAAGCTTGCCTTGAGTGC-Iowa R 2nr4nr Black FQTM HIV 2-LTR circles C1/f TAGACCAGATCTGAGCCTGGGA R C4/r GTAGTTCTGCCAATCAGGGAAG U3 6-FAM-AGCCTCAATAAAGCTTGCCTTGAGTGC-Iowa R 2nr4nr Black FQTM MLV late products (Plus strand extension) OJWB45 GCGCCAGTCTTCCGATAGACTG R OJWB48 ACAATCGGACAGACACAGATAAGTTG Gag OJWB38 6-FAM-ATCCGAATCGTGGTCTCGCTGTTC-TAMRA R MLV 2-LTR circles OJWB45 GCGCCAGTCTTCCGATAGACTG R OJWB46 GGGCTCTTTTATTGAGCTCGGAG U3 OJWB38 6-FAM-ATCCGAATCGTGGTCTCGCTGTTC-TAMRA R Macrophage CCR5 CCR5/r CTCACAGCCCTGTGCCTCTTCTTC CCR5/f GCTGTCTTTGCGTCTCTCCCAGGA 6-FAM-AGCAGCGGCAGGACCAGCCCCAAG-Iowa CCR5 probe Black FQTM

Table 2-1. Primers and probes for quantitative real-time PCR. 39

viruses (1 million RT/well) in the presence of proteasome inhibitors including

Lactacystine (10 µM), ALLN (50 µM) or Proteasome inhibitor 1 (50µM). After 3–5 hours, supernatant was removed and replaced with fresh medium containing proteasome inhibitors. After 24 and 48 h postinfection total DNA was isolated using DNAzol reagent (Invitrogen) and analyzed by real-time PCR assay for 2-LTR circles.

2.7 COS-Macrophage Cell Staining and Cell Fusion

For FACS analysis, COS cells and human macrophages were stained with 3.5 mM

CellTracker Green CMFDA (5-chloro methylfluorescein chloromethyl- fluorescein diacetate) and 24 mM CellTracker Blue CMAC (7-amino-4- chloromethylcoumarin), respectively. For fluorescence microscopy, COS cells and macrophages were stained with 2.5 mM DiO (3,39-dioctadecyloxacarbo cyanine perchlorate) and 12 mM DiI

(1,19-dioctadecyl-3,3,39,39- tetramethylindo- carbocyanine perchlorate) respectively, according to manufacturer’s instructions (Molecular Probes).

Generation of macrophage homokaryons was achieved by polyethylene glycol

(PEG). Briefly, labeled cells, 15×106 each group, were mixed and centrifuged at 250 g.

50% PEG-1450 was added dropwise to the pellet and cells incubated for 2 min at 37ºC with gentle mixing. 1 ml PBS was then added dropwise to the cells over 1 min, followed by 3 ml of 2% FBS/PBS over another 2 minutes. Cells were washed 3 times with 2%

FBS/PBS and plated in a 100 mm culture dish (1×107 cells/dish). COS-macrophage and 40

COS-COS cell fusion was achieved using paramyxovirus hemagglutinin-neuraminidase

(HN) protein and fusion (F) protein. Briefly, COS cells were transfected with pCAGGS-HN and pCAGGS-F expression vectors encoding HN and F proteins of

Newcastle disease virus (gift of Prof. T. Morrison) (149). Sixteen to twenty hours post-transfection, COS cells were stained, mixed with stained macrophages (ratio 1:1.5) and plated in 100 mm dishes. COS homokaryons were generated at 1:1 ratio. After overnight incubation, cells were infected with either SIV wild-type or SIVΔVpx for 24 h.

Cell sorting was performed with a FACSAria flow cytometer using the FACSDiva software (Becton Dickinson). Double-stained cells were sorted. Total DNA was isolated using DNeasy Blood and Tissue Kit (Quiagen) and analyzed by realtime PCR assay for

2-LTR circles.

2.8 HeLa-Monocyte Cell Staining and Cell Fusion

HeLa-monocyte fusion was achieved using a GenomeONE-CFEX HVJ envelope fusion kit (Cosmo Bio Co., Ltd.). Manufacturer’s instructions for fusion in suspension were followed. Briefly, GFP-expressing HeLa were mixed with monocytes (ratio 1:6) and incubated in the presence of HVJ-E suspension (1.25 ul/1x 106 cells) on ice for 5 min and subsequently at 37ºC for 15 min. Cells were plated in 100 mm dishes and infected with HIV-1NL43 Luc or SIVWT for 40 hours. Prior to cell sorting, cells were stained with an APC-conjugated antibody to CD14 (BD Biosciences). Heterokaryons 41

were sorted based on GFP and APC double staining. HIV-1 NL43 Luc infection was measured by quantifying luciferase activity.

2.9 Virion Precipitation, Protein Purifications and Western Blotting

Supernatants from 293T cells transfected with infectious molecular clones were cleared of cellular debris by low-speed centrifugation (1500g, 10 min) and then filtered

(0.45 µm). Virions in clarified supernatants were concentrated at 10,000 g for 2 h with

20% sucrose cushion. The supernatants were removed and the virus pellets were lysed in

RIPA buffer (50 mM Tris-Hcl pH 7.5, 150 mM NaCl, 1% NP-40, 0.5% NaDoc, 0.1%

SDS and protease inhibitor cocktail). The cells were also lysed in RIPA buffer and clarified by centrifugation at 14,000 rpm for 15 min. Lysates of transfected cells or purified virions were boiled in sample buffer, resolved by SDS/ PAGE and Western blotted. The presence of encapsidated Vpx proteins was examined by an anti-HA antibody (HA, 16B12, Covance).The presence of viral Capsid was examined by anti-Capsid antibody (polyclonal, ABI).

2.10 Analysis of Vpx Ubiquitylation

293T cells were co-transfected with HA-Vpx, HA-Vpx lysine mutants or a pIRES2-EGFP empty vector and pRGB4-6His-myc-Ubiquitin at a 1:4 ratio using lipofectamine 2000 (Invitrogen). Non-6His tagged Ubiquitin was included as a control 42

for Ni-NTA pull-down. 36 h after transfection, the 6His-ubiquitin conjugated proteins were purified using Ni-NTA Magnetic Agarose beads (Qiagen) under native conditions

(150). Briefly, cells were lysed in detergent buffer (10 mM Tris-Hcl pH7.5, 150 mM

NaCl,1% Triton X-100 and protease inhibitor cocktail) and clarified by centrifugation at

14,000 rpm for 15 min. The cell lysates were incubated with Ni-NTA beads overnight at

4uC in detergent buffer with 300 mM NaCl, 20 mM imidazole and 5 mM MG132. The beads were washed in lysis buffer and attached proteins were eluted in elution buffer (50 mM NaH2PO4, 375 mM NaCl, 1% Triton, 250 mM imidazole pH 8.0).

2.11 RNA interference of DDB1

The siRNA sequences for DDB1 silencing in macrophages, COS-1 or 293T cells were siRNA1: GCAAGGACCTGCTGTTTAT siRNA2: GCATGCCAGCATTGACTTA siRNA3: CCTGCATCCTGGAGTATAA

The Scrambled control siRNA sequence was CAGTCGCGTTTGCGACTGG

Macrophages or COS-1 cells were transfected twice with 60 pmol each siRNA using lipofectamine 2000. 24 h after siRNA transfection, cells were infected with

RT-normalized viruses as indicated. The DDB1 protein knockdown levels were examined at the same time point as cDNA analysis. 43

2.12 Vpx-DDB1 co-immunoprecipitation

293T cells were transfected with Flag-Vpx, Flag-Vpx lysine mutant (VpxM4) or pIRES2-EGFP vector. 36 h after transfection, cells were harvested and lysed in Co-IP lysis buffer (100 mM NaCl, 50 mM Tris-Hcl pH 7.5, 5 mM MgCl2, 0.5% NP-40, protease inhibitor cocktail) and incubated with Protein A and Protein G beads

(Invitrogen) conjugated anti-Flag M2 antibody overnight at 4uC. The beads were washed 4 times in a more stringent wash buffer (400 mM NaCl, 50 mM Tris-Hcl pH 7.5,

5 mM MgCl2, 0.5 % NP-40, and protease inhibitor cocktail). And bound proteins were boiled and eluted in 26 Laemmli’s SDS sample buffer.

2.13 Dose Dependent Analysis of Vpx

293T cells were co-transfected with ΔVpx PBj1.9 proviral DNA (9µg) and increasing amount of plasmid expressing Vpx, or empty plasmid. Wild-type PBj1.9 was used as a positive control. All viruses were pseudotyped with VSV envelope glycoprotein. Viral infection efficiency was gauged from synthesis of viral 2-LTR cDNA products at 24 and 48 h post-infection. Viral cDNA copies were normalized with CCR5 copy numbers. Virions were harvested from supernatant through sucrose density centrifugation and lysed in RIPA buffer. Lysed virions were resolved by SDS/PAGE and western blotted with anti p27 or anti Vpx antibody. The integrated density was measured by Scion Image software. 44

2.14 FACS and Monocyte/Macrophage Immunophenotyping

Expression of CD14, CD71, or GFP in monocytes/macrophages was monitored by flow cytometry. Cells were collected day 0 to day 6 post-infection and washed twice with buffer (PBS containing 0.1% fetal bovine serum and 2 mM EDTA). The washed cells were incubated with an antibody mixture containing PE conjugated anti-human

CD14 (BD Biosciences) and APC conjugated anti-human CD71 (BD Biosciences) for 40 min. Cells were rinsed twice with washing buffer and fixed with 1% paraformaldehyde.

Fixed cells were analyzed by cell flow cytometry analysis using a FACSCalibur System

(BD Biosciences) and analyzed with Flowjo software (Tree Star, Inc). The percentage of infected CD71– monocytes and CD71+ macrophages were determined from the percentages of GFP+/CD71– or GFP+/CD71+ cells, respectively.

2.15 APOBEC3G Analysis

H9 cells, monocytes or macrophages were washed twice with PBS and incubated with lysis buffer containing 50 mM HEPES pH 7.4, 125 mM NaCl, 0.2% NP-40 and

EDTA-free protease inhibitor cocktail (Roche). Cell lysates were clarified by centrifugation at 14000 rpm for 30 min at 4ºC (Microfuge 22R, Beckman Coulter).

Cleared cell lysates were quantitated (Protein assay kit, Bio-Rad) and analyzed by Fast

Performance Liquid Chromatography (FPLC). For RNase treatment of HMM complexes from H9 cells, cell lysates was incubated with 50 μg/ml RNase A (Roche, DNase-free) at 45

room temperature for 1h before analysis by FPLC. FPLC was run on an ÄKTA™ FPLC using a Superose 6 10/300 GL gel filtration column (GE healthcare). The running buffer contained 50 mM HEPES pH 7.4, 125 mM NaCl, 0.1%NP-40, 1mM DTT and 10%

Glycerol. Fraction size was set at 1ml. 20 μl of each fraction was boiled with Laemmli’s

23 SDS-sample buffer (6xreducing, BOSTON Bioproducts) and loaded onto a 10%

SDS-PAGE. Proteins were transferred to nitrocellulose membranes and blotted with rabbit anti-APOBEC3G antibody (Courtesy of Dr. Tariq Rana) using a TROPIX

CDP-star system (PerkinElmer). 46

CHAPTER III

Vpx Promotes Macrophage Infection by HIV-1 and MLV

3.1 Chapter Summary

This chapter presents evidence that a restriction in macrophages potently antagonizes infection of macrophages by SIV. Vpx was required for macrophage infection by SIVSM. Viral cDNA production was reduced dramatically in macrophages infected with an SIVSM variant lacking Vpx. However, infection of COS or HeLa cells with wild-type or Vpx-deleted SIVSM resulted in comparable cDNA levels. This suggests the existence of a cellular factor that regulates SIVSM infection. To determine if COS cells contain a positive factor which is activated by Vpx, or if macrophages contain a negative factor which is counteracted by Vpx, heterokaryons between permissive COS cells and nonpermissive macrophages were generated. Macrophage/COS heterokaryons remained resistant to SIVΔVpx infection, indicating that macrophages harbored a dominant antiviral restriction that is counteracted by the Vpx protein and that this restriction is absent from COS cells.

Using an HIV-1 chimera containing SIVSM Vpx, I demonstrated that the antiviral restriction that antagonized SIVSM infection of macrophages was active against HIV-1.

Furthermore, neutralization of this restriction by encapsidating Vpx into HIV-1 virions or by preinfecting macrophages with wild-type SIV dramatically enhanced HIV-1 47

infection in macrophages, confirming the susceptibility of HIV-1 to this restriction. This also indicated that Vpx functioned in the target cells shortly after infection and that a small amount of Vpx was sufficient to neutralize the restriction. Packaging of Vpr in trans failed to enhance HIV-1 infection in macrophages, supporting that the neutralization activity is specific for Vpx.

Macrophages are refractory to transduction by gammaretroviruses such as MLV. To determine whether the same restriction is an obstacle to transduction of macrophages by

MLV, I examined whether neutralization of the restriction would render macrophages permissive to MLV. Macrophages preinfected with wild-type but not Vpx-deleted SIV were permissive to MLV transduction. This suggests that Vpx delivered to macrophages removes the block to MLV and that the same restriction that antagonizes SIV/HIV-1 infection of macrophages also antagonizes MLV.

In summary, our results indicate that macrophages harbor a restriction that antagonizes SIV, HIV-1, and MLV at the level of reverse transcription. The Vpx protein of HIV-2/SIVSM specifically overcomes this restriction. Therefore, the relative ability of lentiviruses and other retroviruses such as MLV to transduce macrophages is partially or fully dependent upon their ability to neutralize this cellular restriction. 48

3.2 SIVSM Vpx but not Vpr is Required for Infection of Human Macrophages by

SIVSM.

Previous publications have demonstrated that Vpx of HIV-2/SIVSM was essential for early events in SIVSM infection of macaque macrophages yet dispensable for infection of macaque PBMCs or CEM174 cells (38). The first experiment examined whether Vpx or Vpr was required for SIVSM infection of human macrophages and cell lines. Vpx function was studied in the context of SIVSM PBj which represents a primary isolate (143). To increase particle infectivity and facilitate analysis of early events in the viral life cycle, viruses were pseudotyped with VSV-G envelope proteins. Although

VSV pseudotyping has been shown to alleviate the defects exhibited by other accessory gene mutants such as Nef, pseudotyping did not alleviate the infectivity defect of

Vpx-deleted viruses in macrophages. In order to gauge infection of primary macrophages under single cycle conditions, viral cDNAs (mainly 2-LTR cDNA) were quantitated by real time PCR.

The profound requirement for Vpx but not Vpr in macrophage infection by SIVSM is illustrated in Figure 3-1A. 2-LTR cDNA is formed only after completion of viral reverse transcription and translocation of viral cDNA to the nucleus where circularization occurs. Levels of 2-LTR cDNA in macrophages infected with a wild-type

SIV and an SIV variant lacking Vpr were indistinguishable (Figure 3-1A). In contrast, 49

Figure 3-1. Differential susceptibility of macrophages and cell lines to infection by wild-type and Vpx-deleted (ΔVpx) or Vpr-deleted (ΔVpr) variants of SIVSM. (A)The profound requirement for Vpx but not Vpr in macrophage infection by SIVSM Virus infection was gauged from the levels of viral 2-LTR cDNA at 24 and 48 hours post-infection. SIV cDNA copy number was normalized to cell number based on CCR5 copy number. (B) Susceptibility of COS or HeLa cells to infection by wild-type, ΔVpx and ΔVpr SIVSM. 50

there is a profound block to infection of macrophages by Vpx-deleted SIV at the level of reverse transcription. Viral 2-LTR cDNA was reduced at least 100 fold in macrophages infected with an SIV variant lacking Vpx (Figure 3-1A). In COS cells and in HeLa cells, viral cDNA synthesis with wild-type and Vpr-deleted or Vpx-deleted viruses were similar (Figure 3-1B). Our original study on the requirement for Vpx in SIV infection of monkey macrophages reported a significant defect in 2-LTR circle formation using non quantitative PCR (38). This is consistent with the defect observed in this study which involves infection of human macrophages with SIV. These results suggest that Vpx protein is required for SIVSM infection in macrophages, but is dispensable for SIVSM infection of COS and HeLa cells.

3.3 Macrophages Harbor a Restriction Factor that is Counteracted by the Vpx

Protein

Although Vpx was necessary for macrophage infection, Vpx was dispensable for infection of COS/ HeLa cells. This suggested the existence of cellular activities, differentially expressed between macrophages and COS cells or HeLa cells, which impact primate lentivirus infection. One possibility was that COS and HeLa cells contain a cellular activity that promotes virus infection. But in macrophages, this activity must be activated by the Vpx protein. An alternative possibility was that macrophages contain a cellular restriction to infection that is counteracted by the Vpx protein and this cellular 51

restriction is not expressed in COS or HeLa cells. To distinguish between these two possibilities, a strategy previously adopted to characterize the mechanism by which Vif promotes viral infection was used (151, 152).

Heterokaryons were generated between macrophages and COS cells and the susceptibility of the heterokaryons to infection by wild-type SIV and SIVΔVpx was compared. When the fusogenic proteins of Newcastle Disease Virus (NDV) were expressed in COS cells, these cells readily underwent fusion with primary macrophages

(Figure 3-2A). Macrophage/COS heterokaryons (double staining cells) were isolated by fluorescence-activated cell sorting (FACS). Double staining cells were not observed when normal COS cells (not expressing NDV proteins) were mixed with macrophages

(Figure 3-2B). As an additional control, macrophage homokaryons were produced using polyethylene glycol (PEG). Both macrophage/COS heterokaryons as well as COS and macrophage homokaryons were infectible by wild-type SIV (Figure 3-2C). In contrast, macrophage homokaryons and macrophage/COS heterokaryons were resistant to

SIVΔVpx infection (Figure 3-2C). Since fusion with COS cells did not relieve the block to macrophage infection by SIVΔVpx, this indicated that macrophages harbor an antiviral restriction which is counteracted by the Vpx protein and this restriction is absent from COS and Hela cells (Figure 3-3).

Figure 3-2. Vpx antagonizes an antiviral restriction in macrophages. (A)

Heterokaryons were formed between primary macrophages and between COS cells expressing fusogenic HN and F proteins of Newcastle Disease Virus. To visualize heterokaryons by fluorescence microscopy, COS cells were stained with DiO (green) and macrophages were stained with DiI (red). (B) FACS analysis of macrophage-COS heterokaryons. COS cells were cotransfected with NDV HN and F expression vectors

(COS-NDV) or with empty, control vectors (COS). COS cells were stained with

CellTracker Green CMFDA and macrophages were stained with CellTracker Blue

CMAC. Double-stained cells were sorted as indicated by the gate. (C) Susceptibility of macrophage/COS heterokaryons and COS and macrophage homokaryons to infection by

SIVWT and SIVΔVpx virus variants. Infection was gauged from levels of late cDNAs and 2-LTR circle cDNAs. 54

Figure 3-3. Model of the function of Vpx in SIVSM infection of macrophages.

Macrophages harbor an antiviral restriction blocking SIVSM infection before completion of reverse transcription. This restriction is counteracted by Vpx protein.

3.4 HIV-1 Vpr is Dispensable for HIV-1 Reverse Transcription in Macrophages

HIV-2, SIVSM and SIVMAC encode both Vpx and Vpr proteins. However, Vpr is the only accessory protein in HIV-1 that is closely related to Vpx. Previous studies from our group demonstrate that Vpr proteins of HIV-2/SIVSM induce cell cycle arrest and associate with UDG, but are dispensable for macrophage infection in vitro. Vpx neither induces cell cycle arrest nor associates with UDG, but is required for SIV infection in macrophages (38, 39, 40). This suggests that HIV-1 Vpr-ascribed activities segregate between the Vpx and Vpr proteins of HIV-2/SIVSM (38). I next sought to determine if

HIV-1 Vpr has the ability to overcome the restriction factor in macrophages.

Vpx-deleted SIVSM was fully attenuated in macrophages, thus whether Vpr-deleted

HIV-1 was also attenuated in macrophages was examined. Two HIV-1 strains, LAI and

NL43 were used in this study. The transduction efficiency of wild-type or Vpr-deleted

HIV-1 in macrophages was similar, when gauged by the level of 2-LTR circles (Figure

3-4). This suggests that HIV-1 Vpr is dispensable for infection of macrophages at the level of reverse transcription.

The observation that both wild-type and Vpr-deleted HIV-1 were comparable in single round infection in macrophages can be explained by two possibilities. One possibility is that HIV-1 is not blocked by the same restriction factor that blocks SIVSM infection in macrophages. Therefore, the deletion of Vpr has no effect on HIV-1 2-LTR 56

0.08 0.07 0.06 24h+AZT 0.05 24h 0.04 48h+AZT 0.03 48h 0.02 0.01 0

HIV cDNA (2LTR copies/cell) LAI LAIΔVpr

0.18 0.16 0.14 0.12 24h+AZT 0.1 24h 0.08 48h+AZT 0.06 48h 0.04 0.02 0

HIV cDNA (2LTR copies/cell) NL43 NL43ΔVpr

Figure 3-4. Vpr is dispensable for HIV-1 infection of macrophages at the level of reverse transcription. Macrophages were infected with wild-type or Vpr-deleted HIV-1.

Both LAI (upper panel) and NL43 (lower panel) strains were used for this study. Virus infection was gauged from the levels of viral 2-LTR circles at 24 and 48 hours post infection. 57

level. Another possibility is that HIV-1 is partially restricted by the same restriction factor, but HIV-1 Vpr is not able to overcome this restriction. This would account for the indistinguishable infectivity between wild-type and Vpr-deleted HIV-1 in macrophages.

3.5 The Antiviral Restriction Which Antagonizes SIVSM Infection of

Macrophages is Active against HIV-1

A significant defect in 2-LTR circle synthesis was observed in macaque and human macrophages infected with Vpx-deleted SIV. In contrast to SIV, wild-type or Vpr-deleted

HIV-1 infected human macrophages to a similar level, as evidenced by comparable levels of 2-LTR circle production. Based on these observations, it was initially assumed that HIV-1 was not affected by the macrophage restriction. If SIVSM is restricted in macrophages while HIV-1 is not, replacing the viral component that is targeted by the restriction in SIVSM with the corresponding sequence from HIV-1 would rescue

SIVSMΔVpx infection of macrophages. The same strategy was used to identify CA as the target of TRIM restriction (86).

The Gag-Pol products of primate lentiviruses function at several different steps of the lentivirus life cycle. I first examined whether SIVSM Gag-Pol products are involved in determining the antiviral restriction in macrophages. Chimeras between HIV-1 and

SIVSM were generated with sequences of MA, CA, NC, p6, PR or RT from HIV-1 inserted into the corresponding region of the SIVSM backbone (Figure 3-5). All the 58

HIV-1

SIVSM

Figure 3-5. Structure of chimeric clones between HIV-1 and SIVSM. The SIVSM

PBj1.9 isolate and HIV-1 NL43 were used to create these chimeric constructs. The different domains of NL43 were precisely substituted for the same domain in the PBj1.9 proviral clone. Sequences from SIVSM were shown in white, while the black area represented components from HIV-1 that were inserted into the corresponding region of the SIVSM proviral clone. Vpx-deleted variant of each chimera was also constructed. 59

chimeras in this study were created by overlapping PCR. The chimeric SIVSM containing p6 and PR from HIV-1 were replication-defective in COS cells that support SIV ΔVpx replication. The Vpx-deleted chimeric viruses with MA, CA, NC or RT replaced were capable of single round infection in COS cells. However, those viruses were restricted in macrophages (Figure 3-6 to Figure 3-9), suggesting that the substituted viral components were not the target of the macrophage restriction.

I next examined whether the target of the restriction was located on the 5’ half or

3’ half of the SIVSM genome. Additional chimeric viruses were constructed with an

HIV-1 backbone containing the 3’ half of the SIVSM genome (Figure 3-10). The junctions between SIVSM and HIV-1 were located at the beginning the vif gene and the end of the env gene. In this chimeric NL43 (SIV-Vif-Env), the LTR and the gag-pol sequences were derived from the HIV-1 clone NL43. Vif (including a small overlapping region between pol and vif), vpx, vpr, env, tat and rev genes were derived from the SIVSM clone PBj1.9 (Figure 3-10). The Vpx-deleted variant of this chimera was created by mutating the vpx start codon and introducing an early stop codon (Figure 3-10). The mutations introduced were silent mutations for vif gene. The susceptibility of COS cells and macrophages to HIV-1/SIVSM chimeric virus infection was examined. The infectivity of NL43 (SIV-Vif-Env) and the Vpx-deleted variant NL43

(SIV-Vif-EnvΔVpx) in COS cells was similar when gauged by HIV-1 cDNA levels, 60

Infection of COS cells

0.002 0.0015 d1 AZT d1 0.001 d2 AZT 0.0005 d2 0

SIV Vpx Mock SIV cDNA (2LTR copies/cell) SHIV-MA-1SHIV-MA-2 SIVΔ

SHIVΔVpx-MA-1SHIVΔVpx-MA-2

Infection of Macrophages

0.01 0.01 d1 AZT 0.01 d1 0.01 0.00 d2 AZT 0.00 d2 0.00

V 2 k - px 1 c SI A V A- o -MA-1 M M SIV cDNA (2LTR copies/cell) (2LTR cDNA SIV V x-M x-MA-2 HI p p S SHIV- SIVΔ V ΔV IV SH SHIVΔ

Figure 3-6. Vpx is required for SHIV-MA infection of macrophages. (A) A schematic of chimeric proviral clone with SIV backbone and MA from HIV-1

(SHIV-MA) and the Vpx-deleted variant (SHIVΔVpx-MA). (B) Susceptibility of COS cells to infection by SHIV-MA chimera and Vpx-deleted variant SHIVΔVpx-MA. COS cells were infected and virus infection was gauged from the levels of viral 2-LTR cDNA at 24 and 48 h post-infection. (C) Susceptibility of macrophages to infection by

SHIV-MA chimera and Vpx-deleted variant. 61

Infection of COS cells

0.0012 0.001 d1 AZT 0.0008 d1 0.0006 d2 AZT 0.0004 d2 0.0002 0

x 1 k p - c

SIV cDNA (2LTR copies/cell) (2LTR cDNA SIV o CA-2 V A-2 M - Δ C x-CA HIV p SHIV-CA-1 S SIV V Δ IVΔVpx- SHIV SH

Infeciton of Macrophages

0.6 0.5 0.4 d1 AZT d1 0.3 d2 AZT 0.2 d2 0.1 0 1 k

SIV cDNA (2LTR copies/cell) SIV cDNA - -2 -1 A A A-2 -C C Moc V x-C p px- SHIV-CA SHI SIVΔVpx V ΔV V SHI SHIVΔ

Figure 3-7. Vpx is required for SHIV-CA infection of macrophages. (A) A schematic of chimeric proviral clone with CA and p2 from HIV-1 inserted into SIV backbone (SHIV-CA) and the Vpx-deleted variant (SHIVΔVpx-CA). (B) Susceptibility of COS cells to infection by SHIV-CA chimera and Vpx-deleted variant SHIVΔVpx-CA.

Infection of COS cells

300 250 200 150 d1 AZT 100 d1 50 0 1 -2 px -1 -2 -3 C- C C-3 V C SIV cDNA (2LTR copies) cDNA SIV -N N NC Mock V-N VΔ x- x-N HIV HI S S SHIV- SI Vp Vp VΔ VΔVpx-NCVΔ I SHI SHI SH

Infection of macrophages

500 400 300 d1 AZT 200 d1 100 0

ck SIV cDNA (2LTR copies) -NC-1 -NC-2 -NC-3 Mo

SHIV SHIV SHIV SIVΔVpx Vpx-NC-1Vpx-NC-2Vpx-NC-3

SHIVΔ SHIVΔ SHIVΔ

Figure 3-8. Vpx is required for SHIV-NC infection of macrophages. (A) A schematic of chimeric proviral clone with NC and p1 from HIV-1 inserted into SIV backbone

(SHIV-NC) and the Vpx-deleted variant (SHIVΔVpx-NC). (B) Susceptibility of COS cells to infection by SHIV-NC chimera and Vpx-deleted variant SHIVΔVpx-NC. (C)

Susceptibility of macrophages to infection by SHIV-NC chimera and Vpx-deleted variant. 63

Infeciton of COS cells

250 200 d1 AZT 150 d1 100 d2 AZT 50 d2 0

SIV cDNA (2LTR copies) (2LTR cDNA SIV 3 SIV px Mock x-RT-2 IVΔV px-RT-1 p px-RT- SHIV-RT-1 S V

HIVΔV SHIVΔ SHIVΔV S

Infection of Macrophages

40 30 d1 AZT d1 20 d2 AZT 10 d2 0

SIV cDNA (2LTR copies) (2LTR SIV cDNA -1 SIV px RT-3 Mock

SHIV-RT SIVΔV ΔVpx-RT-1VΔVpx-RT-2 HIV HI HIVΔVpx- S S S

Figure 3-9. Vpx is required for SHIV-RT infection of macrophages. (A) A schematic of chimeric proviral clone with RT from HIV-1 inserted into SIV backbone (SHIV-RT) and the Vpx-deleted variant (SHIVΔVpx-RT). (B) Susceptibility of COS cells to infection by SHIV-RT chimera and Vpx-deleted variant SHIVΔVpx-RT. (C)

Susceptibility of macrophages to infection by SHIV-RT chimera and Vpx-deleted variant. 64

NL43 (SIV-Vif-Env)

NL43 (SIV-Vif-Env ΔVpx)

HIV-1

SIVSM

Figure 3-10. A schematic of chimeric proviral clone NL43 (SIV-Vif-Env) and

Vpx-deleted variant NL43 (SIV-Vif-EnvΔVpx). The fragment from vif to env of NL43 was precisely substituted for the same domain in the PBj1.9 proviral clone. Sequences from SIVSM were shown in white, while the black area represented the fragment from

HIV-1 that was inserted into the corresponding region of the SIVSM proviral clone.

NL43 (SIV-Vif-Env ΔVpx) was the same chimera in which the expression of Vpx was eliminated. Vpx was deleted by mutating the start codon of Vpx and introducing an early stop codon. All the mutations introduced were silent mutations for vif gene. 65

indicating that these chimeric viruses are capable of single round infection in permissive cells (Figure 3-11B). However, infection of macrophages by NL43 (SIV-Vif-EnvΔVpx) was highly inefficient compared to that by NL43 (SIV-Vif-Env), as evidenced by the levels of viral cDNA synthesis (Figure 3-11A), suggesting Vpx dramatically enhanced the infectivity of this chimera in macrophages. Therefore, chimeric NL43 (SIV-Vif-Env) is restricted in macrophages, indicating that the 3’ half of SIVSM may contain the target of the macrophage restriction.

To confirm this, another chimera between HIV-1 and SIVSM was constructed in which the fragment of HIV-1 vif-vpr was replaced by SIVSM vif-vpx in the context of the

NL43 backbone. The junctions between SIVSM and HIV-1 were located at the beginning of vif and the end of vpx (Figure 3-12). The infectivity of these chimeric viruses in COS cells and macrophages was examined. In permissive COS cells, both NL43

(SIV-Vif-Vpx) and Vpx-deleted variant NL43 (SIV-Vif-ΔVpx) underwent comparable reverse transcription with similar levels of 2-LTR circle production (Figure 3-13B).

Surprisingly, 2-LTR circle production in macrophages infected with NL43

(SIV-Vif-ΔVpx) dramatically decreased (Figure 3-13A), indicating that this chimera is antagonized by the macrophage restriction. The Vpx-deleted chimeras with the HIV-1 backbone infected macrophages although with lower efficiency, suggesting that they are partially restricted compared to SIVSM. These results led us to consider that HIV-1 is also

Macropahges

3000 2500 2000 24h+AZT 24h 1500 48h+AZT 1000 48h 500 2LTR cDNA copies cDNA 2LTR 0 NL43(SIV-Vif-Env) NL43(SIV-Vif-EnvΔVpx)

COS cells

500 400 24h+AZT 300 24h 200 48h+AZT 48h 100 2LTR cDNA copies 0 NL43(SIV-Vif-Env) NL43(SIV-Vif-EnvΔVpx)

Figure 3-11. Vpx promotes chimeric NL43 (SIV-Vif-Env) infection in macrophages.

(A) Susceptibility of macrophages to infection by NL43 (SIV-Vif-Env) chimera and

Vpx-deleted variant NL43 (SIV-Vif-EnvΔVpx). Macropahges were infected and virus infection was gauged from the levels of viral 2-LTR cDNA at 24 and 48 h post-infection.

(B) Susceptibility of COS cells to infection by NL43 (SIV-Vif-Env) chimera and

Vpx-deleted variant.

NL43 (SIV-Vif-Vpx)

NL43 (SIV-Vif-ΔVpx)

HIV-1 SIV

Figure 3-12. A schematic of chimeric proviral clone NL43 (SIV-Vif-Vpx) and

Vpx-deleted variant NL43 (SIV-Vif-ΔVpx). The black area represents the fragment from HIV-1 and the white area represents the fragment from HIV-1. The fragment from vif to vpx of NL43 was precisely substituted for the same domain in the PBj1.9 proviral clone. NL43 (SIV-Vif-ΔVpx) was the same chimera in which the expression of Vpx was eliminated. Vpx was deleted by mutating the start codon of Vpx and introducing an early stop codon. All the mutations introduced were silent mutations for vif gene. 68

Macrophages

2500 2000 24h+AZT 1500 24h 1000 48h+AZT 48h 500 2LTR cDNA copies 0 NL43(SIV-Vif-Vpx) NL43(SIV-Vif-ΔVpx)

COS cells

1000 800 24h+AZT 600 24h 400 48h+AZT 48h 200 2LTR cDNA copies cDNA 2LTR 0 NL43(SIV-Vif-Vpx) NL43(SIV-Vif-ΔVpx)

Figure 3-13. Vpx promotes NL43 (SIV-Vif-Vpx) infection in macrophages. (A)

Differential susceptibility of macrophages to infection by NL43 (SIV-Vif-Vpx) and

Vpx-deleted variant NL43 (SIV-Vif- ΔVpx). Macropahges were infected and virus infection was gauged from the levels of viral 2-LTR cDNA at 24 and 48 hours post infection. (B) Susceptibility of COS cells to infection by by NL43 (SIV-Vif-Vpx) and

Vpx-deleted variant. COS cells were infected and virus infection was determined as described in A. 69

antagonized by the macrophage restriction that blocks SIVSM infection.

To evaluate whether the antiviral restriction which antagonized HIV-2/SIVSM infection was active against HIV-1 and if Vpx indeed promoted HIV-1 infection of macrophages, the spreading infection of macropahges by a HIV-1 variant expressing

Vpx was examined. A chimeric construct ADAΔVpr(PBj-Vpx) was created, within which the sequence of Vpr in the ADA backbone was replaced by the sequence of Vpx derived from SIV PBj (Figure 3-14A). Since the expression of Vpr was eliminated in this chimera, Vpr-deleted ADA was used as a control. Macropahges were infected with wild-type ADA, ADAΔVpr and ADAΔVpr(PBj-Vpx) chimera that expressed Vpx. The culture Supernatants were collected and HIV-1 infection was determined by reverse transcriptase activity in the supernatants over 31 days post-infection. The infectivity of

ADAΔVpr was lower than that of wild-type ADA in macrophages (Figure 3-14B).

However, the infectivity of ADAΔVpr was profoundly enhanced compared to that of

ADAΔVpr (Figure 3-14B), indicating that the expression of Vpx promoted HIV-1 infection in macrophages. Therefore, the antiviral restriction that antagonizes SIVSM infection of macrophages is active against HIV-1.

3.6 Vpx Counters the Restriction and Promotes HIV-1 infection in trans

Vpx and Vpr are virion proteins and would thus be predicted to exert their function in the target cell shortly after infection. Therefore, I next examined whether the Vpx 70

ADA

vpx

ADAΔVpr(PBj-Vpx)

2.5

ADA 1.5 ADAΔVpr ADAΔVpr(PBj-Vpx) 1

0.5

0 RT activity (million cpm/ml) d1 d4 d7 d10 d13 d16 d19 d22 d25 d28 d31 Days post inoculation

Figure 3-14. Vpx enhances HIV-1 spreading infection in macrophages. (A)

Construction of ADAΔVpr(PBj-Vpx). A schematic of wild-type ADA and chimeric ADA which expresses SIVSM Vpx. Vpx sequence was derived from SIV PBj and was inserted into ADA backbone in place of Vpr. (B) Spreading infection of macrophages by wild-type ADA, ADAΔVpr or ADAΔVpr((PBj-Vpx). Macrophages were infected with

RT unites (cpm) of ADA, ADAΔVpr or ADAΔVpr((PBj-Vpx). Culture supernatants were collected and RT activity (106 cpm/ml) was measured at 3 day intervals post-infection. 72

protein, when packaged in trans within HIV-1 virions, enhanced virus infectivity for primary macrophages.

HIV-1 Vpr and SIVSM Vpx proteins were packaged into wild-type or Vpr-deleted

HIV-1 viruses by cotransfection. The infectivity of those viruses for COS cells and macrophages was then determined from levels of viral cDNA (2-LTR circles) at 24 and

48 hours post-infection. While Vpx had no significant effect on the infectivity of wild-type HIV-1, the infectivity of HIV-1ΔVpr for macrophages was profoundly enhanced by Vpx but not by HIV-1 Vpr (Figure 3-15, lower panel). The infectivity enhancement was also apparent in macrophages infected with an HIV-1 variant expressing GFP (Figure 3-16). Thus, while HIV-1 was infectious for macrophages, its ability to infect these cells was markedly enhanced in the presence of Vpx. Vpx had no effect on the infectivity of wild-type or ΔVpr HIV-1 for COS cells (Figure 3-15, upper panel).

In the above experiments, VSV-G pseudotyped HIV-1 was used. To further confirm that Vpx promotes HIV-1 infection in trans, I used a non-pseudotyped HIV-1 virus

NA20 B59/NL43, which is a macrophage tropic NL43 variant. The infectivity of NA20

B59/NL43ΔVpr for macrophages was remarkably enhanced by packaging of SIV Vpx

(Figure 3-17).

Collectively, these results support our hypothesis that although HIV-1 is infectious 73

Figure 3-15. HIV-1 is sensitive to the macrophage restriction and SIV Vpx but not

HIV-1 Vpr antagonizes the restriction. HIV-1 Vpr and SIV Vpx proteins were packaged in HIV-1WT or HIV-1ΔVpr viruses by cotransfection. For controls, viruses were cotransfected with an empty vector. The infectivity of those viruses for COS-1 cells

(upper panel) and macrophages (lower panel) was then determined from levels of viral cDNA (2-LTR circles) at 24 and 48 hours post-infection.

Figure 3-16. Vpx enhances transduction of macrophages by GFP-expressing HIV-1.

Infection of macrophages with GFP-expressing HIV-1ΔVpr variants in which Vpx was

(+) or was not (–) packaged. GFP positive macrophages (representative fields) were visualized 48 h post-infection. 75

0.8

0.6 24h+AZT 24h 0.4 48h+AZT 48h 0.2

0 Empty Vpx Empty Vpx HIV-1 cDNA (2LTR copies/cell) (2LTR cDNA HIV-1 vector vector

NA20 B59/NL43 WT NA20 B59/NL43ΔVpr

Figure 3-17. SIVSM Vpx promotes NA20 B59/NL43ΔVpr infection in macrophages.

Macrophages were infected with a non-pseudotyped NL43 variant NA20 B59/NL43 (R5 tropic) that had or had not packaged Vpx. Virus infection was gauged from the levels of viral 2-LTR cDNA 24 and 48hours post inoculation.

for macrophages, HIV-1 is partially restricted by the same restriction factor that blocks

SIVSMΔVpx, at the level of reverse transcription. The ability of HIV-1 to infect macrophages is remarkably enhanced in the presence of Vpx. However, HIV-1 Vpr is not able to overcome the restriction

3.7 Vpx Renders Macrophages Permissive to MLV Infection

A fundamental characteristic that distinguishes lentiviruses from simple gammaretroviruses is their capacity to infect nondividing cells (153, 154). Primate lentiviruses are able to transduce nondividing cells, and this underscores their ability to transduce terminally differentiated nondividing cells, including macrophages, microglia, and dendritic cells, both in vitro and in vivo (17, 155, 156). In contrast, gammaretroviruses such as murine leukemia virus (MLV) transduce cells in mitosis and nondividing cells (in G1/S/G2) are refractory to gammaretrovirus transduction

(157–160). Previous experiments have presented evidence that macrophages harbor a restriction that antagonizes HIV-1 and SIV at the level of reverse transcription and that the Vpx protein of SIVSM specifically overcomes this restriction. I next examined whether neutralization of the restriction by Vpx would render macrophages permissive to MLV.

Whether introduction of Vpx into macrophages by wild-type SIV infection would render macrophages susceptible to subsequent transduction by MLV was first examined. 77

Macrophages were initially infected with SIVWT or SIVΔVpx and subsequently infected by MLV. MLV late cDNA copies (Figure 3-18A, upper panel) and 2-LTR circles

(Figure 3-18A, lower panel) were determined 24 and 48 hours after MLV infection. The primary block to transduction of macrophages by MLV appeared to be at the level of reverse transcription (Figure 3-18A). Pre-infection of macrophages with a SIVWT but not a Vpx-deleted SIV (SIVΔVpx) resulted in an increased ability of MLV to transduce macrophages, as evidenced by MLV cDNA synthesis (Figure 3-18A) and expression of

GFP from the MLV genome (Figure 3-18B). Therefore, the restriction that antagonizes lentivirus infection of macrophages also prevents infection of macrophages by MLV and

Vpx delivered in trans permits transduction of macrophages by MLV.

800

600

24h 400 48h

200 MLV cDNA (late copies)

0 AZT No Pre SIVΔVpx SIVwt Pre-infection

2.5

2 24h 1.5 48h

0.5 MLV cDNA (2LTR copies) cDNAMLV (2LTR

0 AZT No Pre SIVΔVpx SIVwt Pre-infectio n

Figure 3-18. Vpx permits transduction of macrophages by MLV in trans (A) Vpx delivered to macrophages by wild-type SIV (SIVWT) infection removes the block to synthesis of MLV cDNA in macrophages. Macrophages were initially infected with

SIVWT or SIVΔVpx and subsequently infected by MLV-GFP after 4 hours.

Macrophages infected with MLV without pre-infection were used as control (no Pre).

Synthesis of MLV late cDNAs (upper panel) and 2-LTR circles (lower panel) was assessed 24 and 48 hours after MLV infection. (B) A representative field of macrophages transduced by MLV-GFP in an independent experiment. 80

CHAPTER IV

Proteasome/Ubiquitylation Pathway and DDB1 Interaction are

Required for the Ability of Vpx to Counteract the Restriction

4.1 Chapter Summary

A possible role for the proteasome/ubiquitin system in the ability of Vpx to neutralize the unknown restriction was evaluated. Vpx was ubiquitylated by over-expressed Histidine-ubiquitin in 293 T cells, as well as by endogenous ubiquitin.

The extent of ubiquitylation was reduced in a Vpx mutant (VpxM4) lacking all four lysine ubiquitylation sites. VpxM4, although packaged within HIV-1 particles, was defective in enhancing HIV-1 infection of macrophages. This suggestes the ability of

Vpx to enhance HIV-1 infectivity requires its ubiquitylation. Furthermore, Vpx failed to enhance the permissiveness of macrophages to HIV-1 or MLV infection when proteasome function was disrupted by a proteasome inhibitor. This indicates that a functional proteasome system was necessary for the biological activity of Vpx.

This chapter also provides evidence that a cellular binding partner for Vpr, DDB1, is required for the ability of Vpx to counteract the restriction. In 293T cells, endogenous

DDB1 associated with a wild-type SIV Vpx protein but not with VpxM4, which suggests that Vpx ubiquitylation is required for DDB1 interaction. This may explain why ubiquitylation sites are important for Vpx function. Furthermore, fusion of DDB1 to SIV 81

Vpr partially restored the ability of Vpx-deleted SIV to infect macrophages.

Vpx failed to enhance lentiviral infection in macrophages in the presence of HIV-1

Vpr, suggesting that HIV-1 Vpr impaired the ability of Vpx to overcome the restriction.

Vpx was packaged into wild-type HIV-1 as well as Vpr-deleted HIV-1 virions. Therefore,

HIV-1 Vpr did not compete with SIV Vpx for virion packaging. Infection of macrophages by SIV harboring a wild-type Vpx gene alleviated the block to subsequent infection by wild-type or ΔVpr HIV-1, suggesting that HIV-1 Vpr competed with SIV

Vpx in target cells, possibly for restriction binding. To determine if Vpr from lab-adapted HIV-1 lost its ability to overcome the restriction due to mutations happened during propagation in vitro, I examined if primary Vpr alleles derived from AIDS patients were able to promote HIV-1 infection. All the tested primary HIV-1 Vpr alleles failed to enhance HIV-1 infection. This confirmed that HIV-1 Vpr does not overcome the putative restriction.

In addition, I examined the amount of Vpx needed to rescue SIVΔVpx infection in macrophages. The ability of trans-packaged Vpx to counteract a macrophage restriction is dose-dependent, and only a small amount of Vpx packaged in trans is sufficient to overcome the restriction in macrophages.

4.2 Vpx Activity Requires Ubiquitylation and Functional Proteasome

Primate lentiviruses have evolved the accessory protein Vif to counteract the 82

antiviral activity of cellular APOBEC 3 cytidine deaminases (30). Vif achieves this by promoting ubiquitylation and proteasomal degradation of APOBEC3 proteins (161, 162).

Therefore Vpx possibly antagonizes the macrophage restriction through a similar mechanism.

Vpx is ubiquitylated

To evaluate a possible role for the ubiquitin-proteasome system in the activity of

Vpx, whether Vpx itself was ubiquitylated was first examined. A Vpx mutant (VpxM4) containing lysine (K) to arginine (R) substitutions at all four lysine residues was constructed (Figure 4-1A). HA-tagged Vpx and VpxM4 were co-expressed in 293T cells with 6-Histidine-myc-tagged ubiquitin. Mono and poly ubiquitylated Vpx proteins were purified on nickel beads and western blotted. Immunoblotting with an HA antibody revealed the presence of mono and poly ubiquitylated forms of Vpx (Ub-Vpx, Figure

4-1B, left panel). It was also examined whether Vpx was ubiquitylated by endogenous ubiquitin (as opposed to over expressed and tagged ubiquitin). HA-tagged Vpx was expressed in 293 T cells and cell lysates were directly Western blotted and probed with an HA antibody. This revealed the presence of higher molecular weight ubiquitylated forms of Vpx (Figure 4-1B, right panel). The extent of Vpx ubiquitylation was reduced in VpxM4 (Figure 4-1B, left panel). Despite mutagenesis of all four lysines in Vpx, polyubiquitylated forms of the protein were still evident (compare GFP signal with

Figure 4-1. Identification of ubiquitylated residues in Vpx. (A) The positions of the

Lysine (K) to Arginine (R) mutations in VpxM4 mutant. (B) Wild-type and lysine mutant

VpxM4 (HA tag) were expressed in 293T cells expressing Histidine-tagged ubiquitin.

Ubiquitylated Vpx proteins (Ub-Vpx) were purified on nickel beads. Immunoblotting with an HA antibody revealed the presence of mono and poly ubiquitylated forms of

Vpx (left panel). Vpx was also ubiquitylated by endogenous ubiquitin. HA-tagged Vpx was expressed in 293T cells and cell lysates were directly blotted with anti-HA. The presence of higher molecular weight Ub-Vpx was revealed (right panel). 84

VpxM4 signal, Figure 4-1B, left panel). This suggested an involvement of both lysine and nonlysine residues in Vpx ubiquitylation (163, 164).

VpxM4 does not enhance HIV-1 infection in macrophages.

I first examined if VpxM4 mutant was able to be packaged into HIV-1 virions.

VpxM4 was packaged within HIV-1 particles at levels indistinguishable from wild-type

Vpx (Figure 4-2). The packaging of the VpxM4 in viral particles suggests, at the very least, that this mutant is competent for binding to the p6 domain of the viral Gag polyprotein through which packaging of Vpr and Vpx protein is mediated (112, 113).

I next evaluated whether the ability of Vpx to enhance HIV-1 infectivity depended upon its ubiquitylation. Wild-type SIVSM Vpx, VpxM4 or wild-type HIV-1 Vpr were packaged within HIV-1ΔVpr virions by cotransfection. Empty vector was cotransfected with HIV-1 proviral clone as a control. Single cycle infection of macrophages was evaluated from synthesis of 2-LTR cDNAs. Package of Vpx dramatically promoted

HIV-1 infection of macrophages (Figure 4-3). VpxM4 did not enhance HIV-1 infectivity when packaged within HIV-1ΔVpr virions (Figure 4-3), indicating the ability of Vpx to enhance the infectivity of HIV-1ΔVpr was compromised by the M4 mutation. To conclude, a Vpx mutant lacking lysine ubiquitylation sites failed to enhance macrophage infection by HIV-1. Therefore, the ability of Vpx to enhance HIV-1 infectivity for macrophages requires its ubiquitylation.

Figure 4-2. Packaging of Vpx proteins in wild-type and Vpr-deleted HIV-1. HA tagged wild-type Vpx or VpxM4 proteins were packaged within NL43WT or NL43ΔVpr by cotransfection. The virions were collected and pelleted with 20% sucrose cushion.

Virion lysates are subject to SDS-PAGE and blotted with anti-p24 (left panel) or anti-HA (right panel).

Figure 4-3. Ubiquitylation is required by Vpx for enhancement of HIV-1 infectivity in macrophages. Wild-type HIV-1 Vpr, SIV Vpx or lysine mutant Vpx (VpxM4) proteins were packaged in HIV-1ΔVpr and infectivity of those viruses was assessed in macrophages. Viral cDNA synthesis was evaluated 24 and 48 h post-infection.

A functional proteasome is necessary for the ability of Vpx to enhance HIV-1 and

MLV infection

Whether the ability of Vpx to regulate HIV-1 and MLV infection of macrophages required proteasome function was then examined. Macrophages were treated with two different proteasome inhibitors and then infected with HIV-1ΔVpr variants that had packaged wild-type Vpx or VpxM4. 2-LTR cDNA was quantitated 24 hours after infection. ALLN and proteasome inhibitor 1 (Prot.1) markedly impaired infection of macrophages by HIV-1ΔVpr containing wild-type Vpx (Figure 4-4A). In contrast, macrophage infection by HIV-1ΔVpr which does not contain wild-type Vpx was not dramatically compromised by the proteasome inhibitors (Figure 4-4A). Since proteasome disruption only impacted macrophage infection by HIV-1ΔVpr containing

Vpx, this argued that proteasome inhibition specifically impaired Vpx function rather than impacting virus infection through off-target effects.

I also examined if the ability of Vpx to render macrophages permissive to MLV infection required a functional proteasome. Macrophages were treated with the proteasome inhibitor ALLN, or DMSO as control. The cells were then infected with wild-type or Vpx-deleted SIV, and subsequently infected with MLV after 6 hours. MLV cDNA production was quantitated by real-time PCR 24 and 48 hours post-infection. Vpx delivered to macrophages by wild-type SIV pre-infection rendered macrophages

MLV in Macrophages

3.5

2.5

2 24h 1.5 48h

MLV cDNA (late/CCR5) 0.5

at O ZT SO e LN A ction L e M A + +D no tr x einf t x x+DMS r w p p P V SIVwt+ALLN V o- SIVwt no treat SI N IVΔV IVΔ SIVΔVp S S Pre-infection

Figure 4-4. The ability of Vpx to enhance permissivity of macrophages to HIV-1 and MLV infection requires a functional proteasome. Effects of proteasome inhibitors on HIV and MLV infection of macrophages are indicated. (A) Macrophages were treated with the proteasome inhibitors ALLN or proteasome inhibitor 1 (Prot. 1) or with DMSO as a control. Those cells were then infected with HIV-1ΔVpr variants which had packaged wild-type or lysine mutant Vpx proteins. The level of HIV-1 infection

(2-LTR cDNA) was determined 24 hours post-infection by PCR. (B) Macrophages were treated with the proteasome inhibitor ALLN or with DMSO as a control. Those cells were initially infected with wild-type or ΔVpx SIV, and subsequently infected by MLV.

The level of MLV infection (late cDNA) was determined 24 and 48 hours post-infection. 90

permissive to MLV (Figure 4-4B). However, Vpx was not able to rescue MLV infection of macrophages in cells that were treated with a proteasome inhibitor (Figure 4-4B).

Vpx failed to enhance permissiveness of macrophages to HIV-1 or MLV infection in macrophages in which proteasome function was disrupted by proteasome inhibitors.

Therefore, the ability of Vpx to enhance HIV-1 infectivity or to rescue MLV infection required proteasome function.

Collectively, these experiments indicate the presence of a potent antiviral restriction in macrophages that is counteracted by the Vpx protein and that the proteasome/ubiquitin system is required for the ability of Vpx to counteract this restriction.

4.3 Vpx Function Requires DDB1

Recent studies have demonstrated that the ability of HIV-1 Vpr to induce cell cycle arrest requires the E3 ubiquitin ligase complex scaffolding factor, damaged DNA

binding protein 1 (DDB1) (118–119120121122). Therefore, whether the ability of Vpx to counteract the macrophage restriction to SIV and HIV-1 infection was DDB1-dependent was examined.

First experiment investigated whether DDB1 is required for Vpx ubiquitylation or

Vpx ubiquitylation is required for DDB1 interaction. In 293T cells, endogenous DDB1 associated with a wild-type SIV Vpx protein but not with VpxM4 (Figure 4-5A). A 91

A B

Figure 4-5. Vpx ubiquitylation is required for Vpx interaction with DDB1. (A)

Association of SIV Vpx with endogenous DDB1. Association of DDB1 with wild-type

Vpx (VpxWT) and non-ubiquitylated Vpx (VpxM4) was evaluated in 293T cells expressing FLAG-tagged Vpx or IRES-GFP as a control. FLAG immunoprecipitates were immunoblotted with DDB1 or FLAG antibodies (upper panels). Levels of endogenous DDB1 and expressed Vpx in cell lysates were confirmed by Western blotting with a DDB1 antibody and with a FLAG antibodie respectively. (lower panels)

(B) Impact of DDB1 silencing on Vpx ubiquitylation. 293T cells were cotransfected with DDB1 or scrambled siRNAs and with Histidine-ubiquitin and HA-Vpx or

IRES-GFP expression plasmids as outlined in Figure 4-1. Ubiquitin-conjugated proteins were nickel purified and immunoblotted for HA-Vpx (upper panels). Cell lysates were directly blotted for Vpx and DDB1 proteins (lower two panels). 92

specific association of SIV Vpx with DDB1 was apparent in coimmunoprecipitation experiments with FLAG-tagged Vpx protein (Figure 4-5A). Although ubiquitylation was necessary for the ability of Vpx to counteract the restriction to HIV-1 and SIV infection of macrophages, DDB1 protein was not required for Vpx ubiquitylation (Figure 4-5B).

Mono and poly ubiquitylated forms of Vpx were evident and apparently increased in cells in which DDB1 expression was reduced by RNA interference (Figure 4-5B).

Whether DDB1 was required for the ability of Vpx to counteract the restriction to

HIV-1 infection was next examined. Since Vpx, when packaged in HIV-1 virions, enhanced macrophage infection, a transpackage strategy was used to examine whether

Vpx enhanced HIV-1 infection in DDB1 depleted macrophages. While packaging of

Vpx in HIV-1 particles markedly increased infectivity for macrophages transfected with a scrambled siRNA (Figure 4-6A), silencing of DDB1 in macrophages significantly reduced the ability of Vpx to enhance HIV-1 infection (Figure 4-6A). However, HIV-1

Vpr did not antagonize a macrophage restriction. The activity of the restriction in HIV-1 was only revealed by the ability of Vpx to enhance HIV-1 infection of macrophages. In agreement with this, DDB1 silencing had no significant effect on the infectivity of

HIV-1 which had not packaged Vpx (Figure 4-6A). Therefore, DDB1 appears to be a specific Vpx cofactor in primary macrophages.

Since SIV Vpx but not SIV Vpr was essential for macrophage infection (Figure

Figure 4-6. DDB1 is required for the ability of Vpx to counteract the restriction to macrophage infection by HIV-1 and SIV. (A) SIV Vpx (or GFP as a control) was packaged into HIV-1ΔVpr virions by co-transfection. Infectivity of those viruses for

DDB1-depleted macrophages (DDB1 siRNA) or control macrophages (ScrI siRNA) were evaluated from levels of viral cDNA 24 h later (+, p>0.2; *, p<0.002). (B) DDB1 packaging partially substitutes for Vpx. A Vpx/Vpr deletion mutant of SIV (SIVΔXR) was co-transfected with vectors expressing SIV Vpr, SIV Vpx, DDB1 or a Vpr-DDB1 fusion. Infectivity of the resulting viruses for macrophages was evaluated from levels of

SIV cDNA at 24 and 48 hours post-infection (*, p<0.005). 94

3-1A), I examined whether fusion of DDB1 to SIV Vpr was sufficient to allow SIV Vpr to counteract the macrophage restriction. Packaging of Vpr alone into a Vpr and

Vpx-deleted SIV (SIVΔXR) did not permit macrophage infection. In contrast, there was a partial and significant restoration of infectivity when a Vpr-DDB1 fusion was packaged relative to infectivity of virions in which the DDB1 protein was not packaged (Figure

4-6B). Collectively, these results suggest that DDB1 is required for the ability of Vpx to antagonize a restriction to infect macrophages by HIV and SIV, but that DDB1 is not required for Vpx ubiquitylation.

4.4 HIV-1 Vpr Impairs the Ability of Vpx to Neutralize the Macrophage Restriction

Previous experiments demonstrated that Vpx had the ability to compliment

HIV-1ΔVpr but not wild-type HIV-1 (Figure 3-15 and Figure 3-17). Therefore, one possibility is that the ability of Vpx to promote HIV-1 infection is compromised by the presence of HIV-1 Vpr. To assess this hypothesis I packaged SIVSM Vpx or HIV-1 Vpr into a Vpx-expressing HIV-1 variant NL43 (SIV-Vif-Vpx), or NL43 (SIV-Vif-ΔVpx) that does not express Vpx. The infectivity of NL43 (SIV-Vif-Vpx) was dramatically higher than that of NL43 (SIV-Vif-ΔVpx) in macrophages, as evidenced by viral 2-LTR production (Figure 4-7). However, packaging of HIV-1 Vpr into NL43 (SIV-Vif-Vpx) virions profoundly decreased virus infection of macrophages, to a level similar to NL43

(SIV-Vif-ΔVpx) (Figure 4-7). This confirmed that the packaged HIV-1 Vpr protein 95

7000

6000

5000 24h+AZT 4000 24h 3000 48h+AZT 48h 2000

1000 HIV-1 cDNA (2LTR copies) 0 No GFP Vpx Vpr No GFP Vpx Vpr trans trans Proteins packaged in trans

NL43 (SIV-Vif-Vpx) NL43 (SIV-Vif-ΔVpx)

Figure 4-7. HIV Vpr inhibits the ability of SIVSM Vpx to antagonize the macrophage restriction. Macrophages were infected with NL43 (SIV-Vif-Vpx) which had packaged SIVSM Vpx or HIV-1 Vpr proteins. The infectivity of those viruses was gauged from the levels of HIV-1 2-LTR circle 24 and 48 hours post infection. 96

inhibited the ability of Vpx to neutralize the macrophage restriction.

A possible explanation is that Vpx and HIV-1 Vpr proteins compete for packaging within HIV-1 virions. An alternative possibility is that these proteins do not compete for packaging into virions but compete for interaction with the restriction after infection has occurred. Western blotting analysis revealed that Vpx proteins were packaged into wild-type and Vpr-deleted HIV-1 virions (Figure 4-2). This suggested that HIV-1 Vpr competed with Vpx in the target cell following infection and this competition precluded the ability of Vpx to neutralize the restriction. A prediction of this is that delivery of Vpx to this target cell prior to HIV-1 infection should be sufficient to inactivate the restriction and subsequently enhance macrophage infection by both wild-type and

Vpr-deleted HIV-1. To evaluate this, I bypassed the requirement for Vpx packaging by directly introducing Vpx into the target cell by SIVWT infection. The susceptibility of those cells to infection by wild-type or Vpr-deleted HIV-1 variants was then examined.

The infectivity of both wild-type and Vpr-deleted HIV-1 variants for macrophages was enhanced when Vpx was first introduced into the cell by SIVWT infection (Figure 4-8).

In contrast, prior infection with a SIVΔVpx variant did not enhance subsequent HIV-1 infection of macrophages (Figure 4-8). Therefore, in the absence of competition by packaged Vpr, Vpx greatly enhanced wild-type HIV-1 infectivity for macrophages.

In summary, HIV-1 Vpr does not abrogate Vpx packaging into HIV-1 virions. 97

Figure 4-8. Vpx delivered to macrophages by SIVWT infection enhances the permissivity to HIV-1WT and HIV-1ΔVpr infection. Macrophages were first infected

(1º infection) with wild-type or ΔVpx SIV variants, left uninfected (none) or treated with AZT. After 8 h, these cells were super-infected (2º infection) with WT or ΔVpr

HIV-1 variants and HIV-1 infection (2-LTR cDNA synthesis) was determined 24 and 48 h later.

Instead, HIV-1 Vpr interferes with Vpx function in target cells, possibly by competing for interaction with the restriction factor. Without competition from HIV-1 Vpr, SIVSM

Vpx delivered into macrophages by SIV pre-infection antagonizes the restriction and enhances wild-type HIV-1 infection.

4.5 Primary HIV-1 Vpr Alleles Fail to Overcome the Macrophage Restriction

Initial experiments demonstrated that both HIV-1 and SIVSM were antagonized by a macrophage restriction factor. Although HIV-1 was only partially restricted in macrophages and infected macrophages to a moderate level, the introduction of Vpx dramatically enhanced its infectivity. One possibility is that HIV-1 Vpr antagonizes the macrophage restriction but the ability of Vpr to overcome the restriction is lost during viral expansion in lymphocyte culture. HIV-1 Vpr induces cell cycle arrest; therefore, it is possible that during viral propagation in vitro, viruses with mutations in vpr that are less efficient in inducing G2 cell cycle arrest are selected. As a result, Vpr from lab-adapted viruses may lose the ability to counteract the restriction factor.

To test this hypothesis, I examined if primary Vpr alleles derived from AIDS patients were able to neutralize the macrophage restriction and promote HIV-1 infection.

PBMCs were obtained from AIDS patients with high viral load. Primary Vpr sequences were amplified from total cDNA and then cloned into a p-IRES-EGFP expression vector.

Primary Vpr proteins were packaged into Vpr-deleted HIV-1 virions by cotransfection. 99

While HIV-1 containing wild-type NL43 Vpr moderately infected macrophages, encapsidation of SIVSM Vpx enhanced HIV-1 infectivity in macrophages dramatically

(Figure 4-9). However, none of the primary Vpr alleles obtained from clinical samples enhanced HIV-1 transduction in macrophages (Figure 4-9), suggesting that the primary

Vpr alleles do not neutralize the macrophage restriction.

4.6 The Ability of Vpx to Neutralize the Restriction is Dose Dependent

Previous experiments have demonstrated that Vpx delivered in trans by virus particles enhances the permissivity of macrophages to SIVSM and HIV-1 infection. I next titered the amount of Vpx needed to rescue SIVΔVpx infection in macrophages and whether the ability of packaged Vpx to counteract the macrophage restriction was dose-dependent. Since primary macrophages cannot be transfected with Vpx expression plasmids and expression of Vpx following infection of macrophages with viruses containing packaged Vpx has not been detectable with available Vpx antibodies, I conducted an experiment in which different amounts of Vpx were packaged into SIVSM virions.

A Vpx-deleted SIV (SIVΔVpx) variant expressing GFP was used for this experiment. Increasing amount of Vpx was packaged into SIVΔVpx by cotransfection.

Wild-type SIV was used as a control. The levels of packaged Vpx in the purified virions were determined by western blotting with a Vpx antibody and were normalized with p27 100

HIV-1Δvpr containing primary Vpr

14000 12000 10000 24h+AZT 8000 24h 6000 48h+AZT 4000 48h 2000 0 HIV-1 cDNA (2LTR copies)

x -5 -6 -7 -4 -7 8 8 0 Vp L43 9 +GFP + N 4 4 r pr r pr pr v Vp V Vpr 48 V Vpr 69-4 + + + pr pr+Vpr 49 pr pr+Vpr 43Δ v v v L vpr Δvpr+ Δ Δvpr+ Δ Δ N Δ 3 3 NL43 Δvp 4 L L43 L43 L43 NL43 N N NL4 N NL43Δv N

Figure 4-9. Primary HIV-1 Vpr alleles fail to overcome the macrophage restriction.

Primary Vpr alleles were derived from AIDS patient plasma. NL43 Vpr and primary Vpr proteins were packaged into Vpr deleted HIV-1 (NL43ΔVpr) virions by cotransfection.

The infectivity of those viruses for macrophages was then determined from levels of

2-LTR cDNA 24 and 48 hours post-infection. 101

level. With increasing amount of a co-transfected Vpx-expressing plasmid, an increasing amount of Vpx in viral particles was observed (Figure 4-10A). When 0.5µg

Vpx-expressing plasmid was cotransfected with 9µg SIVΔVpx proviral DNA, the amount of Vpx packaged into SIVΔVpx virions reached a level similar to that of wild-type SIV (Figure 4-10A).

The infectivity of these viruses in primary macrophages was determined from the levels of SIV 2-LTR circle or late cDNA 24 and 48 hours post-infection. The percentage of infected (GFP+) cells was determined by FACS. An increasing level of 2-LTR production was observed with increasing amount of packaged Vpx (Figure 4-10B). The percentage of GFP+ post infection was also proportional to the amount of Vpx packaged into particles (Figure 4-10C). This suggests that the ability of packaged Vpx to counteract a macrophage restriction is dose-dependent. It was also observed that even a small amount of trans-packaged Vpx can counter the restriction present in macrophages

(Figure 4-10). Vpx is packaged in molar amounts equivalent to Gag proteins (165).

Assuming ~2000 Gag molecules per virion (166), and assuming uniform Vpx:Gag stoichiometry in each viral particle, Vpx packaged at ~10% of wild-type levels still rescued a ΔVpx virus (Figure 4-10), suggesting that as few as 200 Vpx molecules/virion can counteract the restriction.

102

7.00E+00

6.00E+00

5.00E+00

4.00E+00 AZT d1 3.00E+00 d2

2.00E+00

SIV cDNA (2LTR/cell) 1.00E+00

0.00E+00 x x px p px vpx vpx wt g v g v g g Bj µg vpx µ P 0µ 1 01µ 0. 25µ 2+ 0. 0. X 2+ 2+0.5 2+ X X X 2+0.025µg vpX2+0.05µg v X2+ X

30 d2 20 d3

10 GFP+ Percnetage (%) 0 x x px px px p p v vpx v v v v Mock g g g g Bj wt µ µg P 0µ 1 .05 0. X2+ +0.25µ 2+0.5µg 2+0.01µ X2+ X X 2+0.025µg vpxX2+0 X2 X

103

Figure 4-10. Dose-dependent ability of packaged Vpx to counteract a macrophage restriction. Pseudotyped SIVΔVpx (X2) was produced in 293T cells by cotransfecting

SIVΔVpx proviral DNA with pVSV-G and increasing amount of a Vpx expression vector. (A) The amount of packaged Vpx in the purified virions was determined by western blotting with a Vpx antibody and normalization with p27 by densitometry. The integrated density was measured by Scion Image software. (B) The infectivity of these viruses in primary macrophages was determined from quantitation of SIV 2-LTR cDNA

24 and 48 h post-infection. PBjWT was used as positive control for this experiment. (C)

Virus transduction was determined from percentage of GFP+ cells 48 and 72 h post-infection by FACS. 104

CHAPTER V

Vpx Renders Primary Monocytes Permissive to HIV-1 Transduction

5.1 Chapter Summary

Quiescent monocytes are highly refractory to HIV-1 and the infection is blocked at an early post-entry step. Susceptibility to infection occurs only upon differentiation of monocytes to macrophages (126, 134, 135). A heterokaryon experiment was used to examine if the resistance of monocytes to infection in vitro was due to the absence of a positive factor or the presence of a restriction factor. The fusion of nonpermissive monocytes with permissive HeLa cells did not remove the block to HIV-1 infection, suggesting the presence of a restriction factor in monocytes.

The Vpx protein of SIVSM counteracts a macrophage restriction and enhances

HIV-1 infection in macrophages. I therefore examined whether the same restriction is operative in monocytes. Packaging of Vpx within HIV-1 virions conferred the ability to transduce quiescent monocytes, as evidenced by increased cDNA production and GFP expression. Additionally, Vpx introduced by pre-infecting monocytes with wild-type

SIV also removed the block to infection by HIV-1.

To confirm that Vpx rendered undifferentiated monocytes permissive to HIV-1 without inducing monocyte differentiation into macrophages, the expression of CD71 post-infection was examined. Infection of monocytes by HIV-1 either with or without 105

Vpx did not have an effect on temporal expression of CD71. I also examined whether

HIV-1 transduction was restricted to a small percentage of differentiated CD71+ macrophages in the culture. As the frequency of GFP+ cells increased, there was no apparent bias to an increased frequency of CD71+/GFP+ cells, confirming that Vpx directly rendered undifferentiated monocytes permissive to HIV-1 transduction.

Previous studies have suggested that an enzymatically active, low-molecular -mass

(LMM) APOBEC3G complex contributes to the resistance of monocytes to lentiviral infection. To determine whether Vpx rendered monocytes permissive to HIV-1 by inducing a shift of APOBEC3G into an enzymatically inactive HMM complex, I examined APOBEC3G complexes in monocytes infected with wild-type or Vpx deleted

SIV. The majority of APOBEC3G in quiescent monocytes was present as a LMM form.

Introduction of Vpx into the monocytes did not significantly shift APOBEC3G into a

HMM APOBEC3G complex. This suggested that the impact of Vpx on monocyte permissivity to HIV-1 infection was not due to changes in APOBEC3G distribution.

In conclusion, our studies indicate that the ability of primate lentiviruses to infect quiescent monocytes is governed by a cellular restriction. Vpx is necessary and sufficient to remove this restriction and permit the transduction of quiescent monocytes by HIV-1.

5.2 The Resistance of Quiescent Monocytes to Lentivirus Transduction is 106

Governed by a Restriction

The first experiment investigated whether the fusion of HeLa cells with monocytes would result in heterokaryons that are permissive to HIV-1 infection. To generate HeLa- monocyte heterokaryons, the fusogenic properties of Sendai Virus (hemmaglutinating virus of Japan; HVJ) envelope proteins were exploited. The susceptibility of those heterokaryons to HIV-1 infection was then examined. HIV-1 infection was determined by luciferase activity expressed from the HIV-1 genome (values were expressed as percentages of those obtained with HeLa cells). As with unfused monocytes,

HeLa-monocyte heterokaryons were highly refractory to transduction by HIV-1 (Figure

5-1A), suggesting the presence of a negative factor in nonpermissive monocytes.

The ability of Vpx to overcome the block to HIV-1 infection of HeLa-monocyte heterokaryons was next examined. Heterokaryons between monocytes and between

HeLa cells that expressed the Vpx protein was constructed (Figure 5-1B). In this case, the permissivity of HeLa-monocyte heterokaryons to HIV-1 transduction was increased by Vpx whereas HeLa-monocyte heterokaryons not expressing Vpx remained refractory to HIV-1 transduction (Figure 5-1B). Since Vpx does not increase the efficiency of

HIV-1 infection in HeLa cells, this result was not due to infection of unfused HeLa cells.

Therefore, the heterokaryons formed between nonpermissive monocytes and permissive

HeLa cells are nonpermissive, due to the presence of a dominant restriction, and that 107

108

Figure 5-1. Transduction of primary monocytes by HIV-1 is blocked by a restriction. Heterokaryons were formed between primary monocytes and HeLa cells using HVJ envelope fusion kit. (A) Hela-monocyte heterokaryons are highly refractory to transduction by HIV-1. FACS analysis of HeLa-monocyte heterokaryons is shown on the left panels. HeLa cells expressed GFP and macrophages were stained with an

APC-conjugated anti-CD14. Double-stained cells were sorted as indicated by the gate.

HIV-1 infection was gauged from luciferase activity (right panels). Values were expressed relative to those obtained for HeLa cells. (B) Vpx renders HeLa-monocyte heterokaryons permissive to HIV-1 infection. Heterokaryons were formed between primary monocytes and HeLa cells expressing Vpx as described in A). Susceptibility of

HeLa-monocyte heterokaryons to HIV-1 infection was examined after expression of

Vpx in HeLa cells. FACS analysis of HeLa-Vpx-monocyte heterokaryons is shown on the left panels. Double-stained cells were sorted as indicated by the gate. Infection of monocytes and infection of HeLa-monocyte heterokaryons with and without Vpx was gauged by luciferase activity (right panels). 109

Vpx was sufficient to render HeLa-monocyte heterokaryons permissive to HIV-1 infection.

5.3 Vpx Counteracts a Monocyte Restriction to HIV-1 Infection in trans

During HIV-1 infection of macrophages, the restriction is neutralized by Vpx proteins that are encapsidated within the virus particle. Therefore, I examined whether packaging of Vpx within virions would be sufficient to confer upon HIV-1 the ability to transduce quiescent monocytes. Vpx proteins were packaged into HIV-1 virions by cotransfecting LAIΔVpr-GFP proviral DNA with a Vpx expression plasmid. HIV-1 containing Vpr or empty vector was used as control. Fresh monocytes were infected with different viruses and viral 2-LTR and late product cDNA synthesis was determined

24, 48 and 72 hours post-infection. Transduction by HIV-1 (based on GFP expression) was visualized 72h after monocyte infection. HIV-1 infection of quiescent monocytes was blocked at, or prior to, reverse transcription as evidenced by viral cDNA production

(Figure 5-2A). The transduction efficiency was similar for HIV-1ΔVpr with or without

Vpr packaged in trans (Figure 5-2). Packaging of Vpx within HIV-1ΔVpr virions markedly increased the efficiency of transduction in primary monocytes, in terms of viral cDNA synthesis (Figure 5-2A) and GFP expression from the HIV-1 genome

(Figure 5-2B). Furthermore, HIV-1 cDNA that was detected in these monocytes was synthesized de novo and was inhibited in the presence of AZT (Figure 5-2A). These 110

2.5

1.5 LAIΔvpr LAIΔvpr+vpr 1 LAIΔvpr+vpx 0.5

HIV cDNA (late/cell) 0 AZT d1 d2 d3 Days post-infection

0.3

0.25

0.2 LAIΔvpr 0.15 LAIΔvpr+vpr LAIΔvpr+vpx 0.1

0.05 HIV cDNA (2LTR/cell) cDNA HIV 0 AZT d1 d2 d3 Days post-infection

111

Figure 5-2. HIV-1 virions encapsidating Vpx efficiently transduce primary monocytes. (A) Monocytes were infected with HIV-1ΔVpr-GFP variants in which Vpx was packaged. Levels of HIV-1 late cDNA (upper panel) and 2-LTR circle (lower panel) production were gauged on the indicated intervals post-infection. (B) GFP expression was visualized 72 hours post-infection. Representative fields of primary monocytes following transduction by HIV-1-GFP is shown. 112

results suggest that packaging of Vpx within HIV-1 Virions confers the ability to transduce quiescent monocytes.

I next examined whether introduction of Vpx into monocytes by pre-infection would remove the monocyte restriction. Since monocytes were partially permissive to

SIVWT transduction, Vpx was introduced into monocytes by SIVWT infection, and those monocytes were subsequently examined for permissivity to HIV-1. SIV infection rendered monocytes highly permissive to subsequent HIV-1 infection, as evidenced by an increase in HIV-1 cDNA synthesis (Figure 5-3A). In contrast, monocytes that had not been preinfected with SIV remained refractory to HIV-1 (Figure 5-3A). Furthermore, monocytes infected with SIVWT but not SIVΔVpx could be transduced by HIV-1, as evidenced by expression of GFP from the HIV-1 genome (Figure 5-3B). Therefore, Vpx introduced by SIV infection removes the block to Monocyte infection by HIV-1.

Collectively these results indicate that Vpx is sufficient to render primary monocytes permissive to HIV-1 infection in trans.

5.4 Vpx Renders Monocytes Permissive to HIV-1 Infection without Inducing

Monocyte Differentiation

Quiescent monocytes acquire permissivity to HIV-1 transduction once they differentiate into macrophages (126, 134, 135). Vpx may not permit transduction of undifferentiated monocytes by HIV-1, but rather, rapidly induced monocyte 113

1.6 No preinfection SIVΔVpx preinfection 1.2 SIVwt preinfection

0.8

0.4

HIV cDNA (late/cell) 0 AZT d1 d2 d3 Days post-infection

0.1 No preinfection 0.08 SIVΔVpx preinfection SIVwt preinfection 0.06

0.04

0.02 HIV cDNA (2LTR/cell)

0 AZT d1 d2 d3 Days post-infection

No pre-infection SIVΔVpx SIVWT

114

Figure 5-3. Vpx delivered to monocytes by SIVWT infection removes a block to subsequent infection by HIV-1. (A) Infection of monocytes by wild-type SIV removes a reverse transcription block to subsequent infection by HIV-1. SIVWT-infected monocytes were subsequently infected (6 hours later) by HIV-1. Levels of HIV-1 late cDNA (upper panel) and 2-LTR circle (lower panel) production were gauged on the indicated intervals post-infection. (B) Prior infection by SIVWT but not SIVΔVpx renders primary monocytes permissive to subsequent transduction by HIV-1. Monocytes were infected as in A and were visualized 72 hours post-infection by phase and fluorescence microscopy. 115

differentiation into macrophages that are permissive to HIV-1 infection. To examine the effect of Vpx protein on monocyte differentiation, Monocytes were infected with

HIV-1ΔVpr with or without Vpx, and the percentage of CD14+ (monocyte/macrophage) or CD71+ (macrophage) cells was determined by FACS at indicated intervals post-infection. HIV-1 virions harboring Vpx protein efficiently transduced primary monocytes as evidenced by GFP expression from the HIV-1 genome (Figure 5-4A).

CD14 expression remained constant throughout 6 days post-infection (Figure 5-4B, upper panel). CD71 expression increased gradually, indicating ongoing monocyte differentiation in culture (Figure 5-4B, lower panel). Although there were dramatic differences in GFP expression level between monocytes infected with HIV-1 encapsidating Vpx and cells infected with HIV-1 not containing Vpx (Figure 5-4A), there were no significant differences in CD14 or CD71 expression (Figure 5-4B). In conclusion, infection of monocytes by HIV-1 either with or without Vpx did not have an effect on temporal expression of CD14 or CD71, suggesting that Vpx affected monocyte permissivity independent of differentiation status.

5.5 Vpx Promotes HIV-1 Infection of Quiescent Monocytes without Preferably

Infecting Differentiated Monocytes

Another possibility is that HIV-1 transduction was restricted to a small percentage of differentiated (CD71+) macrophages in the culture. To examine this, frequencies of 116

30 Mock 25 HIV-1ΔVpr 20 HIV-1ΔVpr+Vpx 15 10 5 GFP (% positive) (% GFP 0 d0 d1 d2 d3 d4 d5 d6 Days post-infection

117

Figure 5-4. Vpx Renders Monocytes Permissive to HIV-1 Infection without

Inducing Monocyte Differentiation. (A) HIV-1 virions encapsidating Vpx efficiently transduce primary monocytes. Monocytes were infected with HIV-1ΔVpr-GFP variants in which Vpx was or was not packaged. Levels of transduction (percentage of GFP+ monocytes) were determined at the indicated intervals after monocyte infection. (B) Vpx does not affect differentiation status of monocytes in culture. Fresh monocytes were infected with HIV-1ΔVpr-GFP that had or had not packaged Vpx, and the percentage of monocyte/macrophage (CD14+, upper panel) and differentieated monocyte (CD71+, lower panel) subsets was determined by FACS at the indicated intervals post-infection. 118

infected monocytes (CD71–) and macrophages (CD71+) were examined by FACS following infection with a GFP-expressing HIV-1 variant in which Vpx had been packaged. Packaging of Vpx within HIV-1 virions markedly increased their ability to transduce undifferentiated monocytes, as evidenced by percentage of GFP+ cells in

CD71– subset (Figure 5-5), arguing against the possibility that HIV-1 virions containing

Vpx selectively transduced differentiated cells. Furthermore, as the frequency of GFP+ cells increased, there was no apparent bias to an increased frequency of CD71+/GFP+ cells (Figure 5-6A). Indeed, the frequencies of infected CD71– monocytes at day 2, 3 and 4 post-infection paralleled those for infected CD71+ cells (Figure 5-6A). In an independent experiment, equivalent transduction of CD71+ and CD71– by HIV-1 over 6 days post-infection was maintained (Figure 5-6B).

As infected monocytes do not begin to express GFP until 2-3 days in culture, viral cDNA synthesis in CD71– monocytes 24 and 48 hours post infection was examined, to determine if Vpx rendered CD71– monocytes permissive to HIV-1 at early stages of infection. Packaging of Vpx within HIV-1 virions markedly increased 2-LTR circle and late cDNA levels in CD71– cells (Figure 5-7). Collectively, these results indicate that

Vpx directly renders undifferentiated monocytes permissive to HIV-1 transduction without preferentially infecting differentiated cells.

119

Percentage of GFP+ in CD71- subset

30 25 Mock 20 HIV-1ΔVpr 15 HIV-1ΔVpr+Vpx 10 5

GFP (% positive) 0 d0 d1 d2 d3 d4 d5 d6 Days post-infection

Figure 5-5. HIV-1 virions encapsidating Vpx efficiently transduce CD71– monocytes.

Fresh monocytes were infected with HIV-1ΔVpr-GFP that had or had not packaged Vpx.

The frequency of GFP-expressing cells in CD71– subset was determined by FACS at indicated intervals post-infection.

120

121

Figure 5-6. HIV-1 with encapsidated Vpx equally transduces undifferentiated

(CD71–) and differentiated (CD71+) monocyte populations. (A) Fresh monocytes were infected with HIV-1ΔVpr in which Vpx had been packaged (lower three panels), and the frequencies of infected GFP+CD71+ macrophages and GFP+CD71– monocytes were determined by FACS. Upper three panels depict controls for gating. (B) The frequency of HIV-1 infection in CD71+ and CD71– cells at different intervals post-infection.

122

CD71- population

0.4

0.3 NL43Δvpr 0.2 NL43Δvpr+Vpx 0.1

0 HIV cDNA (2LTR/cell) d1 d2 Days post-infection

CD71- population

5.0

4.0

3.0 NL43Δvpr 2.0 NL43Δvpr+Vpx

1.0

0.0 HIV cDNA (late/cell) d1 d2 Days post-infection

Figure 5-7. Vpx enhances late product and 2-LTR cDNA production in undifferentiated CD71– cell population. Freshly isolated monocytes were infected with

HIV-1ΔVpr with or without Vpx. CD71– cells were sorted by FACS 24h and 48 hours post-infection. HIV-1 2-LTR circles (upper panel) and late cDNAs (lower panel) were determined by real-time PCR..

123

5.6 Vpx Affects Monocyte Permissivity Independent of APOBEC3G

Previous studies have demonstrated that APOBEC3G exists predominantly in a

LMM complex in quiescent monocytes and that this complex restricts infection of monocytes by HIV-1. Differentiation of monocytes to macrophages redistributes

APOBEC3G into a HMM complex and this correlates with the permissivity of macrophage to HIV-1 infection. (22, 137, 138). To investigate the possibility that Vpx rendered monocytes permissive to infection by causing a shift in APOBEC3G from LMM to

HMM complexes, I compared the distribution of APOBEC3G in uninfected monocytes and in monocytes infected with wild-type SIV and SIV ΔVpx.

Fresh monocytes were infected with wild-type SIV or SIVΔvpx, and the cells were collected 1 day post-infection for APOBEC3G analysis. H9 cell, fresh monocytes (d0) and differentiated macrophages (d10) were used as controls. As published previously

(137), APOBEC3G was sequestered primarily in a HMM complex in H9 cells and in differentiated (day 10) macrophages (Figure 5-8). RNase treatment of HMM complexes from H9 cells led to the formation of LMM APOBEC3G complexes (Figure 5-8). In undifferentiated (day 0) monocytes, APOBEC3G was sequestered primarily in an LMM complex (Figure 5-8). Infection of monocytes by wild-type or Vpx-deleted SIV did not noticeably alter distribution of APOBEC3G between LMM and HMM complexes

(Figure 5-8). 124

Figure 5-8. Vpx renders monocytes permissive to HIV-1 infection without inducing

APOBEC3G redistribution. Distribution of APOBEC3G between LMM and HMM nucleoprotein complexes in undifferentiated (d0) monocytes, differentiated (d10) macrophages and SIV-infected monocytes is shown. Distribution of APOBEC3G between H9 cell-derived HMM and LMM complexes before and after RNase treatment is shown for comparison.

125

CHAPTER VI

Summary and Discussions

6.1 Myeloid Cell Permissivity to Lentiviruses and Gammaretroviruses is

Determined by a Restriction

Our study and other studies have suggested that the accessory proteins Vpr and

Vpx of primate lentiviruses have evolved to specifically promote infection of

nondividing myeloid-lineage cells (33, 36–3738, 167, 168). By generating heterokaryons between cells in which Vpx was dispensable for infection and primary macrophages in which Vpx was required for SIV infection, it was demonstrated that macrophages harbor a dominant restriction and that this restriction is specifically counteracted by Vpx.

HIV-1 Vpr did not exhibit the ability to counter the macrophage restriction. For this reason, deletion of Vpr did not impair susceptibility of macrophages to HIV-1 infection.

However, the fact that the restriction was active against HIV-1 was revealed by the demonstration that Vpx greatly increased the permissivity of macrophages to HIV-1 infection. I also demonstrated that this restriction is an obstacle to transduction of terminally differentiated macrophages by the gammaretrovirus MLV. Furthermore, I present evidence that the ability of lentiviruses to transduce quiescent monocytes is regulated by this same restriction and that neutralization of the restriction in monocytes confers susceptibility to lentivirus infection. Previous studies have also demonstrated 126

that SIV is more efficient than HIV-1 in transducing primary monocytes and that deletion of Vpx prevented monocyte transduction by SIV (169). Collectively, our results suggest that the relative ability of lentiviruses and gammaretroviruses to transduce nondividing myeloid cells is governed primarily by their ability to neutralize a restriction that is present within these cells.

Current models, based primarily on studies with artificially growth-arrested cell lines, suggest that the relative abilities of gammaretroviruses and lentiviruses to traverse the nuclear envelope dictate the differential abilities of these viruses to transduce nondividing cells. Models invoking a nuclear import role for Vpr/Vpx proteins have been supported by the fact that these proteins exhibit a nuclear localization (154). Our study demonstrated an alternative explanation that the differential ability of lentiviruses and gammaretroviruses to transduce nondividing macrophages is dictated by the degree to which they are sensitive to a restriction that acts prior to or at the level of reverse transcription. Actually, in another study by our group, it was observed that MLV infection of artificially growth-arrested HeLa cells was blocked at the level of integration and this block was mechanistically distinct from the block observed in natural nondividing macrophages where MLV transduction was inhibited either prior to or at the level of reverse transcription of viral cDNA. While our data argues against the possibility that nuclear access is blocked during MLV infection of nondividing 127

macrophages, it is possible that the restriction is located in the nucleus and that Vpx must localize to the nucleus in order to counteract the restriction.

Our studies suggest that the same restriction may antagonize HIV-1 infection in monocytes and in macrophages. However, the degree to which HIV-1 is restricted in monocytes and macrophages differs considerably. In the absence of Vpx, HIV-1 still has the ability to transduce macrophages to some degree. Nevertheless, the efficiency with which HIV-1 transduces macrophages is greatly increased by Vpx. Therefore, while infection of macrophages by HIV-1 is antagonized by a restriction, this restriction is not sufficient to completely block transduction of these cells by HIV-1. In contrast, monocytes are totally refractory to HIV-1 infection in the absence of Vpx. Therefore, monocytes can be considered nonpermissive and macrophages semipermissive to HIV-1 transduction. The extent to which monocytes and macrophages are permissive to infection may relate to the levels at which the restriction is expressed in these cells. A similar situation is seen with APOBEC3G, in that some cell lines are semipermissive with regards to Vif-deleted virus (30).

Our study underscores the powerful degree to which restrictions shape lentivirus biology. Primate lentiviruses exhibit tropism for macrophage lineage cells, and reservoirs of tissue macrophages are evident in the gut, lung, lymph nodes, and CNS

(170). Tropism is dictated primarily by the expression of specific coreceptor molecules 128

(mainly CCR5) on macrophages that permit virus binding and entry (reviewed by Gorry et al (171)). Our study reveals a second level of tropism that is manifest post-entry, and our findings would suggest that the ability of primate lentiviruses and perhaps nonprimate lentiviruses to establish reservoirs in myeloid lineage cells is dependent upon their ability to counteract a myeloid cell-specific restriction. Given the potency with which the restriction antagonizes primate lentivirus infection, identification of the restriction itself as well as pharmacologic agents that harness restrictions within macrophages are important objectives.

6.2 Vpx but not Vpr Removes a Restriction in Myeloid Cells

This study demonstrated that the restriction influencing infection of myeloid cells by SIV, HIV-1 or MLV is sensitive to neutralization by Vpx only, but not SIVSM Vpr or

HIV-1 Vpr. The Vpx gene of the HIV-2 group, which includes HIV-2, SIVSM, and

SIVMAC, arose by duplication of the Vpr gene within this group (172, 173), which diverged from the other primate lentiviral groups around 200 years ago (173). While

Vpx represents a duplication event, it does not share all the functional properties of Vpr.

Vpr induces cell cycle arrest, whereas Vpx does not (38). Conversely, the ability to neutralize a restriction in myeloid cells is governed by Vpx but not Vpr (Table 6-1).

Presumably, this activity was manifest in the ancestral Vpr gene, but for unknown reasons has been lost in the HIV-1 and SIVAGM groups. It is possible that loss in the 129

HIV-1 Vpr HIV-2/SIVSM Vpr HIV-2/SIVSM Vpx

G2 cell cycle arrest G2 cell cycle arrest No

UDG association UDG association No

Promote macrophage infection possibly by Not clear Not clear facilitating nuclear import of PIC

Overcome a myeloid cell restriction factor and No No rescue a block at reverse transcription

Table 6-1. Functional comparison of HIV-1 Vpr, HIV-2/SIVSM Vpr and

HIV-2/SIVSM Vpx based on this study. 130

ability to counteract the myeloid cell restriction was compensated for by acquisition of partial resistance to the restriction, as in the case of HIV-1.

Another interesting observation is that the ability of SIVSM Vpx to neutralize the restriction factor in myeloid cells is inhibited by HIV-1 Vpr, demonstrated by the observation that Vpx enhances infectivity of Vpr-deleted but not wild-type HIV-1.

Packaging of HIV-1 Vpr in a chimeric HIV-1 containing Vpx dramatically decreased its infection of macrophages. However, SIV Vpr does not inhibit the ability of SIVSM Vpx to neutralize the restriction. Therefore, one possibility is that the packaging of Vpx is inefficient because of competition for packaging with HIV-1 Vpr. In the case of SIV, both Vpx and SIV Vpr proteins are naturally packaged within virions. However, in our study, Vpx was packaged into wild-type and ΔVpr HIV-1 virions to similar levels. This argues against competition for packaging. Alternatively, HIV-1 Vpr may inhibit Vpx function in target cells by competing for binding to the restriction.

Our study also reveals a paradox with regards to the functional consequences of

HIV-1 Vpr and HIV-2/SIV Vpx interaction with DDB1. DDB1 mediates the cell cycle arrest property of HIV-1 Vpr. DDB1 was also necessary for the ability of SIV Vpx to counteract the macrophage restriction. However, SIV Vpx, although able to interact with

DDB1, does not induce cell cycle arrest. Furthermore, the ability of HIV-1 Vpr to interact with DDB1 does not appear sufficient to confer upon HIV-1 Vpr the ability to 131

efficiently counteract the macrophage restriction. Therefore, there are likely to be different biological outcomes that are dictated by the nature of the interactions that

HIV-1 Vpr and SIV Vpx forge with DDB1 and its associated E3 ubiquitin ligase complex components. Further insight into the mechanisms employed by HIV-1 Vpr and

HIV-2/SIVSM Vpx to enhance macrophage infection may be revealed once the macrophage restriction itself is identified.

6.3 Vpx Function Requires Proteasome/Ubiquitylation Pathway and DDB1

Interaction

Our study suggests that the function of Vpx to antagonize an antiviral restriction in macrophages requires functional proteasome. A role for the proteasome/ubiquitin system is provided by our demonstration that ubiquitylation mutants of Vpx are functionally attenuated and treatment of macrophages with proteasome disrupting agents specifically reduces the ability of Vpx to enhance permissivity of macrophages to HIV-1 or MLV infection.

Our study also implicates DDB1 as a cellular cofactor of Vpx which is required for the ability of Vpx to counteract the macrophage restriction. DDB1 silencing in macrophages specifically impaired the ability of Vpx to enhance infectivity of macrophages by HIV-1. Further experiments are required to determine whether DDB1 association accounts, in totality, for the biological activity of Vpx. DDB1 silencing did 132

not completely impair Vpx function to enhance HIV-1 infection in macrophages.

However, RNA silencing failed to completely deplete DDB1 from primary macrophages, and therefore, residual DDB1 may allow some retention of Vpx activity. This study also presents evidence that DDB1 binds to ubiquitylated Vpx and that lysine mutants of Vpx which are inefficiently ubiquitylated exhibit reduced DDB1 binding and are impaired in their ability to enhance macrophage infection by HIV-1. Using a Vpx mutant lacking lysine residues, Vpx ubiquitylation is found to be important for association with DDB1 and to counteract the macrophage restriction.

Although the loss of Vpx function was attributed to lack of ubiquitylation and loss of DDB1 binding, there is another possibility that loss of function of the mutant protein was due to indirect effects of the mutations on protein structure. At the very least, the

Vpx lysine mutant is packaged within virions, which suggests that it is competent for interaction with the p6 domain of the Gag polyprotein. As with DDB1 silencing, mutation of all four lysines in Vpx did not abrogate Vpx function completely. Therefore, ubiquitylation and DDB1 association may not fully account for the biological activity of

Vpx in macrophages. However, poly ubiquitylation forms of Vpx were still evident in cells transfected with a Vpx mutant lacking all lysine residues. This suggests some degree of Vpx ubiquitylation on nonlysine residues. Identification and mutagenesis of all ubiquitylation residues on Vpx will be required before the degree to which Vpx activity 133

depends upon ubiquitylation can fully be assessed. Furthermore, the ubiquitylation of

Vpx was examined in 293T cells. Due to technical obstacles in transfection of primary macrophages, at present it is not possible to evaluate the extent of Vpx ubiquitylation in primary macrophages and for this reason, it is not possible to direcely assess whether the

Vpx biological activity was dependent on Vpx ubiquitylation.

Our study suggests that DDB1 is not required for Vpx ubiquitylation but that Vpx ubiquitylation is necessary for association with DDB1. Therefore, the loss of function observed with the Vpx lysine mutant is likely to reflect a loss in DDB1 binding.

Although SIV Vpr did not counteract the macrophage restriction, fusion with DDB1 partially conferred this ability. This suggests that the function of Vpx may be to tether

DDB1 to the reverse transcription complex upon which the restriction acts. Although

Vpx is a virion protein, whether DDB1 itself is packaged within virions remains unclear.

However, since silencing of DDB1 in the target cell inhibited the ability of Vpx to enhance macrophage infection by HIV-1, this suggests that Vpx usurps DDB1 after infection of the target cell and likely, within the context of the reverse transcription complex.

6.4 Characteristics of the Restriction Factor in Myeloid Cells

While the restriction that is counteracted by Vpx is as yet unidentified, it exhibits unique characteristics when compared other known antiviral restrictions. Viral Vif and 134

Vpu proteins that neutralize the antiviral restrictions APOBEC3G and tetherin/BST-2 respectively, carry out their function in the virus producing cell. Although some Vif is packaged within virions, there is no evidence that packaged Vif has a functional role in viral infection. By comparison, the ability of Vpx to neutralize the myeloid cell restriction appears to require that Vpx is packaged within virions. Indeed, Vpx protein that was packaged into virions effected a durable removal of the block to subsequent infection by a restricted virus. This phenomenon is unprecedented in the arena of retroviral restrictions and suggests that the restriction has an extremely low turnover rate and takes a considerable time to recover after neutralization by Vpx.

The demonstration that the biological activity of Vpx required association with

DDB1 has parallels with viral proteins that circumvent the interferon response. For example, the V protein of the paramyxovirus simian virus 5, requires DDB1 to promote targeted degradation of STAT1 (174). However, of the various strategies used by viruses to impair the interferon response, all operate after initial infection and de novo expression of the viral defense protein. In this way, viruses prevent the infected cell from subsequently mounting an interferon response that would prevent surrounding cells from being infected by progeny virus. In the case of Vpx, the restriction must be neutralized by virion-associated Vpx in order for establishment of infection to occur.

This indicates that the restriction is constitutively active in macrophages as opposed to 135

being induced upon infection.

The expression level of the restriction factor may decide the degree to which lentiviruses are restricted in myeloid cells. Quiescent monocytes are nonpermissive to

HIV-1 infection, while differentiated macrophages are semipermissive to HIV-1 infection. This may relate to the different levels to which the restriction is expressed in monocytes and macrophages. Alternatively, because of low dNTP levels in monocytes, reverse transcription is inefficient in these cells (136). Since the restriction acts primarily at the reverse transcription step, the restriction may be able to more effectively perturb cDNA synthesis in an environment that is suboptimal for reverse transcription.

6.5 Restrictions as Novel Targets for Antiviral Therapy

During the long term host-virus interaction, viral hosts developed different ways to protect themselves from viruses. Defense against infection by viruses is primarily mediated through classical adaptive immune response, in which specialized B, T helper and cytolytic T cells recognize foreign antigens and clonally expand upon engagement of their antigen receptor. As a result, the invading viruses are controlled by antibodies that neutralize the viruses and by cytotoxic cells that recognize and kill infected cells.

However, the research on restriction factors has revealed an additional line of host defense against viruses such as HIV-1. Cells employ restriction as an innate strategy to restrict viral invasion. Unfortunately, primate lentiviruses have evolved a strategy to 136

counteract these cellular restriction factors over the course of evolution, by expressing viral proteins that can oppose the antiviral action of the restriction factor. The interaction between viral gene products and their cellular factors is still a relatively unexplored area.

Our study provides evidence for a novel restriction that is expressed by monocytes/macrophages and which potently antagonizes HIV, SIV, and MLV infection.

Study of the restriction factor and how the viruses protect themselves from this cellular restriction provides deeper insights into host-virus interaction and the goal is to harness this cellular restriction as the basis for a novel therapeutic strategy against HIV infection.

6.6 Future Directions

The most important goal of this study is to identify the antiviral restriction factor in monocytes and macrophages and to understand how the block occurs. The elucidation of the full restriction pathway is only possible after the identification of the restriction itself.

Identification of this restriction may uncover another target for drug development.

The mechanism of how exactly this restriction inhibits the virion infectivity remains unclear. It is crucial to understand how the restriction act as a viral inhibitor, which component of the viruses is the target of this restriction, and whether the restriction blocks viral infection directly or indirectly through other proteins.

Understanding this antiviral mechanism may uncover a novel antiviral pathway in host 137

cells and suggest new strategies for the development of antiviral therapies.

Another goal is to determine whether Vpx interacts with the restriction directly, or through a complex involving some cofactors. Although our study suggested proteasome/ubiquitylation pathway and DDB1 interaction were required for Vpx function, the pathways that underlie the ability of Vpx to overcome this restriction factor are not well understood.

Although our studies provide insight into mechanisms that restrict retrovirus infection of nondividing myeloid cells, there still remains the question as to how viral genomes access the nuclear compartment. Presumably, the ability to traverse the nuclear envelope appears to be an intrinsic property of retroviruses and lentiviruses rather than a characteristic that distinguishes these viruses. However, further experiments are needed to confirm this hypothesis.

In our study, an interesting comparison between HIV-1 Vpr, SIV Vpx and SIV Vpr was revealed. While SIV Vpx originally evolved from Vpr by a duplication event, it does not share all the functional properties of Vpr. Answers to questions like how Vpx acquired the ability to overcome the cellular restriction over evolution, or if Vpr lost its function in inhibiting the restriction during evolution remain unclear. I also observed that

HIV-1 Vpr inhibited the ability of Vpx to overcome the restriction, while SIV Vpr did not. The mechanism behind this observation is not yet understood. 138

HIV-1 did not evolve a gene with Vpx function even though the virus is partially restricted in macrophages. The explanation for this observation remains unclear. The activity to overcome the restriction may be manifested in the primary HIV-1 Vpr.

However, in our study, primary Vpr alleles fail to overcome the restriction. Another possibility is that it may be beneficial to HIV-1 to be partially restricted in macrophages.

HIV-1 infection of CD4+ T cells is cytopathic and eventually leads to death of infected

CD4+ T cells. However, HIV-1 infection does not impact macrophage viability to the same extent (175). HIV-1 may become cytopathic to macrophages once a higher level of infection is obtained. Macrophages serve as a viral reservoir and play a role in viral dissemination and persistence. Therefore, it may be a selective advantage for the viruses to be partially suppressed in macrophages, thus the infection is less cytopathic. I did some preliminary experiments that showed that HIV-1 containing Vpx induced higher cytopathic effect on macrophages. However, further studies are required to verify this hypothesis.

In addition, it remains unclear whether Vpx protein plays a role in HIV-1 infection of other cells such as dendritic cells, or CD4+ T cells. CD4+ T cells are the major HIV-1 reservoir in vivo and dendritic cells are of great importance for the dissemination and persistence of the viruses. Understanding the function of Vpx in these cells would help us to gain more insights into how HIV-1 establishes a persistent infection. 139

Finally, our results indicate that both lentiviruses and other retroviruses such as

MLV are partially or fully restricted by the same myeloid cell restriction. This suggests a possibly universal function of this restriction on diverse virus families. Studies on the sensitivity of other viruses to the restriction are therefore required.

140

REFERENCES

1 http://www.who.int/hiv/data/2008_global_summary_AIDS_ep.png

2 Hahn BH, Shaw GM, De Cock KM, Sharp PM. AIDS as a zoonosis: scientific and public health implications. Science. 2000, 287(5453):607-14.

3 Gao F, Bailes E, Robertson DL, Chen Y, Rodenburg CM, Michael SF, Cummins LB, Arthur LO, Peeters M, Shaw GM, Sharp PM, Hahn BH. Origin of HIV-1 in the chimpanzee Pan troglodytes troglodytes. Nature. 1999, 397(6718):436-41.

4 Marx PA, Li Y, Lerche NW, Sutjipto S, Gettie A, Yee JA, Brotman BH, Prince AM, Hanson A, Webster RG, et al. Isolation of a simian immunodeficiency virus related to human immunodeficiency virus type 2 from a west African pet sooty mangabey. J Virol. 1991, 65(8):4480–5

5 Gao F, Yue L, White AT, Pappas PG, Barchue J, Hanson AP, et al. Human infection by genetically diverse SIVSM-related HIV-2 in west Africa. Nature. 1992, 358(6386):495–9.

6 Calef C,Mokili J, O'Connor DH, Watkins DI, Korber BT (2001). Numbering Positions in SIV Relative to SIVMM239. pp. 171-181 in HIV Sequence Compendium 2001. Edited by: Kuiken C, Foley B, Hahn B, Marx P, McCutchan F, Mellors JW, Wolinsky S, Korber B. Published by: Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, Los Alamos, NM, LA-UR 02-2877.

7 Fields' virology. 5th edition. (2007)editors-in-chief, David M. Knipe, Peter M. Howley; associate editors, Diane E. Griffin et al. Lippincott Williams & Wilkins ISBN-13: 978-0-7817-6060-7

141

8 Brenchley JM, Schacker TW, Ruff LE, Price DA, Taylor JH, Beilman GJ, Nguyen PL, Khoruts A, Larson M, Haase AT, Douek DC. CD4+ T cell depletion during all stages of HIV disease occurs predominantly in the gastrointestinal tract. J Exp Med. 2004, 200(6):749-59.

9 Brenchley JM, Price DA, Schacker TW, Asher TE, Silvestri G, Rao S, Kazzaz Z, Bornstein E, Lambotte O, Altmann D, Blazar BR, Rodriguez B, Teixeira-Johnson L, Landay A, Martin JN, Hecht FM, Picker LJ, Lederman MM, Deeks SG, Douek DC. Microbial translocation is a cause of systemic immune activation in chronic HIV infection. Nat Med. 2006, 12(12):1365-71.

10 Welsch S, Keppler OT, Habermann A, Allespach I, Krijnse-Locker J, Kräusslich HG. HIV-1 buds predominantly at the plasma membrane of primary human macrophages. PLoS Pathog. 2007, 3(3):e36.

11 Deneka M, Pelchen-Matthews A, Byland R, Ruiz-Mateos E, Marsh M. In macrophages, HIV-1 assembles into an intracellular plasma membrane domain containing the tetraspanins CD81, CD9, and CD53. J Cell Biol. 2007, 177(2):329-41.

12 Groot F, Welsch S, Sattentau QJ. Efficient HIV-1 transmission from macrophages to T cells across transient virological synapses. Blood. 2008, 111(9):4660-3.

13 Sharova N, Swingler C, Sharkey M, Stevenson M. Macrophages archive HIV-1 virions for dissemination in trans. EMBO J. 2005, 24(13):2481-9.

14 Williams KC, Hickey WF. Central nervous system damage, monocytes and macrophages, and neurological disorders in AIDS. Williams KC, Hickey WF. Annu Rev Neurosci. 2002, 25:537-62.

142

15 Filion LG, Izaguirre CA, Garber GE, Huebsh L, Aye MT.Detection of surface and cytoplasmic CD4 on blood monocytes from normal and HIV-1 infected individuals. J Immunol Methods. 1990, 135(1-2):59-69.

16 Naif HM, Li S, Alali M, Sloane A, Wu L, Kelly M, Lynch G, Lloyd A, Cunningham AL. CCR5 expression correlates with susceptibility of maturing monocytes to human immunodeficiency virus type 1 infection. J Virol. 1998, 72(1):830-6.

17 Zhu T, Muthui D, Holte S, Nickle D, Feng F, Brodie S, Hwangbo Y, Mullins JI, Corey L. Evidence for human immunodeficiency virus type 1 replication in vivo in CD14(+) monocytes and its potential role as a source of virus in patients on highly active antiretroviral therapy. J Virol. 2002, 76(2):707-16.

18 Gartner S, Markovits P, Markovitz DM, Kaplan MH, Gallo RC, Popovic M. The role of mononuclear phagocytes in HTLV-III/LAV infection. Science. 1986, 233(4760):215-9.

19 Ho DD, Rota TR, Hirsch MS. Infection of monocyte/macrophages by human T lymphotropic virus type III. J Clin Invest. 1986, 77(5):1712-5.

20 McElrath MJ, Steinman RM, Cohn ZA. Latent HIV-1 infection in enriched populations of blood monocytes and T cells from seropositive patients. J Clin Invest. 1991, 87(1):27-30.

21 Llewellyn N, Zioni R, Zhu H, Andrus T, Xu Y, Corey L, Zhu T. Continued evolution of HIV-1 circulating in blood monocytes with antiretroviral therapy: genetic analysis of HIV-1 in monocytes and CD4+ T cells of patients with discontinued therapy. J Leukoc Biol. 2006, 80(5):1118-26.

143

22 Ellery PJ, Tippett E, Chiu YL, Paukovics G, Cameron PU, Solomon A, Lewin SR, Gorry PR, Jaworowski A, Greene WC, Sonza S, Crowe SM. The CD16+ monocyte subset is more permissive to infection and preferentially harbors HIV-1 in vivo. J Immunol. 2007, 178(10):6581-9.

23 Dong C, Janas AM, Wang JH, Olson WJ, Wu L.Characterization of human immunodeficiency virus type 1 replication in immature and mature dendritic cells reveals dissociable cis- and trans-infection. J Virol. 2007, 81(20):11352-62.

24 Kwon DS, Gregorio G, Bitton N, Hendrickson WA, Littman DR. DC-SIGN-mediated internalization of HIV is required for trans-enhancement of T cell infection. Immunity. 2002, 16(1):135-44.

25 Emerman M, Malim MH. HIV-1 regulatory/accessory genes: keys to unraveling viral and host cell biology. Science. 1998, 280(5371):1880-4.

26 Garcia JV, Miller AD. Serine phosphorylation-independent downregulation of cell-surface CD4 by nef. Nature. 1991, 350(6318):508-11.

27 Schwartz O, Maréchal V, Le Gall S, Lemonnier F, Heard JM. Endocytosis of major histocompatibility complex class I molecules is induced by the HIV-1 Nef protein. Nat Med. 1996, 2(3):338-42.

28 Stumptner-Cuvelette P, Morchoisne S, Dugast M, Le Gall S, Raposo G, Schwartz O, Benaroch P. HIV-1 Nef impairs MHC class II antigen presentation and surface expression. Proc Natl Acad Sci U S A. 2001, 98(21):12144-9.

29 Thoulouze MI, Sol-Foulon N, Blanchet F, Dautry-Varsat A, Schwartz O, Alcover A.Human immunodeficiency virus type-1 infection impairs the formation of the

144

immunological synapse. Immunity. 2006, 24(5):547-61.

30 Sheehy AM, Gaddis NC, Choi JD, Malim MH. Isolation of a human gene that inhibits HIV-1 infection and is suppressed by the viral Vif protein. Nature. 2002, 418(6898):646-50.

31 Neil SJ, Zang T, Bieniasz PD. Tetherin inhibits retrovirus release and is antagonized by HIV-1 Vpu. Nature. 2008, 451(7177):425-30.

32 Willey RL, Maldarelli F, Martin MA, Strebel K.Human immunodeficiency virus type 1 Vpu protein induces rapid degradation of CD4. J Virol. 1992, 66(12):7193-200.

33 Jowett JB, Planelles V, Poon B, Shah NP, Chen ML, Chen IS. The human immunodeficiency virus type 1 vpr gene arrests infected T cells in the G2 + M phase of the cell cycle.J Virol. 1995, 69(10):6304-13.

34 Rogel ME, Wu LI, Emerman M. The human immunodeficiency virus type 1 vpr gene prevents cell proliferation during chronic infection. J Virol. 1995, 69(2):882-8.

35 Heinzinger NK, Bukinsky MI, Haggerty SA, Ragland AM, Kewalramani V, Lee MA, Gendelman HE, Ratner L, Stevenson M, Emerman M. The Vpr protein of human immunodeficiency virus type 1 influences nuclear localization of viral nucleic acids in nondividing host cells. Proc Natl Acad Sci U S A. 1994, 91(15):7311-5.

36 Connor RI, Chen BK, Choe S, Landau NR. Vpr is required for efficient replication of human immunodeficiency virus type-1 in mononuclear phagocytes. Virology. 1995, 206(2):935-44.

37 Balliet JW, Kolson DL, Eiger G, Kim FM, McGann KA, Srinivasan A, Collman R. Distinct effects in primary macrophages and lymphocytes of the human

145

immunodeficiency virus type 1 accessory genes vpr, vpu, and nef: mutational analysis of a primary HIV-1 isolate. Virology. 1994, 200(2):623-31.

38 Fletcher TM 3rd, Brichacek B, Sharova N, Newman MA, Stivahtis G, Sharp PM, Emerman M, Hahn BH, Stevenson M. Nuclear import and cell cycle arrest functions of the HIV-1 Vpr protein are encoded by two separate genes in HIV-2/SIV(SM). EMBO J. 1996, 15(22):6155-65.

39 Sleigh R, Sharkey M, Newman MA, Hahn B, Stevenson M. Differential association of uracil DNA glycosylase with SIVSM Vpr and Vpx proteins. Virology. 1998, 245(2):338-43.

40 Hirsch VM, Sharkey ME, Brown CR, Brichacek B, Goldstein S, Wakefield J, Byrum R, Elkins WR, Hahn BH, Lifson JD, Stevenson M. Vpx is required for dissemination and pathogenesis of SIV(SM) PBj: evidence of macrophage-dependent viral amplification. Nat Med. 1998, 4(12):1401-8.

41 Rambaut A, Posada D, Crandall KA, Holmes EC. The causes and consequences of HIV evolution. Nat Rev Genet. 2004, 5(1):52-61.

42 Peters PJ, Dueñas-Decamp MJ, Sullivan WM, Clapham PR. Variation of macrophage tropism among HIV-1 R5 envelopes in brain and other tissues. J Neuroimmune Pharmacol. 2007, 2(1):32-41.

43 Shimizu N, Tanaka A, Mori T, Ohtsuki T, Hoque A, Jinno-Oue A, Apichartpiyakul C, Kusagawa S, Takebe Y, Hoshino H. A formylpeptide receptor, FPRL1, acts as an efficient coreceptor for primary isolates of human immunodeficiency virus. Retrovirology. 2008, 5:52.

146

44 Doranz BJ, Rucker J, Yi Y, Smyth RJ, Samson M, Peiper SC, Parmentier M, Collman RG, Doms RW. A dual-tropic prmary HIV-1 isolate that uses fusin and the beta chemokine receptors CKR-5, CKR-3, and CKR-2b as fusin cofactors. Cell. 1996, 85:1149–1158.

45 He J, Chen Y, Farzan M, Choe H, Ohagen A, Gartner S, Busciglio J, Yang X, Hofmann W, Newman W, Mackay CR, Sodroski J, Gabuzda D. CCR3 and CCR5 are coreceptors for HIV-1 infection of microglia. CCR3 and CCR5 are co-receptors for HIV-1 infection of microglia. Nature 1997, 385(6617):645-9.

46 Neil SJ, Aasa-Chapman MM, Clapham PR, Nibbs RJ, McKnight A, Weiss RA. The promiscuous CC chemokine receptor D6 is a functional coreceptor for primary isolates of human immunodeficiency virus type 1 (HIV-1) and HIV-2 on astrocytes. J Virol. 2005, 79:9618–9624.

47 Jinno A, Shimizu N, Soda Y, Haraguchi Y, Kitamura T, Hoshino H. Identification of the chemokine receptor TER1/CCR8 expressed in brain-derived cells and T cells as a new coreceptor for HIV-1 infection. Biochem Biophys Res Comm. 1998, 243:497–502.

48 Turner BG, Summers MF. Structural biology of HIV. J Mol Biol. 1999, 285(1):1-32.

49 Sarafianos SG, Das K, Tantillo C, Clark AD Jr, Ding J, Whitcomb JM, Boyer PL, Hughes SH, Arnold E. Crystal structure of HIV-1 reverse transcriptase in complex with a polypurine tract RNA:DNA. EMBO J. 2001, 20(6):1449-61.

50 Sayah DM, Sokolskaja E, Berthoux L, Luban J. Cyclophilin A retrotransposition into TRIM5 explains owl monkey resistance to HIV-1. Nature. 2004, 430(6999):569-73.

147

51 Stremlau M, Owens CM, Perron MJ, Kiessling M, Autissier P, Sodroski J. The cytoplasmic body component TRIM5alpha restricts HIV-1 infection in Old World monkeys. Nature. 2004, 427(6977):848-53.

52 Goncalves J, Jallepalli P, Gabuzda DH. Subcellular localization of the Vif protein of human immunodeficiency virus type 1. J Virol. 1994, 68(2):704-12.

53 Fisher AG, Ensoli B, Ivanoff L, Chamberlain M, Petteway S, Ratner L, Gallo RC, Wong-Staal F. The sor gene of HIV-1 is required for efficient virus transmission in vitro. Science. 1987, 237(4817):888-93.

54 Strebel K, Daugherty D, Clouse K, Cohen D, Folks T, Martin MA. The HIV 'A' (sor) gene product is essential for virus infectivity. Nature. 1987, 328(6132):728-30.

55 Gabuzda DH, Li H, Lawrence K, Vasir BS, Crawford K, Langhoff E. Essential role of vif in establishing productive HIV-1 infection in peripheral blood T lymphocytes and monocyte/macrophages. J Acquir Immune Defic Syndr. 1994, 7(9):908-15.

56 Simon JH, Malim MH. The human immunodeficiency virus type 1 Vif protein modulates the postpenetration stability of viral nucleoprotein complexes. J Virol. 1996, 70(8):5297-305.

57 Von Schwedler U, Song J, Aiken C, Trono D. Vif is crucial for human immunodeficiency virus type 1 proviral DNA synthesis in infected cells. J Virol. 1993, 67(8):4945-55.

58 Jarmuz A, Chester A, Bayliss J, Gisbourne J, Dunham I, Scott J, Navaratnam N. An anthropoid-specific locus of orphan C to U RNA-editing enzymes on chromosome 22. Genomics. 2002, 79(3):285-96.

148

59 Wedekind JE, Dance GS, Sowden MP, Smith HC. Messenger RNA editing in mammals: new members of the APOBEC family seeking roles in the family business. Trends Genet. 2003, 19(4):207-16.

60 Mangeat B, Turelli P, Caron G, Friedli M, Perrin L, Trono D. Broad antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse transcripts. Nature. 2003, 424(6944):99-103.

61 Zhang H, Yang B, Pomerantz RJ, Zhang C, Arunachalam SC, Gao L. The cytidine deaminase CEM15 induces hypermutation in newly synthesized HIV-1 DNA. Nature. 2003, 424(6944):94-8.

62 Harris RS, Bishop KN, Sheehy AM, Craig HM, Petersen-Mahrt SK, Watt IN, Neuberger MS, Malim MH. DNA deamination mediates innate immunity to retroviral infection. Cell. 2003, 113(6):803-9.

63 Bogerd HP, Cullen BR. Single-stranded RNA facilitates nucleocapsid: APOBEC3G complex formation. RNA. 2008, 14(6):1228-36.

64 Soros VB, Yonemoto W, Greene WC. Newly synthesized APOBEC3G is incorporated into HIV virions, inhibited by HIV RNA, and subsequently activated by RNase H. PLoS Pathog. 2007, 3(2):e15.

65 Harris RS, Liddament MT. Retroviral restriction by APOBEC proteins. Nat Rev Immunol. 2004, 4(11):868-77.

66 Newman EN, Holmes RK, Craig HM, Klein KC, Lingappa JR, Malim MH, Sheehy AM. Antiviral function of APOBEC3G can be dissociated from cytidine deaminase activity. Curr Biol. 2005, 15(2):166-70.

149

67 Shindo K, Takaori-Kondo A, Kobayashi M, Abudu A, Fukunaga K, Uchiyama T.The enzymatic activity of CEM15/Apobec-3G is essential for the regulation of the infectivity of HIV-1 virion but not a sole determinant of its antiviral activity. J Biol Chem. 2003 Nov 7;278(45):44412-6.

68 Holmes RK, Malim MH, Bishop KN. APOBEC-mediated viral restriction: not simply editing? Trends Biochem Sci. 2007, 32(3):118-28.

69 Guo F, Cen S, Niu M, Yang Y, Gorelick RJ, Kleiman L. The interaction of APOBEC3G with human immunodeficiency virus type 1 nucleocapsid inhibits tRNA3Lys annealing to viral RNA. J Virol. 2007, 81(20):11322-31.

70 Mbisa JL, Barr R, Thomas JA, Vandegraaff N, Dorweiler IJ, Svarovskaia ES, Brown WL, Mansky LM, Gorelick RJ, Harris RS, Engelman A, Pathak VK. Human immunodeficiency virus type 1 cDNAs produced in the presence of APOBEC3G exhibit defects in plus-strand DNA transfer and integration. J Virol. 2007, 81(13):7099-110.

71 Mehle A, Goncalves J, Santa-Marta M, McPike M, Gabuzda D. Phosphorylation of a novel SOCS-box regulates assembly of the HIV-1 Vif-Cul5 complex that promotes APOBEC3G degradation. Genes Dev. 2004, 18(23):2861-6.

72 Kao S, Goila-Gaur R, Miyagi E, Khan MA, Opi S, Takeuchi H, Strebel K. Production of infectious virus and degradation of APOBEC3G are separable functional properties of human immunodeficiency virus type 1 Vif. Virology. 2007 Dec 20;369(2):329-39.

73 Peng G, Lei KJ, Jin W, Greenwell-Wild T, Wahl SM. Induction of APOBEC3 family proteins, a defensive maneuver underlying interferon-induced anti-HIV-1 activity. J Exp Med. 2006, 203(1):41-6.

150

74 Peng G, Lei KJ, Jin W, Greenwell-Wild T, Wahl SM. Induction of APOBEC3 family proteins, a defensive maneuver underlying interferon-induced anti-HIV-1 activity. J Exp Med. 2006, 203(1):41-6.

75 Himathongkham S, Luciw PA. Restriction of HIV-1 (subtype B) replication at the entry step in rhesus macaque cells. Virology. 1996, 219(2):485-8.

76 Hofmann W, Schubert D, LaBonte J, Munson L, Gibson S, Scammell J, Ferrigno P, Sodroski J. Species-specific, postentry barriers to primate immunodeficiency virus infection. J Virol. 1999, 73(12):10020-8.

77 Perron MJ, Stremlau M, Song B, Ulm W, Mulligan RC, Sodroski J. TRIM5alpha mediates the postentry block to N-tropic murine leukemia viruses in human cells. Proc Natl Acad Sci U S A. 2004, 101(32):11827-32.

78 Reddy BA, Etkin LD, Freemont PS. A novel zinc finger coiled-coil domain in a family of nuclear proteins. Trends Biochem Sci. 1992, 17(9):344-5.

79 Emerman M. How TRIM5alpha defends against retroviral invasions. Proc Natl Acad Sci U S A. 2006, 103(14):5249-50.

80 Reymond A, Meroni G, Fantozzi A, Merla G, Cairo S, Luzi L, Riganelli D, Zanaria E, Messali S, Cainarca S, Guffanti A, Minucci S, Pelicci PG, Ballabio A. The tripartite motif family identifies cell compartments. EMBO J. 2001, 20(9):2140-51.

81 Song B, Gold B, O'Huigin C, Javanbakht H, Li X, Stremlau M, Winkler C, Dean M, Sodroski J. The B30.2(SPRY) domain of the retroviral restriction factor TRIM5alpha exhibits lineage-specific length and sequence variation in primates. J Virol. 2005, 79(10):6111-21.

151

82 Stremlau M, Perron M, Lee M, Li Y, Song B, Javanbakht H, Diaz-Griffero F, Anderson DJ, Sundquist WI, Sodroski J. Specific recognition and accelerated uncoating of retroviral capsids by the TRIM5alpha restriction factor. Proc Natl Acad Sci U S A. 2006, 103(14):5514-9.

83 Yap MW, Nisole S, Stoye JP. A single amino acid change in the SPRY domain of human Trim5alpha leads to HIV-1 restriction. Curr Biol. 2005, 15(1):73-8.

84 Li Y, Li X, Stremlau M, Lee M, Sodroski J. Removal of arginine 332 allows human TRIM5alpha to bind human immunodeficiency virus capsids and to restrict infection. J Virol. 2006, 80(14):6738-44.

85 Li X, Sodroski J. The TRIM5alpha B-box 2 domain promotes cooperative binding to the retroviral capsid by mediating higher-order self-association. J Virol. 2008, 82(23):11495-502.

86 Owens CM, Yang PC, Göttlinger H, Sodroski J. Human and simian immunodeficiency virus capsid proteins are major viral determinants of early, postentry replication blocks in simian cells. J Virol. 2003, 77(1):726-31.

87 Xu L, Yang L, Moitra PK, Hashimoto K, Rallabhandi P, Kaul S, Meroni G, Jensen JP, Weissman AM, D'Arpa P. BTBD1 and BTBD2 colocalize to cytoplasmic bodies with the RBCC/tripartite motif protein, TRIM5delta. Exp Cell Res. 2003, 288(1):84-93.

88 Perez-Caballero D, Hatziioannou T, Yang A, Cowan S, Bieniasz PD. Human tripartite motif 5alpha domains responsible for retrovirus restriction activity and specificity. J Virol. 2005, 79(14):8969-78.

152

89 Javanbakht H, Diaz-Griffero F, Stremlau M, Si Z, Sodroski J. The contribution of RING and B-box 2 domains to retroviral restriction mediated by monkey TRIM5alpha. J Biol Chem. 2005, 280(29):26933-40.

90 Schwartz O, Maréchal V, Friguet B, Arenzana-Seisdedos F, Heard JM. Antiviral activity of the proteasome on incoming human immunodeficiency virus type 1. J Virol. 1998, 72(5):3845-50.

91 Berthoux L, Sebastian S, Sokolskaja E, Luban J. Lv1 inhibition of human immunodeficiency virus type 1 is counteracted by factors that stimulate synthesis or nuclear translocation of viral cDNA. J Virol. 2004, 78(21):11739-50.

92 Wu X, Anderson JL, Campbell EM, Joseph AM, Hope TJ. Proteasome inhibitors uncouple rhesus TRIM5alpha restriction of HIV-1 reverse transcription and infection. Proc Natl Acad Sci U S A. 2006, 103(19):7465-70.

93 Sakuma R, Noser JA, Ohmine S, Ikeda Y. Rhesus monkey TRIM5alpha restricts HIV-1 production through rapid degradation of viral Gag polyproteins. Nat Med. 2007, 13(5):631-5.

94 Strebel K, Klimkait T, Martin MA. A novel gene of HIV-1, vpu, and its 16-kilodalton product. Science. 1988, 241(4870):1221-3.

95 Margottin F, Bour SP, Durand H, Selig L, Benichou S, Richard V, Thomas D, Strebel K, Benarous R. A novel human WD protein, h-beta TrCp, that interacts with HIV-1 Vpu connects CD4 to the ER degradation pathway through an F-box motif. Mol Cell. 1998, 1(4):565-74.

96 Varthakavi V, Smith RM, Bour SP, Strebel K, Spearman P. Viral protein U

153

counteracts a human host cell restriction that inhibits HIV-1 particle production. Proc Natl Acad Sci U S A. 2003, 100(25):15154-9.

97 Van Damme N, Goff D, Katsura C, Jorgenson RL, Mitchell R, Johnson MC, Stephens EB, Guatelli J. The interferon-induced protein BST-2 restricts HIV-1 release and is downregulated from the cell surface by the viral Vpu protein. Cell Host Microbe. 2008, 3(4):245-52.

98 Neil SJ, Sandrin V, Sundquist WI, Bieniasz PD. An interferon-alpha-induced tethering mechanism inhibits HIV-1 and Ebola virus particle release but is counteracted by the HIV-1 Vpu protein. Cell Host Microbe. 2007, 2(3):193-203.

99 Neil SJ, Eastman SW, Jouvenet N, Bieniasz PD. HIV-1 Vpu promotes release and prevents endocytosis of nascent retrovirus particles from the plasma membrane. PLoS Pathog. 2006, 2(5):e39.

100 Perez-Caballero D, Zang T, Ebrahimi A, McNatt MW, Gregory DA, Johnson MC, Bieniasz PD. Tetherin inhibits HIV-1 release by directly tethering virions to cells. Cell. 2009, 139(3):499-511.

101 Göttlinger HG, Dorfman T, Cohen EA, Haseltine WA. Vpu protein of human immunodeficiency virus type 1 enhances the release of capsids produced by gag gene constructs of widely divergent retroviruses.Proc Natl Acad Sci U S A. 1993, 90(15):7381-5.

102 Sakuma T, Noda T, Urata S, Kawaoka Y, Yasuda J. Inhibition of Lassa and Marburg virus production by tetherin. J Virol. 2009, 83(5):2382-5.

154

103 Bartee E, McCormack A, Früh K. Quantitative membrane proteomics reveals new cellular targets of viral immune modulators. PLoS Pathog. 2006, 2(10):e107.

104 Kupzig S, Korolchuk V, Rollason R, Sugden A, Wilde A, Banting G. Bst-2/HM1.24 is a raft-associated apical membrane protein with an unusual topology. Traffic. 2003, 4(10):694-709.

105 McNatt MW, Zang T, Hatziioannou T, Bartlett M, Fofana IB, Johnson WE, Neil SJ, Bieniasz PD. Species-specific activity of HIV-1 Vpu and positive selection of tetherin transmembrane domain variants. PLoS Pathog. 2009, 5(2):e1000300.

106 Varthakavi V, Smith RM, Martin KL, Derdowski A, Lapierre LA, Goldenring JR, Spearman P. The pericentriolar recycling endosome plays a key role in Vpu-mediated enhancement of HIV-1 particle release. Traffic. 2006, 7(3):298-307.

107 Felzien LK, Woffendin C, Hottiger MO, Subbramanian RA, Cohen EA, Nabel GJ. HIV transcriptional activation by the accessory protein, VPR, is mediated by the p300 co-activator. Proc Natl Acad Sci U S A. 1998, 95(9):5281-6.

108 Bachand F, Yao XJ, Hrimech M, Rougeau N, Cohen EA. Incorporation of Vpr into human immunodeficiency virus type 1 requires a direct interaction with the p6 domain of the p55 gag precursor. J Biol Chem. 1999, 274(13):9083-91.

109 Franchini G, Rusche JR, O'Keeffe TJ, Wong-Staal F. The human immunodeficiency virus type 2 (HIV-2) contains a novel gene encoding a 16 kD protein associated with mature virions. AIDS Res Hum Retroviruses. 1988, 4(4):243-50.

155

110 Kappes JC, Morrow CD, Lee SW, Jameson BA, Kent SB, Hood LE, Shaw GM, Hahn BH. Identification of a novel retroviral gene unique to human immunodeficiency virus type 2 and simian immunodeficiency virus SIVMAC. J Virol. 1988, 62(9):3501-5.

111 Le Rouzic E, Benichou S. The Vpr protein from HIV-1: distinct roles along the viral life cycle. Retrovirology. 2005, 2:11.

112 Lu YL, Spearman P, Ratner L. Human immunodeficiency virus type 1 viral protein R localization in infected cells and virions. J Virol. 1993, 67(11):6542-50.

113 Cohen EA, Dehni G, Sodroski JG, Haseltine WA. Human immunodeficiency virus vpr product is a virion-associated regulatory protein. J Virol. 1990, 64(6):3097-9.

114 Kappes JC, Morrow CD, Lee SW, Jameson BA, Kent SB, Hood LE, Shaw GM, Hahn BH. Identification of a novel retroviral gene unique to human immunodeficiency virus type 2 and simian immunodeficiency virus SIVMAC. Virol. 1988, 62(9):3501-5.

115 He J, Choe S, Walker R, Di Marzio P, Morgan DO, Landau NR. Human immunodeficiency virus type 1 viral protein R (Vpr) arrests cells in the G2 phase of the cell cycle by inhibiting p34cdc2 activity. J Virol. 1995, 69(11):6705-11.

116 Re F, Braaten D, Franke EK, Luban J. Human immunodeficiency virus type 1 Vpr arrests the cell cycle in G2 by inhibiting the activation of p34cdc2-cyclin B. J Virol. 1995, 69(11):6859-64.

117 Bouhamdan M, Benichou S, Rey F, Navarro JM, Agostini I, Spire B, Camonis J, Slupphaug G, Vigne R, Benarous R, Sire J. Human immunodeficiency virus type 1 Vpr protein binds to the uracil DNA glycosylase DNA repair enzyme. J Virol. 1996, 70(2):697-704.

156

118 Le Rouzic E, Belaïdouni N, Estrabaud E, Morel M, Rain JC, Transy C, Margottin-Goguet F. HIV1 Vpr arrests the cell cycle by recruiting DCAF1/VprBP, a receptor of the Cul4-DDB1 ubiquitin ligase. Cell Cycle. 2007, 6(2):182-8.

119 DeHart JL, Zimmerman ES, Ardon O, Monteiro-Filho CM, Argañaraz ER, Planelles V. HIV-1 Vpr activates the G2 checkpoint through manipulation of the ubiquitin proteasome system. Virol J. 2007, 4:57.

120 Hrecka K, Gierszewska M, Srivastava S, Kozaczkiewicz L, Swanson SK, Florens L, Washburn MP, Skowronski J. Lentiviral Vpr usurps Cul4-DDB1[VprBP] E3 ubiquitin ligase to modulate cell cycle. Proc Natl Acad Sci U S A. 2007, 104(28):11778-83.

121 Tan L, Ehrlich E, Yu XF. DDB1 and Cul4A are required for human immunodeficiency virus type 1 Vpr-induced G2 arrest. J Virol. 2007, 81(19):10822- 30.

122 Belzile JP, Duisit G, Rougeau N, Mercier J, Finzi A, Cohen EA. HIV-1 Vpr-mediated G2 arrest involves the DDB1-CUL4AVPRBP E3 ubiquitin ligase. PLoS Pathog. 2007, 3(7):e85.

123 Eckstein DA, Sherman MP, Penn ML, Chin PS, De Noronha CM, Greene WC, Goldsmith MA. HIV-1 Vpr enhances viral burden by facilitating infection of tissue macrophages but not nondividing CD4+ T cells. J Exp Med. 2001, 194(10):1407-19.

124 Goujon C, Rivière L, Jarrosson-Wuilleme L, Bernaud J, Rigal D, Darlix JL, Cimarelli A. SIVSM/HIV-2 Vpx proteins promote retroviral escape from a proteasome-dependent restriction pathway present in human dendritic cells. Retrovirology. 2007, 4:2.

157

125 Jenkins Y, McEntee M, Weis K, Greene WC. Characterization of HIV-1 vpr nuclear import: analysis of signals and pathways. J Cell Biol. 1998, 143(4):875-85.

126 Triques K, Stevenson M. Characterization of restrictions to human immunodeficiency virus type 1 infection of monocytes. J Virol. 2004, 78(10):5523-7.

127 Lambotte O, Taoufik Y, de Goër MG, Wallon C, Goujard C, Delfraissy JF. Detection of infectious HIV in circulating monocytes from patients on prolonged highly active antiretroviral therapy. J Acquir Immune Defic Syndr. 2000, 23(2):114-9.

128 McElrath MJ, Steinman RM, Cohn ZA. Latent HIV-1 infection in enriched populations of blood monocytes and T cells from seropositive patients. J Clin Invest. 1991, 87(1):27-30.

129 Collman R, Hassan NF, Walker R, Godfrey B, Cutilli J, Hastings JC, Friedman H, Douglas SD, Nathanson N. Infection of monocyte-derived macrophages with human immunodeficiency virus type 1 (HIV-1). Monocyte-tropic and lymphocyte-tropic strains of HIV-1 show distinctive patterns of replication in a panel of cell types. J Exp Med. 1989, 170(4):1149-63.

130 Di Marzio P, Tse J, Landau NR. Chemokine receptor regulation and HIV type 1 tropism in monocyte-macrophages. AIDS Res Hum Retroviruses. 1998, 14(2):129-38.

131 Eisert V, Kreutz M, Becker K, Königs C, Alex U, Rübsamen-Waigmann H, Andreesen R, von Briesen H. Analysis of cellular factors influencing the replication of human immunodeficiency virus type I in human macrophages derived from blood of different healthy donors. Virology. 2001, 286(1):31-44.

158

132 Neil S, Martin F, Ikeda Y, Collins M. Postentry restriction to human immunodeficiency virus-based vector transduction in human monocytes. J Virol. 2001, 75(12):5448-56.

133 Rich EA, Chen IS, Zack JA, Leonard ML, O'Brien WA. Increased susceptibility of differentiated mononuclear phagocytes to productive infection with human immunodeficiency virus-1 (HIV-1). J Clin Invest. 1992, 89(1):176-83.

134 Sonza S, Maerz A, Deacon N, Meanger J, Mills J, Crowe S. Human immunodeficiency virus type 1 replication is blocked prior to reverse transcription and integration in freshly isolated peripheral blood monocytes. J Virol. 1996, 70(6):3863-9.

135 Münk C, Brandt SM, Lucero G, Landau NR. A dominant block to HIV-1 replication at reverse transcription in simian cells. Proc Natl Acad Sci U S A. 2002, 99(21):13843-8.

136 O'Brien WA, Namazi A, Kalhor H, Mao SH, Zack JA, Chen IS. Kinetics of human immunodeficiency virus type 1 reverse transcription in blood mononuclear phagocytes are slowed by limitations of nucleotide precursors. J Virol. 1994, 68(2):1258-63.

137 Chiu YL, Soros VB, Kreisberg JF, Stopak K, Yonemoto W, Greene WC. Cellular APOBEC3G restricts HIV-1 infection in resting CD4+ T cells. Nature. 2005, 435(7038):108-14.

138 Peng G, Greenwell-Wild T, Nares S, Jin W, Lei KJ, Rangel ZG, Munson PJ, Wahl SM. Myeloid differentiation and susceptibility to HIV-1 are linked to APOBEC3 expression. Blood. 2007, 110(1):393-400.

159

139 Wang X, Ye L, Hou W, Zhou Y, Wang YJ, Metzger DS, Ho WZ. Cellular microRNA expression correlates with susceptibility of monocytes/macrophages to HIV-1 infection. Blood. 2009, 113(3):671-4.

140 Sung TL, Rice AP. miR-198 inhibits HIV-1 gene expression and replication in monocytes and its mechanism of action appears to involve repression of cyclin T1. PLoS Pathog. 2009, 5(1):e1000263.

141 Triboulet R, Mari B, Lin YL, Chable-Bessia C, Bennasser Y, Lebrigand K, Cardinaud B, Maurin T, Barbry P, Baillat V, Reynes J, Corbeau P, Jeang KT, Benkirane M. Suppression of microRNA-silencing pathway by HIV-1 during virus replication. Science. 2007, 315(5818):1579-82.

142 Ahluwalia JK, Khan SZ, Soni K, Rawat P, Gupta A, Hariharan M, Scaria V, Lalwani M, Pillai B, Mitra D, Brahmachari SK. Human cellular microRNA hsa-miR-29a interferes with viral nef protein expression and HIV-1 replication. Retrovirology. 2008, 5:117.

143 Dewhurst S, Embretson JE, Anderson DC, Mullins JI, Fultz PN. Sequence analysis and acute pathogenicity of molecularly cloned SIVSMM-PBj14. Nature. 1990, 345(6276):636-40.

144 Adachi A, Gendelman HE, Koenig S, Folks T, Willey R, Rabson A, Martin MA. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J Virol. 1986, 59(2):284-91.

145 Peters PJ, Bhattacharya J, Hibbitts S, Dittmar MT, Simmons G, Bell J, Simmonds P, Clapham PR. Biological analysis of human immunodeficiency virus type 1 R5

160

envelopes amplified from brain and lymph node tissues of AIDS patients with neuropathology reveals two distinct tropism phenotypes and identifies envelopes in the brain that confer an enhanced tropism and fusigenicity for macrophages. J Virol. 2004, 78(13):6915-26.

146 Gendelman HE, Orenstein JM, Martin MA, Ferrua C, Mitra R, Phipps T, Wahl LA, Lane HC, Fauci AS, Burke DS, et al. Efficient isolation and propagation of human immunodeficiency virus on recombinant colony-stimulating factor 1-treated monocytes. J Exp Med. 1988, 167(4):1428-41.

147 Sharkey ME, Teo I, Greenough T, Sharova N, Luzuriaga K, Sullivan JL, Bucy RP, Kostrikis LG, Haase A, Veryard C, Davaro RE, Cheeseman SH, Daly JS, Bova C, Ellison RT 3rd, Mady B, Lai KK, Moyle G, Nelson M, Gazzard B, Shaunak S, Stevenson M. Persistence of episomal HIV-1 infection intermediates in patients on highly active anti-retroviral therapy. Nat Med. 2000, 6(1):76-81.

148 Bruce JW, Bradley KA, Ahlquist P, Young JA. Isolation of cell lines that show novel, murine leukemia virus-specific blocks to early steps of retroviral replication. J Virol. 2005, 79(20):12969-78.

149 McGinnes LW, Morrison TG. Inhibition of receptor binding stabilizes Newcastle disease virus HN and F protein-containing complexes. J Virol. 2006, 80(6):2894-903.

150 Ward CL, Omura S, Kopito RR. Degradation of CFTR by the ubiquitin- proteasome pathway. Cell. 1995, 83(1):121-7.

151 Simon JH, Gaddis NC, Fouchier RA, Malim MH. Evidence for a newly discovered cellular anti-HIV-1 phenotype. Nat Med. 1998, 4(12):1397-400.

161

152 Madani N, Kabat D. An endogenous inhibitor of human immunodeficiency virus in human lymphocytes is overcome by the viral Vif protein. J Virol. 1998, 72(12):10251-5.

153 Suzuki Y, Craigie R. The road to chromatin - nuclear entry of retroviruses. Nat Rev Microbiol. 2007, 5(3):187-96.

154 Yamashita M, Emerman M. Retroviral infection of non-dividing cells: old and new perspectives. Virology. 2006, 344(1):88-93.

155 Ringler DJ, Wyand MS, Walsh DG, MacKey JJ, Chalifoux LV, Popovic M, Minassian AA, Sehgal PK, Daniel MD, Desrosiers RC, et al. Cellular localization of simian immunodeficiency virus in lymphoid tissues. I. Immunohistochemistry and electron microscopy.Am J Pathol. 1989, 134(2):373-83.

156 Weinberg JB, Matthews TJ, Cullen BR, Malim MH. Productive human immunodeficiency virus type 1 (HIV-1) infection of nonproliferating human monocytes. J Exp Med. 1991, 174(6):1477-82.

157 Bieniasz PD, Weiss RA, McClure MO. Cell cycle dependence of foamy retrovirus infection. J Virol. 1995, 69(11):7295-9.

158 Lewis P, Hensel M, Emerman M. Human immunodeficiency virus infection of cells arrested in the cell cycle.EMBO J. 1992, 11(8):3053-8.

159 Lewis PF, Emerman M. Passage through mitosis is required for oncoretroviruses but not for the human immunodeficiency virus. J Virol. 1994, 68(1):510-6.

160 Roe T, Reynolds TC, Yu G, Brown PO. Integration of murine leukemia virus DNA depends on mitosis. EMBO J. 1993, 12(5):2099-108.

162

161 Cullen BR. Role and mechanism of action of the APOBEC3 family of antiretroviral resistance factors. J Virol. 2006, 80(3):1067-76.

162 Harris RS, Liddament MT. Retroviral restriction by APOBEC proteins. Nat Rev Immunol. 2004, 4(11):868-77.

163 Wang X, Herr RA, Chua WJ, Lybarger L, Wiertz EJ, Hansen TH. Ubiquitination of serine, threonine, or lysine residues on the cytoplasmic tail can induce ERAD of MHC-I by viral E3 ligase mK3.J Cell Biol. 2007, 177(4):613-24.

164 Cadwell K, Coscoy L. Ubiquitination on nonlysine residues by a viral E3 ubiquitin ligase. Science. 2005, 309(5731):127-30.

165 Henderson LE, Sowder RC, Copeland TD, Benveniste RE, Oroszlan S. Isolation and characterization of a novel protein (X-ORF product) from SIV and HIV-2. Science. 1988, 241(4862):199-201.

166 Arthur LO, Bess JW Jr, Sowder RC 2nd, Benveniste RE, Mann DL, Chermann JC, Henderson LE. Cellular proteins bound to immunodeficiency viruses: implications for pathogenesis and vaccines. Science. 1992, 258(5090):1935-8.

167 Goujon C, Arfi V, Pertel T, Luban J, Lienard J, Rigal D, Darlix JL, Cimarelli A. Characterization of simian immunodeficiency virus SIVSM/human immunodeficiency virus type 2 Vpx function in human myeloid cells. J Virol. 2008, 82(24):12335-45.

168 Srivastava S, Swanson SK, Manel N, Florens L, Washburn MP, Skowronski J. Lentiviral Vpx accessory factor targets VprBP/DCAF1 substrate adaptor for cullin 4 E3 ubiquitin ligase to enable macrophage infection. PLoS Pathog. 2008, 4(5):e1000059.

163

169 Wolfrum N, Mühlebach MD, Schüle S, Kaiser JK, Kloke BP, Cichutek K, Schweizer M. Impact of viral accessory proteins of SIVsmmPBj on early steps of infection of quiescent cells. Virology. 2007, 364(2):330-41.

170 González-Scarano F, Martín-García J. The neuropathogenesis of AIDS. Nat Rev Immunol. 2005, 5(1):69-81.

171 Gorry PR, Churchill M, Crowe SM, Cunningham AL, Gabuzda D. Pathogenesis of macrophage tropic HIV-1. Curr HIV Res. 2005, 3(1):53-60.

172 Sharp PM, Bailes E, Stevenson M, Emerman M, Hahn BH. Gene acquisition in HIV and SIV. Nature. 1996, 383(6601):586-7.

173 Tristem M, Marshall C, Karpas A, Hill F. Evolution of the primate lentiviruses: evidence from vpx and vpr. EMBO J. 1992, 11(9):3405-12.

174 Andrejeva J, Poole E, Young DF, Goodbourn S, Randall RE. The p127 subunit (DDB1) of the UV-DNA damage repair binding protein is essential for the targeted degradation of STAT1 by the V protein of the paramyxovirus simian virus 5. J Virol. 2002, 76(22):11379-86.

175 Swingler S, Mann AM, Zhou J, Swingler C, Stevenson M. Apoptotic killing of HIV-1-infected macrophages is subverted by the viral envelope glycoprotein. PLoS Pathog. 2007, 3(9):1281-90. The following figures were reproduced with permissions from publishers

Figure Number Publisher License Number Figure 1-2 Nature Publishing Group 2330811110362 Figure 1-3 Nature Publishing Group 2312000860418 Figure 1-4 Nature Publishing Group 2331240648684 Figure 1-5 Nature Publishing Group 2331240648684 Figure 1-7 Elsevier 2331240932199

The following figures were reproduced from journals: No permission required

Figure Number Publisher Theoretical Biology and Biophysics Group, Los Alamos National Figure 1-1 Laboratory Figure 1-6 National Academy of Sciences of the United States of America Figure 1-8 BioMed Central