USP20 Promotes Cellular Antiviral Responses Via Deconjugating K48-Linked Ubiquitination of MITA

USP20 Promotes Cellular Antiviral Responses via Deconjugating K48-Linked Ubiquitination of MITA

This information is current as Meng-Xin Zhang, Zeng Cai, Man Zhang, Xiao-Meng Wang, of September 25, 2021. Yaqin Wang, Fei Zhao, Jing Zhou, Min-Hua Luo, Qiyun Zhu, Zhigao Xu, Wen-Bo Zeng, Bo Zhong and Dandan Lin J Immunol published online 27 February 2019 http://www.jimmunol.org/content/early/2019/02/26/jimmun

ol.1801447 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2019/02/26/jimmunol.180144 Material 7.DCSupplemental http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 25, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2019 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published February 27, 2019, doi:10.4049/jimmunol.1801447 The Journal of Immunology

USP20 Promotes Cellular Antiviral Responses via Deconjugating K48-Linked Ubiquitination of MITA

Meng-Xin Zhang,*,† Zeng Cai,*,† Man Zhang,*,† Xiao-Meng Wang,*,† Yaqin Wang,‡ Fei Zhao,x Jing Zhou,x Min-Hua Luo,x Qiyun Zhu,{ Zhigao Xu,‖ Wen-Bo Zeng,x Bo Zhong,*,† and Dandan Lin#

Mediator of IRF3 activation ([MITA] also known as STING) is a direct sensor of cyclic dinucleotide and critically mediates cytoplasmic DNA–triggered innate immune signaling. The activity of MITA is extensively regulated by ubiquitination and deubiquitination. In this study, we report that USP20 interacts with and removes K48-linked ubiquitin chains from MITA after HSV-1 infection, thereby stabilizing MITA and promoting cellular antiviral responses. Deletion of USP20 accelerates HSV-1–induced degradation of MITA and impairs phosphorylation of IRF3 and IkBa as well as subsequent induction of type I IFNs and proinflammatory cytokines after HSV-1 infection or cytoplasmic DNA challenge. Consistently, Usp202/2 mice produce decreased Downloaded from type I IFNs and proinflammatory cytokines, exhibit increased susceptibility to lethal HSV-1 infection, and aggravated HSV-1 replication compared with Usp20+/+ mice. In addition, complement of MITA into Usp202/2 cells fully restores HSV-1–triggered signaling and inhibits HSV-1 infection. These findings suggest a crucial role of USP20 in maintaining the stability of MITA and promoting innate antiviral signaling. The Journal of Immunology, 2019, 202: 000–000. http://www.jimmunol.org/ he innate immune system deploys pattern-recognition sensor in various cell types (4, 5). Upon binding to cytoplasmic receptors (PRRs) to detect structurally conserved pathogen- DNA, cGAMP synthase catalyzes the synthesis of cGAMP, which T associated molecular patterns of invading pathogens, which serves as a second messenger binding to the endoplasmic reticu- constitutes the first line of host defense against infectious microbes (1). lum and mitochondrial adaptor protein mediator of IRF3 activa- Nucleic acids including RNA, DNA, and RNA–DNA hybrid are tion ([MITA] also known as STING, MPYS, and ERIS) and classical pathogen-associated molecular patterns recognized by induces dimerization or oligomerization of MITA (6–10). MITA PRRs and trigger a series of signaling cascades (2, 3). Among the further recruits adaptor proteins such as TRAF3 and TRAF6 and identified PRRs, TLRs such as TLR3 and TLR7/8 and retinoic kinases TBK1/IKKε and IKKa/b/g complextoactivatetran- acid–inducible gene I (RIG-I)-like receptors (RLRs) including scription factors IRF3/7 and NF-kB to induce expression of a by guest on September 25, 2021 RIG-I and melanoma differentiation-associated gene 5 (MDA5) large array of downstream genes. detect endosomal or cytoplasmic RNA, respectively. In contrast, Studies with MITA-deficient mice demonstrate that MITA is the TLR9 and a number of DNA sensors including RNA polymerase sole adaptor protein downstream of the cytoplasmic DNA sensors III, IFN-g–inducible protein 16 (IFI16), DEAD-box helicase 41 (11). Therefore, the activity of MITA must be strictly regulated to (DDX41), and DNA-dependent activator of IRFs (DAI) have been elicit protective immune responses and avoid excessive autoim- reported to detect endosomal or cytoplasmic DNA in location-, mune responses. Posttranslational modifications (PTMs) play es- sequence- and/or cell type–dependent manner. Particularly, the sential roles in regulating the activity and fate of target proteins, nucleotidyl transferase cyclic GMP-AMP (cGAMP) synthase de- and multiple PTMs have been reported to regulate the activ- tects dsDNA, ssDNA, and DNA–RNA hybrid independent of the ity of MITA (3). For example, TBK1 and ULK1 phosphorylate sequences and is recognized as a “universal” cytoplasmic DNA MITA at Ser366, which promotes the recruitment of IRF3 and the

*College of Life Sciences, Wuhan University, Wuhan 430072, China; †Medical Research B.Z. and D.L. designed and supervised the study. M.-X.Z. designed and performed Institute, School of Medicine, Wuhan University, Wuhan 430071, China; ‡Reproductive the major experiments; F.Z., J.Z., M.-H.L., and W.-B.Z. generated the H129-G4 Medical Center, Renmin Hospital of Wuhan University, Wuhan 430060, China; xState virus; Z.C. helped with the confocal microscopy analysis; M.Z. and Y.W. helped Key Laboratory of Virology, Chinese Academy of Sciences Center for Excellence in with the flow cytometry analysis and analyzed data; X.-M.W. and Z.X. helped with Brain Science and Intelligence Technology, Wuhan Institute of Virology, Chinese Acad- the animal studies; Q.Z. provided reagents; B.Z., D.L., and M.-X.Z. wrote the paper. emy of Sciences, Wuhan 430071, China; {State Key Laboratory of Veterinary Etiological All authors reviewed the results and approved the final version of the manuscript. Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural ‖ Address correspondence and reprint requests to Dr. Dandan Lin, Dr. Bo Zhong, or Sciences, Lanzhou 730046, China; Department of Pathology, Center for Pathology and Dr. Wen-Bo Zeng, Cancer Center, Renmin Hospital of Wuhan University, 238 Jiefang Molecular Diagnostics, Zhongnan Hospital of Wuhan University, Wuhan 430071, China; Road, Wuhan, China 430060 (D.L.), Medical Research Institute, School of Medicine, and #Cancer Center, Renmin Hospital of Wuhan University, Wuhan 430060, China Wuhan University, 115 Donghu Road, Wuhan, China 430071 (B.Z.), or Wuhan Institute ORCIDs: 0000-0001-5385-5625 (M.-X.Z.); 0000-0002-6332-1683 (Z.C.); 0000- of Virology, Chinese Academy of Sciences, 44 Xiaohongshan Mid-District, Wuhan, China 0002-6611-3898 (X.-M.W.); 0000-0003-1927-5840 (Y.W.); 0000-0001-9352- 430071 (W.-B.Z.). E-mail addresses: [email protected] (D.L.), [email protected]. 0643 (M.-H.L.); 0000-0003-3748-948X (Q.Z.). cn (B.Z.), or [email protected] (W.-B.Z.) Received for publication October 30, 2018. Accepted for publication February 4, The online version of this article contains supplemental material. 2019. Abbreviations used in this article: BMDC, bone marrow–derived dendritic cell; BMDM, This work was supported by grants from the National Key Research and Develop- bone marrow–derived macrophage; cGAMP, cyclic GMP-AMP; DUB, deubiquitinating; ment Program of China (2018YFC1004601), the Natural Science Foundation of China EMCV, encephalomyocarditis virus; ISD, IFN-stimulating DNA; MITA, mediator of (31601131, 31671454, 31622036, and 81501253), the Natural Science Foundation of Hubei IRF3 activation; MLF, mouse lung fibroblast; PRR, pattern-recognition receptor; PTM, Province (2018CFA016), the Health Commission of Hubei Province (WJ2018H0028), the posttranslational modification; qRT-PCR, quantitative RT-PCR; SeV, Sendai virus. Wuhan University (2042017kf0199 and 2042017kf0242), and the State Key Laboratory of Veterinary Etiological Biology (SKLVEB2017KFKT004). Copyright Ó 2019 by The American Association of Immunologists, Inc. 0022-1767/19/$37.50

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1801447 2 USP20 DEUBIQUITINATES AND STABILIZES MITA degradation of MITA, respectively (12, 13). Recently, it has been Reagents and Abs reported that TRIM38 and SENP2 target MITA for sumoylation The IFN-stimulating DNA (ISD)45, HSV60, DNA90, HSV120, and and desumoylation at the early and late phase of HSV-1 infection, poly(I:C) were described previously (34). MG132 and 3MA were pur- respectively (14). Such a reversible PTM modulates the degra- chased from Sigma-Aldrich. IFN-a was from BioLegend (75802). Rabbit dation of MITA through the chaperone-mediated autophagy Ab for USP20 (A301-189A-T-2) was from Abcam, Ab for K48-specific pathway without affecting the ubiquitination of MITA. The E3 anti-ubiquitin (05-1307) was from Millipore, HRP-conjugated goat anti- mouse or rabbit IgG (PA1-86717 and SA1-9510) was obtained from ubiquitin ligases TRIM56, TRIM32, and MUL1 target MITA for Thermo Fisher Scientific, HRP-conjugated mouse anti-FLAG (A8592) was K63-linked ubiquitination, and AMFR promotes K27-linked from Sigma-Aldrich, Ab for tubulin (F0601) was from SunGene, Abs for ubiquitination of MITA upon viral infection, which promotes the MITA (136474S), phospho-IRF3 (4947S), and phospho-IkBa (4947S) recruitment of TBK1 to MITA and the induction of type I IFNs were obtained from Cell Singling Technology, anti-IRF3(sc-9082) and anti-IkBa (sc-371) were purchased from Santa Cruz Biotechnology. and proinflammatory cytokines (15–18). However, genetic studies Staining Abs against CD3, CD4, CD8, CD19, CD25, CD44, CD62L, show that deletion of TRIM56 or TRIM32 has minimal effect on CD11c, CD11b, and F4/80 were purchased from BioLegend or SunGene. ubiquitination of MITA in mouse cells (16, 19). In contrast, Flow cytometry analysis was performed with the instrument of BD TRIM29 and RNF5 target MITA for K48-linked ubiquitination FACSCelesta. and proteasomal degradation and downregulates antiviral immune Quantitative RT-PCR and ELISA response (20–22). As the reverse process of ubiquitination, however, the deubiquitinating process of MITA and the physiological Total RNA was extracted from cells using TRIzol (Invitrogen), and the first- strand cDNA was reversed transcribed with All-in-One cDNA Synthesis relevance have not been fully investigated. SuperMix (BioTool). Gene expression was examined with a Bio-Rad CFX Deubiquitination is mediated by deubiquitinating (DUB) en- Connect system by a fast two-step amplification program with 23 SYBR Downloaded from zymes that play diverse roles in various physiological or patho- Green Fast qPCR Master Mix (BioTool). The value obtained for each gene logical processes (23, 24). We have previously reported that was normalized to that of the gene encoding b-actin. Gene-specific primers have been described previously (26, 35). The ELISA kits for IFN-b, TNF, USP13 constitutively interacts with MITA and disassociates from and IL-6 (BioLegend) and CCL5 (4ABio) were used to detect the indicated MITA after HSV-1 infection to keep K27-linked ubiquitination of cytokines in the sera or in the supernatants of cultured cells. MITA in check, thereby turning down excessive immune responses Coimmunoprecipitation and immunoblot analysis against HSV-1, whereas USP18 interacts with MITA after viral http://www.jimmunol.org/ infection and recruits USP20 to deconjugate K48-linked poly- The experiments were performed as previously described (26, 35). In brief, ubiquitin chains from and prevent proteasomal degradation of cells were lysed in Nonidet P-40 lysis buffer containing 150 mM NaCl, MITA (25, 26). Although it has been reported that USP20 1 mM EDTA, 1% Nonidet P-40, and 1% protease and phosphatase inhibitor mixture (BioTool). Cell lysates were subjected to SDS-PAGE, and targets various proteins including ULK1 (27), Rad17 (28), b immunoblot analysis was performed with the appropriate Abs. For im- adrenergic receptor (29), TRAF6 (30), Claspin (31, 32), and munoprecipitation assays, the lysates were immunoprecipitated with the b-catenin (33) for deubiquitination and thereby regulates IL-1b appropriate Abs, and the precipitants were washed three times with lysis signaling, DNA damage repair, tumorigenesis, and chemo- buffer containing 500 mMNaCl, followed by immunoblot analysis. The Abs were diluted in 3–5% (wt/vol) fat-free milk (BD Biosciences) or 1% resistance of cancers, the genetic evidence of such a regula- BSA (Sigma-Aldrich) in TBS (1:500–1:2000). tion is still lacking. by guest on September 25, 2021 In this study, we have generated USP20-deficient mice and Deubiquitination assays examined the role of USP20 in innate antiviral signaling. We found These experiments were performed as previously described (26, 35). For that knockout of USP20 impairs DNA virus-triggered activation of deubiquitination assays in cells, cells were lysed with the lysis buffer IRF3 and NF-kB and expression of downstream genes and pro- containing 10 mM N-Ethylmaleimide (100 ml), and the supernatants were motes K48-linked ubiquitination and proteasomal degradation of denatured at 95˚C for 5 min in the presence of 1% SDS by lysates. The denatured lysates were diluted with lysis buffer until the concentration of MITA after HSV-1 infection. Consistently, USP20 deficiency SDS reduced below 0.1%, followed by immunoprecipitation (denature- leads to potentiated HSV-1 replication in cells and in vivo and immunoprecipitation) with the indicated Abs. The immunoprecipi- USP20-deficient mice exhibit increased susceptibility to lethal tants were subject to immunoblot analysis with anti-K48–linked HSV-1 infection. Our findings have provided genetic evidence that ubiquitin chains. USP20 plays an essential role in cellular antiviral responses by Cell culture targeting MITA for deubiquitination. Mouse lung fibroblasts (MLFs) were isolated from mice that were 8–10 wk old. Lungs were minced and digested in calcium- and magnesium-free HBSS Materials and Methods buffer supplemented with 10 mg/ml type I collagenase (Worthington) and Mice 20 mg/ml DNase I (Sigma-Aldrich) for 3 h at 37˚C with shaking. Cell +/2 suspensions were filtered through sterile mesh, and the filtered cells were The Usp20 mice were generated by Beijing Vitalstar Biotechnology cultured in DMEM containing 10% FBS, 1% streptomycin and penicillin, Company through CRISPR/Casp9–mediated gene editing. In brief, Cas9 m b mRNA and guide RNA (59-GACCTTCGCCAGTGTACCTGTGG-39 and and 10 M -mercaptoethanol. Two days later, adherent fibroblasts were 59-GTCCTACTGTGCAGCACTCGTGG-39) were in vitro transcribed and rinsed with HBSS and cultured for experiments. Bone marrow cells were injected into the fertilized eggs that were transplanted into pseudopregnant isolated from mouse femur. The cells were cultured in DMEM containing m b mice. The tail DNA of F0 mice was amplified with PCR sequence, and 10% FBS, 1% streptomycin and penicillin, and 10 M -mercaptoethanol, with M-CSF (10 ng/ml; PeproTech) for bone marrow–derived macrophage the chimeras were crossed with wild-type C57BL/6 mice to obtain the +/2 +/2 (BMDM) differentiation or GM-CSF (20 ng/ml; PeproTech) for bone Usp20 mice. The F1 Usp20 mice were further crossed with wild- type C57BL/6 mice for at least three generations. The genotyping of the marrow–derived dendritic cell (BMDC) differentiation. The medium was Usp202/2 mice was confirmed by sequencing of the PCR fragments am- changed every 3 d. On day 7, cells were used for subsequent analysis. plified from the genomic DNA isolated from tails using the following Viral infection primers: Usp20+/+ and Usp202/2 forward 59-TGGGACAAGGACAAGA- GCAGG-39; Usp20+/+ reverse 59-CCCATAGGTTAGGTCCAGCAAC-39; For quantitative RT-PCR (qRT-PCR) or immunoblot analysis, cells Usp202/2 reverse 59-GCAGTGTGTTTATTTAACTTCACGGTA-39. seeded into 24-well plates (2–5 3 105 cells per well) or six-well plates The age- and sex-matched Usp20+/+ and Usp202/2 littermates were (106–107 cells per well) were infected with various viruses for the indi- randomized into groups for animal studies. All mice were housed in the cated time points. The variant of HSV-1, H129-G4, was previously de- specific pathogen-free animal facility at Wuhan University and all animal scribed (34). For viral replication assays, cells (2–5 3 105) were infected experiments were in accordance with protocols approved by the Institu- with HSV-1 or H129-G4. One hour later, the supernatants were removed tional Animal Care and Use Committee of Wuhan University. and cells were washed with prewarmed PBS (1 ml) twice, followed by The Journal of Immunology 3

2 2 culture in full medium for 12–24 h. Viral replication was analyzed by USP20 (aa 1–170) (Supplemental Fig. 1B). The Usp20 / mice flow cytometry, fluorescent microscopy, or qRT-PCR analysis. For mice +/+ 2/2 were normal in growth and development and were born in ac- infection, age- and sex-matched Usp20 and Usp20 littermates cordance with Mendelian ratio (Supplemental Fig. 1C), indi- were injected with HSV-1 (2 3 106 PFU per mouse) and the survival of animals was monitored for 7 d. The lungs and brains were collected cating that USP20 is dispensable for growth or development for qRT-PCR analysis or plaque assays at 24 h or 4 d postinfection, of mice. Flow cytometry analysis suggested that knockout respectively. of USP20 in mice did not affect the lymphocytes numbers or For plaque assay, briefly, viral samples were serially diluted and in- percentages in thymus, spleen, or peripheral lymph nodes cubated with Vero in the plate for 1 h, the homogenates or the dilutions were removed, and the infected Vero cells were washed with prewarmed (Supplemental Fig. 1D–F). In addition, knockout of USP20 did PBS twice, followed by incubation with DMEM containing 1.5% not affect the differentiation of BMDMs or BMDCs in M-CSF or methylcellulose for 48 h. The cells were fixed with 4% paraformaldehyde GM-CSF cultures, respectively (Supplemental Fig. 1G), sug- for 15 min and stained with 1% crystal violet for 30 min before counting gesting that USP20 is not required for the development and the plaques. homeostasis of lymphocytes in vivo. We next examined the Lentivirus-mediated gene transfer cellular localization of USP20 and MITA by transfecting GFP- tagged USP20 and Cherry-tagged MITA into Usp202/2 BMDCs. HEK293 cells were transfected with phage-6tag-MITA, phage-6tag-USP20, phage-6tag-USP20(C560/563S), phage-6tag-Cherry-MITA, phage-6tag- The results suggest that a portion of USP20 and MITA was GFP-USP20, or the empty vector along with the packaging vectors colocalized in the cytosol after HSV-1 infection (Fig. 1B). HSV-1 pSPAX2 and pMD2G. The medium was changed with fresh full medium infection leads to puncta formation of MITA, a hallmark of (10% FBS, 1% streptomycin/penicillin, and 10 mM 2-ME) after 8 h. Forty MITA activation (36). Interestingly, we found that knockout hours later, the supernatants were harvested to infect cells followed by various analyses. of USP20 did not affect the puncta formation of MITA after HSV-1 Downloaded from infection (Fig. 1C). Statistical analysis We next examined whether USP20 plays a role in DNA virus- +/+ Differences between experimental and control groups were tested using triggered expression of downstream genes with Usp20 and 2 2 Student t test or two-way ANOVA with Bonferroni posttest. The p values Usp20 / cells. Results from qRT-PCR analysis showed that the ,0.05 were considered statistically significant. For animal survival anal- induction of Ifnb, Ip10, Il6,orIsg56 was significantly decreased in ysis, the Kaplan–Meier method was used to generate graphs, and the 2/2 Usp20 BMDCs and BMDMs compared with the wild-type http://www.jimmunol.org/ survival curves were analyzed with log-rank analysis. counterparts after infection with HSV-1 or transfection of various DNA ligands (Fig. 2A, 2B). Immunoblot analysis suggested that Results HSV-1–induced phosphorylation of IRF3, IkBa,USP18,andp65 USP20 deficiency impairs DNA virus-triggered signaling was substantially impaired in Usp202/2 BMDCs or BMDMs We have previously investigated the deubiquitinating regulation compared with the wild-type counterparts (Fig. 2A, Supplemental of MITA and demonstrated that USP20 deubiquitinates and Fig. 2). In addition, the production of IFN-b and TNF was also stabilizes MITA after HSV-1 infection (26). In this study, we significantly compromised by knockout of USP20 in BMDCs and initially mapped the domains of USP20 interacting with MITA BMDMs (Fig. 2C). Moreover, the replication of HSV-1 was po- and found that the UCH domain (aa 150–700) was associated tentiated in Usp202/2 BMDCs or BMDMs compared with the wild- by guest on September 25, 2021 with MITA (Fig. 1A). To further investigate the role of USP20 in type counterparts as monitored by the expression of HSV-1 UL30 antiviral signaling in vivo, we generated USP20-deficient mice gene, the HSV-1 titers in the supernatants, or the GFP percentages by CRISPR/Cas9–mediated genome editing (Supplemental Fig. of H129-G4 viruses (37) (Fig. 2D–F). These data together suggest 1A). The generated mice lacked the fourth to the ninth exons of that USP20 positively regulates DNA virus-triggered signaling in Usp20, which resulted in the early translational termination of various primary mouse cells.

FIGURE 1. USP20 interacts with MITA. (A) Immunoblot of HEK293 cells that were transfected to express HA-MITA and FLAG-tagged USP20 or truncates, lysed and immunoprecipitated with anti-FLAG. Cell lysate was analyzed by immunoblot with anti-FLAG or anti-HA. (B and C) Confocal microscopy of Usp202/2 BMDCs cotransfected with phage-Cherry-MITA and phage-GFP-USP20 (B) and Usp20+/+ and Usp202/2 BMDCs transfected with phage-Cherry-MITA (C), infected with HSV-1 for 0–4 h. Scale bars, 10 mm. Data are representative of three independent experiments. 4 USP20 DEUBIQUITINATES AND STABILIZES MITA Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 2. USP20 deﬁciency impairs DNA virus-triggered signaling. (A) qRT-PCR analysis of Ifnb, Il6, and Ip10 mRNA and immunoblot analysis of both total and phosphorylated IkBa and IRF3 and total USP20 and tubulin in Usp20+/+ and Usp202/2 BMDCs or BMDMs infected with HSV-1 for 0–8 h. (B) qRT-PCR analysis of Ifnb, Ip10, and Isg56 mRNA in Usp20+/+ and Usp202/2 BMDCs or BMDMs untransfected (Mock) or transfected with HSV60, HSV120 for 4 h. (C) ELISA analysis of IFN-b and TNF in the supernatants of Usp20+/+ and Usp202/2 BMDCs or BMDMs infected with HSV-1 for 0–24 h. (D and E) qRT-PCR analysis of HSV-1 UL30 mRNA (D) and plaque assays (E) analyzing HSV-1 titers in Usp20+/+ and Usp202/2 BMDCs or BMDMs infected with HSV-1 (multiplicity of infection [MOI] = 0.3) for 1 h, followed by two times PBS wash and cultured in full medium for 12 or 24 h. (F) Flow cytometry analysis (left graphs) and microscopy imaging (right images) of the replication of GFP-tagged HSV-1 in Usp20+/+ and Usp202/2 BMDCs infected with H129-G4 (MOI = 0.2) for 1 h, followed by two times PBS wash and cultured in full medium for 24 h. Scale bars, 200 mm. Data are representative of three (A–E) or two (F) independent experiments [mean 6 SD in (A)–(E)]. *p , 0.05, **p , 0.01, ***p , 0.001 (analysis of two-way ANOVA followed by Bonferroni posttest).

USP20 is dispensable for RNA virus-triggered signaling USP20 (Fig. 3C). These data together suggest that USP20 is not We next examined whether USP20 plays a role in RNA virus- essential for RNA virus-triggered signaling. triggered signaling. The qRT-PCR analysis showed that Sendai Next, we determined whether USP20 affects type I IFN–mediated antiviral responses. Wild-type and Usp202/2 MLFs were virus (SeV)- or encephalomyocarditis virus (EMCV)-induced infected with H129-G4 or HSV-1 for 1 h, and the cells were expression of Ifnb, Ip10,andIl6 was comparable in USP20- washed with prewarmed PBS for twice and cultured in fresh deficient BMDCs and MLFs compared with the wild-type cells complete medium in the presence or absence of IFN-a (400 ng/ml) (Fig. 3A, 3B). Consistently, knockout of USP20 did not inhibit for 24 h, followed by fluorescent microscopy, flow cytometry, SeV- or EMCV-induced phosphorylation of IRF3 or IkBa or qRT-PCR analyses. The results showed that the GFP intensi- (Fig. 3A, 3B). In addition, intracellular poly(I:C)–induced ex- ties or percentages or the mRNA levels of HSV-1 UL30 gene pression of Ifnb, Ip10,andIl6 was not affected by knockout of were comparable between the wild-type and Usp202/2 cells The Journal of Immunology 5

FIGURE 3. USP20 is dispensable for RNA virus-triggered signaling. (A and B) qRT-PCR analysis of Ifnb, Il6,andIp10 mRNA (left graphs) and Downloaded from immunoblot analysis (right panels) of both total and phosphorylated IkBa and IRF3 and total USP20 and tubulin in Usp20+/+ and Usp202/2 BMDCs or MLFs infected with SeV or EMCV for 0–8 h. (C) qRT-PCR analysis of Ifnb, +/+

Il6,andIp10 mRNA in Usp20 and http://www.jimmunol.org/ Usp202/2 BMDCs, BMDMs, or MLFs transfected with poly(I:C) (1 mg) for 0–6 h. Data are representative of three independent experiments (Graphs show mean 6 SD). by guest on September 25, 2021

(Supplemental Fig. 3A, 3B). In addition, knockout of USP20 had no compared with Usp20+/+ mice at 24 h or 4 d after HSV-1 infection, effect on IFN-a–induced phosphorylation of STAT1 (Supplemental respectively (Fig. 4C, 4D). Results from plaque assays further Fig. 3C). These data together suggest that USP20 does not regulate confirmed that USP20 deficiency led to increased HSV-1 titers in type I IFN signaling or type I IFN–mediated antiviral responses. the lungs and brains from Usp202/2 mice 24 h or 4 d postinfection, respectively, compared with wild-type controls (Fig. 4E). USP20-deficient mice are more susceptible to HSV-1 infection These results together suggest that USP20 positively regulates We next examined the function of USP20 in DNA virus infection virus-induced expression of downstream genes and is essential for +/+ 2/2 in vivo. Age- and gender-matched Usp20 and Usp20 mice host defense against DNA viruses in vivo. were i.v. injected with HSV-1 and monitored daily for eight suc- cessive days. Consistent with the results from gene induction USP20 mediates antiviral signaling dependently on its analysis, Usp202/2 mice were more susceptible to lethal HSV-1 DUB activity infection than the control littermates (Fig. 4A). In addition, the We have previously shown that the DUB activity of USP20 is induction of IFN-b, IL-6, and CCL5 was significantly decreased required for deubiquitination of MITA (26). To confirm the es- in the sera of Usp202/2 mice compared with Usp20+/+ mice at sential roles of USP20 DUB activity in regulation of HSV-1– 12 h after HSV-1 infection (Fig. 4B). The expression of Ifnb and triggered signaling in vivo, we transfected the empty vector, proinflammatory cytokines was severely impaired and the repli- USP20 or its enzymatic inactive mutant USP20(C560/563S) cation of HSV-1 (as monitored by the expression of UL30 gene) [designated as USP20(CS)] into Usp202/2 cells followed by in- was exacerbated in lungs and brains from Usp202/2 mice fection with HSV-1 infection or transfection of ISD. Results from 6 USP20 DEUBIQUITINATES AND STABILIZES MITA

FIGURE 4. USP20-deﬁcient mice are more susceptible to HSV-1 infection. (A)Survival (Kaplan–Meier curve) of Usp20+/+ and Usp202/2 (n = 15) mice after i.v. injection of HSV-1 (2 3 106 PFU per mouse) and monitored for 7 d. (B–D) ELISA analysis of sera [(B)at 12 h, n = 4] and qRT-PCR analysis of lungs [(C)at24h, n = 3] or brain [(D)at4d,n = 3] from Usp20+/+ and Usp202/2 mice injected i.v. with HSV-1 (2 3 106 PFU per mouse). (E) Viral titers in lungs and brains from Usp20+/+ and Usp202/2 mice (n = 3) 24 h or 4 d after i.p. injection of HSV-1 (2 3 106 PFU per mouse), respectively. Data are representative of three independent experiments [mean 6 SD in (B)–(E)]. *p , 0.05, Downloaded from **p , 0.01, ***p , 0.001 (Student t test). http://www.jimmunol.org/

qRT-PCR and ELISA analysis showed that HSV-1 or cytosolic into USP20 knockout cells would restore virus-triggered ex- DNA–induced expression of Ifnb and Ip10 andproductionof pression of downstream genes. As we expected, reconstitution of IFN-b and TNF were substantially rescued in Usp202/2 MLFs MITA into Usp202/2 MLFs rescued the phosphorylation of IRF3 reconstituted with USP20 but not in those reconstituted with and IkBa and the expression of Ifnb, Il6, and Ip10 after HSV-1 USP20(CS) (Fig. 5A, 5B). In addition, HSV-1–induced phos- infection (Fig. 6E, 6F). Consistently, the replication of HSV-1 phorylation of IRF3 or IkBa was increased by the reconstitu- was suppressed in Usp202/2 MLFs reconstituted with MITA as tion of USP20 but not USP20(CS) into Usp202/2 MLFs monitored by the GFP signals of H129-G4 or the HSV-1 titers in by guest on September 25, 2021 (Fig. 5C). Consistently, replication of HSV-1 was potentiated in the supernatants (Fig. 6G, 6H). Together, these data suggest that Usp202/2 MLFs reconstituted with USP20 but not in those MITA is the major target of USP20 in regulating cellular antiviral reconstituted with USP20(CS) as monitored by GFP signals or responses to DNA virus infection. the HSV-1 titers in the supernatants (Fig. 5D, 5E). These data together suggest that USP20-mediated potentiation of DNA Discussion virus-triggered signaling requires its deubiquitinating enzy- The adaptor protein MITA critically mediates cellular antiviral matic activity. responses and autoimmunity. The activity and availability of MITA are strictly regulated by various PTMs including ubiquitination USP20 deconjuagates K48-linked ubiquitination of and (38). Whereas the E3 ubiquitin ligases RNF5 and TRIM29 have stabilizes MITA been reported to catalyze K48-linked ubiquitination and protea- We have previously demonstrated that knockdown of USP20 leads somal degradation of MITA (20–22), the DUB enzymes antago- to increased K48-linked ubiquitination of MITA in THP-1 cells nizing such a modification remain to be identified. We have after HSV-1 infection (26). Consistent with these observations, previously reported that deficiency of USP18 results in destabili- HSV-1–induced K48-linked ubiquitination of MITA were sub- zation of MITA in a manner independent of its enzyme activity stantially increased in Usp202/2 MLFs compared with Usp20+/+ (26). Interestingly, USP20 is a direct DUB enzyme targeting MLFs (Fig. 6A). Reconstitution of USP20 but not USP20(CS) into MITA for deubiquitination in vitro and in THP-1 cells (26). In this Usp202/2 MLFs impaired HSV-1–induced K48-linked ubiq- study, we generated USP20-deficient mice and provided genetic uitination of MITA (Fig. 6B), indicating that USP20 removes evidence that deletion of USP20 in primary mouse cells promoted K48-linked polyubiquitin chains from MITA after viral infection, HSV-1–induced K48-linked ubiquitination and proteasomal deg- which may control the protein stability of MITA. In support of radation of MITA. Consistent with these observations, we found this notion, knockout of USP20 promoted degradation of MITA that knockout of USP20 impaired phosphorylation of IkBa and in the absence or presence of CHX (100 mg/ml) after infection IRF3 and expression of downstream type I IFNs and proin- with HSV-1 (Fig. 6C). In addition, HSV-1– or cytoplasmic flammatory cytokines after HSV-1 infection or cytoplasmic DNA DNA–induced degradation of MITA was blocked by the protea- challenge, and the USP20-deficient mice were more susceptible some inhibitor MG132 but not the autophagy inhibitor 3MA in to lethal HSV-1 infection. In addition, we further demonstrated Usp202/2MLFs (Fig. 6D). These data collectively suggest that that complementation of MITA into Usp202/2 cells fully restored USP20 rescues MITA from proteasome-dependent degradation HSV-1–induced phosphorylation of IkBa and IRF3 and induction of MITA by deconjugating K48-linked ubiquitination of MITA. of type I IFNs and proinflammatory cytokines. These data together Because the degradation of MITA is accelerated in USP20- suggest that USP20 targets MITA for deubiquitination and thereby deficient cells, we hypothesized that supplementation of MITA stabilizes MITA to promote cellular antiviral responses. The Journal of Immunology 7 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 5. USP20 mediates antiviral signaling dependently of its DUB activity. (A) qRT-PCR analysis of Ifnb, Ip10, and USP20 mRNA in Usp202/2 MLFs reconstituted with empty vector (Vec), USP20, or USP20(C560/563S) followed by infection with HSV-1, untransfected (Lipo), or transfected with ISD45 for 0–6 h. (B) ELISA analysis of IFN-b and TNF in cells obtained in (A) infected with HSV-1 for 0–24 h. (C) Immunoblot analysis of both total and phosphorylated IkBa and IRF3 and total USP20 and tubulin in cells obtained in (A) infected with HSV-1 for 0–8 h. (D) Plaque assays analyzing HSV-1 titers in the supernatants of cells obtained in (A) infected with HSV-1 (multiplicity of infection [MOI] = 0.3) for 1 h followed by two times PBS wash and cultured with full medium for 12 h. (E) Flow cytometry analysis (left graphs) and ﬂuorescent microscopy imaging (right images) of GFP-tagged HSV-1 in cells obtained in (A) infected with HSV-1–GFP (MOI = 0.3). Scale bars, 200 mm. Data are representative of three (A–C) or two (D and E) independent experiments [mean 6 SD in (A), (B), and (D)]. *p , 0.05, **p , 0.01, ***p , 0.001 (analysis of two-way ANOVA followed by Bonferroni posttest).

The protein stability of MITA is controlled at multiple levels. previously shown that RNF5 ubiquitinates and induces degradation Upon activation, MITA is rapidly transported to ERGIC, where it of MITA in the membrane fractions after viral infection (20). Our recruits TBK1 and IRF3 and promotes phosphorylation of IRF3 data suggest that USP20 removes K48-linked ubiquitin chains from by TBK1 (39). This process requires iRhom2, which facilitates MITA and keeps MITA away from proteasome-mediated degrada- the trafficking and simultaneously recruits EIF3S5 to prevent the tion. This process is likely following the ubiquitination and puncta degradative ubiquitination of MITA (36). There are also reports formation of MITA and it is highly possible that USP20 functions as showing that MITA traffics to autophagosomes that associate with a corrector that antagonizes excessive degradation of MITA medi- endosomal compartments containing NF-kB and IRF3, where ated by E3 ubiquitin ligases after viral infection. MITA recruits TBK1 and IKKa/b/g to activate IRF3 and NF-kB Currently, it is unlikely that USP20 regulates HSV-1 entry into (11). After its activation of IRF3, ULK1 phosphorylates and cells. First, when treated with IFN-a, H129-G4 (GFP-expressing promotes the degradation of MITA, presumably through the auto- HSV-1) or HSV-1 replicated equally in Usp20+/+ or Usp202/2 phagy pathway (12). In addition, TRIM38 and SENP2 catalyze MLFs as monitored by the GFP percentages or HSV-1 UL30 gene sumoylation and desumoylation of MITA at the early and late phase expression. It should be noted that USP20 did not regulate type I of HSV-1 infection, thereby regulating the degradation of MITA IFN–induced phosphorylation of STAT1, suggesting that the equal through chaperon-mediated autophagy pathway (14). More recently, replication is more possible because of equal infection efficiency two groups have reported that TRIM29 and MITA form puncta in than USP20-mediated regulation of type I IFN–triggered signal- the cytosol, where TRIM29 induces K48-linked ubiquitination and ing. Second, reconstitution of MITA into Usp202/2 MLFs inhibited proteasome-dependent degradation of MITA after HSV-1 infec- HSV-1 or H129-G4 replication as equally as did Usp20+/+ MLFs, tion or cytoplasmic DNA challenge (21, 22). Interestingly, we have indicating that MITA is the major and sole factor for increased 8 USP20 DEUBIQUITINATES AND STABILIZES MITA Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 6. USP20 mediates antiviral signaling through MITA. (A and B) Denature-IP (with anti-MITA) and immunoblot analysis (with anti-K48 linkage polyubiquitin, anti-MITA, anti-USP20, or anti-tubulin) of Usp20+/+ and Usp202/2 MLFs (A)orUsp202/2 MLFs reconstituted with empty vector (Vec), USP20, or USP20(CS) (B) infected with HSV-1 for 6 h. (C) Immunoblot analysis of MITA, USP20, and tubulin in Usp20+/+ and Usp202/2 MLFs infected with HSV-1 for 0–12 h in the presence or absence of cycloheximide (100 mg/ml). (D) Immunoblot analysis of MITA, USP20, and tubulin in Usp20+/+ and Usp202/2 MLFs left infected with HSV-1 for 8 h, untransfected (Lipo), or transfected with ISD for 4 h in the presence or absence of MG132 or 3MA. (E) Immunoblot analysis of both total and phosphorylated IkBa and IRF3 and total USP20 and tubulin in Usp20+/+ and Usp202/2 MLFs reconstituted with empty vector (Vec) and MITA and infected with HSV-1 for 0–8 h. (F) qRT-PCR assay of Ifnb, Il6, Ip10, and MITA mRNA in cells obtained in (E) infected with HSV-1 for 4 h. (G) Flow cytometry analysis (left graphs) and microscopy imaging (right images) of GFP-tagged HSV-1 in cells obtained in (E) infected with H129-G4 (multiplicity of infection [MOI] = 0.3). Scale bars, 200 mm. (H) Plaque assays analyzing HSV titers in cells obtained in (E) infected with HSV-1 (MOI = 0.3) for 1 h, followed by two times PBS wash and cultured with full medium for 12 h. Data are representative of three (A–H) independent experiments. [mean 6 SD in (F) and (H)]. *p , 0.05, **p , 0.01, ***p , 0.001 (analysis of two-way ANOVA followed by Bonferroni posttest).

HSV-1 replication in Usp202/2 cells. Finally, our previous and degradation of MITA. It is widely acknowledged that the pri- current studies suggest that knockdown or knockout of USP20 mary role of MITA is to inhibit viral replication rather than viral results in increased K48-linked ubiquitination and accelerated entry by inducing type I IFNs production. However, whether The Journal of Immunology 9

USP20 affects virus entry requires more direct evidence and fur- MITA/STING protein for K63-linked ubiquitination. J. Biol. Chem. 287: 28646– 28655. ther investigations. 17. Wang, Q., X. Liu, Y. Cui, Y. Tang, W. Chen, S. Li, H. Yu, Y. Pan, and C. Wang. In this study, we found that the protein stability of MITA is very 2014. The E3 ubiquitin ligase AMFR and INSIG1 bridge the activation of TBK1 stable in resting cells, and HSV-1 infection or cytoplasmic DNA kinase by modifying the adaptor STING. Immunity 41: 919–933. 2/2 18. Ni, G., H. Konno, and G. N. Barber. 2017. Ubiquitination of STING at lysine 224 challenge rapidly induces its degradation in Usp20 but not controls IRF3 activation. Sci. Immunol. 2: eaah7119. +/+ Usp20 cells, indicating essential roles of USP20 in protecting 19. Seo, G. J., C. Kim, W. J. Shin, E. H. Sklan, H. Eoh, and J. U. Jung. 2018. MITA from degradation. Several studies have reported various TRIM56-mediated monoubiquitination of cGAS for cytosolic DNA sensing. Nat. Commun. 9: 613. gain-of-function mutants of MITA that are associated with auto- 20. Zhong, B., L. Zhang, C. Lei, Y. Li, A. P. Mao, Y. Yang, Y. Y. Wang, X. L. Zhang, immune diseases termed as STING-associated vasculopathy with and H. B. Shu. 2009. The ubiquitin ligase RNF5 regulates antiviral responses by onset in infancy (SAVI) (39–43). These mutants are activated mediating degradation of the adaptor protein MITA. Immunity 30: 397–407. 21. Xing, J., A. Zhang, H. Zhang, J. Wang, X. C. Li, M. S. Zeng, and Z. Zhang. spontaneously without cGAMP binding and constitutively un- 2017. TRIM29 promotes DNA virus infections by inhibiting innate immune dergo dimerization or oligomerization for activation. However, it response. Nat. Commun. 8: 945. is unknown whether these mutants are constitutively ubiquitinated 22. Li, Q., L. Lin, Y. Tong, Y. Liu, J. Mou, X. Wang, X. Wang, Y. Gong, Y. Zhao, Y. Liu, et al. 2018. TRIM29 negatively controls antiviral immune response at cellular compartments. Considering that deletion of MITA through targeting STING for degradation. [Published erratum appears in 2018 2 2 rescues lethality of Trex1 / or Rnaseh2 loss-of-function mutation Cell Discov. 4: 25.] Cell Discov. 4: 13. 23. Komander, D., and M. Rape. 2012. The ubiquitin code. Annu. Rev. Biochem. 81: knock-in mice (44–46), it is very interesting to investigate whether 203–229. USP20 plays a role in autoimmunity by catalyzing deubiquitina- 24. Swatek, K. N., and D. Komander. 2016. Ubiquitin modifications. Cell Res. 26: tion and promoting the degradation of MITA. 399–422. 25. Sun, H., Q. Zhang, Y. Y. Jing, M. Zhang, H. Y. Wang, Z. Cai, T. Liuyu, Downloaded from Z. D. Zhang, T. C. Xiong, Y. Wu, et al. 2017. USP13 negatively regulates antiviral responses by deubiquitinating STING. Nat. Commun. 8: 15534. Acknowledgments 26. Zhang, M., M. X. Zhang, Q. Zhang, G. F. Zhu, L. Yuan, D. E. Zhang, Q. Zhu, We thank members of Zhong laboratory and the core facilities of the J. Yao, H. B. Shu, and B. Zhong. 2016. USP18 recruits USP20 to promote Medical Research Institute for technical help. innate antiviral response through deubiquitinating STING/MITA. Cell Res. 26: 1302–1319. 27. Kim, J. H., D. Seo, S. J. Kim, D. W. Choi, J. S. Park, J. Ha, J. Choi, J. H. Lee, Disclosures S. M. Jung, K. W. Seo, et al. 2018. The deubiquitinating enzyme USP20 stabilizes ULK1 and promotes autophagy initiation. EMBO Rep. 19: e44378. http://www.jimmunol.org/ The authors have no financial conflicts of interest. 28. Shanmugam, I., M. Abbas, F. Ayoub, S. Mirabal, M. Bsaili, E. K. Caulder, D. M. Weinstock, A. E. Tomkinson, R. Hromas, and M. Shaheen. 2014. Ubiquitin-specific peptidase 20 regulates Rad17 stability, checkpoint kinase 1 References phosphorylation and DNA repair by homologous recombination. J. Biol. Chem. 1. Akira, S., S. Uematsu, and O. Takeuchi. 2006. Pathogen recognition and innate 289: 22739–22748. immunity. Cell 124: 783–801. 29. Kommaddi, R. P., P. Y. Jean-Charles, and S. K. Shenoy. 2015. Phosphorylation of 2. Wu, J., and Z. J. Chen. 2014. Innate immune sensing and signaling of cytosolic the deubiquitinase USP20 by protein kinase A regulates post-endocytic traf- nucleic acids. Annu. Rev. Immunol. 32: 461–488. ficking of b2 adrenergic receptors to autophagosomes during physiological 3. Hu, M. M., and H. B. Shu. 2018. Cytoplasmic mechanisms of recognition and stress. J. Biol. Chem. 290: 8888–8903. defense of microbial nucleic acids. Annu. Rev. Cell Dev. Biol. 34: 357–379. 30. Jean-Charles, P. Y., L. Zhang, J. H. Wu, S. O. Han, L. Brian, N. J. Freedman, and 4. Sun, L., J. Wu, F. Du, X. Chen, and Z. J. Chen. 2013. Cyclic GMP-AMP syn- S. K. Shenoy. 2016. Ubiquitin-specific protease 20 regulates the reciprocal by guest on September 25, 2021 thase is a cytosolic DNA sensor that activates the type I interferon pathway. functions of b-Arrestin2 in toll-like receptor 4-promoted nuclear factor kB Science 339: 786–791. (NFkB) activation. J. Biol. Chem. 291: 7450–7464. 5. Li, X. D., J. Wu, D. Gao, H. Wang, L. Sun, and Z. J. Chen. 2013. Pivotal roles of 31. Yuan, J., K. Luo, M. Deng, Y. Li, P. Yin, B. Gao, Y. Fang, P. Wu, T. Liu, and cGAS-cGAMP signaling in antiviral defense and immune adjuvant effects. Z. Lou. 2014. HERC2-USP20 axis regulates DNA damage checkpoint through Science 341: 1390–1394. Claspin. Nucleic Acids Res. 42: 13110–13121. 6. Wu, J., L. Sun, X. Chen, F. Du, H. Shi, C. Chen, and Z. J. Chen. 2013. Cyclic 32. Zhu, M., H. Zhao, J. Liao, and X. Xu. 2014. HERC2/USP20 coordinates CHK1 GMP-AMP is an endogenous second messenger in innate immune signaling by activation by modulating CLASPIN stability. Nucleic Acids Res. 42: 13074– cytosolic DNA. Science 339: 826–830. 13081. 7. Zhong, B., Y. Yang, S. Li, Y. Y. Wang, Y. Li, F. Diao, C. Lei, X. He, L. Zhang, 33. Wu, C., K. Luo, F. Zhao, P. Yin, Y. Song, M. Deng, J. Huang, Y. Chen, L. Li, P. Tien, and H. B. Shu. 2008. The adaptor protein MITA links virus-sensing S. Lee, et al. 2018. USP20 positively regulates tumorigenesis and chemo- receptors to IRF3 transcription factor activation. Immunity 29: 538–550. resistance through b-catenin stabilization. Cell Death Differ. 25: 1855–1869. 8. Ishikawa, H., and G. N. Barber. 2008. STING is an endoplasmic reticulum 34. Zhou, Q., H. Lin, S. Wang, S. Wang, Y. Ran, Y. Liu, W. Ye, X. Xiong, B. Zhong, adaptor that facilitates innate immune signalling. [Published erratum appears in H. B. Shu, and Y. Y. Wang. 2014. The ER-associated protein ZDHHC1 is a 2008 Nature 456: 274.] Nature 455: 674–678. positive regulator of DNA virus-triggered, MITA/STING-dependent innate im- 9. Sun, W., Y. Li, L. Chen, H. Chen, F. You, X. Zhou, Y. Zhou, Z. Zhai, D. Chen, mune signaling. Cell Host Microbe 16: 450–461. and Z. Jiang. 2009. ERIS, an endoplasmic reticulum IFN stimulator, activates 35. Liuyu, T., K. Yu, L. Ye, Z. Zhang, M. Zhang, Y. Ren, Z. Cai, Q. Zhu, D. Lin, and innate immune signaling through dimerization. Proc. Natl. Acad. Sci. USA 106: B. Zhong. 2019. Induction of OTUD4 by viral infection promotes antiviral re- 8653–8658. sponses through deubiquitinating and stabilizing MAVS. Cell Res. 29: 67–79. 10. Jin, L., K. K. Hill, H. Filak, J. Mogan, H. Knowles, B. Zhang, A. L. Perraud, 36. Luo, W. W., S. Li, C. Li, H. Lian, Q. Yang, B. Zhong, and H. B. Shu. 2016. J. C. Cambier, and L. L. Lenz. 2011. MPYS is required for IFN response factor iRhom2 is essential for innate immunity to DNA viruses by mediating trafficking 3 activation and type I IFN production in the response of cultured phagocytes and stability of the adaptor STING. Nat. Immunol. 17: 1057–1066. to bacterial second messengers cyclic-di-AMP and cyclic-di-GMP. J. Immunol. 37. Zeng, W. B., H. F. Jiang, Y. D. Gang, Y. G. Song, Z. Z. Shen, H. Yang, X. Dong, 187: 2595–2601. Y. L. Tian, R. J. Ni, Y. Liu, et al. 2017. Anterograde monosynaptic trans- 11. Ishikawa, H., Z. Ma, and G. N. Barber. 2009. STING regulates intracellular neuronal tracers derived from herpes simplex virus 1 strain H129. Mol. DNA-mediated, type I interferon-dependent innate immunity. Nature 461: 788– Neurodegener. 12: 38. 792. 38. Li, K., and B. Zhong. 2018. Regulation of cellular antiviral signaling by mod- 12. Konno, H., K. Konno, and G. N. Barber. 2013. Cyclic dinucleotides trigger ifications of ubiquitin and ubiquitin-like molecules. Immune Netw. 18: e4. ULK1 (ATG1) phosphorylation of STING to prevent sustained innate immune 39. Dobbs, N., N. Burnaevskiy, D. Chen, V. K. Gonugunta, N. M. Alto, and signaling. Cell 155: 688–698. N. Yan. 2015. STING activation by translocation from the ER is associ- 13. Liu, S., X. Cai, J. Wu, Q. Cong, X. Chen, T. Li, F. Du, J. Ren, Y. T. Wu, ated with infection and autoinflammatory disease. Cell Host Microbe 18: N. V. Grishin, and Z. J. Chen. 2015. Phosphorylation of innate immune adaptor 157–168. proteins MAVS, STING, and TRIF induces IRF3 activation. Science 347: 40. Jeremiah, N., B. Neven, M. Gentili, I. Callebaut, S. Maschalidi, aaa2630. M. C. Stolzenberg, N. Goudin, M. L. Fre´mond, P. Nitschke, T. J. Molina, et al. 14. Hu, M. M., Q. Yang, X. Q. Xie, C. Y. Liao, H. Lin, T. T. Liu, L. Yin, and 2014. Inherited STING-activating mutation underlies a familial inflammatory H. B. Shu. 2016. Sumoylation promotes the stability of the DNA sensor cGAS syndrome with lupus-like manifestations. J. Clin. Invest. 124: 5516–5520. and the adaptor STING to regulate the kinetics of response to DNA virus. 41.Liu,Y.,A.A.Jesus,B.Marrero,D.Yang,S.E.Ramsey,G.A.M.Sanchez, Immunity 45: 555–569. K. Tenbrock, H. Wittkowski, O. Y. Jones, H. S. Kuehn, et al. 2014. Activated 15. Tsuchida, T., J. Zou, T. Saitoh, H. Kumar, T. Abe, Y. Matsuura, T. Kawai, and STING in a vascular and pulmonary syndrome. N. Engl. J. Med. 371: 507– S. Akira. 2010. The ubiquitin ligase TRIM56 regulates innate immune responses 518. to intracellular double-stranded DNA. Immunity 33: 765–776. 42. Melki, I., Y. Rose, C. Uggenti, L. Van Eyck, M. L. Fremond, N. Kitabayashi, 16. Zhang, J., M. M. Hu, Y. Y. Wang, and H. B. Shu. 2012. TRIM32 protein G. I. Rice, E. M. Jenkinson, A. Boulai, N. Jeremiah, et al. 2017. Disease- modulates type I interferon induction and cellular antiviral response by targeting associated mutations identify a novel region in human STING necessary for 10 USP20 DEUBIQUITINATES AND STABILIZES MITA

the control of type I interferon signaling. [Published erratum appears in 2017 45. Mackenzie, K. J., P. Carroll, L. Lettice, Z. Tarnauskaite,_ K. Reddy, F. Dix, J. Allergy Clin. Immunol. 104: 1757.] J. Allergy. Clin. Immunol. 140: 543–552.e5 A. Revuelta, E. Abbondati, R. E. Rigby, B. Rabe, et al. 2016. Ribonuclease H2 43. Konno, H., I. K. Chinn, D. Hong, J. S. Orange, J. R. Lupski, A. Mendoza, mutations induce a cGAS/STING-dependent innate immune response. EMBO J. L. A. Pedroza, and G. N. Barber. 2018. Pro-inﬂammation associated with a gain- 35: 831–844. of-function mutation (R284S) in the innate immune sensor STING. Cell Rep. 23: 46. Pokatayev, V., N. Hasin, H. Chon, S. M. Cerritelli, K. Sakhuja, J. M. Ward, 1112–1123. H. D. Morris, N. Yan, and R. J. Crouch. 2016. RNase H2 catalytic core Aicardi- 44. Chen, Q., L. Sun, and Z. J. Chen. 2016. Regulation and function of the cGAS- Goutie`res syndrome-related mutant invokes cGAS-STING innate immune- STING pathway of cytosolic DNA sensing. Nat. Immunol. 17: 1142–1149. sensing pathway in mice. J. Exp. Med. 213: 329–336. Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 Figure S1 A sgRNA1: GACCTTCGCCAGTGTACCTGTGG sgRNA2: GTCCTACTGTGCAGCACTCGTGG +/- -/- +/+

-500bp Wild-type Usp20 genome: -250bp × Deletion of exon4 - exon9 -500bp Mutant Usp20 genome: -250bp exon3 exon10 Wild-type Usp20 genome: 5’··· CTTGCTAGTCCATTG ············· GAGAAAAG···3’

Mutant Usp20 genome: 5’··· CTTGCTAGT GAGAAAAG···3’ Deletion of 7682 bp B Reading frame C Genotype Number 322 TCA GAG CAG GA … GCC CAG GTG … CCC TGA 2751 bp +/+ 108 S E Q … A Q V ... P * 917 aa (full length) Usp20 72 Usp20+/- 151 Deletion of exons 4-9, 530 bp 322 TCA GAG CAG CCC AGG TGC … ATC TGA 510bp Usp20-/- 77 108 S E Q P R C … R * 170 aa (early termination) D 39.6 38.9 0.93 22.5 Spleen 42.7 500

+/+

Usp20 ) 6 45.7 400 24.6

(x10 14.8 300 38.7 1.02 36.2 20.1 200 umber 42 n

Usp20-/- 100

Cell 43 25.7 0

14.5

CD25 CD44

CD8 Usp20: +/+ -/- CD3

E CD19 CD4 CD4 CD62L 31.7 44.4 3.9 8.74 Peripheral lymph nodes

6 ) Usp20+/+ 6

25.4 34.1 48.4 (x10 30.3 4

42.5 56.8 4.85 7.06 umber n 2 -/-

Usp20 Cell

27 40.1

22.9 41.3 0

CD25 CD44 CD8 CD3 Usp20: +/+ -/- CD19 CD4 CD4 CD62L

G Usp20+/+ Usp20-/- Supplemental Figure 1 Generation and analysis of Usp20-/-mice. (A) A scheme for CRIPSR/Cas9-mediated genome editing of the Usp20 gene +/+ +/- -/- GM-CSF culture locus (left). Genotyping of Usp20 ,Usp20 and Usp20 mice (right). (B) Gene sequence and reading frame of Usp20+/+ and Usp20-/- mice. (C) Mice

70.7 69.9 numbers of each genotype. (D-F) Flow cytometry analysis of immune cells CD11c and quantitative data in spleen (D), peripheral lymph nodes (E) and thymus (F) from Usp20+/+ and Usp20-/- mice (n=3). (G) Flow cytometry analyzing of +/+ -/- GM-CSF, M-CSF induced BMDCs or BMDMs from Usp20 and Usp20 97.3 97.4 M-CSF culture mice (n=3).

Data are representative of two independent experiments (Graphs show mean CD11b F4/80  S.D.). Figure S2

BMDCs Usp20+/+ Usp20-/- Usp20+/+ Usp20-/- HSV-1: 0 4 8 0 4 8 h ISD: 0 3 6 0 3 6 h -p-p65 -p65 -USP18 -USP20 -Tubulin

Supplemental Figure 2 USP20 deficiency impairs DNA virus-triggered signaling. Immunoblot analysis of phosphorylated (p-) and total p65, USP18, USP20 and Tubulin of Usp20+/+ and Usp20-/- BMDCs after infection with HSV-1 or 0-8 hours or transfection of ISD for 0-6 hours. Data are representative of two independent experiments.

Figure S3

A Mock H129-G4 IFNa+H129-G4 H129-G4 IFNa+H129-G4

0.33 17.3 11.7 Usp20+/+

0.19 26.1 12.3

Usp20-/-

SSC GFP B C +/+ -/- 2000 +/+ Usp20 Usp20 *** Usp20 HSV-1 24 hours -/- min

Usp20 IFNa: 0 15 30 0 15 30

1500 -pSTAT1 UL30

- 1000 -STAT1 mRNA Level mRNA

-USP20 HSV 500 -Tubulin Rel. 0

Mock IFNa

Supplemental Figure 3 USP20 deficiency does not affect type I IFN-triggered signaling. (A-B) Usp20+/+ and Usp20-/- MLFs were infected with H129-G4 in the presence or absence of IFNa for 24 hours followed by flow cytometry and fluorescent microscopy (A) and qRT-PCR analysis (B). (C) Immunoblot analysis of total and phosphorylated STAT1, USP20 and Tubulin in Usp20+/+ and Usp20-/- MLFs treated with IFNa for 0-30 min. ***P < 0.001 (two-way ANOVA). Scale bars represent 200 m. Data are representative of two independent experiments (mean  S.D. in B).