Supporting Information Biran et al. 10.1073/pnas.1119165109 SI Materials and Methods cycle, and fed a range of dry fish food and artemia twice daily. Data Mining, Phylogenetic Analysis, and Chromosomal Synteny. The Embryos were generated from natural crosses by breeding the putative Tac3 gene sequences were isolated from zebrafish using male/female pairs. a stepwise evolutionary strategy. First, a protein blast was run A fragment of zebrafish tac3a (Table S1) was cloned into using the mouse Tac2 protein (NP_033338.2) as input. The lowest pGEM-T easy vector. Antisense and sense riboprobes were syn- scoring sequence that still had the neurokinin signature of thesized (Dig RNA labeling kit; Roche Diagnostics) using SpeI or FxGLM (XP_001365310, Monodelphis domesitca) was used as NcoI linearized (respectively) plasmids as templates and whole- input for a genomic search against the platypus genome. One mount in situ hybridization was conducted according to ref. 6. region was found (ornAna1, Contig39139:6403–6445), which We used 0.6–0.8 g sexually mature zebrafish. Fish were first translated to GDMHDFFVGLMGKR. This sequence was used anesthetized with MS-222 (Sigma) and decapitated. Brains were as input to translated blast of fish DNA and EST sequences. removed and fixed with 4% (wt/vol) paraformaldehyde in PBS Several ESTs were found that were built into two consensus for 6 h at 4 °C and immersed in PBS containing 20% (wt/vol) contigs (tac3a and tac3b), aligning to two distinct regions in the sucrose and 30% (vol/vol) optimal cutting temperature (OCT) zebrafish genome (chr 23 and 6, respectively). The cDNAs were (Sakura) for about 24 h. Brains were then embedded in OCT, cloned based on the EST contigs, and the sequences have been frozen in liquid nitrogen, sectioned frontally at 12 μmon submitted to GenBank (tac3a: JN392856; tac3b: JN392857). a cryostat at −18 °C, and mounted onto Superfrost plus glass Because of the fact that these genes had more than one putative slides (Thermo Scientific). active peptide, and the difference in sequence between the To detect tac3a and tac3b mRNA, we prepared a specific di- mammalian and fish sequences, it was decided to isolate as many goxigenin (DIG)-labeled riboprobe for tac3a (position 122–360 fish and mammalian sequences as possible to be sure of the in GenBank accession no. JN392856), tac3b (position 17–246 in identification of orthology as opposed to paralogy. An additional GenBank accession no. JN392857). Probes were prepared using 27 fish tac genes were found, using the zebrafish protein as an DIG RNA labeling kit (SP6/T7; Roche). input to tblastn against the nucleotide and EST databases at the In situ hybridization was generally performed as described in ref. National Center for Biotechnology Information; 23 of the fish 7, with slight modifications. Briefly, sections were washed twice in fi and 4 of the non sh (alligator, frog, chicken, and pig) tacs were PBS, treated with 1 μg/mL protease K for 15 min at 37 °C, built from ESTs, and these have been submitted to GenBank postfixed with 4% paraformaldehyde in PBS for 15 min, and in- – with the following accession numbers BK008100 BK008126. cubated with 0.25% acetic anhydride in 0.1 M triethanolamine for The human TAC genes have several isoforms, the ones that 10 min. Then the sections were prehybridized at 58 °C for 1 h in didn’t cause species-specific gaps or extensions in preliminary × fi hybridization buffer containing 50% (vol/vol) formamide, 5 sa- alignments were chosen for the nal alignments and trees. The line sodium citrate (SSC), 0.12 M phosphate buffer (pH 7.4), 100 tac3ra and tac3rb sequences were cloned based on the predicted μg/mL tRNA. Slides were incubated at 58 °C overnight in the gene sequences in GenBank. The tac3rc was found in a genomic same solution containing 1 μg/mL denatured riboprobe. We used search, and once again, more sequences were then sought to diethyl pyrocarbonate-treated water for the preparation of all ensure proper classification of the receptors. Additional 19 fish solutions for treatment before hybridization. tac3 receptors were found, many with genomic predictions. The After hybridization, sections were washed twice with 50% genomic predictions were manually created, and 13 were im- formamide and 2× SSC followed by two washes of 2× SSC and proved and deposited in GenBank (accession nos.: BK008087– two washes of 0.5× SSC for 15 min each at 58 °C. Slides were BK008099). Phylogenetic analysis was performed using both immersed in DIG-1 (0.1 M Tris-HCl, 0.16 M NaCl, and 0.1% neighbor-joining (ClustalW 2.1) and maximum likelihood (Phy- lip 3.69, ProML (1) on the basis of alignments performed both by Tween 20) for 5 min, 1.5% (vol/vol) blocking reagent with DIG-1 ClustalW (2) and Muscle (3.8.31) (3). The topologies were the for 30 min, and DIG-1 for 15 min, and then incubated with an same in all combinations of multiple alignment and tree con- alkaline phosphatase-conjugated anti-DIG antibody (diluted struction programs. Bootstrapping of 1,000 was performed on 1:1,000 with DIG-1; Roche) for at least 2 h. Sections were the neighbor-joining and of 100 on the maximum-likelihood washed with DIG-1 twice for 15 min each, and DIG-3 (0.1 M trees. Trees were visualized with FigTree 1.3.1 (4). Synteny was Tris-HCl, pH 9.5; 0.1 M NaCl; 0.05 M MgCl2) for 5 min. Sec- observed using the University of California at Santa Cruz ge- tions were then treated with a chromogenic substrate NBT/BCIP nome browser and the following genome builds: human: hg19 stock solution (Roche) diluted 1:250 (vol/vol) in DIG-3 until (5); zebrafish: Zv9/danRer7; medaka: oryLat2; Tetraodon: tet- a visible signal was detected. Sections were immersed in a re- Nig2; Fugu: fr2. action stop solution (10 mM Tris-HCl, pH8.0; 1 mM EDTA, pH8.0) to stop the chromogenic reaction. Sections were then In Situ Hybridization Analysis of Embryos and Adults. Adult wild-type dehydrated, covered using ClearMount Mounting Solution (In- zebrafish were maintained at 27–28 °C on a 14 h:10 h (light:dark) vitrogen) and examined using light microscopy. 1. Felsenstein J (2005) PHYLIP (Phylogeny Inference Package) version 3.6. (Distributed by 5. Kent WJ, et al. (2002) The human genome browser at UCSC. Genome Res 12:996–1006. the author, Department of Genome Sciences) (University of Washington, Seattle, WA). 6. Palevitch O, et al. (2007) Ontogeny of the GnRH systems in zebrafish brain: In situ 2. Larkin MA, et al. (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23: hybridization and promoter-reporter expression analyses in intact animals. Cell Tissue 2947–2948. Res 327:313–322. 3. Edgar RC (2004) MUSCLE: Multiple sequence alignment with high accuracy and high 7. Mitani Y, Kanda S, Akazome Y, Zempo B, Oka Y (2010) Hypothalamic Kiss1 but not throughput. Nucleic Acids Res 32:1792–1797. Kiss2 neurons are involved in estrogen feedback in medaka (Oryzias latipes). 4. Rambaut A (2007) FigTree, a graphical viewer of phylogenetic trees. Available at: Endocrinology 151:1751–1759. http://tree.bio.ed.ac.uk/software/figtree/. Accessed July, 2011. Biran et al. www.pnas.org/cgi/content/short/1119165109 1of9 A 1 ccctgtctctgtgtcttgtctgatagatagtccatcacaaaaggatt 107 taactctccaagcagaaactggaactgagctcttttctacagatctacatcctcagctca 167 gagtaatctgtaaagatgtaccgtggacttgtgttactgttcttggttttggtgctggaa M Y R G L V L L F L V L V L E 15 247 actcgatggagtgagtcgagctgtcagcagtcagagtctcaaagatcagtttcaagcgag T R W S E S S C Q Q S E S Q R S V S S E 35 307 agtccaagttttcggatgtcgactcataacttgctgaagaggtataatgacatagattat S P S F R M S T H N L L K R Y N D I D Y 55 367 gacagtttcgtcggattaatggggcgcagaaacgccgaaacagatgatataccaccccaa D S F V G L M G R R N A E T D D I P P Q 75 427 cgtaaaagggaaatgcacgatatctttgttggactcatgggtcgacgaagcgctgaacct R K R E M H D I F V G L M G R R S A E P 95 487 gaatccggacgtcaatggaggaaagagtacccagaaccaagcggaggaatcttcttcaac E S G R Q W R K E Y P E P S G G I F F N 115 547 aaatgcaaactgaggtttcgtcgtgggttatag K C K L R F R R G L - 125 B 1 ctgaacagcatcctgttaacaccagctcatacgagtacttggataaggtgtgcgaggatg M 1 61 tcctgcggctggctgctcgcgctgctcgtccacgtgctgctgctgctcgcgtgcccgaga S C G W L L A L L V H V L L L L A C P R 21 121 ctctcgcggagcgccctcgactactccttcactgacaacagcgacgcccagccggagcgc L S R S A L D Y S F T D N S D A Q P E R 41 181 tacgacaaacgatatgatgatattgattacgacagtttcgtcggcctgatgggcaggagg Y D K R Y D D I D Y D S F V G L M G R R 61 241 agcacaggaataaatcgtgaggcacatttgccatttagaccgaatatgaatgacatcttt S T G I N R E A H L P F R P N M N D I F 81 301 gtcggactgttaggacggagaaacactttgtcgtctatgagaaaagaaaggagagggaac V G L L G R R N T L S S M R K E R R G N 101 361 attttcttcaaggatggaagactgaggttttgctgtggtgtatga I F F K D G R L R F C C G V - 115 Fig. S1. Nucleotide and deduced amino acid sequences of the zebrafish tac3a (A) and tac3b (B). Numbering of the deduced amino acid sequences begins with the first methionine of the ORF to the right of each line. Nucleotide numbers are to the left of each line. The start and stop codons are shaded in gray, signal peptide amino acids are underlined (as defined by SignalP program analysis http://www.cbs.dtu.dk/services/SignalP/), and the putative secreted peptides are underlined (nucleotides) and bold (amino acids). These sequences have been deposited in the GenBank nucleotide database under accession numbers JN392856 and JN392857, respectively.