The E3 Ligase Thin Controls Homeostatic Plasticity Through Neurotransmitter Release Repression

bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

The E3 ligase Thin controls homeostatic plasticity through neurotransmitter release repression

Martin Baccino-Calace1,2, Katharina Schmidt1 & Martin Müller1,2,3

1Department of Molecular Life Sciences, University of Zurich, Winterthurerstrasse 190, 8057 Zurich, Switzerland 2Zurich Ph.D. Program in Molecular Life Sciences, Winterthurerstrasse 190, 8057 Zurich, Switzerland 3Neuroscience Center Zurich, University of Zurich/ETH Zurich, Zurich, 8057 Zurich, Switzerland

ABSTRACT

Synaptic proteins and synaptic transmission are under homeostatic control, but the relationship between these two processes remains enigmatic. Here, we systematically investigated the role of E3 ligases, key regulators of protein degradation-mediated proteostasis, in presynaptic homeostatic plasticity (PHP). An electrophysiology-based genetic screen of 157 E3 ligase-encoding genes at the Drosophila neuromuscular junction identified thin, an ortholog of human tripartite motif-containing 32 (TRIM32), a gene implicated in several neural disorders, including Autism Spectrum Disorder and schizophrenia. We demonstrate that thin functions presynaptically during rapid and sustained PHP. Presynaptic thin negatively regulates neurotransmitter release under baseline conditions by limiting the number of release-ready vesicles, independent of gross morphological defects. We provide genetic evidence that thin controls release through dysbindin, a schizophrenia-susceptibility gene required for PHP. Thin and Dysbindin localize in close proximity within presynaptic boutons, and Thin degrades Dysbindin in vitro. Thus, the E3 ligase Thin links protein degradation-dependent proteostasis of Dysbindin to homeostatic regulation of neurotransmitter release.

INTRODUCTION homeostatic plasticity’, PHP) 2,4,5, or neurotransmitter receptors (synaptic Nervous system function is remarkably scaling) 6. Several studies have robust despite continuous turnover of established links between homeostatic the proteins determining neural control of synaptic transmission and function. Work in nervous systems of neural disease, such as Autism various species has established that Spectrum Disorder 7, schizophrenia 8, or evolutionarily conserved homeostatic Amyotrophic Lateral Sclerosis 9,10. singling systems maintain neural Synaptic proteins are continuously activity within adaptive ranges 1-3. synthesized and degraded, resulting in Chemical synapses evolved half-lives ranging from hours to weeks mechanisms that compensate for 11. The Ubiquitin-Proteasome System neural activity perturbations through (UPS) is a major protein degradation homeostatic regulation of pathway that controls protein neurotransmitter release (‘presynaptic homeostasis, or proteostasis. E3

1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

ubiquitin ligases confer specificity to the synthesis is not required for PHP. By UPS by catalyzing the ubiquitination of contrast, acute or sustained disruption specific target proteins, thereby of the presynaptic proteasome blocks regulating their function or targeting PHP 24, demonstrating that presynaptic them for proteasomal degradation 12. UPS-mediated proteostasis is required Synaptic proteostasis, and E3 ligases in for PHP. Furthermore, genetic data link particular, have been implicated in UPS-mediated degradation of two various neural disorders 13. However, proteins, Dysbindin and RIM, to PHP 24. our understanding of the role of E3 Yet, it is currently unclear how the UPS ligases in the regulation of synaptic controls PHP. Based on the critical role transmission is very limited. While of E3 ligases in UPS function, we several E3 ligases have been linked to hypothesized an involvement of E3 postsynaptic forms of synaptic plasticity ligases in PHP. 14, only three E3 ligases, Scrapper 15, Here, we realized an highwire 16 and Ariadne-1 17 have been electrophysiology-based genetic screen implicated in the regulation of to systematically analyse the role of E3 presynaptic function. Moreover, a ligases in neurotransmitter release systematic investigation of E3 ligase regulation and PHP at the Drosophila function in the context of synaptic NMJ. This screen discovered that the transmission is lacking. E3 ligase-encoding gene thin, an PHP stabilizes synaptic efficacy ortholog of human TRIM32 25,26, in response to neurotransmitter controls neurotransmitter release and receptor perturbation at neuromuscular PHP. We provide evidence that thin junctions (NMJs) of Drosophila regulates the number of release-ready melanogaster 2,4,5, mice 18, rats 19, and synaptic vesicles through dysbindin, a humans 20. Furthermore, there is recent gene linked to PHP in Drosophila and evidence for PHP in the mouse schizophrenia in humans. cerebellum 21. The molecular mechanisms underlying PHP are best RESULTS understood at the Drosophila NMJ 2, because this system is amenable to An electrophysiology-based genetic electrophysiology-based genetic screen identifies thin screens 2,22,23. At this synapse, To systematically test the role of E3 pharmacological or genetic impairment ligases in PHP, we first generated a list of glutamate receptor activity triggers a of genes predicted to encode E3 ligases retrograde signal that enhances in D. melanogaster (Figure 1A). To this presynaptic release, thereby precisely end, we browsed the D. melanogaster compensating for this perturbation 4,5. genome for known E3-ligase domains PHP can be induced within minutes 27,28. Moreover, we included homologs after pharmacological receptor of predicted vertebrate E3-ligases (see impairment 5. Severing the motoneuron Figure S1). This approach yielded 281 axons forming the Drosophila NMJ in putative E3 ligase-encoding genes close vicinity of the synapse does not (Figure 1A), significantly higher than impair PHP 5, indicating that the previously predicted for D. mechanisms underlying PHP act locally melanogaster (207 genes, 27). To at the synapse. Moreover, explore the relationship between the pharmacological inhibition of protein number of E3 ligase-encoding genes synthesis by cyclohexamide does not and genome size, we plotted the affect PHP at the Drosophila NMJ 5, number of putative E3 ligase-encoding suggesting that de novo protein

2 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Figure 1. An electrophysiology-based genetic screen identifies thin as a synaptic homeostasis mutant

Figure 1. An electrophysiology-based A H. sapiens genetic screen identifies thin as a synaptic E3 homeostasis mutant. 600 PK A) Number of putative E3 ligase-encoding genes (E3) and protein kinase-encoding genes D. melanogaster (PK) as a function of total protein-coding gene number of C. cerevisiae, D. melanogaster, and 300 H. sapiens. Note the similar relationship Gene # Gene S. cerevisiae between E3 number, PK number and total protein-coding gene number across species. B)

# of protein coding protein genes of # Top: 157 E3 ligase encoding genes and 11 0 0 10000 20000 associated genes (180 lines; presynaptic RNAi c155 expression, elav > UAS-RNAi, or mutants) Total protein coding gene # were tested using two-electrode voltage clamp analysis at the Drosophila NMJ in the presence

B 157 E3 ligase-encoding genes Electrophysiological of the glutamate receptor antagonist PhTX-433 (Presynaptic RNAi or mutants) PHP analysis (‘PhTX’) to assess PHP (see Methods). Bottom: Exemplary mEPSPs and AP-evoked EPSCs WT WT + PhTX PHP mutant + PhTX recorded from WT controls, WT in the presence

mEPSP 1 mV of PhTX (‘WT + PhTX’), and a PHP mutant in 4 s the presence of PhTX (‘PHP mutant + PhTX’). 50 nA EPSC 10 ms Note the decrease in mEPSP amplitude after PhTX treatment, indicating GluR inhibition, and the similar EPSC amplitude between WT and WT+PhTx WT + PhTX, suggesting PHP. Small EPSC

CDWT+ PhTX WT WT+ PhTX amplitudes in the presence of PhTX imply a 10 20 WT + PhTX + PhTX defect in PHP or baseline synaptic transmission. 5 10 C) Histogram of mean mEPSP amplitudes for # of lines of # # of lines of # each transgenic or mutant line (mean n=4, 0 0 0 0.5 1.0 0 100 200 range 3-12; N=180 lines) following PhTX mEPSP (mV) EPSC (nA) treatment. The wild-type (WT) averages under control conditions (‘WT’ n=16) and in the presence of PhTX (‘WT + PhTX’, n=16) are E 6 shown as gray and black arrows, respectively. D) Histogram of mean EPSC amplitudes (as in

A C). The red bars indicate transgenic or mutant thin lines with EPSC amplitudes significantly 4 different to the WT control in the presence of PhTX. E) Volcano plot of the ratio between the mean EPSC amplitude of a transgenic or mutant

log10(p-value) 2 line and WT (‘EPSCx/EPSCWT’) in the presence of PhTX (p values from one-way ANOVA with Tukey's multiple comparisons). Transgenic or mutant lines with mean EPSC amplitude 0 changes with p≤0.01 (dashed line) are shown in 2 1 0 1 2 red. A deletion in the gene thin (CG15105; ΔA log2(EPSCX/EPSCWT) thin ; LaBeau-DiMenna et al., 2012) that was selected for further analysis is shown as a filled red circle. One-way ANOVA with Tukey's multiple comparisons was performed for statistical testing (C, D, E).

genes over the total protein-coding number of E3 ligase-encoding genes gene number of three species, and and genome size across species compared it to the relationship between (~0.02-0.03; Figure 1A; 28), suggests an protein kinase-encoding genes and evolutionarily conserved stoichiometry genome size (Figure 1A). The relatively between E3 ligases and target proteins, constant ratio between the predicted similar to protein kinases (Figure 1A).

3 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Hence, a core mechanism of the UPS – compared to PhTX-treated WT NMJs, protein ubiquitination – is likely and two lines with increased EPSC conserved in D. melanogaster. amplitudes (Figure 1D, E, red data). After prioritizing for These represent candidate mutations evolutionarily-conserved genes that that may disrupt PHP. One of the were shown or predicted to be mutant lines with significantly smaller expressed in the nervous system EPSC amplitudes in the presence of (Figure S1), we investigated PHP after PhTX was a previously described genetic perturbation of 157 putative E3 deletion of the gene thin (CG15105, ligase genes and 11 associated genes thinΔA; 25) (Figure 1E, filled red data). (180 lines, Table S1, Figure 1B). This gene was selected for further Specifically, we recorded spontaneous analysis. mEPSPs and AP-evoked EPSCs after applying sub-saturating concentrations Presynaptic thin promotes rapid PHP of the glutamate receptor (GluR) expression antagonist PhTX-433 (PhTX) for 10 In the genetic screen, we compared minutes (20 µM; extracellular Ca2+ synaptic transmission between a given concentration, 1.5 mM). At WT NMJs, genotype and WT controls in the PhTX treatment significantly reduced presence of PhTX (Figure 1C-E). mEPSP amplitude compared to Hence, the small EPSC amplitude of untreated controls (Figure 1C, black and thinΔA mutants seen after PhTX gray arrow), indicating GluR application could be either due to perturbation. By contrast, AP-evoked impaired PHP, or a defect in baseline EPSC amplitudes were similar between synaptic transmission. To distinguish PhTX-treated and untreated WT NMJs between these possibilities, we next (Figure 1D, black and gray arrow). quantified synaptic transmission in the Together with a reduction in mEPSP absence and presence of PhTX in thinΔA amplitude, a similar EPSC amplitude mutants (Figure 2). Similar to WT suggests a homeostatic increase in controls, PhTX application significantly neurotransmitter release after PhTX reduced mEPSC amplitude by ~40% in treatment, consistent with PHP 5. PhTX thinΔA mutants (Figure 2A, B), also reduced mean mEPSP amplitudes suggesting similar receptor impairment. in the 180 transgenic or mutant lines At WT synapses, EPSC amplitudes (either presynaptic/neural RNAi were similar in the absence and expression, elavc155-Gal4 > UAS-RNAi; presence of PhTX (Figure 2A and C). In or mutations within the respective combination with the decrease in coding sequence, see Methods) mEPSC amplitude (Figure 2B), PhTX compared to untreated WT controls incubation increased quantal content (Figure 1C). Moreover, the mean EPSC (EPSC amplitude/mEPSC amplitude) in amplitude of the majority of the tested WT (Figure 2D), indicating homeostatic lines did not differ significantly from the release potentiation. By contrast, PhTX mean WT EPSC recorded at PhTX- treatment significantly reduced EPSC treated NMJs (Figure 1D, white bars). amplitudes in thinΔA mutants (Figure 2A, The combination of a decrease in C) and did not increase quantal content mEPSP amplitude and largely (Figure 2D). These data indicate that unchanged EPSC amplitude indicates thinΔA is required for acute PHP that the majority of the tested lines likely expression. display PHP. We also identified 21 transgenic or mutant lines with significantly smaller EPSC amplitudes

4 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Figure 2. Homeostatic plasticity requires presynaptic thin

A WT + PhTX thinA + PhTX

50nA 1nA 2s 10ms

thinA pre. rescue + PhTX thinA post. rescue + PhTX

B C DE *** ** n.s.*** n.s. *** n.s. *** n.s. 200 1.2 *** ****** *** 200 ***** *** 200 ***

0.6 100 100 100 (% of WT) of (% EPSC (nA) EPSC mEPSC (nA)mEPSC 0 0 0 0 Quantal Content Quantal PhTX + + + + + + + + Content Quantal untreated) of (% + + + + A A A A WT WT WT WT thin thin thin thin pre. res. pre. res.post. res. pre. res.post. res. pre. res.post. res. post. res.

Figure 2. Homeostatic plasticity requires presynaptic thin. A) Representative EPSCs (individual sweeps and averages are shown in light colors and black, respectively), and mEPSCs (insets) of WT (gray), thinΔA mutants (red), presynaptic thin expression (elavC155-Gal4 > UAS-thin, ‘thinΔA pre rescue’, blue), and postsynaptic thin expression (24B-Gal4 > UAS-thin, ‘thinΔA post rescue’, green) in the thinΔA mutant background in the absence and presence of PhTX (‘+ PhTX’, darker colors). Stimulation artifacts were blanked for clarity. Note the decreased EPSC amplitudes at PhTX-treated thinΔA mutant NMJs and thinΔA post rescue NMJs, indicating impaired PHP. B – E) Mean mEPSC amplitudes (B), EPSC amplitudes (C), quantal content after PhTX treatment normalized to the respective untreated control, in the absence (‘–’) and presence (‘+’) of PhTX (D), and baseline quantal content of the indicated genotypes in the absence (‘–’) of PhTX normalized to WT (E). Note that PhTX did not enhance quantal content in thinΔA mutants, indicating impaired PHP. Also note the increased quantal content under baseline conditions in thinΔA mutants, suggesting increased release. Both phenotypes are restored upon presynaptic thin expression in the mutant background. Mean ± s.e.m.; n≥23 NMJs; *p < 0.05; **p < 0.001; ***p < 0.0001; n.s.: not significant; two-way ANOVA followed by Tukey's post hoc test (B, C, D) and one- way ANOVA with Tukey's multiple comparisons (E).

To test if presynaptic or (‘presynaptic rescue’ or ‘pre. rescue’; postsynaptic thinΔA promotes PHP, we Figure 2A, C, blue data), PhTX assessed PHP after presynaptic or application significantly reduced EPSC postsynaptic expression of a thin amplitudes after postynaptic thin transgene in the thinΔA mutant expression in the thinΔA mutant background. PhTX treatment background (‘postsynaptic rescue’ or significantly reduced mEPSC ‘post. rescue’; Figure 2A, C, green amplitudes after neural/presynaptic data). Together with the decrease in (elavc155-Gal4) or postsynaptic (24B- mEPSC amplitude, presynaptic, but not Gal4) expression of thin (UAS-thin) in postsynaptic thin expression thinΔA mutants (Figure 2A, B). While significantly enhanced quantal content EPSC amplitudes were similar in the in the thinΔA mutant background (Figure absence and presence of PhTX after 2D). Thus, presynaptic, but not presynaptic thin expression postsynaptic thin expression restores

5 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

PHP in the thinΔA mutant background, postsynaptic thin expression (Figure implying a presynaptic role for thin in 2E). These data are consistent with the PHP. idea that presynaptic thin represses We also noted a decrease in release under baseline conditions (see mEPSC amplitude in thinΔA mutants Figure 4, 7). By extension, the compared to WT in the absence of increased release under baseline PhTX (Figure 2A, B), which is most conditions in thinΔA mutants may likely due to impaired muscle occlude PHP in response to receptor architecture in thinΔA mutants 25,26. perturbation (see Discussion). Postsynaptic, but not presynaptic thin expression, significantly increased thin promotes sustained PHP mEPSC amplitudes towards WT levels expression in the thinΔA mutant background (Figure PHP is not only expressed after acute 2A, B), suggesting that postsynaptic thin pharmacological receptor perturbation, is required for normal mEPSC but also upon sustained genetic amplitude levels. Furthermore, thinΔA receptor impairment. At the Drosophila mutants displayed a significant increase NMJ, genetic ablation of the GluRIIA in quantal content compared to WT subunit in GluRIIASP16 mutants reduces under baseline conditions in the quantal size and induces sustained absence of PhTX (Figure 2E), which PHP 4. To test if thin is required for was F rescuedigure 3. S ust byaine presynaptic,d homeostasis butis impai notred in thinsustained mutants PHP expression, we

A A WT GluRIIASP16 thin thinA, GluRIIASP16

1nA 50nA 2s 10ms

n.s. * B C *** D *** * 1.5 *** ** 200 t 300 -

) - - - - en -*** - ) (nA

1.0 (nA 200 Cont C C

S 100 al S P

0.5 P 100 E mE uant 0 0 Q 0 16 A 16 16 A 16 16 A 16 P P P P P P WT S S WT S S WT S S IA thin IA IA thin IA IA thin IA luRI luRI luRI luRI luRI luRI G G G G G G A , A , A ,

thin thin thin

Figure 3. Sustained homeostasis is impaired in thin mutants. A) Representative EPSCs (individual sweeps and averages are shown in light colors and black, respectively), and mEPSCs (insets) of WT (gray), GluRIIASP16 mutants (dark gray), thinΔA mutants (red), and thinΔA, GluRIIASP16 double mutants (dark red). Stimulation artifacts were blanked for clarity. B – D) Mean mEPSC amplitudes (B), EPSC amplitudes (C), and quantal content (D) of the indicated genotypes. Note that there is no quantal content increase in thinΔA, GluRIIASP16 compared to thinΔA, indicating impaired PHP. Mean ± s.e.m.; n≥13 NMJs; *p < 0.05; **p < 0.001; ***p < 0.0001; n.s.: not significant; Two-way ANOVA followed by Tukey's post hoc test.

6 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

generated recombinant flies carrying significantly smaller EPSC amplitudes the GluRIIASP16 and the thinΔA mutation than in thinΔA mutants (Figure 3A, C). (‘GluRIIASP16, thinΔA’). GluRIIASP16 Hence, thin is also necessary for mutant NMJs displayed a strong sustained PHP expression, providing decrease in mEPSC amplitude independent evidence for its role in compared to WT (by ~50%; Figure 3A, homeostatic release regulation. B), which was accompanied by a significant increase in quantal content thin negatively regulates release- (Figure 3D) that restored EPSC ready vesicle number amplitudes towards WT levels (Figure Having established that thin is essential 3A, C), in line with previous work 4. By for acute and sustained PHP, we next contrast, while mEPSC amplitudes explored the role of thin in the regulation were decreased by ~40% in of neurotransmitter release under GluRIIASP16, thinΔA double mutants with baseline conditions. thinΔA mutants regard to thinΔA mutants (Figure 3A, B), display increased neurotransmitter there was no increase in quantal release in the absence of PhTX, and content in GluRIIASP16, thinΔA double this increase in release is rescued by mutantsFigure 4. (Figure thin negatively 3D), regulates resulting release-ready in vesiclepresynaptic number thin expression (Figure 2).

A B C D WT thinRNAi 1.5 300 300 n.s. *** *** 1.0 1nA 150 150

2s 0.5 EPSC (nA) EPSC

50nA (nA) mEPSC 10ms 0 0 Content Quantal 0 WT RNAi WT RNAi WT RNAi thin thin thin

E WT thinRNAi F G 3000 0.2 *** 50nA n.s. 0.1s 3 3 9.0 x10 9.0 x10 1500 0.1

4.5 4.5 size RRP 1.3 1.7

0 0 0 probability Release 0 0 20 40 60 0 20 40 60

Cum. EPSC (nA)EPSC Cum. RNAi RNAi Stimulus # Stimulus # WT WT thin thin

Figure 4. thin negatively regulates release-ready vesicle number. A) Representative EPSCs (individual sweeps and averages are shown in light colors and black, respectively), and mEPSCs (insets) of WT (gray) and presynaptic thinRNAi (elavC155-Gal4 > UAS- thinRNAi, red). B – D) Mean mEPSC amplitudes (B), EPSC amplitudes (C), and quantal content (D) of the indicated genotypes. E) Representative EPSC train (60 Hz, 60 stimuli, top) and cumulative EPSC amplitudes (‘cum. EPSC’, bottom) of WT and presynaptic thinRNAi. F, G) Mean readily- releasable vesicle pool (RRP) size (cum. EPSC/mEPSC) (F), and release probability (EPSC/cum. EPSC) (G) of the indicated genotypes. Note the increase in EPSC amplitude and RRP size in presynaptic thinRNAi. Mean ± s.e.m.; n≥22 NMJs; *p < 0.05; **p < 0.001; ***p < 0.0001; ns: not significant; Student’s t-test.

7 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

To elucidate the mechanisms through development. To test this possibility, we which thin negatively modulatesrelease, investigated NMJ morphology in thin we probed the size of the readily- mutants (Figure 5). We confined the releasable pool of synaptic vesicles morphological analysis to NMJs lacking (RRP) and neurotransmitter release thin presynaptically (thinΔA; probability (pr) after presynaptic thin 24BGal4>UAS-thin; henceforth called perturbation (Figure 4). As the ‘presynaptic thinΔA mutant’; Figure 5B), decreased mEPSC amplitude in thinΔA because ubiquitous loss of thin impairs mutants may confound conclusions muscle development 25,26. regarding presynaptic thin function Immunostainings with an antibody (Figure 2), we focused our further detecting neuronal membrane (anti- analyses on the effects of presynaptic horseradish peroxidase, ‘HRP’; 31) thinRNAi expression (Figure 4). revealed a slight, but significant Presynaptic thinRNAi expression increase in HRP area in presynaptic (elavc155-Gal4 > UAS-thinRNAi) thinΔA mutants compared to WT (Figure significantly increased EPSC 5C), indicating a slight increase in NMJ amplitudes (Figure 4A, C), with no size. Analysis of the active zone marker significant effects on mEPSC Bruchpilot (anti-Bruchpilot, ‘Brp’; 32) amplitudes compared to controls uncovered a significant increase in Brp (elavc155-Gal4/+; Figure 4A, B), puncta number per NMJ (Figure 5D), a suggesting that presynaptic thin slight increase in Brp density (Figure represses release, consistent with the 5E), as well as a decrease in Brp data obtained from thinΔA mutants intensity (Figure 5F) in presynaptic (Figure 2). thinΔA mutants. In principle, these Next, we estimated RRP size morphological changes could be related using cumulative EPSC amplitude to the PHP defect or release analysis during high-frequency enhancement seen in thinΔA mutants. stimulation (60 Hz; 29,30) (Figure 4E). However, postsynaptic thin expression This analysis revealed a significantly in WT induced similar morphological larger RRP size upon presynaptic alterations compared to thin thinRNAi expression compared to overexpression in thinΔA mutants controls (Figure 4E, F), implying that (presynaptic thinΔA mutants) (Figure presynaptic thin negatively regulates S2), but neither impaired PHP nor RRP size. We then estimated pr based enhanced release (Figure S2). These on the ratio between the first EPSC data suggest that the morphological amplitude of the stimulus train and the changes seen in presynaptic thinΔA cumulative EPSC amplitude and mutants are caused by postsynaptic thin ΔA observed no significant pr differences expression rather than the thin between thinRNAi and controls (Figure mutation, and that these morphological 4G). Thus, thin represses release by alterations do not block PHP or enhance limiting the number of release-ready release. Together, we conclude that the synaptic vesicles with largely PHP defect and the increase in baseline unchanged pr. synaptic transmission in thin mutants are unlikely caused by major changes in Altered NMJ development unlikely NMJ development. causes PHP defect in thin mutants The PHP defect and the release enhancement under baseline conditions after presynaptic thin perturbation may arise from impaired synaptic

8 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Figure 5. Altered NMJ development unlikely causes PHP defect in thin mutants

WT presynaptic thinA mutant Figure 5. Altered NMJ A B development unlikely causes PHP defect in thin mutants. A) Maximum intensity projection of a WT NMJ, and B) an NMJ lacking thin presynaptically (thinΔA; 24B-Gal4>UAS-thin or ‘thinΔA pre.’ stained against the Drosophila neuronal membrane marker anti-HRP (‘HRP’) and the HRP active-zone marker Bruchpilot (‘Brp’); scale bar, overview, 10 µm; inset, 5 µm. C – F) Mean HRP area (‘HRP area’, C), Brp puncta number per NMJ (‘Brp rp

B puncta #’, D), Brp puncta number/HRP area per NMJ (‘Brp puncta density’, E), Brp puncta fluorescence intensity (‘Brp puncta intensity’, F). Loss of e presynaptic thin induces a slight,

merg but significant increase in the total number of brp puncta. Mean ± s.e.m.; n≥10 NMJs; *p < 0.05; C 800 DE800 1.2 * F300 **p < 0.001; ***p < 0.0001; ns: not

) n.s. ) 2 * ) 2 #

* - **

U. significant; Student’s t-test. a a . a µm

( 0.8 (A (µm nct nct nct y

400 400 y 150 pu pu pu area

rp 0.4 rp rp ensit B B B densit int HRP 00 0 0

A pre. A pre. A pre. A pre. WT WT WT WT

thin thin thin thin

Thin localizes in close proximity to localizes in close proximity to synaptic Dysbindin and promotes Dysbindin vesicle markers 22 (Figure S3). The degradation localization of fluorescently-tagged Trim32, Thin’s human ortholog, Dysbindin likely overlaps with the one of ubiquitinates Dysbindin and targets it for endogenous Dysbindin, as its degradation 33. dysbindin, in turn, is presynaptic expression rescues the required for PHP at the Drosophila NMJ PHP defect in dysbindin mutants 22. The 22, and genetic evidence suggests that strong anti-Thin staining of Drosophila the UPS controls Dysbindin under muscles makes it difficult to distinguish baseline conditions and during PHP 24. between presynaptic and postsynaptic We therefore explored the relationship Thin 25. This prompted us to analyse the between Thin and Dysbindin. First, we localization of fluorescently-tagged investigated the localization of Thin in Thin, which we expressed relation to Dysbindin within synaptic presynaptically (elavC155-Gal4 > UAS- boutons (Figure 6A). Previous studies thinmcherry). Presynaptic Thinmcherry suggest very low endogenous partially overlapped with fluorescently- Dysbindin levels that preclude direct tagged Dysbindin at confocal resolution immunohistochemical analysis at the (elavC155-Gal4 > UAS-dysbvenus; Figure Drosophila NMJ 22,24. However, 6A, B). The localization of fluorescently- presynaptic expression of a tagged Thin also likely overlaps with fluorescently-tagged dysbindin endogenous Thin, because presynaptic transgene revealed that Dysbindin thin expression restores PHP and

9 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Figure 6. Thin localizes in close proximity to Dysbindin and promotes Dysbindin degradation. A) Confocal maximum intensity projection of a representative NMJ branch (muscle 6-7) after presynaptic co-expression (elavc155-Gal4) of venus-tagged Dysbindin (UAS-dysbvenus, ‘Dysb’, green) and mCherry-tagged Thin (UAS-thinmcherry, ‘Thin’, magenta). B) Single plane of the synaptic bouton highlighted by the yellow square in (A) with corresponding line profile (right). The yellow line demarks the location of the line profile. C) gSTED image of the synaptic bouton shown in (B) with corresponding line profile (right). Note the partial overlap between Thin and Dysbindin at confocal and STED resolution. D) Confocal images (single planes) of Drosophila S2 cells stained with anti- Dysbindin (green) and anti-Thin (magenta) under control conditions (top row) and after dysbindin overexpression (UAS-dysbvenus, bottom row). Note the concomitant redistribution of Dysbindin and Thin upon dysbindin overexpression. E) Representative Western blot of S2 cells transfected with UAS-dysbvenus and different levels of UAS-thin. F) Quantification of (E, n=5). Note the decrease in Thin levels upon dysbindin overexpression. Scale bar (A: 5µm), (B, C: 2µm), (D: 5µm).

synaptic transmission in thin mutants spots that partially overlapped (Figure (Figure 2). As indicated by the line 6C). Based on the close proximity profile across a bouton (Figure 6B), between Dysbindin and synaptic vesicle Dysbindin and Thin fluorescence markers 22, these data indicate that a intensity increased toward the bouton fraction of Thin localizes in the close periphery (Figure 6B), similar to vicinity of Dysbindin and synaptic synaptic vesicle markers, such as vesicles. synapsin (Figure S3B). At STED Previous work in cultured human resolution, fluorescently-tagged Thin cells showed that Dysbindin and Dysbindin appeared as distinct ubiquitination by Thin’s human ortholog

10 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Trim32 induces Dysbindin degradation content (Figure 7D) in the dysb1 mutant 33. To test if this function is conserved in background. These data provide Drosophila, we used cultured genetic evidence that thin negatively Drosophila S2 cells. First, we probed controls release through dysbindin the relationship between Thin and (Figure 7E). Dysbindin localization. Interestingly, while anti-Thin fluorescence was DISCUSSION homogenously distributed within S2 cells under control conditions (Figure Employing an electrophysiology-based 6D, top), dysbindin (dysbvenus) genetic screen targeting 157 E3 ligase- overexpression led to a redistribution of encoding genes at the Drosophila NMJ, anti-Thin fluorescence into clusters that we discovered that a mutation in the E3 localized in close proximity to Dysbindin ligase-encoding gene thin disrupts clusters (Figure 6D, bottom), acute and sustained PHP. Presynaptic suggesting a possible interaction loss of thin led to increased release and between Thin and Dysbindin. RRP size, largely independent of gross Next, we assessed whether Thin synaptic morphological changes. Thin expression affects Dysbindin and Dysbindin localize in close abundance in S2 cells by Western blot proximity within synaptic boutons, and analysis. We observed a decrease in biochemical evidence suggests that Dysbvenus levels upon co-expression of Thin degrades Dysbindin in vitro. increasing Thinmcherry levels (Figure 6E, Finally, presynaptic thin perturbation F). Together, these data are consistent did not enhance release in with the idea that Thin acts as an E3 the dysbindin mutant background, ligase for Dysbindin in Drosophila, providing genetic evidence similar to Trim32 in humans 33. that thin represses release through dysbindin. thin represses release through As thin and dysbindin are dysbindin required for PHP, these data are We next explored a possible genetic consistent with a model in interaction between thin and dysbindin which thin controls neurotransmitter in the context of synaptic physiology. As release during PHP and under baseline thin and dysbindin mutants alone conditions through dysbindin (Figure disrupt PHP, the analysis of double 7E, F). mutants would not be informative. We Our study represents the first therefore investigated baseline synaptic systematic investigation of E3 ligase transmission after presynaptic thinRNAi function in the context of synaptic expression in the dysbindin mutant transmission. A considerable fraction of background (Figure 7). Neither lines tested (11%) displayed a decrease presynaptic thinRNAi expression in EPSC amplitude after PhTX (elavc155-Gal4 > UAS-thinRNAi) in the WT treatment (Figure 1C-E). These E3 background, nor in the dysb1 mutant ligase-encoding genes may either be background affected mEPSC amplitude required for PHP and/or baseline (Figure 7A, B). While presynaptic synaptic transmission. Previous PHP thinRNAi expression enhanced EPSC screens in the same system identified amplitude and quantal content in the PHP mutants with a success rate of WT background (Figure 7C, D; see also ~3% 22,23. Thus, our data indicate that Figure 4), presynaptic thinRNAi E3 ligase function either plays a special expression did not change EPSC role in PHP and/or baseline synaptic amplitude (Figure 7C) or quantal transmission. As more transgenic or

11 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Figure 7. thin represses release through dysbindin

A WT +thinRNAi (pre) dysb1 +thinRNAi (pre)

1nA 1s 50nA 10ms

BC D E

1.5 .s.n .s.n 300 latn tnetnoC 300 n.s. n.s. thin )An( CSPE *** *** 1.0

150 150 dysb

0.5

auQ mEPSC (nA) mEPSC 0 0 0 rel. thinRNAi + + + + + + WT dysb1 WT dysb1 WT dysb1

F 26S 26S Ub Thin Dysb Thin Dysb Dysb GluR GluR perturbation

PRE blocked GluR

Retrograde signaling

SNARE proteins POST

Figure 7. thin represses release through dysbindin. A) Representative EPSCs (individual sweeps and averages are shown in light colors and black, respectively), and mEPSCs (insets) of WT (gray) and presynaptic thinRNAi (elavC155-Gal4 > UAS- thinRNAi, dark gray), dysb1 mutants (light red), and presynaptic thinRNAi in the dysb1 mutant background (elavC155-Gal4 > UAS- thinRNAi, dark red) . B – D) Mean mEPSC amplitudes (B), EPSC amplitudes (C), and quantal content (D) of the indicated genotypes. Note that presynaptic thinRNAi expression increases EPSC amplitude and quantal content in WT, but not in dysb1 mutants. Mean ± s.e.m.; n≥13 cells; *p < 0.05; **p < 0.001; ***p < 0.0001; ns: not significant; two-way ANOVA followed by Tukey's post hoc test. E) Working model: Our genetic data support a model in which thin controls neurotransmitter release (‘rel.’) through negative regulation of dysbindin. F) Emerging model: Left: Under baseline conditions, Thin ubiquitinates (‘Ub’) Dysbindin (‘Dysb’) and targets it for degradation by the 26S proteasome (‘26S’). Right: GluR perturbation (red GluRs) induces retrograde PHP signaling (green arrow), which decreases Thin-dependent Dysb degradation through an unknown pathway, thereby increasing Dysb levels and presynaptic release (green synaptic vesicle). Based on previous data, Dysbindin likely increases release by interacting with the SNARE complex through snapin and SNAP-25 (see Discussion).

mutant lines exhibited a decrease in Previous studies linked E3 synaptic transmission, we conclude that ligases to synaptic development and the net effect of E3 ligases is to promote synaptic function at the Drosophila NMJ synaptic transmission at 34,35. For instance, the E3 ligase the Drosophila NMJ. Given the highwire (hiw) restrains synaptic growth evolutionary conservation of most E3 and promotes evoked synaptic ligases tested in this study (Figure 1, transmission at the Drosophila NMJ 34. Table S1), the results of our screen Similarly, the deubiquitinating protease likely allow predicting the role of the fat facets represses synaptic growth tested E3 ligases in neurotransmitter and enhances synaptic transmission 36. release regulation in other systems. Although different molecular pathways

12 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

have been implicated in hiw-dependent been implicated in repressing regulation of synaptic growth and neurotransmitter release, such as the function 16, it is generally difficult to SNARE-interacting protein tomosyn disentangle effects on synaptic 39,40, or the RhoGAP crossveinless-c 41. morphology from synaptic function. thin How could the E3 ligase Thin oppose and its mammalian ortholog Trim32 are neurotransmitter release? We required for maintaining the discovered that dysbindin is required for cytoarchitecture of muscle cells 25,37,38. the increase in release induced by Hence, the changes in synaptic presynaptic thin perturbation (Figure 7). transmission described in the present Moreover, we revealed that Thin study may be a secondary localizes in close proximity to Dysbindin consequence of impaired muscle in synaptic boutons (Figure 6), and that structure. However, presynaptic thin Thin degrades Dysbindin in vitro (Figure expression in the thin mutant 6), similar to its mammalian ortholog background restored synaptic function Trim32 33. At the Drosophila NMJ, 26S- under baseline conditions and during proteasomes are transported homeostatic plasticity (Figure 2). to presynaptic boutons 42, where they Conversely, while postsynaptic thin degrade proteins on the minute time expression largely rescued the defects scale 24,43. Previous genetic data in muscle morphology in thin mutants, suggest a positive correlation between the defects in synaptic function Dysbindin levels and neurotransmitter persisted. These genetic data suggest release 22,24, and there is genetic that the impairment of baseline synaptic evidence for rapid, UPS-dependent transmission and homeostatic plasticity degradation of Dysbindin at the in thin mutants is unlikely caused by Drosophila NMJ 24. In combination with muscular dystrophy. We also noted a these previous observations, our data slight increase in Brp number at are consistent with the idea that Thin presynaptic thin mutant NMJs (Figure opposes release by acting on 5), indicating increased active-zone Dysbindin. Although the low abundance number. In principle, this increase in of endogenous Dysbindin at the active-zone number may underlie the Drosophila NMJ precludes direct increase in neurotransmitter release analysis of Dysbindin levels 22, we after presynaptic loss of thin. However, speculate that Thin decreases postsynaptic thin overexpression Dysbindin abundance by targeting it for increased Brp number in WT, but did degradation. Alternatively, Thin may neither affect baseline synaptic modulate Dysbindin function through transmission, nor PHP (Figure S2). mono-ubiquitination. Genetic data Hence, our results suggest that suggest that Dysbindin interacts with presynaptic thin regulates the SNARE protein SNAP25 through neurotransmitter release under baseline Snapin 44. Hence, Thin-dependent conditions and during homeostatic regulation of Dysbindin may modulate plasticity largely independent of release via Dysbindin’s interaction with changes in synaptic morphology. the SNARE complex. We revealed that presynaptic Our study revealed a crucial role thin perturbation results in enhanced for thin in PHP. How does the increase neurotransmitter release (Figure 2, 4, in neurotransmitter release in thin 7), indicating that the E3 ligase Thin mutants under baseline conditions represses neurotransmitter release relate to the PHP defect? The relative under baseline conditions. Notably, increase in release during PHP of WT there are just a few molecules that have synapses exceeds the increase in

13 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

release in thin mutants under baseline links between Trim32-dependent conditions. Thus, although we cannot control of synaptic homeostasis and exclude that PHP is solely occluded by these disorders in the future. enhanced baseline release in thin mutants, we consider this scenario METHODS unlikely. PHP is blocked by acute pharmacological, or prolonged genetic Fly stocks and genetics proteasome perturbation at Drosophila Drosophila stocks were maintained at NMJ 24. Moreover, PHP at this synapse 21°C – 25°C on normal food. The w1118 requires dysbindin 22, and genetic data strain was used as the wild-type (WT) suggest UPS-dependent control of a control. GluRIIASP16 mutants 4 and Dysbindin-sensitive vesicle pool during dysbindin1 mutants 22 were a kind gift PHP 24. Based on our finding that thin is from Graeme Davis’ lab. thinΔA mutants required for acute and sustained PHP and UAS-abba transgenic flies, now expression (Figures 2 and 3), and the referred to as UAS-thin 25, were a links between thin und dysbindin in the generous gift from Erika Geisbrecht. For context of release modulation outlined pan-neuronal expression, the elavc155- above, we propose a model in which Gal4 (on the X chromosome) driver line Thin-dependent ubiquitination of was used and analysis was restricted to Dysbindin is decreased during PHP male larvae. For expression in muscle (Figure 7F). Given the positive cells, the 24B-Gal4 driver line was used. correlation between Dysbindin levels Both driver lines were obtained from the and release 24,44, the resulting increase Bloomington Drosophila Stock Center in Dysbindin abundance would (Bloomington, IN, USA). Standard potentiate release. Further work is second and third chromosome balancer needed to test how Thin is regulated lines (Bloomington) and genetic during PHP. Thin is the first E3 ubiquitin strategies were used for all crosses and ligase linked to homeostatic regulation for maintaining the mutant lines. For the of neurotransmitter release. generation of transgenic flies carrying Interestingly, a recent study revealed a UAS-thin::mcherry, constructs based on postsynaptic role for Insomniac, a the pUAST-attB vector backbone were putative adaptor of the Cullin-3 ubiquitin injected into the ZP-attP-86Fb fly line ligase complex, in PHP at the harboring a landing site on the third Drosophila NMJ 45, suggesting a key chromosome according to standard function of the UPS in both synaptic procedures 52. compartments during PHP at this synapse. Cell culture and transfection Trim32, the human ortholog of Schneider S2 cells were cultivated in thin, is required for synaptic down- standard Schneider’s Drosophila scaling in cultured hippocampal rat medium (GibcoTM) containing 10% fetal neurons 46, as well as long-term calf serum and 5% potentiation in hippocampal mouse Penicilin/Streptomycin at 25 °C. For slices 47, implying a broader role of this immunohistochemistry and microscopy E3 ubiquitin ligase in synaptic plasticity. cells, were plated on cover slips in 12 Trim32 has been implicated in various well plates with 80% density and neurological disorders, such as transfected with 1.5 μg (total) vector depression 48, Alzheimer’s Disease 49, DNA using FuGENE® HD Transfection Autism Spectrum Disorder 48,50, or Reagent according to the standard attention deficit hyperactivity disorder 51. protocol. Vectors used were: pMT-Gal4 It will be exciting to explore potential (Addgene), pUAS-thin-mCherry and

14 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

pUAS-venus-dysbindin (Dion Dickman). dissection (see 5). AP-evoked EPSCs 24 h after plating, CuSO4 (0.5 mM) was were induced by stimulating hemi- added to the culture for 24 h to induce segmental nerves with single APs (0.3 the expression of the pMT vector driving ms stimulus duration, 0.3 Hz), and Gal4, which in turn drives transcription recorded with a combination of a HS-9A of UAS constructs. x10 and a HS-9A x0.1 headstage (Molecular Devices) in two-electrode Plasmid construction voltage clamp (TEVC) mode. mEPSPs All plasmids were generated by and mEPSCs were recorded with one or standard restriction enzyme ligation. two HS-9A x0.1 headstage(s) For the pUAS_attB_mCherry_thin (Molecular Devices), respectively. vector, mCherry was cloned into Muscle cells were clamped to a pUAS_attB (Addgene) via EcoRI/NotI membrane potential of −65 mV for using the following primers EPSCs and −100 mV for mEPSCs to (fw: 5’- increase the signal-to-noise ratio. A total ctcggcgcgccaATGGTGAGCAAGGGC of 50 EPSCs were averaged to obtain GAGGAG-3', the mean EPSC amplitude for each rev: 5’- NMJ. RRP size was calculated by the cgcggtaccttaCTTGTACAGCTCGTCCA method of cumulative EPSC amplitudes TGCCGC-3’). 53. NMJs were stimulated with 60-Hz thin was amplified from Drosophila trains (60 stimuli, 5 trains per cell), and cDNA by PCR using the following the cumulative EPSC amplitude was primers obtained by back-extrapolating a linear (fw : fit to the last 15 cumulative EPSC CGGAATTCATGGAGCAATTCGAGCA amplitude values of the 60-Hz train to GCTGTTGACG, time zero. rev: CGTCTAGAATGAAGACTTGGACGC Immunohistochemistry and GGTGATTCTCTCG) and then cloned microscopy into the pUAS-attB-mcherry vector via Drosophila NMJ: Third-instar larval NotI/XbaI. preparations were fixed for 3 min with Correct cloning was confirmed by Bouin’s fixative (100%, Sigma-Aldrich, sequencing of all final vectors. HT-10132) for confocal microscopy, or 100% ice-cold Ethanol for 10 min for Electrophysiology STED microscopy. Preparations were Electrophysiological recordings were washed thoroughly with PBS containing made from third-instar larvae at the 0.1% Triton X-100. After washing, wandering stage. Larvae were preparations were blocked with 3% dissected and sharp-electrode normal goat serum in PBS containing recordings were made from muscle 6 in 0.1% Triton X-100. Incubation with the abdominal segments 3 and 4 using an primary antibody was done at 4 °C on a Axoclamp 900A amplifier (Molecular rotating platform overnight. Devices). The extracellular HL3 saline The following antibodies and contained (in mM): 70 NaCl, 5 KCl, 10 dilutions were used for NMJ stainings: MgCl2, 10 Na-Hepes, 115 sucrose, 5 (Primary) anti-Bruchpilot (nc82, mouse, trehalose, 5 HEPES, 1.5 CaCl2. To DSHB, AB_2314866, 1:100), anti-GFP induce PHP, larvae were incubated with (rabbit, Thermo Fisher Scientific, 20 μM PhTX-433 (Cat # sc-255421, G10362, 1:500), anti-GFP (mouse, Santa Cruz Biotechnology) for 10 min at Thermo Fisher Scientific, A-11120, room temperature after partial 1:500), anti-DsRed (rabbit, Clontech,

15 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

sc-390909, 1:500), anti-SYNORF1 University of Zurich Center for (Synapsin, 3C11, mouse, DSHB, Microscopy and Image Analysis. AB_528479, 1:250), anti-HRP Alexa- Excitation light (580nm or 640nm) of a Fluor 647 (goat, Jackson flexible white light laser was focused ImmunoResearch 123–605–021, onto the specimen using a 100x 1:200). For confocal microscopy Alexa- objective (HC PL APO 1.40 NA Oil Fluor anti-mouse 488 (Thermo Fisher STED WHITE; Leica Microsystems, Scientific; 1:500) and Alexa Fluor anti- Germany) with immersion oil guinea pig 555 (Thermo Fisher conforming to ISO 8036 with a Scientific; 1:400) were applied overnight diffraction index of n=1.5180 (Leica at 4°C on a rotating platform. For Microsystems, Germany). For gSTED gSTED microscopy (Figure 6,S3) the imaging, the flexible white light laser following secondary antibodies (1:100) was combined with a 775 nm STED were applied for 2 h at room depletion laser. Emitted light was temperature on a rotating platform: Atto detected with two HyD detectors in 594 (anti-mouse, Sigma-Aldrich, 76085) photon counting mode (Leica and Abberior STAR 635 P (anti-rabbit, Microsystems, Germany). Pixel size Abberior, 53399). Experimental groups was 20 x 20 nm and z-stacks were of a given experiment were processed acquired with a step size of 120 nm. For in parallel in the same tube. STED imaging, we used time-gated Preparations were mounted onto slides single photon detection (empirical with ProLong Gold (Life Technologies, adjustment within a fluorescence P36930). lifetime interval from 0.7 to 6.0 ns). Pixel S2 cell culture: S2 cells grown on size was 20 x 20 nm and z-stacks were coverslips were washed with PBST acquired with a step size of 120 or 130 (PBS + 0.1% TritonX-100) and fixed nm. Line accumulation was set to 1 and with 10% PFA for 10 min. After washing 6 for confocal and STED imaging, three times with PBST, preparations respectively. Images were acquired with were blocked with 5% normal goat LAS X software (Leica Application Suite serum in PBST for 30 min. Incubation X, version 2.0; Leica Microsystems, with primary antibody was done at RT Germany). Experimental groups were on a rotating platform for 2 h. The imaged side-by-side with identical following antibodies were used for S2 settings. cell stainings: anti-thin (guineapig, gift Images were processed and from Erika R. Geisbrecht, 1:200), anti- deconvolved with Huygens Professional dysbindin (mouse, gift from Dion (Huygens compute engine 17.04, Dickman, 1:400). After washing three Scientific Volume Imaging B.V., times with PBST, cells were incubated Netherlands). In brief, the “automatic with secondary antibodies Alexa Fluor background detection” tool anti-guinea pig 555 and Alexa Fluor (radius=0.7µm), and the "auto stabilize" anti-mouse 488 (Thermo Fisher feature were used to correct for Scientific; 1:400) at RT on a rotating background and lateral drift. Images platform for 2 h. Cover slips were were deconvolved using the Good's mounted onto slides with ProLong Gold roughness Maximum Likelihood (Life Technologies, P36930) after three algorithm with default parameter PBST washes. settings (maximum iterations: 10; signal Confocal and gSTED microscopy: to noise ratio: 7 for STED and 15 for Images were acquired with an inverse confocal; quality threshold: 0.003). Leica TCS SP8 STED 3X microscope (Leica Microsystems, Germany) of the

16 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Western blot mEPSCs were detected using an Transfected cells in 12-well-plates were implementation of a template-matching washed with PBS and lysed by adding algorithm 55. 50 µl of RIPA buffer (50 mM Tris, pH Microscopy images were 8.0, 150 mM NaCl, 1% Nonidet P-40, analysed using custom-written routines 0.5% deoxycholate, 0.1% SDS, 0.2 mM in ImageJ (version 1.51n, National sodium vanadate, 10 mM NaF, 0.4 mM Institutes of Health, USA). Brp EDTA, 10% glycerol) containing quantification was performed as follows: protease inhibitors (cOmplete™, Mini, First, individual Brp puncta were EDTA-free Protease Inhibitor Cocktail, isolated by segmenting binary Sigma) for 30 min on ice. The lysates fluorescence intensity threshold masks were sonified three times for 1 min and (15% or 35% of the maximum intensity boiled for 5 min in SDS-sample buffer value) of background corrected (rolling containing 5% ß-Mercaptoethanol. ball, radius = 1 μm) and filtered (3 x 3 Samples were separated on acrylamide median) maximum intensity projection gels using SDS-PAGE, then transferred images. The number of Brp objects in to nitrocellulose membranes the mask served as a proxy for AZ (Amersham Hibond GE healthcare). number, and was normalized to the area After blocking in 5% milk in PBST, of the HRP mask (binary mask, 15% or membranes were incubated in the 35% of the maximum intensity value). following primary antibodies: anti-GFP Average Brp-intensity values were (rabbit, Thermo Fisher Scientific, calculated for each Brp punctum from G10362; 1:500), anti-DsRed (rabbit, background-corrected, unfiltered Clontech, sc-390909, 1:500) in blocking maximum intensity projection images. solution overnight. Horseradish Statistical analyses were done peroxidase–conjugated secondary Abs using RStudio Team (2021). RStudio: (anti-mouse-HRP and anti-rabbit-HRP Integrated Development Environment 1:2000 in blocking solution) were for R. RStudio, PBC, Boston, MA. For applied to membranes for 2 h. Detection more than two factors, we used two-way was performed using ECL Reagent (GE ANOVA followed by Tukey's post hoc Healthcare, Chicago, IL, USA). test to correct for multiple comparisons between genotypes and conditions. For Data analysis one factor with more than two groups, Electrophysiology data were acquired one-way ANOVA with Tukey's multiple with Clampex (Axon CNS, Molecular comparisons was performed. Two- Devices) and analysed with custom- sided Student’s t-tests or nonparametric written routines in Igor Pro Mann-Whitney U tests were used for (Wavemetrics). For the genetic screen comparison between two groups after a data, mEPSPs were detected with a Shapiro-Wilk test and a Levene’s test. template matching algorithm Statistical significance was set to 0.05 implemented in Neuromatic (Rothman (*), 0.01 (**) and 0.001 (***). Power & Silver, 2018) running in Igor Pro analysis was performed using the pwr- (Wavemetrics). The average mEPSP package of Rstudio to estimate the amplitude was calculated from all minimum sample size for a power above detected events in a recording after ≥0.8 and a significance level of 0.05 for visual inspection for false positives. For two-sided Student’s t tests or Mann- the rest of the data, mEPSC data were Whithiney U tests. Data are given as analysed using routines written with mean ± s.e.m. scientific python libraries, including Figures were assembled using numpy, scipy, IPython and neo 54, and GIMP (The GIMP team, 2.8.10,

17 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

www.gimp.org) and Inkscape (Inkscape (2006). project, 0.92.2. 4. Petersen, S. A., Fetter, R. D., http://www.inkscape.org). Noordermeer, J. N., Goodman, C. S. & DiAntonio, A. Genetic analysis Acknowledgement: We are grateful to of glutamate receptors in members of the Müller lab for helpful Drosophila reveals a retrograde discussions and critical comments on signal regulating presynaptic the manuscript. We thank Dr. Damian transmitter release. Neuron 19, Szklarczyk for help with STRING-based 1237–1248 (1997). protein-protein interaction analysis used 5. Frank, C. A., Kennedy, M. J., Goold, for prioritization of E3 ligases. C. P., Marek, K. W. & Davis, G. W. Mechanisms underlying the rapid Funding: This research was funded a induction and sustained expression Swiss National Science Foundation of synaptic homeostasis. Neuron Assistant Professor grant (PP00P3– 52, 663–677 (2006). 15), and an European Research Council 6. Turrigiano, G. G., Leslie, K. R., Starting grant (SynDegrade-679881) to Desai, N. S., Rutherford, L. C. & MM. Nelson, S. B. Activity-dependent scaling of quantal amplitude in Author Contributions: MB-C, KS and neocortical neurons. Nature 2012 MM conceptualized and designed 486:7401 391, 892–896 (1998). experiments. MB-C and KS conducted 7. Mullins, C., Fishell, G. & Tsien, R. research and analysed data. MB-C, KS W. Unifying Views of Autism and MM interpreted data. MM and MB- Spectrum Disorders: A C wrote the manuscript. Consideration of Autoregulatory Feedback Loops. Neuron 89, Competing Interests: The authors 1131–1156 (2016). declare no competing interests. 8. Dickman, D. & Wondolowski, J. Emerging links between Data Availability: All data needed to homeostatic synaptic plasticity and evaluate the conclusions in the paper neurological disease. Front. Cell. are present in the paper and the Neurosci. 7, (2013). Supplementary Materials and are 9. Orr, B. O. et al. Presynaptic available upon reasonable request. Homeostasis Opposes Disease Progression in Mouse Models of

ALS-Like Degeneration: Evidence REFERENCES for Homeostatic Neuroprotection. Neuron 107, 95–111.e6 (2020). 1. Turrigiano, G. G. The Self-Tuning Neuron: Synaptic Scaling of 10. Perry, S., Han, Y., Das, A. & Dickman, D. Homeostatic plasticity Excitatory Synapses. Cell 135, 422–435 (2008). can be induced and expressed to restore synaptic strength at 2. Delvendahl, I. & Müller, M. Homeostatic plasticity-a neuromuscular junctions undergoing ALS-related presynaptic perspective. Current Opinion in Neurobiology 54, 155– degeneration. Human Molecular Genetics 26, 4153–4167 (2017). 162 (2019). 3. Marder, E. & Goaillard, J.-M. 11. Cohen, L. D. et al. Metabolic turnover of synaptic proteins: Variability, compensation and homeostasis in neuron and kinetics, interdependencies and implications for synaptic network function. 7, 563–574

18 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

maintenance. PLoS ONE 8, Trautmann, A. & Uchitel, O. D. On e63191 (2013). the release of transmitter at 12. Zheng, N. & Shabek, N. Ubiquitin normal, myasthenia gravis and Ligases: Structure, Function, and myasthenic syndrome affected Regulation. human end-plates. J. Physiol. https://doi.org/10.1146/annurev- (Lond.) 299, 621–638 (1980). biochem-060815-014922 (2017). 21. Delvendahl, I., Kita, K. & Müller, M. doi:10.1146/annurev-biochem- Rapid and sustained homeostatic 060815-014922 control of presynaptic exocytosis at 13. George, A. J., Hoffiz, Y. C., a central synapse. Proc. Natl. Charles, A. J., Zhu, Y. & Mabb, A. Acad. Sci. U.S.A. 116, 23783– M. A Comprehensive Atlas of E3 23789 (2019). Ubiquitin Ligase Mutations in 22. Dickman, D. K. & Davis, G. W. The Neurological Disorders. Front. Schizophrenia Susceptibility Gene Genet. 9, (2018). dysbindin Controls Synaptic 14. Hegde, A. N. The ubiquitin- Homeostasis. Science 326, 1127– proteasome pathway and synaptic 1130 (2009). plasticity. Learn. Mem. 17, 314– 23. Müller, M., Pym, E. C. G., Tong, A. 327 (2010). & Davis, G. W. Rab3-GAP Controls 15. Yao, I. et al. SCRAPPER- the Progression of Synaptic dependent ubiquitination of active Homeostasis at a Late Stage of zone protein RIM1 regulates Vesicle Release. Neuron 69, 749– synaptic vesicle release. Cell 130, 762 (2011). 943–957 (2007). 24. Wentzel, C., Delvendahl, I., Sydlik, 16. Russo, A. et al. The E3 ligase S., Georgiev, O. & Müller, M. Highwire promotes synaptic Dysbindin links presynaptic transmission by targeting the NAD‐ proteasome function to synthesizing enzyme dNmnat. homeostatic recruitment of low EMBO reports 20, (2019). release probability vesicles. Nat 17. Ramirez, J. et al. The ubiquitin Commun 9, 267 (2018). ligase Ariadne-1 regulates 25. LaBeau-DiMenna, E. M. et al. Thin, neurotransmitter release via a Trim32 ortholog, is essential for ubiquitination of NSF. J. Biol. myofibril stability and is required for Chem. 100408 (2021). the integrity of the costamere in doi:10.1016/j.jbc.2021.100408 Drosophila. Proc. Natl. Acad. Sci. 18. Wang, X., Wang, Q., Engisch, K. L. U.S.A. 109, 17983–17988 (2012). & Rich, M. M. Activity-dependent 26. Domsch, K., Ezzeddine, N. & regulation of the binomial Nguyen, H. T. Abba is an essential parameters p and n at the mouse TRIM/RBCC protein to maintain neuromuscular junction in vivo. the integrity of sarcomeric Journal of Neurophysiology 104, cytoarchitecture. J Cell Sci 126, 2352–2358 (2010). 3314–3323 (2013). 19. Plomp, J. J., van Kempen, G. T. & 27. Du, J. et al. In Vivo RNAi Screen Molenaar, P. C. Adaptation of Reveals Neddylation Genes as quantal content to decreased Novel Regulators of Hedgehog postsynaptic sensitivity at single Signaling. PLoS ONE 6, e24168 endplates in alpha‐bungarotoxin‐ (2011). treated rats. J. Physiol. (Lond.) 28. Ketosugbo, K. F., Bushnell, H. L. & 458, 487–499 (1992). Johnson, R. I. A screen for E3 20. Cull-Candy, S. G., Miledi, R., ubiquitination ligases that

19 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

genetically interact with the adaptor mutated in limb girdle muscular protein Cindr during Drosophila dystrophy type 2H that binds to eye patterning. PLoS ONE 12, skeletal muscle myosin and e0187571 (2017). ubiquitinates actin. J Mol Biol 354, 29. Weyhersmüller, A., Hallermann, S., 413–424 (2005). Wagner, N. & Eilers, J. Rapid 38. Cijsouw, T. et al. Mapping the active zone remodeling during Proteome of the Synaptic Cleft synaptic plasticity. J. Neurosci. 31, through Proximity Labeling 6041–6052 (2011). Reveals New Cleft Proteins. 30. Müller, M., Liu, K. S. Y., Sigrist, S. Proteomes 6, 48 (2018). J. & Davis, G. W. RIM Controls 39. Chen, K., Richlitzki, A., Homeostatic Plasticity through Featherstone, D. E., Schwärzel, M. Modulation of the Readily- & Richmond, J. E. Tomosyn- Releasable Vesicle Pool. J. dependent regulation of synaptic Neurosci. 32, 16574–16585 transmission is required for a late (2012). phase of associative odor memory. 31. Jan, L. Y. & Jan, Y. N. Antibodies Proc. Natl. Acad. Sci. U.S.A. 108, to horseradish peroxidase as 18482–18487 (2011). specific neuronal markers in 40. Hatsuzawa, K., Lang, T., Drosophila and in grasshopper Fasshauer, D., Bruns, D. & Jahn, embryos. PNAS 79, 2700–2704 R. The R-SNARE motif of tomosyn (1982). forms SNARE core complexes with 32. Kittel, R. J. et al. Bruchpilot syntaxin 1 and SNAP-25 and promotes active zone assembly, down-regulates exocytosis. J. Biol. Ca2+ channel clustering, and Chem. 278, 31159–31166 (2003). vesicle release. Science 312, 41. Pilgram, G. S. K., Potikanond, S., 1051–1054 (2006). van der Plas, M. C., Fradkin, L. G. 33. Locke, M., Tinsley, C. L., Benson, & Noordermeer, J. N. The RhoGAP M. A. & Blake, D. J. TRIM32 is an crossveinless-c interacts with E3 ubiquitin ligase for dysbindin. Dystrophin and is required for Human Molecular Genetics 18, synaptic homeostasis at the 2344–2358 (2009). Drosophila neuromuscular junction. 34. Wan, H. I. et al. Highwire regulates J. Neurosci. 31, 492–500 (2011). synaptic growth in Drosophila. 42. Kreko-Pierce, T. & Eaton, B. A. Neuron 26, 313–329 (2000). The Drosophila LC8 homolog cut 35. van Roessel, P., Elliott, D. A., up specifies the axonal transport of Robinson, I. M., Prokop, A. & proteasomes. J Cell Sci 130, Brand, A. H. Independent 3388–3398 (2017). regulation of synaptic size and 43. Speese, S. D., Trotta, N., Rodesch, activity by the anaphase-promoting C. K., Aravamudan, B. & Broadie, complex. Cell 119, 707–718 K. The ubiquitin proteasome (2004). system acutely regulates 36. DiAntonio, A. et al. Ubiquitination- presynaptic protein turnover and dependent mechanisms regulate synaptic efficacy. Current Biology synaptic growth and function. 13, 899–910 (2003). Nature 2012 486:7401 412, 449– 44. Dickman, D. K., Tong, A. & Davis, 452 (2001). G. W. Snapin is Critical for 37. Kudryashova, E., Kudryashov, D., Presynaptic Homeostatic Plasticity. Kramerova, I. & Spencer, M. J. J. Neurosci. 32, 8716–8724 (2012). Trim32 is a ubiquitin ligase 45. Kikuma, K. et al. Cul3 and

20 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

insomniac are required for rapid 409 (1999). ubiquitination of postsynaptic 54. Garcia, S. et al. Neo: an object targets and retrograde homeostatic model for handling signaling. Nat Commun 10, 2998 electrophysiology data in multiple (2019). formats. Front. Neuroinform. 8, 46. Srinivasan, B., Samaddar, S., (2014). Mylavarapu, S. V. S., Clement, J. 55. Clement, J.D., Bekkers, J.M. P. & Banerjee, S. Homeostatic Detection of spontaneous synaptic scaling is driven by a translation- events with an optimally scaled dependent degradation axis that template. Biophysical Journal 73, recruits miRISC remodelling. 220–229 (1997). bioRxiv 2020.04.01.020164 (2020). 56. Larkin, A., Marygold, S. J., Acids, 47. Ntim, M. et al. TRIM32 Deficiency G. A. N.2021. FlyBase: updates to Impairs Synaptic Plasticity by the Drosophila melanogaster Excitatory-Inhibitory Imbalance via knowledge base. Notch Pathway. Cereb Cortex 30, academic.oup.com 4617–4632 (2020). doi:10.1093/nar/gkaa1026 48. Ruan, C.-S. et al. Deletion of 57. Li, W. et al. Genome-wide and TRIM32 protects mice from functional annotation of human E3 anxiety- and depression-like ubiquitin ligases identifies MULAN, behaviors under mild stress. a mitochondrial E3 that regulates European Journal of Neuroscience the organelle's dynamics and 40, 2680–2690 (2014). signaling. PLoS ONE 3, e1487 49. Yokota, T. et al. Brain site-specific (2008). gene expression analysis in 58. Hu, Y. et al. An integrative Alzheimer's disease patients. Eur J approach to ortholog prediction for Clin Invest 36, 820–830 (2006). disease-focused and other 50. Lionel, A. C. et al. Disruption of the functional studies. BMC ASTN2/TRIM32 locus at 9q33.1 is Bioinformatics 12, 357–16 (2011). a risk factor in males for autism 59. Celniker, S. E. et al. Unlocking the spectrum disorders, ADHD and secrets of the genome. Nature other neurodevelopmental 2012 486:7401 459, 927–930 phenotypes. Human Molecular (2009). Genetics 23, 2752–2768 (2014). 60. Chintapalli, V. R., Wang, J. & Dow, 51. Lionel, A. C. et al. Rare copy J. A. T. Using FlyAtlas to identify number variation discovery and better Drosophila melanogaster cross-disorder comparisons models of human disease. Nat. identify risk genes for ADHD. Sci Genet. 39, 715–720 (2007). Transl Med 3, 95ra75–95ra75 61. Mering, von, C. et al. STRING: (2011). known and predicted protein- 52. Bischof, J., Sheils, E. M., protein associations, integrated Björklund, M. & Basler, K. and transferred across organisms. Generation of a transgenic Nucleic Acids Res. 33, D433–7 ORFeome library in Drosophila. (2005). Nat Protoc 9, 1607–1620 (2014). 62. Pazos Obregón, F., Papalardo, C., 53. Schneggenburger, R., Meyer, A. C. Castro, S., Guerberoff, G. & & Neher, E. Released fraction and Cantera, R. Putative synaptic total size of a pool of immediately genes defined from a Drosophila available transmitter quanta at a whole body developmental calyx synapse. Neuron 23, 399– transcriptome by a machine

21 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448554; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

learning approach. BMC Genomics 16, 694 (2015). 63. Pazos Obregón, F. et al. An improved catalogue of putative synaptic genes defined exclusively by temporal transcription profiles through an ensemble machine learning approach. BMC Genomics 20, 1011–8 (2019).