RRIG1 Mediates Effects of Retinoic Acid Receptor Tumor Cell Growth

Research Article

RRIG1 Mediates Effects of Retinoic Acid Receptor B2 on Tumor Cell Growth and Gene Expression through Binding to and Inhibition of RhoA

Zheng D. Liang,1 Scott M. Lippman,1 Tsung-Teh Wu,2 Reuben Lotan,3 and Xiao-Chun Xu1

Departments of 1Clinical Cancer Prevention, 2Pathology, and 3Thoracic/Head and Neck Medical Oncology, The University of Texas M.D. Anderson Cancer Center, Houston, Texas

Abstract also resistant to RA-induced growth inhibition (4–6). Furthermore, h The expression of retinoic acid receptor B (RAR-B )is lung carcinoma cells expressing transfected RAR- 2 exhibited 2 2 decreased tumorigenicity in nude mice (7) and transgenic mice frequently lost in various cancers and their premalignant h h lesions. However,the restoration of RAR- B expression inhibits expressing antisense RAR- 2 developed lung cancer (8). RAR- 2 2 was also suppressed in breast cancer metastases in a mouse tumor cell growth and suppresses cancer development. To h understand the molecular mechanisms responsible for this xenograft model (9). Knocking out RAR- 2 by homologous recombination in F9 cells resulted in the loss of RA-associated RAR-B2-mediated antitumor activity,we did restriction fragment differential display-PCR and cloned a novel retinoid growth arrest and an altered cell morphology and differentiation potential (10). The induction of RAR-h expression inhibited the receptor–induced gene 1 (RRIG1),which is differentially 2 growth of various cancers, induced tumor cells to undergo apop- expressed in RAR-B2-positive and RAR-B2-negative tumor cells. RRIG1 tosis, and suppressed cancer development in vitro and in vivo (1, 2). cDNA contains 2,851 bp and encodes a protein with 276 h amino acids; the gene is localized at chromosome 9q34. In particular, the expression of RAR- 2 in esophageal cancer cells Expressed in a broad range of normal tissues, RRIG1 is also suppressed tumor cell growth and colony formation and induced lost in various cancer specimens. RRIG1 mediates the effect of apoptosis (11), which correlated with the suppression of the epidermal growth factor (EGF) receptor (EGFR), of the phosphor- RAR-B2 on cell growth and gene expression (e.g.,extracellular signal–regulated kinase 1/2 and cyclooxygenase-2). The RRIG1 ylation of extracellular signal–regulated kinases 1 and 2 (Erk1/2), and of the expression of activating protein 1 and cyclooxygenase-2 protein is expressed in the cell membrane and binds to a and inhibits the activity of a small GTPase RhoA. Whereas (COX-2; ref. 12). Furthermore, benzo[ ]pyrene diol epoxide, a carcinogen present in tobacco smoke and environmental pollution, induction of RRIG1 expression inhibits RhoA activation and suppressed RAR-h2 expression in a premalignant and different f-actin formation and consequently reduces colony formation, h invasion,and proliferation of esophageal cancer cells,anti- malignant esophageal cell lines (12, 13). Molecularly, RAR- 2 sense RRIG1 increases RhoA activity and f-actin formation and inhibited the EGFR/mitogen-activated protein kinase molecular pathway and COX-2 expression (11, 12). thus induces the colony formation,invasion,and proliferation h of these cells. Our findings therefore show a novel molecular Together, these studies show that RAR- 2 plays an important B role in the suppression of cancer development, suggesting that it is pathway involving RAR- 2 regulation of RRIG1 expression and h RRIG1-RhoA interaction. An understanding of this pathway a tumor suppressor gene and that loss of RAR- 2 expression alters the downstream signaling pathway of the gene. Although the may translate into better control of human cancer. (Cancer Res h 2006; 66(14): 7111-8) precise molecular mechanisms responsible for RAR- 2-mediated effects on antitumor activities are not well understood, several studies have investigated the possible role of RAR-h -targeting Introduction 2 genes (14–16). We have identified, through restriction fragment The altered expression of nuclear retinoid receptors has been differential display-PCR, several cDNA fragments of which the shown to correlate with malignant transformation of human cells. levels were different between RAR-h2-positive or RAR-h2-negative h h In particular, the loss of retinoic acid receptor 2 (RAR- 2) esophageal cancer cells. One fragment was matched to DNA expression has been shown to be the most common event in sequences at chromosome 9q34, which has shown frequent loss of different human cancers (1, 2). We and others have previously heterozygosity in human cancers (17–19). Using cDNA from this h shown that the presence of suppressed RAR- 2 expression in the fragment as a probe for in situ hybridization, we established that h in vivo early stages of carcinogenesis and the modulation of RAR- 2 normal esophageal mucosa expressed the mRNA of this fragment by retinoids can be used as biomarkers (1–3). Notably, however, but that esophageal cancer tissues lost such expression. We h RAR- 2 was not inducible by a pharmacologic level of RA in many therefore cloned the full-length cDNA and named it retinoid lung, breast, and esophageal cancer cell lines, and these cells were receptor–induced gene 1 (RRIG1). In the current study, we further characterize the RRIG1 gene and describe a novel pathway involving RRIG1-RhoA interaction. Note: The nucleotide sequences reported in this article have been submitted to the GenBank/European Molecular Biology Laboratory Data Bank with accession no. AY096240. Materials and Methods Requests for reprints: Xiao-Chun Xu, Department of Clinical Cancer Prevention, Unit 1360, The University of Texas M.D. Anderson Cancer Center, 1515 Holcombe Cell lines and culture. The esophageal squamous cancer cell lines TE-3, Boulevard, Houston, TX 77030. Phone: 713-745-2940; Fax: 713-563-5747; E-mail: xxu@ TE-7, and TE-8; their sublines TE3-A3, TE3-A5, TE8-S20, and TE8-S22; and mdanderson.org. I2006 American Association for Cancer Research. esophageal adenocarcinoma cell line SKGT-4 were available from our doi:10.1158/0008-5472.CAN-06-0812 previous studies (11–13). The breast cancer cell lines MCF-7, MDA453, and www.aacrjournals.org 7111 Cancer Res 2006; 66: (14). July 15, 2006

SK-BR3 were obtained from American Type Culture Collection (Manassas, Biomedicals, Costa Mesa, CA) to a specific activity of f1 Â 109 dpm/Ag VA). The lung cancer cell line Calu-1, colon cancer cell line DLD-1, and with a random primer labeling kit (Prime It II, Stratagene, La Jolla, CA), and prostate cancer cell line PC3 were from the laboratory of one of the authors the membranes were hybridized with RRIG1 or a GAPDH probe, as in our (R.L.). The normal esophageal cell line EEC, which was a generous gift from previous publications (5, 11–13). Dr. Yutaka Shimada (Department of Surgery and Surgical Basic Science, Transcription-translation assay and antibody generation. In vitro Graduate School of Medicine, Kyoto University, Kyoto, Japan), was available transcription-translation that used the open reading frame of RRIG1 cDNA from our previous study (20). was carried out with the TNT T7 coupled reticulocyte lysate system All cancer cell lines were plated in tissue-culture dishes and grown in (Promega) labeled with [35S]cysteine and the products were separated by DMEM with 10% FCS at 37jC in a humidified atmosphere of 95% air and 12% SDS-PAGE. The dried gels were subsequently analyzed with

5% CO2. The normal cells were grown in keratinocyte serum-free medium autoradiography. We then chose the CAADGLRKPQVHSARAL peptide as containing 2.5 Ag/mL EGF and 25 Ag/mL bovine pituitary extract at 37jCin an antigen to generate a polyclonal rabbit anti-RRIG1 antibody (Lampire a humidified atmosphere of 95% air and 5% CO2. For restriction fragment Biological Laboratories, Pipersville, PA). differential display-PCR, TE-8 cells were transiently transfected with a RAR- Protein extraction and Western blotting. Total cellular or nuclear h2 expression vector, followed by cell sorting to retain RAR-h2-positive cells. protein from the cell lines was isolated as previously described (11–13). A The pMark7/RAR-h2 vector, which was previously described (21), was First, 50 g of protein were subjected to electrophoresis in 12% SDS-PAGE. used for transfection, and an anti-CD7 antibody and MagnaBind goat anti- The proteins were then transferred electrophoretically to a Hybond-C mouse immunoglobulin G beads (both from Pierce Chemical Company, nitrocellulose membrane (GE-Amersham) at 300 mA for 2 hours at 4jC and Rockford, IL) were used for sorting. mRNAs from TE-8, TE8-S20 (a stable subjected to Western blotting with either an anti-RRIG1 antibody at a h h h RAR- 2-transfected TE-8 subline), and TE-8/RAR- 2 (TE-8 cells with dilution of 1:2,000 or an anti- -actin antibody (Sigma) following a standard h transient RAR- 2 transfection) cells were then subjected to restriction procedure. fragment differential display-PCR assay. Transient gene transfection. Esophageal cancer cell lines were Tissue specimens. Paraffin-embedded blocks of lung, breast, prostate, subcultured overnight and transiently transfected with 2 Agofa and pancreatic cancer tissues were obtained from the Pathology pcDNA3.1/RRIG1 sense or antisense expression vector and Cos-1 cells with Department of The University of Texas M.D. Anderson Cancer Center. pUSEamp containing activated, dominant-negative, or wild-type RhoA Eighty-four esophageal cancer specimens were available from our previous (Upstate, Lake Placid, NY) for 24 hours. The cells were then treated with study (22). These specimens included 66 distant normal squamous 200 Ag/mL G418 and/or hygromycin B (Roche, Indianapolis, IN) for 5 days mucosae. All samples were routinely fixed in 10% buffered formalin, to eliminate nontransfected cells. Thereafter, mRNA and protein were embedded in paraffin, and cut into 4-Am sections. One each of the four extracted from these cells and subjected to Northern and Western blotting sections was stained with H&E for classification. analyses, respectively. Restriction fragment differential display-PCR. RNA from TE-8, TE- RhoA activation assay. TE-8 and SKGT-4 cells were transfected with

8S20, and TE-8/RAR-h2 cells was isolated with TRI-reagent (Molecular pcDNA3.1 (control) or a pcDNA3.1/RRIG1 sense or antisense construct and Research Center, Cincinnati, OH). mRNA was further purified from the total then were treated with the antibiotic G418 for 5 days. After that, the cells RNA with the NucleoTrap mRNA kit (BD Clontech, Palo Alto, CA) according were detached with 0.05% trypsin, counted, reseeded, and cultured in new to the instructions of the manufacturer. Restriction fragment differential culture dishes in DMEM with 10% FCS for 16 hours and then in DMEM display-PCR was done with a display profile kit (BD Clontech) according to without FCS for an additional 12 hours. To activate the RhoA, we cultured the kit instructions. To recover the differential display cDNA fragments, we the cells in DMEM with 10% FCS for 3 hours; after which, the total cellular cut PCR bands from the gel and placed them into microtubes containing protein was extracted in an ice-cold lysis buffer containing 20 mmol/L Tris- 50 AL of Tris-EDTA buffer. After heating the tubes at 95jCfor HCl (pH 7.5), 10 mmol/L MgCl2, 150 mmol/L NaCl, 1 mmol/L Na2 EDTA, 15 minutes, cDNA from the PCR bands was reamplified with PCR and 1 mmol/L EGTA, 1% Triton X-100, 2.5 mmol/L sodium pyrophosphate, cloned into a pGEM5Zf(+) vector (Promega, Madison, WI). 1 mmol/L h-glycerophosphate, 1 mmol/L Na3VO4, and 1 Ag/mL leupeptin. In situ hybridization. A previously described method of nonradioactive The activated GTP-bound Rho protein in the cell lysates was pulled down in situ hybridization was used (5, 22). The plasmid pGEM5Zf(+) containing using a recombinant glutathione S-transferase (GST)–tagged rhotekin-Rho the RRIG1 cDNA fragment was linearized with the SacI restriction enzyme, binding domain (Upstate) and analyzed with Western blotting using an which generated a 1.3-kb fragment for labeling the riboprobes with anti-RhoA antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Levels of digoxigenin-UTP using T7 polymerase. We verified the binding quality and the activated RhoA protein were normalized with total RhoA from cell specificity of the digoxigenin-labeled antisense RNA probe using negative lysates not subjected to the pulldown assay. control sections. Chemoinvasion assay. The same transfected cells (5 Â 104) as for the Immunohistochemical analysis. The immunohistochemical localiza- RhoA activation assay were then resuspended in medium and put into tion of the RRIG1 and f-actin was done using a modified avidin-biotin Matrigel-coated Boyden chambers (BD Biosciences, Bedford, MA) in complex technique previously described (23), with a polyclonal anti-RRIG1 triplicate. The lower chamber was filled with 10% FCS as the chemo- antibody at a dilution of 1:800 and phalloidin-TRITC (Sigma Chemical Co., attractant and incubated for 22 hours. The cells on the upper surface were St. Louis, MO) at a concentration of 50 Ag/mL (24). then removed by wiping the surface with a cotton swab; the cells that had Review and scoring of sections. The stained sections were reviewed invaded the Matrigel and attached to the lower surface of the filter were and scored under an Olympus microscope. The sections were scored for fixed and stained with H&E. The Matrigel membranes were then gently positive or negative staining only; positive staining meant that z10% removed from the chamber, mounted onto glass slides, and photographed epithelial cells were stained (22, 23). Statistical analyses were done with the for four microscopic fields (Â100 magnification) per chamber. The cells on McNemar’s test to determine the association between normal tissues and the photomicrographs were counted and the results were summarized as h tumors and the Kendall test for the correlation of RAR- 2 and RRIG1 mean F SD and presented as the percentage of controls. expression. P values were generated using Statistica 4.01 software (StatSoft, Colony formation assay. TE-8 and SKGT-4 cells were transfected with a Tulsa, OK). pcDNA3.1 (control) or with a pcDNA3.1/RRIG1 sense or antisense construct Northern blotting. mRNA (2 Ag per lane) was fractionated on a 0.66 and then treated with G418 antibiotic for 5 days. The cells were detached mol/L formaldehyde and 1.2% agarose gel and then transferred overnight to with 0.05% trypsin and counted; 2,000 of the cells were resuspended in the a Hybond-N+ nylon membrane (GE-Amersham, Piscataway, NJ). RNA was medium with 0.35% agarose and were then placed into 6-well cell culture fixed to the membrane by UV cross-linking. In addition, a nylon membrane, plates with 0.5% agarose. The medium was refreshed every 3 days with G418 containing 1 Ag of mRNA each from different normal human tissues, was and the surviving cell colonies were counted 21 days later (5). obtained from BD Clontech. RRIG1 and glyceraldehyde-3-phosphate 5-Bromo-2¶-deoxyuridine incorporation assay. TE-8, TE8-V1, and dehydrogenase (GAPDH) cDNAs were labeled with [32P]dCTP (ICN TE8-S20 cells were grown in monolayers for 24 hours and transiently

Cancer Res 2006; 66: (14). July 15, 2006 7112 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 2006 American Association for Cancer Research. RRIG1, a Novel RAR-b2-Induced Gene transfected with either the pCMS/EGFP-RRIG1 expression vector or the breast cancers, 1 of 5 pancreatic cancers, and 43 of 84 (51.2%) pCMS/EGFP empty vector (BD Clontech) as a control for 36 hours; esophageal cancers (data not shown). However, 61 of 66 (92.4%) A ¶ 10 mol/L 5-bromo-2 -deoxyuridine (BrdUrd) was then added to the growth normal esophageal mucosae from the sectioned margin of the medium and the cells were cultured for an additional 4 to 8 hours. The cells esophageal cancer specimens expressed RRIG1 mRNA. This were fixed with 4% paraformaldehyde at room temperature for 10 minutes difference between normal and cancerous esophageal specimens to preserve the green fluorescent protein (GFP) and were permeabilized in P 1% Triton X-100 for 20 minutes at room temperature. The cells were then was statistically significant ( < 0.00001, McNemar’s test). subjected to BrdUrd immunostaining as previously described (23). After Furthermore, RRIG1 mRNA expression closely correlated with h h that, f200 cells were counted for positive staining of GFP and for positive RAR- 2 mRNA expression in RAR- 2-stained sections from our or negative BrdUrd staining. The percentage of inhibition of BrdUrd previous study (ref. 22; s = 0.45; SE, 0.07; P < 0.00005, Kendall’s test). incorporation was calculated using the following equation: % of inhibition = Cloning and characterization of RRIG1. RRIG1 was cloned 1 À (Nb / Ng) Â 100, where Nb is the number of BrdUrd-positive cells of the using a 3¶/5¶ rapid amplification of cDNA ends and confirmed by GFP-positive cells from RRIG1 transfected cultures and Ng is the number the primer extension assay (data not shown), of which the full- from control cultures. length cDNA included 1,947 bp in the 5¶-end untranslated region, 831 bp in the coding sequence, and 15 bp in the 3¶-end untranslated Results region; the corresponding RRIG1 protein had a predicted molecular Detection of RRIG1 expression and its correlation with mass of 28.67 kDa (Fig. 1). Northern blot analysis with RRIG1 cDNA RAR-B2 in tissue samples. To explore the underlying molecular used as a probe revealed that RRIG1 mRNA was expressed in h mechanisms for RAR- 2 antitumor activities, we did restriction normal human tissues, with the highest expression levels in the fragment differential display-PCR experiments on TE-8V1 (a brain, heart, muscle, and placenta and the lowest levels in the liver, vector-only–transfected TE-8 subline), TE-8S20 (a stable RAR-h2- spleen, lung, and leukocytes (Fig. 2A). However, RRIG1 mRNA and h h B trans transfected TE-8 subline), and TE-8/RAR- 2 (a transient RAR- 2- protein expression was lost in some tumor cells (Fig. 2 ). All- transfected TE-8 cell line) cells. We identified several cDNA RA, which can induce RAR-h2 expression in the TE-3 and TE-7 fragments of which the levels were differentially expressed between esophageal cancer cell lines (5), slightly increased RRIG1 mRNA h h a RAR- 2-positive and RAR- 2-negative esophageal cancer cells. One expression, whereas benzo[ ]pyrene diol epoxide, which can of the fragments matched DNA sequences at chromosome 9, which reduce RAR-h2 expression (12, 13), inhibited RRIG1 mRNA shows frequent loss of heterozygosity in human cancers (17–19). expression (Fig. 2C). However, all-trans RA could not induce in situ h h We therefore used cDNA from this fragment as a probe for RRIG1 expression in RAR- 2-negative TE-8 cells or stable RAR- 2- hybridization to analyze RRIG1 mRNA expression in formalin-fixed, transfected TE-8S20 or TE-8S22 cells (Fig. 2D). paraffin-embedded tissues from different cancers. RRIG1 mRNA To further characterize RRIG1, we did in vitro transcription- was detected in 1 of 5 lung cancers, 2 of 5 prostate cancers, 2 of 5 translation experiments (data not shown) and generated a

Figure 1. Sequence of RRIG1 cDNA. The underlined amino acid sequence was used to generate a rabbit anti-RRIG1 polyclonal antibody. Sequence analysis (PHD_htm program; European Molecular Biology Laboratory, Heidelberg, Germany) predicted the RRIG1 protein to have a transmembrane helix. Specifically, amino acid residues 1 to 179 faced the outside of the cell membrane, residues 180 to 197 laywithin the membrane, and residues 198 to 276 faced the cytoplasm.

www.aacrjournals.org 7113 Cancer Res 2006; 66: (14). July 15, 2006

polyclonal rabbit anti-RRIG1 antibody. Western blotting using Additionally, the NH2 terminus of the RRIG1 protein contains this antibody showed that expression of RRIG1 protein correlated two putative Src homology 3 (SH3) domain-binding motifs (i.e., well with RRIG1 mRNA, as shown by Northern blotting (Fig. 2B). 63-PRAPHPP-69 and 152-LPVLSSPPTP-161), both of which contain Furthermore, our findings from immunohistochemical analysis and PXXP (25). Immunohistochemical analysis using the anti-RRIG1 in situ hybridization also showed a good correlation between antibody showed that the RRIG1 protein is localized in the cell RRIG1 mRNA and protein (Fig. 3A). Therefore, we assessed RRIG1 membrane (Fig. 3A). Furthermore, after we stained intact and expression by doing an immunohistochemical analysis with this living esophageal cancer cells with the anti-RRIG1 antibody, our antibody in breast cancer tissue specimens and found that RRIG1 data showed that the RRIG1 protein was localized on the cell protein expression was significantly higher in normal mammary surface (Fig. 3B). Further support for the cell-surface localization of glands (10 of 10 cases) than in invasive breast cancer tissue [14 of RRIG1 was obtained by labeling cell-surface proteins on intact cells 30 (46.7%); P = 0.0023, Fisher’s exact test; data not shown]. with sulfo-NHS-LC-biotin, followed by immunoprecipitation with A GenBank search for the RRIG1 protein did not reveal an anti-RRIG1 antibody after cell membrane solubilization and homology to any existing proteins but instead predicted that analysis of immunoprecipitates on a SDS-PAGE. An avidin-biotin RRIG1 is a transmembrane protein with the NH2 terminus facing complex kit was then used to identify cell-surface biotinylated outward and the COOH terminus facing inward in the cells. proteins. The positive band revealed that the native size of the RRIG1 protein was f28.7 kDa (Fig. 3C). By comparing the RRIG1 cDNA with DNA sequences of chromosome 9 available in GenBank, we identified the intron- exon boundaries of the RRIG1 gene (Table 1) and found a direct repeat of 18 putative retinoic acid response element sites (AGGT- CAAAGTGGTTGGATCACCTGAGGTCA) 5,160 bp upstream of the RRIG1 cDNA. Further study is needed to determine whether this direct repeat site is a functional retinoic acid response element site. RRIG1,a downstream gene of RAR- B2. Because our data clearly indicated that RRIG1 expression was closely associated with RAR-h2 expression, we next determined whether the RRIG1 gene h mediates RAR- 2 effects on tumor cell growth and gene expression. In analyzing RRIG1 expression in stable RAR-h2-transfected esophageal cancer cell lines (11), we found that RAR-h2 induced RRIG1 expression and reduced Erk1/2 phosphorylation and COX-2 h expression, whereas antisense RAR- 2 reduced RRIG1 expression and increased Erk1/2 phosphorylation and COX-2 expression in monolayer cultures subjected to a physiologic level of RA (Fig. 4A) and in organotypic cultures and nude mice xenografts (data not shown). We further transiently transfected the sense or antisense RRIG1 expression vector into these stable RAR-h2-transfected h cancer cell lines. Our findings showed that the antisense RAR- 2- transfected TE-3 cell lines TE3-A3 and TE3-A5 down-regulated RRIG1 expression and up-regulated Erk1/2 phosphorylation and COX-2 expression, whereas transient transfection of the RRIG1 expression vector into these cell lines restored RRIG1 expression and suppressed Erk1/2 phosphorylation and COX-2 protein expression in monolayer cultures subjected to a physiologic level B C h of RA (Fig. 4 and ). In contrast, stable RAR- 2-transfected TE- 8 cells (i.e., TE8-S20 and TE8-S22 cells) induced RRIG1 expression but suppressed Erk1/2 phosphorylation and COX-2 expression, but antisense-RRIG1 transfection not only suppressed RRIG1 protein levels but also induced Erk1/2 phosphorylation and COX-2 Figure 2. Expression and modulation of RRIG1. A, tissue distribution of RRIG1 B C mRNA. A nylon membrane containing 1 Ag of mRNA from each different normal expression (Fig. 4 and ). In addition, transient RRIG1 antisense human tissue was subjected to Northern blotting according to the instructions of transfection into TE8-V1 and TE-8S22 cells showed that expression the manufacturer. B, expression of RRIG1 in human cancer cell lines of the of RAR-h2 reduced cell proliferation by 29% in a 40-hour culture esophagus (TE-8, TE-8S22, TE-7, and TE-1), lung (Calu-1), breast (MDA453), colon (DLD-1), and prostate (PC3) and in normal human esophageal epithelial between pCMS/EGFP vector-only–transfected TE8-V1 and TE-8S22 cells (EEC). mRNA from these cells was extracted and subjected to Northern blot cells but antisense RRIG1 transfection increased cell proliferation analysis with RRIG1 cDNA used as a probe. GAPDH was used as a loading by 25% between TE8-V1 and TE-8S22 cells, as shown by the per- control. In an analysis of the RRIG1 protein distribution, total protein from these same cell lines was extracted and subjected to Western blotting with the anti- centage of BrdUrd-positive cells among the vector-only– and anti- RRIG1 antibody. NS, nonspecific band. C, esophageal cancer TE-3 and TE-7 sense RRIG1–transfected cells. Taken together, these data clearly cells were treated with 1 Amol/L all-trans RA or 1 Amol/L benzo[a]pyrene diol h epoxide (BPDE) for 16 hours, and mRNA from these cells was then isolated and show that RRIG1 mediates the effects of RAR- 2 on tumor cell subjected to Northern blotting. C, control. D, stable RAR-h2-transfected growth and gene expressions, at least in esophageal cancer cells. esophageal cancer cell sublines TE-8S20 and TE-8S22 and vector-onlysubline RRIG1 binds to RhoA-GTP and suppresses its activity. To TE-8V1 were treated with or without 1 Amol/L all-trans RA for 24 hours; after which, the total cellular protein from these cells was extracted and subjected to identify RRIG1 protein binding partners, we expressed the GST- Western blotting. RRIG1 fusion protein in vitro and then did a GST pulldown assay.

Cancer Res 2006; 66: (14). July 15, 2006 7114 www.aacrjournals.org

Figure 3. Expression of RRIG1 mRNA and protein. A, paraffin-embedded sections of adjacent normal and cancerous esophageal specimens were subjected to in situ hybridization and immunohistochemical analysis with a digoxigenin-labeled RRIG1 cRNA probe or a polyclonal anti-RRIG1 antibody, respectively. The purple-blue and brown colors show positive staining for mRNA and protein, respectively. SCC, squamous cell carcinoma. B, immunofluorescent staining of intact and living cells using the anti-RRIG1 antibodyin negative (TE-8) and positive (TE-7) esophageal cancer cell lines. C, immunoprecipitation assay of biotinylated cell-surface proteins in negative (TE-8) and positive (TE-7) esophageal cancer cell lines. The cells were grown in monolayer for 5 days and then labeled with sulfo-NHS-LC-Biotin for cell-surface protein. The total cell lysate was then subjected to an immunoprecipitation assaywith anti-RRIG1 antibodyand to detection with a biotin-avidin complex and chemiluminescence solution.

Several possible RRIG1-binding partners were identified, which had with RRIG1 sense cDNA and SKGT-4 cells transfected with anti- molecular masses ranging from 20 to 100 kDa (data not shown). sense cDNA to chemoinvasion and colony formation assays. The We surmised that some of these proteins should be membrane restoration of RRIG1 expression reduced the number of colonies associated. Indeed, one of them was similar in size with the small resistant to the G418 antibiotic in TE-8 cell by 32%; in contrast, the GTPase proteins. Western blotting of the GST pulldown protein antisense RRIG1 construct increased the number of resistant with anti-RhoA antibody showed that this protein was RhoA bound colonies by 62% in SKGT-4 cells (Fig. 6A). Moreover, restoration of to RRIG1 (Fig. 5A). For further confirmation, we did an immuno- RRIG1 expression suppressed TE-8 cell invasion by 95% compared precipitation assay with an anti-RRIG1 antibody and then Western with control (vector-only–transfected) cells, whereas the RRIG1 blotting with an anti-RhoA antibody in total cell lysates of RRIG1- antisense construct increased SKGT-4 cell invasion by 176% h B positive and RAR- 2-negative breast cancer cells. The data (Fig. 6 ), which correlated with suppression or induction of RhoA obtained also showed that RRIG1 bound to RhoA (Fig. 5B). activation, respectively (Fig. 5D). Because the RhoA protein is a molecular switch and its active For additional evidence of the ability of RRIG1 to suppress tumor form (i.e., RhoA-GTP) is required for control of various cell cell growth, we transiently transfected the pCMS/EGFP-RRIG1 or functions (26–31), we next determined whether RRIG1 binds to the the pCMS/EGFP expression vector (a control) into TE-8 cells and GTP or GDP forms of RhoA protein and whether the binding of then treated them with BrdUrd, which was incorporated into the RRIG1 and RhoA changes RhoA activity. We first expressed the activated, dominant-negative, and wild-type forms of the RhoA protein in Cos-1 cells using the transient gene transfection assay. Table 1. Intron-exon junctions of the RRIG1 gene The Cos-1 cell lysates were pulled down with the GST-RRIG1 fusion protein and then subjected to Western blotting with anti-RhoA Intron Exon:intron Intron Intron:exon antibody. Our findings showed that RRIG1 binds to the active form number size (bp) of the RhoA protein (i.e., to RhoA-GTP; Fig. 5C). We then investigated whether RRIG1 suppresses RhoA activity. RRIG1 sense 1 GGACAAG:gtaagtt 460 tgcccag:GCCGAGC or antisense cDNA was transfected into the TE-8 and SKGT-4 2 TCACGTG:gtcccac 241 cccgcag:GTGAACC esophageal cancer cell lines, respectively, and RhoA protein activity 3 TGGGCAG:gtgcggg 303 ctgccag:CTCCCAG was measured using the rhotekin-Rho binding domain and an anti- 4 TGCCATG:gtgagta 106 tctccag:ATTTCCC RhoA antibody. The induction of RRIG1 expression suppressed the 5 TGATGAG:gtgggcc 314 tctgcag:CTCATCA active RhoA protein level in TE-8 cells, and antisense RRIG1 D reduced its level in SKGT-4 cells (Fig. 5 ), which correlated with NOTE: Intron-exon boundaries were determined by comparing the inhibited or increased stress fiber (f-actin) levels, respectively (data RRIG1 cDNA sequence with the human chromosome 9 DNA not shown). sequences. Uppercase letters represent exon sequences and lower RRIG1 suppresses tumor cell proliferation,invasion,and case letters represent intron sequences. Consensus splice donor and colony formation. To examine the consequences of the interac- acceptor sites are underlined. tion between RRIG1 and RhoA, we subjected TE-8 cells transfected www.aacrjournals.org 7115 Cancer Res 2006; 66: (14). July 15, 2006

significantly reduced BrdUrd incorporation by 41.6% in these esophageal cancer cells (P = 0.00001, m2 test).

Discussion In this study, we have cloned and characterized a novel RAR- h2-induced gene, RRIG1, which is differentially expressed in RAR- h2-positive and RAR-h2-negative esophageal cancer cells. RRIG1 is expressed in a broad range of normal tissues, but this expression is diminished in various cancer specimens. RRIG1 binds to a small GTPase RhoA, inhibits its activity, and, consequently, reduces the colony formation, invasiveness, and proliferation of esophageal cancer cells. Our results also provide evidence that RRIG1 is able to mediate the effects of RAR-h2 on tumor cell growth and gene expressions, supporting the notion that RRIG1 is a downstream h gene of RAR- 2. This study has described a novel molecular pathway involving RAR-h2 regulation of RRIG1 expression and RRIG1-RhoA interaction. We believe that further study of this pathway may translate into better control of human cancer.

Figure 4. RRIG1 modulation of RAR-h2 effects on gene expression. A, stable RAR-h2-transfected TE-8 sublines TE-8S20 and TE-8S22, stable antisense RAR-h2-transfected TE-3 sublines TE-3A3 and TE-3A5, and vector-control sublines TE-8V1 and TE-3V1 were grown in monolayer for 5 days in DMEM containing 10% FCS and 200 Ag/mL G418. Total cellular and nuclear proteins were then extracted and subjected to Western blot analysis for RAR-h2 and Erk1/2 or RRIG1 and COX-2 expression, respectively. B, stable RAR-h2- transfected TE-8 sublines TE-8S20 and TE-8S22 and the vector-control TE-8V1 subline were transientlytransfected with vector onlyor antisense RRIG1 expression vector pcDNA3.1-RRIG1AS/hygromycin. The stable antisense RAR-h2-transfected TE-3 sublines TE-3A3 and TE-3A5 and the vector-control subline TE-3V1 were transientlytransfected with vector onlyor the RRIG1 Figure 5. RRIG1 binding to RhoA and suppression of RhoA activation. expression vector pcDNA3.1-RRIG1/hygromycin. These cells were then grown A, GST-RRIG1 fusion protein pulldown and Western blot assays. After in DMEM containing 10% FCS and 200 Ag/mL G418 and hygromycin for 5 days; GST-RRIG1 pulldown with a TE-7 cell lysate, results of Western blotting with an after which, total cellular protein was extracted and subjected to Western blot anti-RhoA antibodyshowed RRIG1 binding to RhoA whereas GST alone did not. analysis. S, sense vector; AS, antisense vector. C, quantitation of the B, immunoprecipitation-Western blotting assay. Total cellular protein lysates Western blots shown in (B) using NIH ImageJ 1.34s software. Expression were immunoprecipitated with anti-RRIG1 antibodyand then subjected to levels of each gene were quantified and summarized as percentage of control Western blot analysis with anti-RhoA antibody. The negative (NC) and positive (h-actin). The data were then plotted as vector-onlyand RRIG1 transfection (PC) controls were from the GST and the GST-RRIG1 fusion protein pulldown and labeled for easycomparison. assays, respectively. C, RhoA activation assay. The active, dominant-negative, and wild-type forms of RhoA plasmids were first transiently transfected into Cos-1 cells, and the cell cultures were treated with G418 for 5 days. Thereafter, total cellular protein was extracted and 200 Ag of each protein were subjected DNA of proliferating cells. After immunostaining for BrdUrd, we to a GST-RRIG1 pulldown assayand Western blotting with an anti-RhoA counted f200 GFP-positive cells among these transfected cells. antibody. D, RhoA activation assay. TE-8 and SKGT-4 were transiently More than half (163 of 307; 53.1%) of the control cells but only transfected with vector only(control) or with an RRIG1 sense or antisense expression vector and treated with G418 for 5 days. The total cell lysates 31.0% (52 of 168) of the RRIG1-transfected cells stained positively were then subjected to RhoA protein activation and a pulldown assay for BrdUrd, indicating that the transient expression of RRIG1 (see Materials and Methods).

Cancer Res 2006; 66: (14). July 15, 2006 7116 www.aacrjournals.org

Figure 6. RRIG1 suppression of colonyformation and invasiveness of esophageal cancer cells. A, colony formation assay. The same transfected cells in Fig. 5D were also subjected to a colonyformation assay.The antibiotic G418-resistant colonies were counted and averaged; columns, mean percentage of the control (vector-only) cells; bars, SD. B, chemoinvasion assay. The same transfected cells were subjected to a chemoinvasion assay. The invading cells were counted and averaged; columns, mean percentage of the control (vector-only) cells; bars, SD.

RRIG1 cDNA contains 2,851 bp and encodes a protein with 276 (24, 26, 29, 40, 41). For example, RhoA, Rac1, and cdc42 must be amino acids; the gene is localized at chromosome 9q34. A search of present for cells to progress through the G1 phase of the cell cycle GenBank showed that RRIG1 cDNA sequences partially share with (29). The aberrant activation of RhoA proteins has similarly been SH3GLB2 cDNA, an SH3 domain GRB2-like endophilin B2 protein found to cause cell growth, transformation, invasion, and (ref. 32; i.e., exons 2-4 of the RRIG1 gene share with exons 7-9 of the metastasis in experimental models of carcinogenesis (26, 41–43), SH3GLB2 gene). Further analyses showed that the open reading and inhibition of RhoA suppressed cell proliferation, invasion, and frames and sizes of these two genes are quite different; e.g., the angiogenesis in vitro and in vivo (26–31, 44). Furthermore, many RRIG1 gene covers only 4.181 kb of the DNA sequences in growth factors (e.g., EGF, lysophosphatidic acid, and platelet- chromosome 9q34 with 5 exons and codes a protein that is derived growth factor) can activate the RhoA protein (26, 30). The localized in the cell membrane, whereas the SH3GLB2 gene covers RhoA expression level has been shown to correlate with tumor 20.226 kb of the DNA sequences with 10 exons and codes a protein progression (45) and the growth and invasiveness of breast cancer with 395 amino acids that is localized in the cytoplasm. In addition, cells (46). Our study has shown that the protein encoded by RRIG1 the transcription start site of SH3GLB2 is 16.284 kb ahead of binds to RhoA, suppresses RhoA activation, and inhibits Erk1/2 RRIG1 start site, indicating that RRIG1 and SH3GLB2 are two phosphorylation and COX-2 expression, which in turn suppresses different genes. tumor cell growth, colony formation, and invasion. Although it RRIG1 protein contains two putative SH3 domain-binding motifs is known that RRIG1 expression is lost in different cancer (i.e., PRAPHPP and LPVLSSPPTP). Accumulated data have shown tissues, further study is needed to determine how the RRIG1 that SH3 domains play an inhibitory role in cancer development protein fully interacts with RhoA and suppresses RhoA protein because their mutation or deletion activates the transforming activity to control cancer cell growth and invasion and cancer potential of c-Src and c-Abl proto-oncoproteins (33–35). Specifi- development. cally, the mutations of an SH3 domain converted a nontransform- All-trans RA, which induces RAR-h2 expression, increased RRIG1 h h ing c-Src into a highly oncogenic v-Src (36). Recent studies have mRNA levels, but not in RAR- 2-negative or stable RAR- 2- further shown that the SH3 domain of the Crk-associated substrate transfected cancer cells. The reason for this lack of effectiveness blocked v-Src-stimulated anchorage-independent cell growth, is that RA cannot induce RAR-h2 expression in TE-8, TE-8S20, and Matrigel invasion, and tumor growth in nude mice (37). However, TE-8S22 cells; the expression of RAR-h2 in TE-8S20 and TE-8S22 the SH3 domain in different genes may have different functions in cells is driven by plasmids with a cytomegalovirus promoter. cell signaling and cancer development (38, 39). Therefore, further Furthermore, although RRIG1 is a novel retinoid receptor–induced studies are needed to determine whether these putative SH3 gene, it is different from other RA-induced genes in that RA- h D domain binding motifs in the RRIG1 protein are functional and induced RRIG1 expression occurs through RAR- 2 (Fig. 2 ). In this whether they play a role in suppressing tumor cell growth and study, we used only a physiologic level of RA (in 10% FCS) in all our invasion in tumor cells. experiments to avoid the possibility of RA-induced activity. The h Our study has also shown that RRIG1 interacts with RhoA to physiologic level of RA was sufficient to retain RAR- 2 expression execute its biological function. Evidence has shown that Rho in RAR-h2-positive cells (e.g., TE-3 cells) and to have RAR-h2 proteins are members of the Ras gene superfamily of small activity remain in control of gene expression. We have shown that h GTPases; their biological function is controlled by the cycling RRIG1 mediated the effects of RAR- 2 in regulating tumor cell h between active GTP-bound and inactive GDP-bound states growth and gene expression. Specifically, stable RAR- 2 transfec- (24, 26, 30). Early evidence showed that Rho proteins can regulate tion suppressed growth and colony formation of esophageal cancer cell morphology and the formation of the actin cytoskeleton, and cells and inhibited the expression of EGFR, c-Jun, and COX-2 and later studies have clearly shown that Rho proteins can also affect the phosphorylation of Erk1/2 (11, 12). These effects correlated gene expression, cell proliferation and migration, and angiogenesis with induction of RRIG1 expression. However, the suppression of www.aacrjournals.org 7117 Cancer Res 2006; 66: (14). July 15, 2006

RRIG1 expression with RRIG1 antisense cDNA abolished the effects suppress tumor cell growth, invasion, and colony formation. h of RAR- 2 on the inhibition of gene expression and tumor cell Therefore, further studies are needed to verify whether RRIG1 growth. These findings indicate that RRIG1 is indeed a downstream can be a biomarker for early detection or progression of esophageal gene of RAR-h2. A previous study showed that RhoA induces COX-2 and breast cancers in the clinic. expression through ROCK and nuclear factor-nB activation (47). Our current study further confirmed effect of RhoA on COX-2 Acknowledgments h expression and revealed a possible mechanism by which RAR- 2 Received 3/3/2006; revised 5/3/2006; accepted 5/19/2006. and RRIG1 suppress COX-2 expression. Grant support: National Cancer Institute grant R29 CA-74835 and the Jerry and RRIG1 was expressed in normal esophageal and breast tissues, Maury Rubenstein Foundation (X-C. Xu). The costs of publication of this article were defrayed in part by the payment of page but this expression was lost in cancer tissues. This finding raises charges. This article must therefore be hereby marked advertisement in accordance the possibility that the decrease in RRIG1 expression is associated with 18 U.S.C. Section 1734 solely to indicate this fact. We thank Hong Wu for performing the in situ hybridization and immunohisto- with the malignant transformation of some epithelial tissues, at chemical analyses and the Department of Scientific Publication at M.D. Anderson least in the esophagus and mammary glands. RRIG1 expression can Cancer Center for editing the manuscript.

References 16. Xu XC, Zhang W, Song S, Lotan R, Lippman SM. Heim J. SH3GLB, a new endophilin-related protein Identification of RAR-h-regulated genes using cDNA family featuring an SH3 domain. Genomics 2001;71: 1. Xu XC, Lotan R. Aberrant expression and function of microarray. Cancer Epidemiol Biomarkers Prev 2002; 222–34. retinoid receptors in cancer. In: Nau H, Blaner WS, 11:A120. 33. Jackson P, Baltimore D. N-terminal mutations editors. Handbook of experimental pharmacology. New 17. Aoki T, Mori T, Du X, Nisihira T, Matsubara T, activate the leukemogenic potential of the myristoylated York: Springer; 1999. p.323–43. Nakamura Y. Allelotype study of esophageal carcinoma. form of c-abl. EMBOJ 1989;8:449–56. 2. Soprano DR, Qin P, Soprano KJ. Retinoic acid Genes Chromosomes Cancer 1994;10:177–82. 34. Seidel-Dugan C, Meyer BE, Thomas SM, Brugge JS. receptors and cancers. Annu Rev Nutr 2004;24:201–21. 18. Devlin J, Elder PA, Gabra H, Steel CM, Knowles MA. Effects of SH2 and SH3 deletions on the functional 3. Lotan R, Xu XC, Lippman SM, et al. Suppression of High frequency of chromosome 9 deletion in ovarian activities of wild-type and transforming variants of c- retinoic acid receptor-h in premalignant oral lesions cancer: evidence for three tumour-suppressor loci. Br J Src. Mol Cell Biol 1992;12:1835–45. and its up-regulation by isotretinoin. N Engl J Med 1995; Cancer 1996;73:420–3. 35. Hirai H, Varmus HE. Mutations in src homology 332:1405–10. 19. Simoneau M, LaRue H, Aboulkassim TO, Meyer F, regions 2 and 3 of activated chicken c-src that result in 4. Geradts J, Chen J-Y, Russell EK, Yankaskas JR, Nieves L, Moore L, Fradet Y. Chromosome 9 deletions and preferential transformation of mouse or chicken cells. Minna JD. Human lung cancer cell lines exhibit recurrence of superficial bladder cancer: identification Proc Natl Acad Sci U S A 1990;87:8592–6. resistance to retinoic acid treatment. Cell Growth Differ of four regions of prognostic interest. Oncogene 2000;19: 36. Miyazaki K, Senga T, Matsuda S, et al. Critical amino 1993;4:799–809. 6317–23. acid substitutions in the Src SH3 domain that convert c- 5. Xu XC, Liu X, Tahara E, Lippman SM, Lotan R. 20. Liang Z, Lippman SM, Kawabe A, Shimada Y, Xu XC. Src to be oncogenic. Biochem Biophys Res Commun Expression and up-regulation of retinoic acid receptor-h Identification of benzo(a)pyrene diol epoxide-binding 1999;263:759–64. is associated with retinoid sensitivity and colony DNA fragments using DNA immunoprecipitation tech- 37. Cheng CH, Yu KC, Chen HL, et al. Blockade of v-Src- formation in esophageal cancer cell lines. Cancer Res nique. Cancer Res 2003;63:1470–4. stimulated tumor formation by the Src homology 3 1999;59:2477–83. 21. Wan H, Oridate N, Lotan D, Hong WK, Lotan R. domain of Crk-associated substrate (Cas). FEBS Lett 6. Sirchia SM, Ren M, Pili R, et al. Endogenous Overexpression of retinoic acid receptor-h in head and 2004;557:221–7. h reactivation of the RAR- 2 tumor suppressor gene neck squamous cell carcinoma cells increases their 38. Groysman M, Nagano M, Shaanan B, Katzav S. epigenetically silenced in breast cancer. Cancer Res sensitivity to retinoid-induced suppression of squamous Mutagenic analysis of Vav reveals that an intact SH3 2002;62:2455–61. differentiation by retinoids. Cancer Res 1999;59:3518–26. domain is required for transformation. Oncogene 1998; 7. Houle B, Rochette-Egly C, Bradley WE. Tumor- 22. Qiu H, Zhang W, El-Naggar AK, et al. Loss of retinoic 17:1597–606. suppressive effect of the retinoic acid receptor h in acid receptor-h expression is an early event during eso- 39. Avizienyte E, Fincham VJ, Brunton VG, Frame MC. human epidermoid lung cancer cells. Proc Natl Acad Sci phageal carcinogenesis. Am J Pathol 1999;155:1519–23. Src SH3/2 domain-mediated peripheral accumulation of U S A 1993;90:985–9. 23. Xu XC, Shappell SB, Liang Z, et al. Reduced 15S- Src and phospho-myosin is linked to deregulation of E- 8. Berard J, Laboune F, Mukuna M, Masse S, Kothary R, lipoxygenase-2 expression in esophageal cancer speci- cadherin and the epithelial-mesenchymal transition. Bradley WEC. Lung tumors in mice expressing an mens and cells and up-regulation in vitro by the Mol Biol Cell 2004;15:2794–803. antisense RAR-h2 transgene. FASEB J 1996;10:1091–7. cyclooxygenase-2 inhibitor, NS398. Neoplasia 2003;5: 40. Benitah SA, Valeron PF, van Aelst L, Marshall CJ, 9. Treutin PM, Chen LI, Buetow BS, et al. Retinoic acid 121–7. Lacal JC. Rho GTPases in human cancer: an unresolved receptor-h2 inhibition of metastasis in mouse mammary 24. Ridley AJ, Hall A. The small GTP-binding protein rho link to upstream and downstream transcriptional gland xenografts. Breast Cancer Res Treat 2002;72:79–88. regulates the assembly of focal adhesions and actin regulation. Biochim Biophys Acta 2004;1705:121–32. 10. Faria TN, Mendelsohn C, Chambon P, Gudas LJ. The stress fibers in response to growth factors. Cell 1992;70: 41. Gomez del Pulgar T, Benitah SA, Valeron PF, Espina targeted disruption of both alleles of RARh2 in F9 cells 389–99. C, Lacal JC. Rho GTPase expression in tumourigenesis: results in the loss of retinoic acid-associated growth 25. Alexandropoulos K, Cheng G, Baltimore D. Proline- evidence for a significant link. Bioessays 2005;27:602–13. arrest. J Biol Chem 1999;274:26783–8. rich sequences that bind to Src homology 3 domains 42. Sahai E, Marshall CJ. Differing modes of tumour cell 11. Li M, Song S, Lippman SM, et al. Induction of retinoic with individual specificities. Proc Natl Acad Sci U S A invasion have distinct requirements for Rho/ROCK acid receptor-h suppresses cyclooxygenase-2 expression 1995;92:3110–4. signaling and extracellular proteolysis. Nat Cell Biol in esophageal cancer cells. Oncogene 2002;21:411–8. 26. Burridge K, Wennerberg K. Rho and Rac take center 2003;5:711–9. 12. Song S, Lippman SM, Zou Y, Ye X, Xu X-C. Induction stage. Cell 2004;116:167–79. 43. Qiu RG, Chen J, McCormick F, Symons M. A role for of cyclooxygenase-2 by benzo[a]pyrene diol epoxide 27. Etienne-Manneville S, Hall A. Rho GTPases in cell Rho in Ras transformation. Proc Natl Acad Sci U S A h through inhibition of retinoic acid receptor- 2 expres- biology. Nature 2002;420:629–35. 1995;92:11781–5. sion. Oncogene 2005;24:8268–76. 28. Hoang MV, Whelan MC, Senger DR. Rho activity 44. Yoshioka K, Nakamori S, Itoh K. Overexpression of 13. Song S, Xu XC. Effect of benzo[a]pyrene diol epoxide critically and selectively regulates endothelial cell small GTP-binding protein RhoA promotes invasion of on expression of retinoic acid receptor-h in immortal- organization during angiogenesis. Proc Natl Acad Sci tumor cells. Cancer Res 1999;59:2004–10. ized esophageal epithelial cells and esophageal cancer U S A 2004;101:1874–9. 45. Fritz G, Just I, Kaina B. Rho GTPases are over- cells. Biochem Biophys Res Commun 2001;281:872–7. 29. Olson MF, Ashworth A, Hall A. An essential role for expressed in human tumors. Int J Cancer 1999;81:682–7. 14. Toulouse A, Loubeau M, Morin J, Pappas JJ, Wu J, Rho, Rac, and Cdc42 GTPases in cell cycle progression 46. Pille JY, Denoyelle C, Varet J, et al. Anti-RhoA and Bradley WE. RARh involvement in enhancement of lung through G1. Science 1995;269:1270–2. anti-RhoC siRNAs inhibit the proliferation and invasive- tumor cell immunogenicity revealed by array analysis. 30. Sahai E, Marshall CJ. RHO-GTPases and cancer. Nat ness of MDA-MB-231 breast cancer cells in vitro and FASEB J 2000;14:1224–32. Rev Cancer 2002;2:133–42. in vivo. Mol Ther 2005;11:267–74. 15. Zhuang Y, Faria TN, Chambon P, Gudas LJ. Identi- 31. Vial E, Sahai E, Marshall CJ. ERK-MAPK signaling 47. Benitah SA, Valeron PF, Lacal JC. ROCK and nuclear fication and characterization of retinoic acid receptor coordinately regulates activity of Rac1 and RhoA for factor-nB-dependent activation of cyclooxygenase-2 by h 2 target genes in F9 teratocarcinoma cells. Mol Cancer tumor cell motility. Cancer Cell 2003;4:67–79. Rho GTPases: effects on tumor growth and therapeutic Res 2003;1:619–30. 32. Pierrat B, Simonen M, Cueto M, Mestan J, Ferrigno P, consequences. Mol Biol Cell 2003;14:3041–54.

Cancer Res 2006; 66: (14). July 15, 2006 7118 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 2006 American Association for Cancer Research. RRIG1 Mediates Effects of Retinoic Acid Receptor β2 on Tumor Cell Growth and Gene Expression through Binding to and Inhibition of RhoA

Zheng D. Liang, Scott M. Lippman, Tsung-Teh Wu, et al.

Cancer Res 2006;66:7111-7118.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/66/14/7111

Cited articles This article cites 46 articles, 17 of which you can access for free at: http://cancerres.aacrjournals.org/content/66/14/7111.full#ref-list-1

Citing articles This article has been cited by 3 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/66/14/7111.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/66/14/7111. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.